COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..630308 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(847..1068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS 1092..1388 product DUF5372 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078070384.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 1543..1995 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514470.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 1968..2297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 note possible pseudo, frameshifted CDS 2287..2772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(2809..3147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00060 assembly_gap 3124..3133 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3299..4246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(4303..8196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 8383..9099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 9158..9958 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206608.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 9977..10411 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118000.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 10436..10858 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200660.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 10902..11864 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994121.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(11906..12631) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545014.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(12757..13521) product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083089.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(13578..14798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 15193..15981 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089546.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 16050..16451 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210948.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene gloA CDS complement(16456..17088) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163029.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(17079..18887) product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919918.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene edd CDS 19001..19618 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814300.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(19702..20340) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524160.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 20489..21127 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188935.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene pdxH CDS complement(21223..21756) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189960.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene msrA CDS complement(21886..23175) product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183209478.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(23345..27100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 note possible pseudo, internal stop codon CDS 27169..27966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(28174..29739) product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266880.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 30022..30870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 tRNA complement(30979..31055) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(31228..33480) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521683.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(33477..34346) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832186.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 34398..35168 product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113501.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene bdhA CDS complement(35224..35937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 36115..36849 product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199523.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene ompR CDS 36836..38296 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196632.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(38342..39613) product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033044475.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 39682..43128 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193121.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene mfd CDS 43181..43900 product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193217.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene serB CDS 44142..45974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(45994..47727) product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(47801..48613) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965820.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(48656..48991) product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene nirD CDS complement(49024..51573) product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024901082.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene nirB CDS 52298..52744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(52767..53615) product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357921.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene asd CDS complement(53695..57744) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202033.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene hrpA CDS 57948..59297 product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192168.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene argA CDS 59323..59595 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 59848..60177 product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524142.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 60367..62226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 62610..64838 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190933.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene rpoD CDS 65029..65994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 66093..67166 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527679.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene hemH CDS complement(67258..68319) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523784.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(68536..70059) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529613.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(70059..70562) product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537806.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(70562..71521) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312075.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 71624..72295 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205450.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 72292..73746 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114178.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 73743..74180 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039824.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 74323..74931 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194243.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene grpE CDS 75022..76995 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039219.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene dnaK CDS 77098..78249 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821186.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene dnaJ CDS complement(78401..80284) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 80534..82222 product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113468.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(82241..83425) product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938358.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(83512..84921) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192724.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(85141..85593) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191711.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene rplI CDS complement(85609..85899) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193360.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene rpsR CDS complement(85957..86283) product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192181.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene priB CDS complement(86283..86645) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193673.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene rpsF CDS complement(86855..89251) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193522.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene ppsA CDS 89439..90272 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192738.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(90336..91118) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063752.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(91115..91720) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191384.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene rnhB CDS complement(91725..92846) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205135.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene lpxB CDS complement(92885..93676) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811774.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene lpxA CDS complement(93687..94124) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192266.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene fabZ CDS complement(94124..95149) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521195.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene lpxD CDS complement(95247..95756) product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930951.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(95756..98056) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535505.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene bamA CDS complement(98069..99430) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063746.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene rseP CDS complement(99427..100620) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705098.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene ispC CDS complement(100676..101500) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521189.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(101511..102254) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690027.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(102278..102838) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192143.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene frr CDS complement(102851..103561) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193606.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene pyrH CDS complement(103659..104555) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197087.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene tsf CDS complement(104634..105380) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193246.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene rpsB CDS 105609..107105 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193193.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(107263..109677) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550537.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene rnr tRNA 109761..109845 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(110093..110614) product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063925.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(110634..112037) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534924.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(112009..113166) product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930786.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(113292..114200) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930787.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene hflC CDS complement(114226..115533) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203976.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene hflK CDS complement(115530..116789) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191816.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene hflX CDS complement(116844..117050) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192796.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene hfq CDS complement(117179..118522) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063931.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene der CDS complement(118536..119651) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193323.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene bamB CDS complement(119648..120340) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193441.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(120368..121696) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191559.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene hisS CDS complement(121778..123055) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527159.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene ispG CDS complement(123067..123966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(123959..124741) product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227268.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene pilW CDS complement(124781..125932) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192451.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene rlmN CDS complement(125981..126406) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193561.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene ndk CDS complement(126563..129058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(129055..129747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 note possible pseudo, frameshifted CDS complement(130060..131019) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203970.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 note possible pseudo, internal stop codon CDS 131154..131900 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193722.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(132004..132243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(132408..134501) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930213.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(134544..135641) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550551.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene zapE CDS complement(135708..137135) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813626.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene lpdA CDS complement(137261..138529) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521670.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene odhB CDS complement(138649..141504) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191889.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(141795..142757) product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970881.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(142840..144636) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(144709..145005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 assembly_gap 145046..146235 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 146487..147284 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768855.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene murI CDS complement(147300..148592) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065115.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(148782..149120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 149605..150627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 tRNA complement(150801..150888) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(150956..151585) product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920995.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene queE CDS complement(151603..152673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(152832..153929) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113380.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(154002..155120) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069319778.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(155228..156034) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531071.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(156031..157341) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670439.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(157422..158852) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082901032.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(158933..160096) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480157.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 160324..161010 product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187874.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 161007..161921 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198511.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 161921..163021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 tRNA complement(163149..163222) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(163262..163337) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(163415..165844) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193454.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene lon CDS complement(165945..167207) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521258.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene clpX CDS complement(167368..167976) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812508.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene clpP CDS complement(168081..169388) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193941.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene tig tRNA complement(169415..169501) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 169626..170477 product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040123.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene hpnC CDS 170474..171322 product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene hpnD CDS 171322..172638 product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040124.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene hpnE CDS 172733..173542 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524720.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(173656..174657) product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557110.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene pbpG CDS complement(174820..176361) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(176375..178060) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113805.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene leuA CDS complement(178326..179165) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522420.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene pssA CDS complement(179622..180038) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459671.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(180383..181399) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185539.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene ilvC CDS complement(181552..182043) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene ilvN CDS complement(182215..183987) product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522422.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 184237..184800 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186304.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 184797..185261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 185272..186051 product DUF3106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526454.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 186048..186569 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065147.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(186570..187652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(187642..188526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 note possible pseudo, frameshifted CDS complement(188699..191035) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522490.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene parC CDS complement(191122..193104) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185934.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene parE CDS 193199..194395 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 194412..194549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 194555..195133 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192474.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 195206..196087 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191516.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene dapA CDS 196154..197287 product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809956.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene bamC CDS 197319..198095 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(198227..198445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(198688..199797) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535743.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 199854..200387 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 200407..201033 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206803.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(201109..204210) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531051.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(204207..205565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(205721..206182) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812576.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene dut CDS complement(206258..207487) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186216.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene coaBC CDS 207581..208360 product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113451.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(208753..211380) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204967.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene alaS CDS complement(211553..212956) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974965.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 213234..214538 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106268.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene gabT CDS 214553..215737 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186063.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 215734..216927 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205107.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 217208..218377 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552010.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 218469..219494 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525160.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 219668..220960 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196172.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 220980..221804 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552009.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 221953..223443 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063671.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 223522..224436 product lipid A hydroxylase LpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094463.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene lpxO CDS complement(224504..225445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 tRNA complement(225507..225580) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 225733..226443 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185899.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene trmB CDS complement(226537..227214) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925693.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(227248..228105) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(228183..228752) product DUF1439 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186118.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 228865..229530 product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 229546..229881 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 229970..231313 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(231342..232625) product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185503.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene waaA CDS complement(232648..234036) product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522260.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 234271..235182 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929974.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 235535..236239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 236331..237032 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444207.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(237134..237643) product DUF2231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975779.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 237921..238598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(238697..238903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 238827..239201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(239438..239866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 239967..240746 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811135.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 tmRNA complement(240804..241282) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(241888..242598) product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448326.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene ubiG CDS complement(242672..243325) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189892.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 243601..246267 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189243.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene gyrA CDS 246269..246829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 246834..247934 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813372.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene serC CDS 247927..249033 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190098.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene pheA CDS 249036..249920 product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930098.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 249971..252019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 note possible pseudo, frameshifted CDS 252190..253905 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189285.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene rpsA CDS 253927..254247 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 254394..254699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 254703..255848 product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188993.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene lapB CDS 255890..256630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337106.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 256702..257640 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 257784..258764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 258880..259821 product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 259827..260696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 260702..261742 product glycosyltransferase family 10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058148.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(261764..263548) product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186431.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene msbA CDS 263631..263948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(263955..264431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(264513..268037) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522462.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene dnaE CDS 268078..268818 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039013.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 268821..269768 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338826.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(269782..270501) product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073551.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(270560..271261) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811176.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 271338..272327 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811174.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 272332..273234 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186469.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene gluQRS CDS 273363..273758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(273878..274510) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546220.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 274557..275954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 276136..276306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 276348..276704 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525093.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(276809..278458) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807214.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(278801..279358) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189767.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene orn CDS 279422..280684 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189931.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 280687..281595 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550124.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene rsgA CDS complement(281654..282643) product CobD/CbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195964.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(282734..283420) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550123.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(283577..283930) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189360.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene rplS CDS complement(284099..284902) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063943.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene trmD CDS complement(284926..285510) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195969.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene rimM CDS complement(285536..285841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 286088..286624 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807699.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 286621..287097 product NINE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189308.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(287153..288163) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193771.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(288192..288839) product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193838.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(289063..289572) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814348.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(289569..291062) product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194112.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene pcnB note possible pseudo, frameshifted CDS complement(291137..291805) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194213.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(291841..292518) product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196484.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene hda CDS complement(292729..293607) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522631.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(293631..295202) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064095.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene murJ CDS 295382..295699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(295865..296260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 296538..297710 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039570.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 297719..298639 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064107.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene argF CDS 298698..299477 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088429.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 299467..300918 product bifunctional serine/threonine-protein kinase/universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088428.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 300956..301327 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705754.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 301550..302119 product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189913.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 302193..303992 product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065133.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 304273..304776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(304858..305457) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836185.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(305524..308355) product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928590.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(308534..310198) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814257.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene ettA CDS 310478..312031 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(312158..313015) product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038527.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(313018..313818) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814010.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene yaaA CDS complement(314047..314745) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810880.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene ypfH CDS 314965..315282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 315345..315767 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809248.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 315795..316253 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102894.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 316306..317313 product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203434.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 317390..317980 product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240487.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(317982..318413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(318422..319627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(319904..322354) product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 322575..323888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(323895..325307) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040493.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 325401..326699 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028898.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(326736..329627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 assembly_gap 329657..330975 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 331106..331348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 331778..332773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(333565..334119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(334743..335750) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338425.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 note possible pseudo, frameshifted CDS 336176..337498 product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766669.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(337536..338303) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103688.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(338395..340857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(341113..343038) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208115026.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(343055..344488) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198857.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene dbpA CDS 344647..345660 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084237.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 345662..345922 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037775.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(345943..348144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 348247..349254 product TIM44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189141.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 349272..349823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(349893..350105) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196837.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 350356..350985 product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073570.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene rluA CDS 351006..351602 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207122.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 351599..352369 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063645.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(352374..352934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 353096..354346 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094912.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(354363..355496) product YbdK family carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195787.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(355540..356790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(356827..357570) product 2OG-Fe dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640646.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(357627..358514) product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 358625..359176 product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197759.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 359243..359527 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036600.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 359524..360099 product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143855.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 360116..360595 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930594.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 360763..361014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 361272..363581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(363588..364628) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189377.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene murB CDS 364620..365162 product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 365368..366216 product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811915.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 366216..366863 product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene cheD CDS 366875..367969 product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200023.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(367986..369197) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186023.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene hemW CDS complement(369190..369825) product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186211.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene rdgB CDS complement(369822..370562) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186400.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene rph CDS complement(370587..371492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(371536..372504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 372533..373441 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185526.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 373481..374101 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185877.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene gmk CDS 374135..374338 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185855.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene rpoZ CDS 374442..376721 product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194871.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(376788..377261) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene greB CDS complement(377446..377700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 tRNA complement(377846..377922) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA complement(378239..378315) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(378348..379568) product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193604.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(379589..380554) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930984.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(380674..381474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 note possible pseudo, frameshifted CDS complement(381480..382415) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193185.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene hemC CDS 382535..385333 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191560.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene ppc CDS 385428..386825 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191886.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene argH CDS complement(386926..388080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(388209..388691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(388886..389749) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706862.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(389795..390175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812662.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(390195..391325) product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812663.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(391345..391599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(391596..392246) product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812668.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene fdh3B CDS complement(392280..395276) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812670.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(395421..395633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 396047..397435 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074304.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 397435..399411 product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074303.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(399435..399977) product DUF3455 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765561.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(400108..400647) product DUF3455 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765561.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 400880..401614 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088392.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 401725..402711 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526811.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 402717..403565 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085817.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 403562..404551 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526811.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(404590..404805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(404822..406087) product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(406149..407393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(407405..408148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(408172..408726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 408945..409925 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175019.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 410124..411446 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640497.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 411601..412011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 412129..412584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(412600..413232) product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812672.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(413241..415379) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930373.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(415300..415941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(415987..416478) product DUF3305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812677.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(416480..417571) product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567450.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene apbC CDS 417684..419783 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039014.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene metG CDS 419931..421640 product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene sulP CDS complement(421660..422874) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535741.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 422873..423898 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965078.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(423924..424832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(424906..425367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 425446..425649 product DUF3460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193782.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 425699..426700 product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192594.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 426885..427814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 427838..428926 product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339192.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(429028..430878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(430883..431623) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089752.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 431812..433725 product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704322.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(433735..434493) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529133.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 434556..435251 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186100.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 435383..435817 product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553866.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(435833..436732) product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene folE2 CDS complement(436800..438707) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266656.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene dxs CDS complement(438745..439632) product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190235.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(439629..439871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 440160..441278 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190814.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 441430..441921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 442020..442907 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229732.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 442976..443839 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190656.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 443917..444351 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193608.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(444451..445230) product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810564.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(445364..448114) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540200.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene polA CDS 448101..448499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 448503..449483 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530313.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 449488..450360 product BPSS1780 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190835.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(450264..450485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 450632..450841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(450880..453231) product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555925.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 453314..454117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 454114..455199 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388793.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 455363..456340 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356720.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene guaC CDS 456502..459333 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191922.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 459482..460348 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192544.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene galU CDS complement(460424..460651) product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(460677..461648) product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532363.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene cysM tRNA 461692..461776 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 461933..462496 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216918.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 462748..463800 product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530631.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(463811..464713) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943285.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 464859..465908 product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 465913..466893 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931671.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(466981..467700) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185649.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(467711..468484) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194783.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(468481..469608) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186310.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(469634..470557) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526290.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(470786..472117) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930945.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 472225..473559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(473612..474334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(474379..477486) product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765563.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(477483..478616) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405528.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(478676..479962) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928917.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 480171..480839 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533623.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(480962..482791) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625913.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 482923..483264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 483367..484287 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456728.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 484287..484988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 485187..487400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(487410..488297) product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(488361..488621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 488688..488966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 note possible pseudo, frameshifted CDS complement(489353..490636) product putative Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929970.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(490760..492685) product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038140.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(492740..493474) product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039223.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene kdpE CDS complement(493497..495179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 tRNA complement(494947..495030) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(495352..495831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(495978..496886) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082934.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(496886..498193) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526889.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(498214..498435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 498410..498991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(498993..500063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 500256..500882 product protocatechuate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922892.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(501188..501994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 501903..502196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 502555..502875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 503029..503988 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265660.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 503985..504743 product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640174.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 504747..505025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 505555..505761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(505794..506294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(506375..506896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 507069..507350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 507442..507648 product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339146.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 507652..508008 product DUF3140 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978015.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(508321..511338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(511348..512343) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268102.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 512552..513730 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529310.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(513750..514382) product glycoside hydrolase family 19 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113192.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 514708..515403 product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144308590.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 515599..517377 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536557.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(517547..519040) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067122.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(519126..520343) product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550272.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(520635..523088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(523227..524192) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943999.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 524272..525099 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943998.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(525119..526036) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966109.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(526048..527238) product L-lyxonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(527280..528329) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113700.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(528350..529348) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(529374..530327) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113699.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(530342..531304) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809384.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 531426..532355 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089050.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(532371..533159) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104460.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(533171..534022) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104459.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(534034..534960) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245922.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(534957..536009) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010220797.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(536057..537682) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104458.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(537718..538872) product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010210634.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 539044..539829 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243745.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 540026..541081 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537788.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(541418..542518) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036429297.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(542607..544046) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976014.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(544149..545060) product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620479.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene kdgD CDS complement(545279..545848) product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037571.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(546021..546242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 assembly_gap 546251..546365 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(547342..548304) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039572.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(548382..549359) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064103.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(549361..550377) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809986.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(550452..551633) product L-talarate/galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218254.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 551801..552817 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981551.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(552845..554119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(554252..555490) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970632.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(555789..556100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 556459..557460 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706078.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(557621..557887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 558001..558183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 558194..558619 product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525507.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 558683..559726 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105224.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(559973..560203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(560651..560863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(561196..563424) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814008.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 563600..564301 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199325.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 565122..565625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 565625..567019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(567104..568279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(568435..570300) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175139359.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 570495..570977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(571180..572577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(572801..574777) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086466.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(574906..575412) product acetone carboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001877024.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(575437..577761) product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285084.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(577782..579926) product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650637.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 580229..581359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 581461..581928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 582022..583101 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521284.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(583171..583452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(583532..584455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 584601..585017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 585114..586577 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186165.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene zwf CDS 586915..587124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(587186..587482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(587739..588710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 note possible pseudo, internal stop codon CDS complement(588707..588970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(588975..589205) product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810443.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 589326..590591 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141757.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(590739..591596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 591629..592666 product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140590772.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(592651..592842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 592798..593031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(593390..595501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(595519..595947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 note possible pseudo, frameshifted CDS complement(596574..613151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 assembly_gap 598971..599649 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 614442..615017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 616683..617057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 617086..617643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 617565..620363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 621993..625421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 assembly_gap 627375..628209 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 629539..630045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 sequence002 source 1..468906 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..948 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063841.1:sigma-54 dependent transcriptional regulator locus_tag LOCUS_05410 CDS 1137..2585 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105011.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 2582..3052 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702452.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(3124..3873) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187868.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(3961..4467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523304.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(4505..7351) product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529468.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 7440..7601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(7648..8133) product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113663.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 8296..8730 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811318.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 8684..9232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 9324..9914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 10195..10515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(10575..11066) product DUF1854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928936.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(11070..13241) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 13480..15654 product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447960.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene cphA CDS 15654..18209 product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928938.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene cphA CDS 18256..18873 product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185803.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(18948..19667) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810365.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(19660..20049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(20055..21092) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102904.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 21350..24469 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420345.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(24448..25560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(25699..26970) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808794.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 27146..27295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(27362..28402) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104462.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 28388..28606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(28495..28929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 29068..29955 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529258.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 30032..31792 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010202254.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(31736..32110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 32019..33137 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404437.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 33134..34588 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096703.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 34771..35157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(35302..37131) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064828.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene glmS CDS 37282..37776 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064827.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(37748..38929) product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116288.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene rlmI CDS complement(39035..40030) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064714.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene xerC CDS complement(40035..40718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(40715..41572) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199067.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene dapF CDS complement(41633..41890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(41904..42212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 42440..43198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(43223..44107) product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523078.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(44169..45026) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807187.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 45226..46404 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925730.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene metK CDS 46752..47375 product DUF2760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524145.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 47372..49285 product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539133.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 49282..52050 product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205537.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 assembly_gap 52262..52852 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 52877..54034 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766635.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 54144..55322 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527150.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 55438..56034 product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813586.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene phbB assembly_gap 56013..56022 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 56184..58055 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086511.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 58052..59494 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086512.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 59943..60917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(60984..62063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211410235.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(62175..63248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211410235.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 63330..65261 product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(65277..66500) product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218919764.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(66856..67386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(67379..68557) product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114778.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(68595..68978) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792460.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(68975..71035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(71172..71624) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187340.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene rpiB CDS complement(71646..73412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(73412..74290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(74307..75566) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969406.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(75568..76092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(76339..77322) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037087840.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(77411..78160) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098400.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 78292..79179 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206048.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 79346..79768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(79842..80141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(80366..81811) product DUF3999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765555.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(81808..84702) product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105345.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(84767..86017) product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189663.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene kynU CDS 86159..87892 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920652.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 87904..88368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 88565..88993 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252490.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 89074..89484 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534958.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 89514..89963 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926982.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 90090..90539 product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819714.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 90549..90980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(90996..92231) product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389058.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene hutI CDS complement(92237..93787) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192520.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene hutH CDS complement(93837..95528) product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174873167.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(95622..96155) product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813842.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(96312..96524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(96624..97640) product NADPH-dependent aldehyde reductase Ahr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309160.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene ahr CDS 98308..98580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(98724..99260) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(99267..101015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 101097..103316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(103347..104516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(104823..105992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(106302..107435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(107682..110315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 110474..110665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 110943..111617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(111703..111993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 112283..113869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(113936..114838) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331304.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 114964..116217 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523139.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 116207..117295 product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543120.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(117345..117740) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339147.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(117760..118098) product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101146.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(118122..119690) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090223.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(119761..120381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(120701..121585) product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071494957.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(121628..122524) product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200833.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene choW CDS complement(122521..123207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 note possible pseudo, frameshifted CDS complement(123919..125418) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331281.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(126448..127416) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524076.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(127768..129027) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186490.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(129151..130149) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399686.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(130193..131098) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973459.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(131172..132380) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112975.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(132544..133290) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101372.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(133732..134478) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101372.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 134561..135994 product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407936.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 136008..136862 product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037405.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene eutC CDS 136903..138165 product fatty-acid peroxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246284.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene cypC CDS 138204..138842 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975504.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(138862..140103) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064552.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(140075..140725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(140857..141834) product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390200.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(141846..142643) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390199.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(142649..143422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 143736..144368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 144399..145208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 145212..146234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(146247..147083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(147097..148119) product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104220.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 148216..149454 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814920.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 149476..150111 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815892.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 150230..150916 product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054996466.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(150926..154675) product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211162.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene putA CDS 154809..155402 product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194061.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 155421..156125 product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113852.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(156230..157351) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194585.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(157806..158678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(158884..159708) product quinoprotein dehydrogenase-associated SoxYZ-like carrier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966743.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(159738..160727) product quinoprotein relay system zinc metallohydrolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532067.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(160732..161274) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087475.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(161307..162275) product cytochrome D1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087474.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(162262..162942) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194213.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(162947..163336) product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532029.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(163467..164000) product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326305.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene fae CDS complement(164041..164853) product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532025.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(164850..165770) product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334456.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene fhcD CDS complement(165767..167458) product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922276.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(167505..168779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(169059..169799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 169798..170766 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123514.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 170756..171817 product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532038.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 171819..172421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 172597..173973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(174001..175239) product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532852.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 175296..176207 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192193.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 176416..176649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 176659..177327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(177383..177856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(178094..178906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(178903..179475) product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532039.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(179472..180893) product DUF6513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532040.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(180872..181510) product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532041.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(181488..183509) product sigma-54-dependent transcriptional regulator EatR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114083.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene eatR CDS complement(183953..185959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(186037..186375) product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266599.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene tnpB CDS complement(186372..186794) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105580.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(186850..187188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(187185..187790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(187787..188023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(188311..190266) product sigma-54-dependent transcriptional regulator EatR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114083.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene eatR CDS complement(190386..191123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(191127..192167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(192164..192367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(192364..192717) product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813037.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(192721..193512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 assembly_gap 193231..193240 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(193518..194459) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423235.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(194635..194871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 note possible pseudo, frameshifted CDS complement(194946..195083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 note possible pseudo, frameshifted CDS complement(195234..196574) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086508.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(197086..197598) product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532036.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene fae CDS complement(197656..198549) product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827560.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(198546..199487) product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532034.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(199598..200587) product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532033.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene mch CDS complement(200571..201692) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532032.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(201697..202599) product methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532031.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(202630..203664) product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532030.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 203879..205978 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530092.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 205999..206544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 206927..208336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 208378..209565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(209646..210038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(210035..210796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(210793..211866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(211871..212764) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966732.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(212764..213165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(213276..215099) product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719727.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(215258..216217) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085366.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 216344..217810 product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969556.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 217834..218253 product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532057.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 218280..219212 product CbbX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975098.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene cbbX CDS 219209..220006 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143673.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 220006..220686 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 220727..221767 product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626372.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 221888..222766 product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390157.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 223040..225061 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110216.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene tkt CDS 225221..226240 product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071213.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene fba CDS complement(226355..227011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220138722.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(227278..228423) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200893.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(228556..228933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(229212..229619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 229932..230180 product DUF1272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969964.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(230216..230665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 231052..232653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(232689..233900) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896675.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene purT CDS 234098..235606 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275161.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 235648..235986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 236136..236597 product BLUF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073432.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 236600..237319 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401743.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(237323..238234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(238231..239118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(239201..240220) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(240318..241706) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088210.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(241733..242581) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222556.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 242733..243539 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402690.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 243843..244523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(244553..246454) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203850.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 246336..246614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(246849..247697) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197098.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene map CDS complement(247694..247918) product ParD-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192010.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(247992..248861) product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925894.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(248861..249808) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070732.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 249914..250318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 250443..250916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 250928..251317 product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957955.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(251323..251961) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088037.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(251958..253556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 253662..256172 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372678.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(256343..257596) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968609.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(257726..258709) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170821.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 259195..259602 product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089748.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene rnk CDS complement(259651..260580) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815215.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 260813..263716 product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268309.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 263716..264060 product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268310.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 264137..265804 product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771172.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 265801..266289 product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771170.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 266286..266564 product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554071.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 266561..266923 product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771168.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(266880..269837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(270010..271923) product bifunctional sugar phosphate isomerase/epimerase/4-hydroxyphenylpyruvate dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738807.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(271944..272834) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112680.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(272902..273909) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395802.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(274010..275290) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395804.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(275328..275912) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974960.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(276223..276918) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226204.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 277243..278325 product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338265.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 278437..280293 product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566012.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 280320..280907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 280945..281673 product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089678.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene cybH CDS 281685..282353 product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338268.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 282358..282678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 282737..283222 product hydrogenase expression/formation protein HupG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089675.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 283236..284138 product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338271.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 284138..284356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 note possible pseudo, frameshifted CDS 284375..284887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 284884..285984 product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388922.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 285977..286321 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338274.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene hypA CDS 286371..287462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 287476..288750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 288741..288986 product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 288983..290140 product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089666.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene hypD CDS 290154..291218 product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene hypE CDS 291291..292772 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089663.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 292769..293785 product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338262.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 tRNA 293005..293103 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 293800..295254 product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338263.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 295258..296670 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089662.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 296667..297443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 297440..298639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 298681..299247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 299395..300525 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 300581..301780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 301777..305721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(305791..306237) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene aroQ CDS complement(306234..306503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 306427..307434 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531227.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 307498..307992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 308007..308534 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366672.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 308609..309397 product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567731.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(309484..309957) product DUF6152 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808351.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(309977..310429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927660.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(310470..311549) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151633682.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 311668..313380 product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 313377..316208 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene fdhF CDS 316705..317772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 318394..319068 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531973.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(319143..319505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 319793..321994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(323998..325023) product plasmid partitioning protein RepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538279.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene repB CDS complement(325020..326276) product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891622.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene repA CDS 327114..328583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(328599..329543) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(329617..330198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(330330..332837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(332825..333880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560783.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 334379..334957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(335005..335952) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767549.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 336127..338265 product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112522.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene dinG CDS 338311..339024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 339272..341341 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084250.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 341338..342468 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103632.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 342613..343245 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401479.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 343386..346601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 346715..347737 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209249.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene dnaJ CDS complement(347774..347992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(348133..348426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 348534..349145 product DUF938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143861.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(349226..349858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 349949..350515 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521881.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 350613..350951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 351035..352429 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070904.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 352410..353372 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925611.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 353369..354169 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(354403..354588) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402493.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(354706..354924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 355290..355691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 355814..356506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 356554..356982 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191582.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 357410..357808 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266252.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(357781..357972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 357899..358096 product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812201.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(358132..360066) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140636.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(360084..360542) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316403.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(360542..362737) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(362938..363396) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316403.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(363396..364001) product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103759.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(364137..366767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(367236..368336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(368601..370784) product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545619.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(370781..372136) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199991.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(372149..373081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(373181..373366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 373724..374449 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(374473..377565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(377629..378864) product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479768.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 379121..380158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 380177..383260 product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 383262..383600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 383597..384826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 384931..385200 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767847.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 385235..385780 product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337790.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 note possible pseudo, internal stop codon CDS 385846..386520 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 386522..387940 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103754.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(388053..389171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(389168..390301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 390545..391240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 391293..391487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 391507..394356 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812670.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 394482..395303 product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812668.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene fdh3B CDS 395483..395692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 395730..396791 product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930376.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 396791..397318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 397350..397790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(397803..399209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 399475..400068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 400244..400756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 400762..401286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 401376..402092 product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898511.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 402128..402640 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002001056.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 402690..403310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 403360..404079 product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231388.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(404098..404331) product DUF2630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897080.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 404374..404919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(404939..405781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(405778..406059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 406151..407383 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390206.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(407397..409745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(409748..410806) product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226381.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene rhaS CDS complement(411021..411317) product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974926.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(411413..411889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(411914..412678) product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969653.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(412755..413948) product L-talarate/galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218254.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(413966..414949) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039576.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(415059..416591) product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(416615..418138) product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973343.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 418380..419354 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530862.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(419370..420380) product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098398.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(420400..421227) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098399.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(421260..422120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(422203..424092) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084961.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(424213..425235) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497714.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(425435..426184) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098400.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 427007..427258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 427741..429336 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037320.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(429587..429919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(430176..430706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 430989..431168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 431149..433221 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173640842.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(433238..433591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(433588..435135) product IS21-like element ISBj11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084518.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene istA CDS 435559..436563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 tRNA complement(436502..436583) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 436596..437465 product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020867621.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 437470..438093 product fumarate hydratase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229040.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 438389..439360 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040703.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 439370..440332 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813988.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 440374..441147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(441151..441927) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086229.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(441943..443022) product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382304.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(443030..443980) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090457.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(444110..445315) product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039581.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene pcaF CDS 445587..446693 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523466.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 446862..448091 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229035.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 448091..448699 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229036.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 448778..449473 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173662.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 449470..450465 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970169.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 450733..452280 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029259.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 452273..453043 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206438.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 453033..454064 product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064892.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 454104..455090 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040322.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(455214..455735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(455780..456166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 456442..458196 product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200871.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(458318..459124) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064792.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(459121..459690) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229034.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(459778..460746) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206006.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 461053..461355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 461352..462020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 note possible pseudo, frameshifted CDS complement(462024..462455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(462630..463082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(463201..464772) product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698054.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(464835..465167) product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266599.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene tnpB CDS complement(465164..465541) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105580.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 465666..467330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(467393..468472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 468589..468885 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139205698.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 sequence003 source 1..421453 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(180..1823) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967567.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 2010..3326 product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974376.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 3354..3656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(3778..5487) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187329.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 6396..6659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(6924..7616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 8228..8458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 8724..9503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(9561..10634) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190971.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 10751..11671 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529199.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 11784..12563 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090581.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 repeat_region 12811..14364 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccgctcgcgcgggaaatac assembly_gap 14365..15243 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 15461..15470 estimated_length known gap_type within scaffold linkage_evidence paired-ends repeat_region 15472..15684 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccggttcatccccgctcgcgcgggaaatac assembly_gap 15685..18271 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(18443..18739) product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942042.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene cas2e CDS complement(18720..19649) product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144847.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene cas1e CDS complement(19681..20295) product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229112.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene cas6e CDS complement(20270..20965) product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229113.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene cas5e CDS complement(20968..22137) product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229114.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene cas7e CDS complement(22155..22697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(22694..24292) product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229116.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene casA CDS complement(24289..26973) product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229117.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 repeat_region 27329..27662 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccgctcacgcgggaaatac assembly_gap 27663..28435 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(28662..29054) product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113117.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 29182..30753 product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259149.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 30744..32030 product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(32032..34605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(34801..35925) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931215.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 36083..36298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(36406..36942) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369584.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 37213..38091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(38112..38897) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086446.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 39014..40033 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 40049..40495 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene aroQ CDS 40753..42954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 42969..43427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(43465..44673) product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186349.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(44756..47626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(47850..48890) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930616.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 49048..52686 product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930621.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 52831..53064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 53092..54534 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814704.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 54639..55502 product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225189.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 55685..56128 product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896757.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene cynS CDS complement(56122..57651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(57653..59068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 59233..59895 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920739.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 59960..61183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(61203..61937) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(62045..62410) product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265541.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(62458..63774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(63892..64137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187318.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(64268..64534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633780.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(64803..65429) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556052.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(65744..67768) product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257258.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 68005..68751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 69014..70372 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931030.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 70369..71898 product thymidine phosphorylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169161074.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(72235..72654) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613681.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene cueR CDS complement(72740..73969) product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275134.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene egtB CDS complement(74042..74752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 note possible pseudo, internal stop codon CDS complement(74753..74965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 note possible pseudo, internal stop codon CDS 75095..76252 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315813.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 76398..78305 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528329.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene ftsH CDS complement(78352..79554) product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389221.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(79559..81034) product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524980.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(81031..81849) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195584.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene fabI CDS complement(81967..82380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(82370..84259) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009950383.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 84706..86217 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082298.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 86231..86737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205734.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(86796..88055) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706551.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene glgC CDS complement(88234..89685) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene ccoG CDS complement(90118..91455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 91827..93530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(93493..94314) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526188.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 94523..96364 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920825.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(96452..97201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(97702..98139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(98477..99328) product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002690262.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(99710..99952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(100398..100883) product DUF456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943276.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(101060..104806) product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419176.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene putA CDS complement(104942..105421) product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206578.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(105583..106401) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114953.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 106740..107390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10580 assembly_gap 107422..107471 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 107505..108296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 108418..109563 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200893.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(109710..110408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(110423..110917) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731391.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(110959..111177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(111905..113233) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201828.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 113759..115270 product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399332.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene dhaS CDS 115679..116272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 116392..116874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(116997..118166) product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207582.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(118675..120993) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064553.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(120990..121463) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808116.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(121460..121936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(121953..123518) product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088947.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(124917..126461) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201704.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(126721..127686) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267512.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(127861..128868) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084062.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(129045..130043) product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525879.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(130173..130820) product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810527.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene maiA CDS complement(131011..131697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(131769..132698) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064750.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(132695..133909) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814920.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(133923..134282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(134279..135586) product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808480.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene fahA CDS complement(135598..136134) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085118.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(136218..137177) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185661.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(137246..138403) product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143817.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(138434..139147) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227935.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(139163..140941) product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090557.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(140938..141861) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810750.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(141920..143113) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064221.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(143176..143952) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086233.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(143955..145703) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089544.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 145871..146656 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815499.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 147090..148250 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927133.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 148466..149248 product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921213.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 149267..151261 product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 151270..151773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(151896..152870) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812927.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 153494..156184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(156278..157384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 157740..158408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 158982..159398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(159694..159852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(160116..160337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 assembly_gap 160139..160148 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 160588..161274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 161387..162676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 162968..163915 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815277.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 163927..165099 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523585.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 165385..166641 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039905.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 166656..167540 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083964.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(167556..168692) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207123.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(169060..170385) product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818932.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene fahA CDS complement(170423..171721) product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920389.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene hmgA CDS complement(171765..172736) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807281.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(172769..172975) product DUF2783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808487.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(173000..174664) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808489.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(174809..175300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 assembly_gap 175319..175328 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 175527..175991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(176848..177222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 177300..178262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(179247..180338) product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366138.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(180533..181627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(181624..182841) product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035215636.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene repA CDS 183328..184614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 185564..186559 product plasmid replication initiator TrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942817.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene trfA CDS 186649..187521 product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092000.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(187528..188004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(188001..188462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(188462..189019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(189016..189621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(189618..190175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(190175..191356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(191467..192432) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463394.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 192762..193715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 193832..195331 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366329.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 195420..196265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(196315..197643) product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818932.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene fahA CDS complement(197648..197872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(197890..199545) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808489.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(199652..200611) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185661.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 200723..201538 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089545.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(201543..202586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(203177..204136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(204199..204438) product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036496.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(204486..205007) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869958.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 205147..206022 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815017.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 206143..208395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 208515..209351 product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810516.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene kynA CDS 209681..210316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 210456..211487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 211480..211905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(211963..213108) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200893.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 213282..215633 product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086220.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 215630..216415 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 216412..216981 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815019.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 216978..217829 product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815000.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 217842..219032 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064927.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 219046..220653 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814996.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 220719..221111 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 221270..222412 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810994.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 222504..223130 product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810992.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 223130..225136 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810990.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 225322..225588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(225593..227191) product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140892.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(227206..227400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 227690..228817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 228881..230131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889394.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(230141..234487) product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204931.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(234583..236340) product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204930.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(236836..238017) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227558.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 238234..238599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 238589..238873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(239002..239331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 239586..240056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 240346..241104 product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299673.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene otsB CDS 241080..242480 product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205173.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene otsA CDS 242477..242659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(242785..242904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 note possible pseudo, internal stop codon CDS 243109..243618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 243868..244353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 244813..245298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 245355..245744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(245816..246514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(246618..247229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 247408..247899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 247969..248523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 248560..249111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 249126..249710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(249990..250250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 250346..250843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(251075..251311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 251902..252444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 252799..253245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 note possible pseudo, frameshifted CDS 253296..253922 product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220818393.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(253945..254385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 254666..254992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(254996..257773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(257795..259234) product conjugal transfer pilus assembly protein TraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309243.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene traH CDS complement(259254..260105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(260102..260470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(260467..261795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(261792..262544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(262531..263541) product conjugal transfer pilus assembly protein TraU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947798.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene traU CDS complement(263538..264239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(264257..264805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(264802..265170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(265167..267731) product TraC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331477.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(267741..268337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(268334..269134) product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186871.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(269121..270503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(270500..271243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(271356..271922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(271941..272240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(272273..272770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(272767..273492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(273489..273989) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942768.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(274148..274642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 275547..276116 product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 276360..276929 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552423.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 277130..277363 product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170066.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene vapB CDS 277380..277790 product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170069.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene vapC CDS complement(278146..278859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 note possible pseudo, internal stop codon CDS complement(278872..279744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(279867..280487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(280484..282391) product conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205050578.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene traD CDS complement(282393..284036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(284478..285155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(285179..285472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(285797..286861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(287131..288129) product primase-helicase zinc-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260358.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(288419..290020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(290083..290394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(290587..291147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 291623..292423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 292865..293146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 293496..294434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(294658..295257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 295641..295913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(295987..296475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(296600..296899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(297217..297672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 298170..300662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 300659..302176 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383503.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 302184..305075 product Z1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383504.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 305155..306060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 306063..307820 product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008002.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 308135..309148 product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258773.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(309579..310022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(310184..311374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(311686..314715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(314720..315121) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986456.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 315817..316617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(316836..318041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 319204..320256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 320253..320549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 320793..321011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 321681..323201 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225878.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 assembly_gap 323887..323971 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 324508..324783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 324780..326135 product type II toxin-antitoxin system toxin serine/threonine-protein kinase HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071024.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene hipA CDS complement(326272..328554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 328680..329111 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530551.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene arsC CDS 329326..330858 product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932512.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(330889..334440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 334756..335199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 335180..336190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 336236..337471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 337508..337975 product ChaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228348.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 337988..338134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(338150..339247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(339461..342562) product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(342625..343806) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929017.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(343854..345170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(345365..345832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(345982..346539) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179664825.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 346724..347200 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930750.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 347202..349484 product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965397.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 350063..350458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(350848..351468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(351477..352037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 352361..353719 product flagellar protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259035.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 353780..355114 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337016.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 355347..357029 product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090366.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 357143..357571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(357538..358329) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189279.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(358507..359265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706016.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(359378..360496) product acetoin dehydrogenase dihydrolipoyllysine-residue acetyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112997.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(360496..361512) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104786.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(361577..362560) product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112998.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(362574..363626) product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222291.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 363943..365964 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113000.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 366193..366897 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083999.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 366919..368742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(368810..370141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 370889..371989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 372317..373234 product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089666.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene ppk2 CDS complement(373350..374108) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817053.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(374268..375164) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113814.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(375222..377270) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089686.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 377257..377424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(377512..377985) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171812.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 378186..379418 product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064255.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 379408..380595 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532460.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(380616..381518) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099119.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 381609..381929 product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111167.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene sugE CDS 382242..382754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 382807..383286 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943074.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(383475..384674) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085983.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(384890..386671) product xylonate dehydratase XylD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640069.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene xylD CDS complement(386723..387727) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 387886..388845 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089050.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(388856..390658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(390990..391358) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938884.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(391381..391932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(391929..392675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(392663..395014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(395191..395523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(395696..396862) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102904.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 397068..397277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 397364..397594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(397648..399690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 399850..400923 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410204.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(400966..402513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 note possible pseudo, internal stop codon, frameshifted CDS 402730..403257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521816.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 403275..404786 product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207327.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 404890..405207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(405652..406359) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705315.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(406349..407317) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814852.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(407428..408198) product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205448.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene hpaI CDS complement(408222..409391) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870021.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(409406..410587) product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705317.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 tRNA 409849..409944 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(410581..411648) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086666.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene pdxA CDS 411876..412712 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392015.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 412709..413842 product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975063.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(414286..414672) product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230330.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(414986..416089) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104683.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(416094..417593) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930172.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene ppx CDS 417874..418917 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199345.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene pstS CDS 419106..420101 product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193912.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene pstC CDS 420098..420982 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521821.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene pstA sequence004 source 1..367349 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(349..1467) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112662.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(1764..2423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 assembly_gap 2454..2968 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3716..4066) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810617.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 4656..5939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 assembly_gap 5603..5612 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6012..7022) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931011.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(7084..8301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 8487..9311 product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201260.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 9455..10474 product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788737.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 10458..11228 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448285.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 11235..12179 product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815411.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 12264..13166 product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533957.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 13163..13957 product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192990.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 14202..15617 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192601.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene glnA CDS 15743..16297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 16294..17373 product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135202727.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene glnL CDS 17393..18889 product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192209.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene ntrC CDS 19431..20822 product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 20875..22947 product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene prsK CDS 22944..24296 product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene prsR CDS complement(24333..25340) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 25954..26529 product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 26607..28178 product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 28183..29433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 note possible pseudo, internal stop codon, frameshifted CDS 29464..31041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 31051..32106 product XrtA-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390863.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 32103..33233 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060909.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene wecB CDS 33248..34108 product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 34105..35142 product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 35147..36373 product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 36382..37944 product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene xrtA CDS 38128..39612 product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083207.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 39614..40657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 40647..41792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 42112..43311 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229156.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 43315..45258 product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 45375..46649 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 46713..47930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 note possible pseudo, frameshifted CDS 47978..49324 product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064823.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 49321..50574 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 50588..51934 product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942599.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 51947..53284 product putative O-glycosylation ligase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390842.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 53287..54300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 54384..56495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(56603..57193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(57748..58680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(58701..60194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(60191..61171) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(61168..62199) product hydrolase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390872.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(62196..63056) product hydrolase 2, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390871.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(63077..63466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 63667..65277 product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187764.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 65363..66595 product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 67119..69134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(69417..69656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(69806..70906) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390849.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(70903..71823) product HprK-related kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390848.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(71820..72125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(72143..72742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(72843..73403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 73402..73608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(73769..74827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 75073..76095 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150678942.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 76113..77246 product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063891.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 77243..79900 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063890.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 80160..80567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(80580..81068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 note possible pseudo, frameshifted CDS complement(81052..81519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 note possible pseudo, frameshifted CDS complement(81947..82726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(82881..84404) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808433.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 84516..85454 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930460.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 85551..86414 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185611.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene nadC CDS 86434..87408 product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267907.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 87405..88607 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040700.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 88604..89146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 89277..90191 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532449.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 90353..91429 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040464.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 91461..91985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 92033..92905 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494199.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 92973..93974 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814852.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 93982..94728 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868218.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 95041..96018 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064939.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 96008..97858 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399880.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 97855..99384 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086088023.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 99719..100213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 100389..100883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 note possible pseudo, frameshifted CDS complement(101041..101475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14240 note possible pseudo, internal stop codon CDS 101360..101638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 assembly_gap 101506..101515 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 101870..103060 product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536151.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 103105..104484 product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930692.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 104485..105024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 105032..105844 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071334.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 105823..106440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 106494..106736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 106753..108636 product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037005.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 108638..108889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(109266..110300) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(110380..111195) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867574.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(111211..112182) product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113741.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(112179..113141) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191748.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(113138..113902) product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113739.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(113997..115040) product transcriptional regulator PtxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113738.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene ptxS CDS complement(115102..115515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(115515..116534) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229262.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(116543..117319) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(117393..118556) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083642.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(118711..118989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 119117..120040 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419793.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 tRNA complement(120724..120799) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(120911..121618) product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044922.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(121693..122088) product YchJ family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810229.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(122188..122442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(122675..124480) product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814246.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 124638..125066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(125142..126656) product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853666.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 126769..127500 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185607.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 127497..128777 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930862.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene purD CDS 128782..129720 product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526433.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene hemF CDS 129717..130325 product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930864.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene nadD CDS 130326..131162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 131174..131644 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813199.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene rlmH CDS 131739..132347 product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185695.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 132382..133866 product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522445.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene rng CDS complement(133904..134974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(135158..135373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 135258..135641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(135654..137105) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(137133..138578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 138736..139092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(139141..139923) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926539.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene xth CDS 140024..141193 product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525010.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 141231..141851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(141913..142491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(142537..143037) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189313.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(143307..144284) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064486.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(144406..145062) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927036.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(145205..147016) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173455.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 147110..147637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 147634..149067 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064132.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 149105..150460 product EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205096.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 150571..152223 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813155.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 152410..153225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(153180..154388) product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942826.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(154385..156892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(156969..157622) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083822.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 157748..158251 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251763.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 158402..159163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 159285..159599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 159599..160339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 160580..161155 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251763.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(161270..162223) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194103.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene miaA CDS complement(162238..163482) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770075.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(163551..163841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 163729..165834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 165934..167655 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037563.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 167668..168027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 168315..168659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(168775..170631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 170760..171830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 171880..173304 product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123272.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene sbcB CDS complement(173324..173671) product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063836.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 173825..174643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 174871..175773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(175826..176704) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845312.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 176932..178263 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228635.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 178365..179792 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228635.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(179883..182474) product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064143.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene acnB CDS complement(182782..183381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 183380..183577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(183633..184655) product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188261.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(184773..185759) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065155.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 185933..186697 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196014.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 186849..187277 product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536542.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene sdhC CDS 187303..187665 product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187439.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene sdhD CDS 187684..189477 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009940953.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene sdhA CDS 189491..190195 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187935.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 190227..190505 product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528990.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 190525..191835 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813645.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 192030..193016 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089798.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 193177..194205 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101804634.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(194246..195079) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113152.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene phnE CDS complement(195093..195923) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103283.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(195920..196750) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113154.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(196985..197452) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021829.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(197638..198501) product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169047059.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 198596..199552 product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931515.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene egtD CDS 199610..200587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 200584..201642 product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339554.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene selD CDS 201752..202666 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927823.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 202677..204107 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187091.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene leuC CDS 204133..204780 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187882.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene leuD CDS 204809..205897 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187693.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene leuB CDS 205991..207121 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812646.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene asd CDS 207231..209828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 209821..210654 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203245.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene truA CDS 210673..211314 product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 211354..212592 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528977.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene trpB CDS 212589..213419 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187543.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene trpA CDS 213416..214288 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188147.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene accD CDS 214356..215651 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528975.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene folC CDS 215703..216782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 216782..217291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 217324..218850 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525195.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene purF CDS 218850..220079 product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530350.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 220084..221490 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197094.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene gltX tRNA 221562..221637 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 221690..221765 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 221812..221888 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 221970..222045 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 222097..222173 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 222205..222280 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 222627..223220 product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192676.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene phaR CDS 223224..224648 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521351.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene rimO CDS 224725..225909 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527146.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 225966..227015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(227073..227549) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197080.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene smpB CDS 227598..228050 product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811752.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 228037..228360 product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063760.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 228478..229950 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192833.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene guaB CDS 229961..231262 product TCR/Tet family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615760.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 231273..232856 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193192.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene guaA CDS 234302..235006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 235759..236277 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552523.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene tadA CDS 236598..238595 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400611.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 238798..239742 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930515.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 239798..242074 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039388.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 242071..243054 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810153.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 243059..244477 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926305.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(244642..244833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 244839..246779 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536928.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(246866..247624) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812901.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(247776..248432) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064094.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene adk CDS complement(248706..249476) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185994.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene kdsB CDS complement(249473..249700) product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064092.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(249690..250748) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555967.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene lpxK CDS complement(250735..251154) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064090.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(251190..251819) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812889.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 252095..253450 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522628.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene xseA CDS 253572..254156 product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185841.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene sodB CDS complement(254237..254704) product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820399.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 254774..257053 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706149.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 257060..257269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 257284..258723 product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene ccoN CDS 258745..259362 product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087318.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene ccoO CDS 259386..259577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 259577..260503 product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930775.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene ccoP CDS 260641..260931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 260983..261258 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930778.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(261345..262082) product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212452.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene fnr CDS 262259..263668 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064046.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene hemN CDS 263717..264433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 264617..265870 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189552.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene icd tRNA 266017..266092 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 266164..266239 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 266397..266472 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 266534..268516 product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191640.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 tRNA 268578..268653 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 268803..271193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 271190..274240 product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256729.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 274313..277831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 note possible pseudo, internal stop codon, frameshifted CDS complement(277845..278741) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221065779.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(278881..279801) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083635.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(279832..280674) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192869.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(280816..281385) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073616.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(281510..282202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 282545..283342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 283339..286038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(286059..287072) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087190.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 287177..288352 product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087191.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 288352..289959 product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040777.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 289982..290758 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063886.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 290760..292766 product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035499.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 292763..293665 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104166.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 293981..294670 product glycoside hydrolase family 19 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167387192.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 294667..295152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(295219..295698) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197880.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(295831..296361) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091630.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 296611..297618 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331258.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(297651..298799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(298796..299968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(299965..300675) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(300672..301541) product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521491.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(301522..302403) product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508789.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 302624..303124 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085556.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 303194..303730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 303893..304216 product DUF2282 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946406.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 304334..304840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 304853..306160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 306179..306964 product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027998753.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 307051..308112 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213256.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 308123..309088 product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613252.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 309085..309456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 309453..310814 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946411.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(310831..314622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 tRNA complement(314793..314877) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(314925..316154) product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242132.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(316267..317457) product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113387.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene hmpA CDS 317609..319195 product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113388.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene norR CDS 319206..319577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(319588..320268) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192421.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 320456..321208 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811017.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene surE CDS 321205..322008 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203980.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 322061..322996 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192107.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 323027..324055 product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193640.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene rpoS CDS 324156..325595 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039993.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene rlmD CDS complement(325670..326368) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521332.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 326591..326986 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821377.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 327263..328429 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198695.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene carA CDS 328431..331685 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193866.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene carB CDS 331792..332268 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192392.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene greA CDS 332265..332735 product DUF4149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192787.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(332751..333071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 332985..333248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 333245..333919 product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193119.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 334080..335990 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809623.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene ftsH CDS 336014..336892 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039236.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene folP CDS 336978..338309 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266863.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene glmM CDS 338570..339604 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199345.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene pstS CDS 339733..340758 product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193912.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene pstC CDS 340755..341636 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251992.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene pstA CDS 341647..342468 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193614.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene pstB CDS 342507..343214 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193271.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene phoU CDS 343242..343958 product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192125.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene phoB CDS 343965..345320 product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197666.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene phoR CDS complement(345290..346960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191882.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(347110..347370) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193070.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(347561..348826) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810577.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene rho CDS complement(349103..349507) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380053.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene trxA CDS 349767..351401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(351701..352837) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869698.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene purM CDS 352935..354989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 355008..355334 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809572.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 355354..355950 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930424.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene recR CDS 356091..356513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 note possible pseudo, internal stop codon, frameshifted CDS 356661..357431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(357552..359303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(359300..360073) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087949.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene gloB CDS 360114..360956 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192921.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 360949..361437 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084134.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene rnhA CDS complement(361496..362596) product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103472247.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 362843..363457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 363745..364392 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704823.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 364389..365504 product phenazine-1-carboxylate N-methyltransferase PhzM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093617.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene phzM CDS complement(365629..366114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(366114..366362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 sequence005 source 1..338699 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1068 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088615.1:galactarate dehydratase locus_tag LOCUS_16710 CDS complement(1079..5347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 5655..6008 product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030572.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(6019..6525) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195771.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 6654..10241 product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530989.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 10312..11319 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200388.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(11320..11784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(11939..13069) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812176.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(13093..14523) product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039542.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 14754..15791 product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070823.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 16215..16760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(16770..17336) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087248.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 17518..22749 product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812871.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 22781..25060 product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064081.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene pbpC CDS 25190..25855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(25877..26587) product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243013.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(26694..27593) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037155.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(27718..28713) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537788.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(28871..29833) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816017.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(30008..30367) product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521222.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene uraH CDS 30600..31346 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391590.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 31425..32372 product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521217.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene puuE CDS 32376..34127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 34270..35499 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 35661..36710 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338610.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 36707..37519 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162687942.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 37646..38404 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971358.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 38418..38927 product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173672.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 39078..39785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(39816..40466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(40466..40894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(40873..41457) product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039916.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(41482..43512) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926646.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(43509..43934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(43931..44095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(44172..44960) product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene ccmC CDS complement(44977..45705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(45639..46274) product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457758.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene ccmA CDS complement(46286..46888) product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448283.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(46910..47404) product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811425.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(47401..49992) product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033467030.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene napA CDS complement(50010..50291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(50288..50503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 50578..50865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 50897..51718 product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269030.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 51814..53700 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937746.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 53793..54350 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123673.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(54626..55318) product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112317.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene urtE CDS complement(55323..56201) product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269028.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene urtD CDS complement(56198..57322) product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532250.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene urtC CDS complement(57319..58869) product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535962.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene urtB CDS complement(59019..60305) product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269025.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene urtA CDS complement(60434..61441) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811351.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 61774..62097 product EthD family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405748.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 62372..62920 product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030649.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 62943..63620 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990622.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 63648..64082 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259124.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 64095..64571 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233166.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 64568..65098 product DUF2867 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208083.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(65112..66056) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972311.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(66037..69543) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969807.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 69718..70020 product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317023.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene ureA CDS 70064..70240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 70237..70545 product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720474.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 70546..72279 product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205201.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene ureC CDS 72326..72970 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812309.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 73038..73775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 73775..74458 product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533998.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 74472..75119 product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814817.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene ureG CDS 75254..75790 product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521293.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene lysM CDS complement(75884..76144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(76321..76800) product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815898.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene bfr CDS complement(76941..77570) product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706579.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene uvrY CDS complement(77605..79107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(79104..80000) product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387845.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene pip CDS 80360..81280 product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269163.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene pqqB CDS 81310..82059 product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111679.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene pqqC CDS 82056..82340 product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088542.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene pqqD CDS 82340..83509 product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269165.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene pqqE CDS 83771..84409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(84396..85730) product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779337.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene qseC CDS complement(85762..86439) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(86471..87472) product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191725.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(87469..87891) product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193415.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(87884..88546) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(88592..89605) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193798.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 90164..93352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 note possible pseudo, internal stop codon, frameshifted CDS 93553..93819 product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193592.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 93845..95224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(95265..97874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 98407..100245 product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527836.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene tssF CDS complement(100290..101354) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193430.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene nagZ CDS complement(101351..101761) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191194.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene acpS CDS complement(101758..102561) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760838.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(102524..103333) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192953.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene recO CDS complement(103330..104481) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191678.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene era CDS complement(104488..105210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(105380..106345) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193513.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene lepB CDS complement(106354..108162) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193305.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene lepA CDS complement(108666..110183) product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192020.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(110230..111210) product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042144922.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(111224..111856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(111898..112503) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813797.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene rpoE CDS complement(112508..112990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(113017..114261) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028603047.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene fabF CDS complement(114269..114508) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197638.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene acpP CDS complement(114605..115354) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197597.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene fabG CDS complement(115351..116289) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193828.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene fabD CDS complement(116328..117317) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524613.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(117314..118348) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192749.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene plsX CDS complement(118570..118752) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813827.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene rpmF CDS complement(119036..119608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 119667..120254 product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065087.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 120303..121610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 121607..122362 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(122387..123865) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194757.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(123801..124985) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186126.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 125272..127155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 127162..128337 product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529927.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 128369..129430 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266716.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene rfbB CDS 129444..130340 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266715.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene rfbD CDS 130375..131268 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004419145.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene rfbA CDS 131282..131833 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706041.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene rfbC CDS 131921..133351 product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 133360..134286 product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 134283..135431 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863514.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene gmd CDS 135466..136464 product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063962.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 136488..137261 product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261038.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene rfbF CDS 137264..138346 product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535171.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene rfbG CDS 138343..139665 product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939427.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene rfbH CDS 139679..140566 product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208595.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 140563..141588 product CDP-paratose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770936.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 141585..142526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 142538..143824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 143882..144565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 144597..145541 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088748.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 145538..146698 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088747.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 146798..147970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 147967..148803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 148800..149564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 149572..150702 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550082.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(150838..152136) product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292875.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(152452..154323) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185930.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(154320..154910) product O-antigen biosynthesis protein WlbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929610.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene wlbG CDS complement(154943..156106) product O-antigen biosynthesis aminotransferase WlbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853419.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene wlbF CDS complement(156120..156836) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812818.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(156850..157881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(157878..159011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(159008..159610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(159617..160864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(160933..161490) product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 161633..163192 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192783.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene lysS CDS 163360..163911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(163934..164122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(164213..164620) product IS200/IS605-like element ISSen6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458342.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene tnpA CDS 164643..165917 product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029732907.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(166108..166902) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198410.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(166992..168260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(168313..170052) product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527796.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(170129..170590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(170652..172286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(172523..173254) product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186871.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(173283..174395) product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521997.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 174519..175364 product MOSC N-terminal beta barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194630.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 175488..176582 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186874.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene ychF CDS 176980..177912 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522872.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene rpoH CDS complement(177993..178640) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197988.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(178625..179590) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522902.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene cyoE CDS complement(179587..180753) product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526026.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(180760..181458) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553808.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(181415..182152) product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197992.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 182195..182428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(182473..183357) product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197994.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(183396..183629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(183626..184222) product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185071.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(184245..184394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(184400..186016) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197996.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene ctaD CDS complement(186049..187161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(187224..187796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(187982..188896) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788683.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 188923..189660 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103309.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 189708..190178 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522909.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene trmL CDS complement(190238..191245) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536061.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(191247..191705) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198004.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene secB CDS complement(191824..192081) product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929908.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene grxC CDS complement(192285..192692) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198006.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 192717..193562 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198007.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene gpmA CDS complement(193640..194521) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965715.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(194586..195386) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186297.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(195413..196720) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186353.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(196740..197702) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(197702..198214) product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185915.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene pyrR CDS complement(198211..198624) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186163.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene ruvX CDS complement(198621..199193) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185441.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 199227..200762 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(200773..201741) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529946.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 201865..202518 product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113808.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(202551..205652) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328246.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(205649..206800) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328247.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(206824..208281) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267829.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 208280..208516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(208408..209415) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043922219.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(209434..216288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(216293..218563) product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene pilJ CDS complement(218560..219108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(219128..219493) product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084587.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene pilH CDS complement(219549..219977) product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene pilG CDS complement(220029..220181) product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186709.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 220361..221329 product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186397.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 221319..222632 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527562.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene hemL CDS 222702..224060 product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527766.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene mpl CDS 224137..224772 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814956.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 224995..225735 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene fabG CDS 225924..227969 product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014486102.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 227978..228865 product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931246.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 228895..229734 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184294754.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene aroE CDS 229801..230565 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522050.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene mtgA CDS 230680..231288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194356.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 231285..231797 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814954.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 232131..232610 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194067.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene accB CDS 232782..234131 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522043.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene accC CDS 234143..235051 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084360451.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene prmA CDS 235059..236117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 236135..237037 product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522039.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(237165..237692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(237981..239162) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194129.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(239356..242277) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194230.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(242643..243257) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194313.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene ampD CDS complement(243254..243502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(243596..244426) product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929606.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene ccsA CDS 244485..245861 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194338.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene ffh CDS complement(245983..247131) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522862.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene ftsY tRNA 247206..247282 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 247366..249216 product bifunctional anthranilate synthase component I family protein/class IV aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225844.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 249420..250724 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190165.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene miaB CDS complement(250782..251012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(251163..251450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 251569..252870 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209421240.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene hemA CDS 252929..254017 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807618.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene prfA CDS 254014..254871 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927443.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene prmC CDS 254997..255569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 255666..255986 product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186955.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 gene grxD CDS 255989..256549 product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807624.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(256581..257183) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219051.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(257180..258925) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814636.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 259060..259641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(259708..260826) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194262.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene proB CDS complement(260823..261902) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194312.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene obgE CDS complement(261977..262234) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807460.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene rpmA CDS complement(262262..262798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 262827..263768 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204136.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 tRNA 263851..263927 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 264184..265905 product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene pilB CDS 265984..267207 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079343.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 267207..268136 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266634.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 268136..268774 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927124.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene coaE CDS 268844..269083 product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195120.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 269249..269539 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186661.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene groES CDS 269584..271227 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185913.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene groL CDS complement(271333..272091) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521909.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene yihA CDS 272148..272786 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 272925..275087 product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527907.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 275084..276445 product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806943.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene ccsB CDS 276628..277620 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527906.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene msrP CDS 277631..278299 product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065084.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene msrQ CDS complement(278289..283958) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814283.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene uvrA CDS 284272..284712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 284842..285819 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818532.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 285942..287489 product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064005.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 287495..287731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(287710..288816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943375.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(288914..289732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(290030..290365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(290548..291846) product glucarate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267913.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(291875..292849) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814852.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(292974..293999) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037078874.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 294121..294423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(294444..295034) product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536930.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 295146..295361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 295495..296469 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089704.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 296619..296936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 297156..297797 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994186.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 297813..298727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(298736..301657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(301942..302421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(302406..303344) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193564.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(303350..304369) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524668.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 304618..305952 product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872005.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene glf CDS 305952..308132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 308555..310396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 310591..312288 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536557.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(312617..314038) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene ccoG CDS complement(314172..314672) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191066.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(314674..315882) product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536130.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(315879..316967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550161.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(316980..317339) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196984.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(317341..317610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 317779..318798 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812788.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 318845..320173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 320292..320684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 320921..322627 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528518.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 322831..323541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(323745..324068) product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533578.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(324261..325514) product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199381.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 325691..326023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(326072..326518) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811678.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(326590..327294) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036715.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(327343..328230) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528382.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(328281..329090) product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528383.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene narI CDS complement(329087..329788) product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092956.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene narJ CDS complement(329806..331338) product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205549.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene narH CDS complement(331369..335151) product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105302.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(335193..336578) product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524712.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(336688..337899) product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524713.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 337835..338179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 sequence006 source 1..317705 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 776..1003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(1198..2262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(2654..2881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 3133..3333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 3674..3961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(4341..4667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 5043..5399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 5471..6175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(6344..8329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 9275..10375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 10744..10872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(10985..13354) product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267622.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(13455..14870) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267550.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 14979..15974 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816017.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 15996..16490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(16748..17125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 17404..17628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 18041..19003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(19163..19534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 19760..20053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(20409..21035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 21814..22254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 22473..23060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 23289..25559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(26050..27321) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405216.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS 27666..30323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(30567..30875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 note possible pseudo, frameshifted CDS complement(30829..31476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20110 note possible pseudo, frameshifted assembly_gap 31010..31019 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 31546..32271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 32332..32604 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039113.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(32622..33050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS 32938..33294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 33294..33827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 33793..34707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(34818..35036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 35205..35765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(35966..38947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 39377..40606 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523315.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 40603..41223 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223962128.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 41220..42395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 42392..44254 product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537466.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 44321..45298 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188546.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 45309..46448 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188715.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 46454..47446 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529463.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(47530..48180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(48182..49129) product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189069.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene rfaE1 CDS complement(49126..49629) product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072769.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene gmhB CDS complement(49695..50183) product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189202.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene rfaE2 CDS complement(50336..51463) product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113726.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(51480..52481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(52609..53061) product PA2169 family four-helix-bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314059.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 53074..54426 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101181.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 54423..55202 product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112786.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(55262..55498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 55639..56436 product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113230.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(56486..57031) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036172.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(57015..58175) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(58256..59323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(59389..60636) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626611.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 60673..61818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(61849..62178) product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389255.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 62455..63381 product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039274.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 63385..64308 product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929674.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 64503..65162 product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401008.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 65214..65879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 note possible pseudo, internal stop codon CDS 66226..69771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 69836..70261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 70325..70957 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103689.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS complement(71001..74675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(74686..75240) product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226147.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 75323..75715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 76017..77477 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552247.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(77566..78594) product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942561.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(78728..81769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(81988..84024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 84162..85235 product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975382.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 85232..85423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 85705..85944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 86047..86484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(86507..86971) product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920736.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(86971..88293) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947032.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 88393..88896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 89019..90890 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185742.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene htpG CDS complement(90989..92014) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556653.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(92080..92733) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202737.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 93050..93478 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522094.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene rplM CDS 93488..93880 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549989.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene rpsI CDS 94110..94487 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814883.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene erpA CDS complement(94576..95724) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931222.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(95721..97085) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931221.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 97300..98553 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814877.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene tyrS CDS 98643..99539 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928785.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 99539..99976 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103447.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene dtd CDS complement(100034..101002) product tripartite tricarboxylate transporter substrate binding protein BugD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969733.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 101374..102195 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266561.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(102214..102501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(103170..104375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(104779..106134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(106289..107170) product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207225.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 107659..108093 product nitric oxide reductase subunit NorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113238.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene norC CDS 108098..109540 product nitric-oxide reductase subunit NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113237.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene norB CDS 109693..110499 product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086000.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 110521..111594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 111641..113503 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113236.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 113659..114351 product transcriptional regulator Dnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene dnr CDS complement(114393..116039) product cytochrome D1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068497115.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(116039..117265) product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124643914.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene nirJ CDS complement(117268..118350) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903298.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(118343..119329) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903402.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(119326..120534) product heme d1 biosynthesis protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113241.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene nirF CDS complement(120531..120860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(120871..121185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(121288..123024) product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene nirS CDS 123175..124005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(124109..126325) product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208315.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(126448..127278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189747.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(127304..127831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(127951..128415) product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197673.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene sixA CDS complement(128422..130566) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192053.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene ppk1 CDS 130815..131576 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064128.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(131633..132613) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148287.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(132740..134101) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197666.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene phoR CDS complement(134106..134492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21060 assembly_gap 134552..134576 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(135192..136457) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818460.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(136450..136743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(136768..137574) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807257.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(137673..139019) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448384.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(139105..140181) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807261.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(140201..141130) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807265.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(141201..142058) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807268.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(142058..144004) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807270.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 144132..144863 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807272.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 144928..146040 product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011416681.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene ydiK CDS complement(146071..147072) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197190.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS complement(147274..148494) product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196821.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene gspF CDS complement(148535..149953) product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533498.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene gspE CDS complement(149986..152241) product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196826.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene gspD CDS 152156..152398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(152385..153266) product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525775.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(153263..153778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(153775..155016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(155117..156085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(156154..156792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(156798..157163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(157160..157606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(157657..158091) product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085349.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene gspG CDS 158133..158813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(158881..160449) product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815155.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene ilvA CDS 160592..161215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(161251..161898) product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527787.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene coq7 CDS 162134..163282 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930034.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(163446..164729) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196768.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene lysA CDS complement(164726..164890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 164942..165295 product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099261.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene cyaY CDS complement(165395..167776) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110255951.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 167975..168574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 note possible pseudo, frameshifted CDS 168489..169109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 note possible pseudo, frameshifted CDS 169109..169786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 169793..170458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS 170455..171000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 170997..172553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 172660..173214 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535019.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 173224..174318 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196751.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene aroB CDS 174386..175525 product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196750.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 175537..176232 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196743.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS 176367..181127 product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350708.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS 181249..182715 product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886828.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 182891..183733 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS 183730..184521 product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199929.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene mlaE CDS 184560..185066 product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene mlaD CDS 185105..185893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 185965..186582 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040736.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 186588..186887 product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199923.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(186978..187868) product DNA-binding transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213148.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene hexR CDS complement(187929..189107) product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626511.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(189104..190579) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186165.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene zwf CDS 190748..191701 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533671.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene tal CDS 191698..193314 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932668.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene pgi CDS 193311..193922 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327623.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(194033..195151) product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809015.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(195199..196440) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814551.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 196485..198569 product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527789.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS 198566..199624 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528524.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS 199735..200685 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS 200682..201443 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 201559..201828 product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS 201921..203189 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527889.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene murA CDS 203198..203875 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199915.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene hisG CDS 203931..205250 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931641.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene hisD CDS 205250..206350 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene hisC CDS 206350..206952 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199911.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene hisB CDS 206954..207661 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199907.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene hisH CDS 207714..208469 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199906.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene hisA CDS 208472..209251 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene hisF CDS 209248..209943 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522861.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene rsmD CDS 209940..210437 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808574.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 gene coaD CDS 210488..210751 product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195247.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(210828..211475) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221185.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene pth CDS complement(211628..212248) product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200150.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(212356..213318) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195243.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 tRNA complement(213402..213478) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(213516..214427) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808500.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene ispE CDS complement(214589..215119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(215116..216912) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808496.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 217003..217836 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925978.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene mutM CDS 217949..219004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 219030..220109 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195232.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene mutY CDS complement(220123..220797) product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812191.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(220794..221693) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815183.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene rapZ CDS complement(221690..223384) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550021.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene recN CDS complement(223384..224259) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533590.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 224329..225348 product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194248.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene hrcA tRNA 225389..225465 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(225575..226381) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531062.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(226339..226812) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400759.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 226892..227776 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113743.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(227805..230579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(230721..231632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(231768..232286) product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039271.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 232465..232902 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523329.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 232970..233485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 233482..233844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(233891..234430) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996417.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(234611..235168) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037574.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 235303..236064 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093932.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(236070..236474) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189082.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 236473..238347 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS 238405..239307 product glutamate/aspartate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531996.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 239425..240171 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389841.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 240171..240839 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090325.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 240852..241586 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082761.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 241705..243159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(243895..244695) product type III secretion system export apparatus subunit SctT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763879.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene sctT CDS complement(244707..244976) product SctS family type III secretion system export apparatus subunit YscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212945.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene yscS CDS complement(244987..245640) product type III secretion system export apparatus subunit SctR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188009.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene sctR CDS complement(245682..246710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(246715..247389) product response regulator FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085544.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene fixJ CDS complement(247412..248485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(248482..249645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(249673..250323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(250421..251062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(251395..251856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS complement(251853..253190) product type III secretion system ATPase SctN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204622.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene sctN CDS complement(253187..253819) product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392294.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(253816..254361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(254358..255191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(255456..255872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(255883..256206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(256262..257425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(257826..259658) product type III secretion system outer membrane ring subunit SctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199794.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene sctC CDS complement(259655..261613) product FHIPEP family type III secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036424.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(261610..262410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS 262745..263938 product SctU family type III secretion system export apparatus subunit BscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930815.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene bscU CDS 263923..264249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS 264457..265182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 265271..266020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 266056..266502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 266499..266726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 266752..267399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(268014..268787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 269206..271743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(271778..273499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(273496..274728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 274833..275870 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene pyrC CDS 275897..276703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(276616..277605) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037436394.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(277697..278614) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645000.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene cysK CDS complement(279136..280008) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036276.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(280115..280882) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036275.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(281152..282063) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063174092.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(282105..282329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 282446..283438 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224978.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(283499..283777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 284167..284517 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194130.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene mraZ CDS 284517..285536 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194427.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene rsmH CDS 285533..285814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 285811..287589 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532007.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 287684..289201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 289284..290645 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194098.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene murF CDS 290645..291826 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194370.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene mraY CDS 291836..293602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS 293599..294837 product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194175.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene ftsW CDS 294834..295910 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194182.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene murG CDS 295907..297313 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814572.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene murC CDS 297334..298293 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814571.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 298313..299125 product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522020.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 299140..300369 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194020.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene ftsA CDS 300366..301628 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194380.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 gene ftsZ CDS 301811..302746 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522022.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene lpxC CDS 302760..302945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 303080..303772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 303886..304509 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974325.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 304506..305114 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327147.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 305119..306060 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974327.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(306079..306630) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene ruvC CDS complement(306804..308396) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194285.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene purH CDS complement(308456..308719) product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194052.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(308716..309747) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194278.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 gene dusB CDS 309918..310388 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815154.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(310664..311983) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528286.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 312120..313199 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525362.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS 313196..314689 product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050942.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(314711..315592) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082110.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS 315846..316706 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142885.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 316822..317013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22860 sequence007 source 1..308183 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 761..1639 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1667..2941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 3068..4873 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147968.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 4870..6252 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098666.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS 6485..7720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 7782..9551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS 9542..10516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 10513..11505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 11518..12519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 12575..14770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 14763..15770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 15838..17190 product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189214.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 17499..17759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 17756..18043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 18103..18297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS 18374..19603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 19710..20606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 20603..22396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(22400..23050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(23047..24588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(24585..25670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(25698..26618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(26896..27465) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186086.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 gene lspA CDS complement(27468..30320) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541624.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 gene ileS CDS complement(30588..31550) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535897.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 31658..32860 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814856.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(32963..33286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(33312..33815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 34373..34753 product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650044.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene mobC CDS 35492..35995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS 36007..36939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 37521..37823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(37922..38629) product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185598.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 38761..39471 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812658.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 39468..40250 product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930378.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 40241..41083 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567445.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 41182..43119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 43130..43459 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482886.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 43452..43775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 43748..44092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(44472..44690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 45492..45614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23270 note possible pseudo, frameshifted CDS 45642..46013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23280 note possible pseudo, frameshifted CDS complement(46030..46290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(46348..47460) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812659.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 47638..49752 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064497.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 49926..50693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 50690..51736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 51884..53623 product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399374.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 53664..54416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS 54602..55075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(55116..56126) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083775.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS complement(56117..56833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS complement(56833..57327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(57324..57929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088431.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(57937..58623) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088432.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(58633..59484) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969563.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(59463..60623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS complement(60632..61591) product YVTN family beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066872222.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS complement(61691..62470) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088930.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(62467..63132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(63368..65560) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530092.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 65831..66232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23480 assembly_gap 66106..66115 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 67109..68596 product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083901.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 gene boxB CDS 68854..69387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 69621..70601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(70651..71865) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895662.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(71930..75013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 75095..75316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 75352..76365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 76420..77757 product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033450547.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS complement(77770..80475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 80625..81572 product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707170.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 81685..82455 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112938.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(82489..84864) product DUF6351 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 85012..86778 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173645.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(87020..88114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(88321..88920) product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970111.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene wrbA CDS complement(89083..89967) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256111.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene rarD CDS 90052..90441 product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973792.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(90463..93273) product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112435.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(93398..95254) product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225751.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 95522..96004 product cytochrome c-550 PedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113462.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene pedF CDS 96102..97742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23690 assembly_gap 96790..96799 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 97924..98466 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941579.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS 98491..100338 product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869226.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS 100410..101693 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392245.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS 101732..101986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS 101992..102297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(102431..109840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(109868..111001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(111911..113542) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526156.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS complement(113665..114789) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(114827..115633) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811489.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(115630..116691) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082970.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(116696..117853) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033450234.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(117923..119230) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896236.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(119487..120227) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112543.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS 120518..120787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 120823..121785 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064791.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(122116..122838) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256276.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(122854..123705) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066342893.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(123787..124725) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533150.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 124894..125100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 125144..125905 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064586.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 125907..126839 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064585.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS 126857..127525 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211827.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 127602..129290 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449775.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 129401..130609 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112662.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 130606..130968 product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818672.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 131003..131347 product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813037.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 131344..132780 product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083975.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 132941..134122 product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905810.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 134405..135229 product GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050480010.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(135346..135582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 136262..136570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 136956..140492 product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523124.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 140580..141224 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189176.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 gene can CDS complement(141248..142210) product porin Omp38 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184655.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 gene omp38 CDS complement(142405..143358) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089798.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(143550..144833) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201417591.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS 145817..146668 product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088963.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS complement(146985..147950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS 148324..149280 product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267907.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS 149322..150413 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031099.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(150649..151239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 151465..152631 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976271.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 assembly_gap 153030..153144 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 153408..153845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 154012..156117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 156310..157323 product ribonuclease T2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443921.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS complement(157403..157810) product anaerobic/virulence modulator AnvM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092971.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene anvM CDS complement(157884..159536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS 159767..161062 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039084.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS 161059..162066 product pteridine-dependent deoxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275502.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 162063..162881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS 162888..163637 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099156.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 163634..164434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(164480..165223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(165316..165885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042595818.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 165869..166057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(166177..166614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(166832..167563) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039074.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 gene fabG CDS complement(167598..168053) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039075.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS complement(168050..168853) product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039070.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(168850..170034) product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039069.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(170031..170753) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038464.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(170798..171643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(171749..174124) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039076.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(174121..174714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(174704..175654) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039079.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(175651..175962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039080.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(175959..177326) product xanthomonadin biosynthesis 3-hydroxybenozate--AMP ligase XanA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506148.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene xanA2 CDS complement(177371..178000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(178011..178310) product xanthomonadin biosynthesis acyl carrier protein XanC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039083.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene xanC CDS 178563..179336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS complement(179355..180440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 180660..181430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(181451..181921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(181924..182892) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929877.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS 183142..184833 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808489.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 184845..185036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS 185070..185606 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085118.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS 185619..186935 product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818932.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene fahA CDS 187307..187726 product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097604.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 gene rnk CDS 188086..188508 product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706600.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene rnk CDS 188659..189657 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093974.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 189667..190626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS 190605..191573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810430.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(191654..192877) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141940.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(192874..193932) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200336.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene bioB CDS complement(193980..194711) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189380.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene bioD CDS complement(194708..195916) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189736.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene bioF CDS complement(195882..197282) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525973.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene bioA CDS complement(197451..197912) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247259.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(197912..199939) product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387813.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(199964..201496) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS complement(201541..202551) product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920341.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene meaB CDS complement(202622..204826) product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337301.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 gene scpA CDS 204867..205559 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926795.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(205617..206342) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207546.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS 206428..207321 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089835.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS 207425..208843 product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704752.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 gene tcuA CDS 208830..209996 product tricarballylate utilization 4Fe-4S protein TcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065186.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene tcuB CDS 210165..211145 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064800.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS 211142..211723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS 211720..212304 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197821.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(212319..213236) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246046.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS 213327..214307 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809384.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS 214376..215182 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087565.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS 215235..216314 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199671.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 216818..218098 product succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880832.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS 218123..220834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS 220861..221349 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378342.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(221375..221824) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194379.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 gene aroQ CDS complement(221889..222896) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395802.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(223023..223844) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089132.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 gene aroE CDS complement(223841..225085) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089133.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(225115..225591) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089134.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(225625..226011) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921517.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(226045..226980) product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089136.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS 227110..228057 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089137.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(228178..230643) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809150.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene lon CDS complement(230653..231030) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809153.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 231313..232059 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965671.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS 232154..233131 product sialic acid TRAP transporter substrate-binding protein SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965680.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS 233151..233771 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089572.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS 233784..235190 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089571.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS 235317..236066 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536803.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS 236095..236961 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921637.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 236981..238516 product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 238568..239623 product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066680.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(239683..240681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS 240803..241177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS complement(241199..241543) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523720.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 241663..242154 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821327.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS 242469..242723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(242817..243854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(243901..244902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(245024..246148) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772473.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS 246382..247314 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775836.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 247315..248184 product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010206379.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(248213..248695) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202739.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS 248866..249174 product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067278.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 249186..250097 product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919486.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene phhA CDS 250094..250801 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257174.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 251016..252554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 252671..253684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(253700..253933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 254610..254930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS 255075..256199 product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172581.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene ada CDS complement(256234..256668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 256915..257265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(257732..258331) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640067.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS complement(258331..259812) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037811.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS complement(259805..262969) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918692.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS complement(262989..264281) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(264484..265677) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225072.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 gene pncB CDS 265882..266724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(266749..267975) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517213.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(267972..268718) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481731.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 268734..269312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(269353..270372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(270369..271853) product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106515452.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(271850..273064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 273323..274276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS complement(274263..275900) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895536.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 276324..277715 product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206092.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene gdhA CDS complement(277819..278202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS 278470..279396 product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188957.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 279445..282138 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040039036.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(282285..282590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 282870..283751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(283785..284054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS 284475..285311 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244107.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 285358..285993 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388742.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 286008..286445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(286481..287185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(287256..288515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(288522..292244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(292266..292691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(292743..294227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS complement(294224..295711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(295718..297406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(297403..299157) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883999.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(299154..300146) product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883998.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(300172..300561) product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883997.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS complement(300554..300964) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036369.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS complement(300969..301859) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036368.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 302032..302703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS 302774..303433 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 303455..304780 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190128.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(304787..305572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 305758..307299 product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526224.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 307577..307924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25590 sequence008 source 1..271359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(402..1034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(1076..2920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25610 note possible pseudo, internal stop codon, frameshifted CDS complement(2947..3999) product dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase VioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198210.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 gene vioA CDS 4344..5075 product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639909.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS 5140..6705 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615386.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS 6719..7552 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117849.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS 7549..9420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS 9449..11602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS 11599..13539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS 13545..15035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 15084..15638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(16342..17370) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040477.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 17490..18140 product FMN-dependent NADH-azoreductase AzoR2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113473.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene azoR2 CDS complement(18807..19211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25730 note possible pseudo, frameshifted CDS complement(19112..19894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25740 note possible pseudo, frameshifted CDS 20063..20341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(20427..20951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS complement(21539..21685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(21810..22007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(22408..23832) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258085.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS complement(23874..24575) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203497.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(24679..25284) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083269944.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(25410..25934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(26419..26610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS complement(26888..27139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 27026..27907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 27954..28466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS complement(28610..29065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(29268..29870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(29877..30077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(30717..30863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(30900..31223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(31240..31863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25920 note possible pseudo, internal stop codon CDS complement(32231..33220) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189177.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 gene lipA CDS 33712..35157 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064876.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 gene lpdA CDS 35159..35695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 35679..35957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25960 note possible pseudo, frameshifted CDS 35957..36190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25970 note possible pseudo, frameshifted CDS 36271..36540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25980 note possible pseudo, frameshifted CDS 36684..37805 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188244.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS 37840..39585 product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088947.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS 39590..40357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS 40414..40761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS 40819..41877 product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140590772.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS 42357..42638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(42657..43310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 43494..44054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 44033..44533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS 44530..44832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 44849..45187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS 45191..46501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 note possible pseudo, internal stop codon CDS 46640..47671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26110 note possible pseudo, internal stop codon CDS 47671..48075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 48091..49092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS 49110..49820 product P-type DNA transfer protein VirB5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011264014.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 gene virB5 CDS 49836..50570 product virB8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974428.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS 50567..51418 product TrbG/VirB9 family P-type conjugative transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162050504.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 51415..52785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 52800..53840 product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011264003.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 gene virB11 CDS 53837..55993 product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037620.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 56012..56692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 56700..58121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS 58121..58759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS 58833..59120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 59165..59692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS 59689..60162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 60340..61161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 61161..62198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS 62313..62618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 62615..63178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS 63178..64209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(64262..64810) product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111523.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(64807..65082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(65318..65818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS 65811..66071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS complement(66117..66890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 67014..67277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(67521..68717) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390922.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS complement(68922..70361) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267663.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(71408..71599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 71526..71738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS 71735..72010 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192868.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(72707..73045) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101229.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS complement(73359..74054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973993.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS complement(74096..75070) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329741.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS complement(75142..76098) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(76119..77492) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063956.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(77489..78166) product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562698.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 78257..79183 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525667.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS complement(79282..79890) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042599338.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 81138..83555 product copper-translocating P-type ATPase CopA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene copA1 CDS complement(83930..84253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(84434..85789) product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 assembly_gap 86234..86243 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 86319..86957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 86972..91282 product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193490.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(91539..93287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS 93682..94755 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404394.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(94788..96089) product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275477.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(96067..97542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(97579..98658) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171472.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 gene coxB CDS complement(98655..99119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(99116..100012) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063174003.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS complement(99996..101867) product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525144.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS complement(101873..102298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS complement(102295..102729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS complement(102733..103347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS complement(103344..105215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS complement(105600..105935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS 105974..107356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS 107415..108344 product CDF family zinc transporter CzcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100957.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene czcD CDS complement(108461..108784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS complement(108869..109198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS complement(109530..110870) product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(111066..112304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(112325..112780) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971129.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS 112922..113809 product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333519.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS 113842..114396 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140452.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS 114408..115196 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256130.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS complement(115226..116185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 116410..117120 product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827390.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 117212..118981 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531857.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS 118978..119946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(119989..120438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS 120374..120739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS complement(120788..121321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS 121310..121762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS 121707..122060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26860 note possible pseudo, frameshifted CDS 122195..122995 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115216.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS 123095..124423 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105667.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS complement(124613..124993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(124993..125514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26900 note possible pseudo, internal stop codon, frameshifted CDS complement(126195..126644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(126693..127307) product DUF1326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528738.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 127424..128221 product DUF2182 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528739.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 128653..129549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS 129869..130315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 130888..131094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 131113..131493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS complement(131601..132926) product IS701 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209648948.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 132959..133108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(133470..133862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27000 note possible pseudo, internal stop codon CDS complement(133866..134681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27010 note possible pseudo, internal stop codon CDS 134810..135013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS 135148..136227 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035552.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 136341..137372 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971356.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS 137386..137892 product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839848.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS 137996..138490 product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088894.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS 138622..139893 product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186744778.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS complement(139927..140193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS 140336..141250 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027270.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(141343..141756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 141680..143839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(143856..145355) product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705934.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS complement(145434..147416) product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027999.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS 147415..148065 product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258004.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 148192..151005 product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258002.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS 151013..151963 product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930139.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 151963..152289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 152286..154298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS 154295..154936 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258003.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS 154933..156033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256522.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS 156020..156358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS 156355..157185 product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940893.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 157182..158144 product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258007.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene coxB CDS 158141..159793 product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258008.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene ctaD CDS 159790..160416 product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 160461..160769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(160794..160931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS complement(160931..161308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 161501..161761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS complement(161851..164763) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228347.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(164770..166560) product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063840.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 166824..168119 product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525271.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS 168122..168859 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397690.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS complement(168899..169420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS complement(169410..169820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(169882..171180) product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494242.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS complement(171226..171663) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531558.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS complement(171907..174528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS complement(174557..175372) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038629.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS complement(175490..176545) product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404839.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS complement(176625..176936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(177099..178307) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS complement(178426..180798) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932893.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(180811..181536) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090711.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS complement(181687..181992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 182286..183275 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088811.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 183490..186210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS complement(186311..186607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(186608..187009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27490 note possible pseudo, internal stop codon CDS complement(187037..187861) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927928.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS complement(187941..188546) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815815.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 gene petA CDS 188861..189262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS complement(189273..190337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS 190491..190784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS 190798..190980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 191171..192055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS complement(192076..192675) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206673.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS 192961..194331 product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038711081.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS complement(194332..195234) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705963.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS 195401..196162 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705962.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS 196250..197071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS 197073..197387 product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930342.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 197518..198144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(198199..199215) product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367601.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS complement(199386..201269) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231470.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 gene ggt CDS complement(201438..202712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS complement(202728..202967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS 203767..204948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS complement(205009..205446) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(205482..206696) product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064085.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 gene pcaF CDS 206940..207542 product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096750.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene paaY CDS 207560..208834 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092007.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS complement(209269..211608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS complement(211881..212504) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329392.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(212587..213903) product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064014.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene paaF CDS complement(213933..214367) product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813284.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene paaI CDS complement(214390..215187) product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969784.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene paaG CDS 215532..215807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS 215834..217195 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS 217411..219162 product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086513.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 gene phaC CDS complement(219164..220888) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205437.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS complement(221097..226274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS 226598..226792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS complement(226810..228795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS 229051..229449 product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808737.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(229482..230966) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063675.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS 231084..231710 product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812310.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(231743..233491) product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190081.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(233552..233968) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090571.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(233980..235230) product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104287.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS complement(235315..237114) product feruloyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921377.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS 237289..237951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(237962..239452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS 240270..241448 product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891622.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 gene repA CDS 241468..242475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS 245009..245698 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218867.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS complement(246426..248453) product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528611.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS 248560..249414 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727349.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 249473..252265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS 252382..253392 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528459.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 253416..254384 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205474.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS complement(254422..255219) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813954.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(255216..256202) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065071.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 256671..258299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(258440..259189) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113595.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 gene nudC CDS 259935..260849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS 260884..262560 product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029096096.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(262899..263474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS 263552..264574 product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 264961..266064 product IS110-like element IS1618 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211760.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS complement(266310..266903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28110 note possible pseudo, frameshifted CDS complement(266900..267373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28120 note possible pseudo, frameshifted CDS 267429..267941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS 268065..268256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 268262..268708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS complement(268731..270449) product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698054.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS complement(270510..270848) product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266599.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 gene tnpB CDS complement(270845..271180) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105580.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 sequence009 source 1..259614 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(368..1417) product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 assembly_gap 1800..2414 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3456..4370 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767508.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS 4491..6185 product phage integrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900397.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS complement(6386..7369) product oxidative stress response transcriptional regulator OsaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083596.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 gene osaR CDS 7493..8344 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167842.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 8347..8535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 8901..9947 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859695.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 10414..10644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS complement(10943..12616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS complement(12759..13448) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194030.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(13879..14571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(14568..14867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS 15191..15424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS 15810..16073 product SWIB/MDM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814592.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS complement(16306..16716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS 17128..17421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS 17439..20210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 20919..21773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS 21923..22939 product DotH/IcmK family type IV secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106987.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS 22948..24276 product conjugal transfer protein TraO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106988.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 gene traO CDS 24308..25156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS 25170..25703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS 25732..26175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS 26207..26962 product conjugal transfer protein TraT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107033.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 26976..30044 product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463645.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS 30041..31258 product conjugal transfer protein TraW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769758.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 gene traW CDS 31255..31872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 31869..34034 product DotA/TraY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107036.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 34100..34633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 34730..35785 product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140590772.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(36059..37957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204879.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS complement(37957..38445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204878.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS complement(38442..39491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204877.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS 40607..41041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS 41063..41440 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176929198.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 41437..42681 product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019197495.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(42930..43172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS complement(45532..46206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS complement(46224..46640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS 46987..53205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS 53292..53780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 53845..54714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(54758..56197) product IS5-like element IS1478 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035783.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(56942..57328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS 57539..58276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS 58291..59412 product IncI1-type conjugal transfer protein TrbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121263.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 gene trbA CDS 59415..60323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS 60414..62636 product type IVB secretion system protein IcmO/DotL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946195.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 gene icmO CDS 62712..63953 product DUF1173 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054186288.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS 64221..65654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS complement(65825..66217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS 66561..67196 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088434.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS complement(67410..67811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS 67830..69299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS complement(69386..69655) product IcmT/TraK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004668192.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 gene icmT CDS complement(69652..70812) product plasmid transfer ATPase TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107026.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 gene traJ CDS complement(70809..71735) product IncI1-type conjugal transfer lipoprotein TraI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646098.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 gene traI CDS complement(71747..72223) product DotD/TraH family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106980.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS complement(72283..73971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(73968..74135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 74227..74427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS complement(75288..75545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS complement(75645..75941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS 76201..77010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 77021..77704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS 77697..78344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(78510..79568) product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS 79665..79838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS complement(81002..81760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS complement(81819..83294) product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928981.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS complement(83291..84199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS 84547..84828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS 84980..85426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(85493..86554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS 86880..87914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(88338..88646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS complement(88782..89447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS complement(90901..91332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS complement(91383..92261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(92271..93176) product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065050.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS 93281..94378 product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703864.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS complement(94404..96149) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808638.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(96146..97144) product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771929.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 gene garR CDS complement(97153..98109) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811660.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS complement(98134..98559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS complement(98559..100304) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808140.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS 100335..101237 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090000.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(101502..101666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS complement(101726..102052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(102333..102542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(102637..102807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS 103413..104849 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941769.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(104939..105220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS 105147..106283 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772473.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS 106286..107113 product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065001.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS 107136..108101 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807825.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS 108170..108580 product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525590.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene pcaC CDS 108615..109586 product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771929.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 gene garR CDS 109663..110616 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808005.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 110724..111638 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808636.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS 112023..112289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 112300..113136 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086453.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 113740..114033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS 114045..115640 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114382.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS 115804..116730 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227993.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS 116772..117155 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808835.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS 117260..118204 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329741.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS 118293..119255 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810803.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS 119315..119773 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523768.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS 119785..122052 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085521.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS 122115..123794 product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088947.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS 123770..124156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS complement(124285..125076) product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174733.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene soxA CDS complement(125073..125399) product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085518.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 gene soxZ CDS complement(125399..125854) product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086296.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 gene soxY CDS complement(125999..126448) product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171929.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 gene soxX CDS complement(126481..127650) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(127800..128162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(128430..129419) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082559.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS complement(130093..131400) product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538642.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(131458..132480) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088295.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS complement(132618..133589) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112374.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 133919..134911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS 134943..135689 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403965.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS 135898..136476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(136501..136701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS complement(136711..136926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS complement(137079..137675) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642965.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS complement(137895..138065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS 138278..139171 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088296.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS complement(139242..140651) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927472.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(140672..143899) product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391803.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(143930..145171) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086651.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS 145549..146526 product AraC family transcriptional regulator CmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 gene cmrA CDS complement(146541..148070) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084124.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS complement(148219..149202) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817250.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(149224..150231) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368609.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(150285..151277) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209763.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS complement(151890..152951) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817249.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS complement(153002..154432) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538286.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS 154580..154912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 155138..155302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 155318..155944 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391019.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS 156010..157431 product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545384.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS 157551..158504 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039024.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS 158600..160039 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941769.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS 160078..161187 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772473.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS 161266..162384 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090661.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS 162391..163143 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807589.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS 163229..164185 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811660.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(164234..165211) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063668.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(165208..166146) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815063.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS 166484..167440 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS 168508..169506 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814318.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS 169517..170869 product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926974.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS 170909..171847 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195802.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(171877..172857) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS 172950..174338 product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926974.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS 174350..176017 product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064632335.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(176174..176515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS 177524..178621 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859695.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS 180078..180974 product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477273.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 gene mmsB CDS 180977..181960 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082559.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS 181977..182945 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812334.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS 183072..183362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29830 note possible pseudo, frameshifted CDS 183487..184443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(185028..186683) product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275127.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS 186915..187898 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859695.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS complement(188011..189048) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523784.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS 189402..190328 product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297159.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 gene garR CDS 190501..190860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS 190984..191367 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808835.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS complement(192592..192876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29910 note possible pseudo, internal stop codon, frameshifted CDS 192905..194167 product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309930.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS 194399..194695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(195178..196239) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966592.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS complement(196318..196524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS complement(196936..197901) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808766.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS complement(198750..199622) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(199624..200802) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259419.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS complement(200877..202043) product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064581.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS complement(201970..202842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(202845..203627) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939802.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS complement(203649..204911) product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807983.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS complement(204914..205903) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090457.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS complement(206035..206673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(206872..207864) product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525879.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS 207957..208286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS complement(208392..208628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS complement(209406..211025) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095408.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS complement(211144..212193) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974028.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS complement(212200..213159) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811660.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS complement(213253..214668) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(214684..215847) product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064581.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS complement(215868..217460) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS complement(217474..218766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS 219084..219752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS 219859..220650 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925927.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS 220717..221547 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086453.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(221604..221795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 222005..222226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30190 note possible pseudo, frameshifted CDS complement(222943..224373) product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545384.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(224455..225834) product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065007.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS 226254..227276 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814852.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS complement(227375..228319) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083524.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS complement(228328..229410) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529931.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS 230079..230363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30250 note possible pseudo, frameshifted CDS 230601..231668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS complement(232157..232564) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582689.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS complement(233076..235385) product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS complement(235382..235867) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS 236478..236711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30300 note possible pseudo, internal stop codon, frameshifted CDS 237295..237777 product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770938.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(237824..239131) product replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194484.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS 240231..241457 product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331445.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 gene repA CDS 241454..242500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS complement(242487..242669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS complement(245271..245477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(246427..247548) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529189.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(247885..248463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS 248425..248760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS complement(248779..249252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30400 note possible pseudo, frameshifted CDS complement(249660..249950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS 250151..251887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS 251884..252207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS 253500..254906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS 255687..256304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS complement(256516..256908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30460 note possible pseudo, internal stop codon, frameshifted CDS 257159..257836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS 258255..259289 product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140590772.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 sequence010 source 1..233093 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(396..1364) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931314.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS 1468..3066 product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089156.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 gene mdlC CDS 3103..4554 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089157.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS 4885..5865 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931174.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(5917..6576) product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115060.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS 6649..7974 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210164.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS complement(8049..8858) product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083344.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 gene xdhC CDS complement(8855..11260) product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522221.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 gene xdhB CDS complement(11275..12759) product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186232.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 gene xdhA CDS 12832..13839 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521226.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS 13836..15128 product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189962.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 gene guaD CDS 15646..17049 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530099.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS complement(17054..18400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS complement(18438..18866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS complement(18926..20035) product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102241.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(20032..23436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS 23635..25167 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184304236.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS 25187..26284 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389657.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS 26284..27204 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389656.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS 27264..28430 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407996.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS 28807..29556 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525145.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS 29636..30673 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522340.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 30904..31632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS 31889..32632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS 32646..33110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS complement(33139..34122) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807825.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS complement(34163..35143) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807822.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS complement(35140..36348) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267114.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(36488..38968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS complement(39144..39905) product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965276.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS complement(40068..40424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS 40572..41669 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS 41728..42822 product spore photoproduct lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971741.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS complement(42824..43666) product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038749.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 43696..46377 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204961.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS 46427..47392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(47414..49213) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205414.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(49422..51032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS 51279..51788 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086994.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS 52071..53294 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088694.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS 53311..54171 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088693.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS 54171..55181 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088692.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS 55270..56025 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088691.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS 56018..56725 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088690.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(56744..57535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS complement(57606..59585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30940 assembly_gap 60246..61480 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 61987..64755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30950 note possible pseudo, frameshifted CDS 64913..66286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS 66286..68418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS complement(68534..69823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS complement(70067..70708) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020639392.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(70734..71618) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144396477.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS 71734..72666 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930268.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS 72807..73310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS complement(73312..74217) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268178.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS 74332..75213 product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532208.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS complement(75266..75844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975568.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS 76041..76796 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969908.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS 76864..77271 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065141.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS complement(77279..77698) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926524.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS 77900..79153 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037764.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS 79290..81551 product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083865574.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene katG CDS complement(81654..82172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS 82727..84070 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112297.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS 84126..85205 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206162.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS 85202..86176 product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267907.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS 86418..86573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS complement(86595..88217) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537232.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS 88370..88930 product IS607-like element IS1602 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414146.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS 88923..90557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS complement(91088..92713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31190 note possible pseudo, internal stop codon, frameshifted CDS complement(92866..93405) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191562.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS complement(93497..95236) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543739.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS complement(95299..97071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS complement(97120..99372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(99408..99770) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083943.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS 100018..101133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS 101130..101765 product response regulator transcription factor RqpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197176.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 gene rqpR CDS complement(101848..102975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS complement(103174..103935) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930333.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 gene fliR CDS complement(103943..104212) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199882.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 gene fliQ CDS complement(104246..105028) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420040.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 gene fliP CDS complement(105039..105371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS complement(105756..106205) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184995.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 gene fliN CDS complement(106195..107202) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196784.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 gene fliM CDS complement(107210..107779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS complement(108253..110634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(110631..111101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(111239..112663) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197164.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 gene fliI CDS complement(112660..113313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS complement(113471..114469) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197167.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 gene fliG CDS complement(114476..116209) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523066.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene fliF CDS 116441..116764 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947487.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 gene fliE CDS 117025..117741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31420 assembly_gap 117679..117688 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 117710..118186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS 118187..118630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 118632..119486 product gallate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS 119527..120237 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036036.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS complement(120254..121108) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808840.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS complement(121110..122252) product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268305.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 gene ssuD CDS complement(122366..123577) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188478.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS complement(123962..125029) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175341.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 125178..126209 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525362.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS complement(126181..127137) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925705.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 gene dapA CDS complement(127366..128883) product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337441.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS 129148..130989 product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827630.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS complement(131116..131769) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385044.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS complement(131750..132919) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266342.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS complement(132928..133737) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188447.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS complement(133776..135134) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115003.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS complement(135168..136451) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234334.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS complement(136525..137766) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729543.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS 138067..138651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS 138810..140639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS 140636..141625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS 141612..142247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS complement(142281..143177) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113814.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS 143314..143766 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091697.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS complement(143902..145377) product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205726.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS complement(145535..146068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(146224..146841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS 147259..147750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS 147747..148688 product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257219.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS 148700..149683 product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(149695..151125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS complement(151122..151613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(151642..152301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS 152594..153346 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338008.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 153455..154318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(154342..155271) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS 155536..156912 product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS 156987..157652 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189774.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS 157685..159469 product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526128.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS 159478..159921 product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526860.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS 159990..162380 product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189629.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS 162401..163603 product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189727.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS complement(163643..163807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041937190.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(163890..164828) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927823.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS 164913..165653 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103289.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(165621..166385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS 166318..166536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS 166533..167822 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889588.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(167878..168342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS 168469..169026 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267085.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS 169266..169547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS 169756..171183 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012695322.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS complement(171263..171799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS complement(171942..172466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS complement(172463..174706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS complement(174708..177578) product type VI secretion system Vgr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196687.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS 177853..179919 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928427.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS complement(180039..180371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS complement(180453..180650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS 181221..182870 product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526156.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS 183207..187826 product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933286.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS 188076..189167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS 189216..189410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS 189407..189808 product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971327.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS complement(189861..190271) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088450.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS complement(190442..191119) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967556.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS complement(191179..191874) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265932.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS complement(191876..192151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS complement(192241..193773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS complement(193804..194235) product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067200.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(194405..196537) product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268668.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS complement(196684..197667) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808015.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(197694..198065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247553.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS complement(198062..199408) product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063958.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS 199513..200427 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818676.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS complement(200429..201538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS complement(201707..202384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS complement(202428..204230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS complement(204268..205215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS 205420..206109 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398720.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS complement(206343..206807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS complement(206961..207326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS complement(207962..208753) product DUF4261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449850.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS 209358..209735 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529579.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS complement(209844..210143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS complement(210209..212152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS complement(212167..212739) product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396060.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS complement(212840..213292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS 213729..215798 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967665.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS 215985..219236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS 219500..220552 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064926.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(220595..221731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS 222106..222936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS 222896..224380 product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550915.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS 224377..227619 product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543942.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS complement(227664..229160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 229579..229986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(230098..231642) product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389974.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS complement(231623..232669) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096000.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 sequence011 source 1..228779 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 246..351 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 CDS complement(487..1587) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381253.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 gene galK CDS complement(1670..3454) product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229244.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS 3530..4591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS 4674..5201 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369637.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS 5557..6246 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193573.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(6261..7040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS 7211..7720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS complement(7737..8141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS 8344..8613 product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523722.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS complement(8619..9917) product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797770.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS complement(9926..11641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS complement(11972..14680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(14772..15527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS complement(15756..16868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS complement(16948..17286) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942075.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS complement(17355..17660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS complement(17647..18048) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS complement(18076..19503) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140636.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 note possible pseudo, internal stop codon CDS 19502..19693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS 20074..21657 product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084568.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 gene nifB CDS 21695..21889 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084569.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS 21902..22285 product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533503.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS 22288..22857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS 22870..23658 product 4Fe4S-binding leucine-rich repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338306.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS 23651..23986 product nitrogen fixation protein NifZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028153326.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS 23999..24361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS 24417..24722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS complement(24796..25212) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218564.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS complement(25258..26175) product ADP-ribosyl-[dinitrogen reductase] hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388763.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 gene draG CDS complement(26165..27022) product NAD(+)--dinitrogen-reductase ADP-D-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626076.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS complement(27030..27650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497969.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS 28090..28971 product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084578.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 gene nifH CDS 29095..30555 product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084552.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 gene nifD CDS 30683..32242 product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084553.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 gene nifK CDS 32332..32679 product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563670.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS complement(32745..33713) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521393.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 gene corA CDS 33947..35356 product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084554.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 gene nifE CDS 35382..36785 product nitrogenase iron-molybdenum cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084555.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 gene nifN CDS 36817..37227 product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084556.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 gene nifX CDS 37224..37700 product NifX-associated nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389938.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS 37693..37896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS 38021..38326 product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720698.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 gene fdxB CDS 38329..38730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS complement(38896..39897) product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869721.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS 40338..41552 product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812462.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS 41601..42020 product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225139.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 gene iscU CDS 42071..42484 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016875.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 gene erpA CDS 42575..42898 product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004702422.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 gene iscA CDS 42911..44812 product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244129.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 gene hscA CDS 44822..45208 product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092818.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 gene fdx CDS 45264..45740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(45745..46050) product N(2)-fixation sustaining protein CowN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391263.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 gene cowN CDS complement(46086..46826) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460474.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS 47045..48187 product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389924.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 gene nifV CDS 48211..48561 product nitrogenase-stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389923.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS 48677..49525 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389922.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS 49551..50648 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389921.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 assembly_gap 50755..50934 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 50935..52251 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389920.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS 52248..52559 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389919.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS 52566..53021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS 53350..55134 product nif-specific transcriptional activator NifA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388748.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 gene nifA CDS complement(55227..57680) product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113643.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 gene katE CDS 57565..57897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS complement(57975..59321) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730480.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(59372..60313) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532100.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(60339..61139) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267485.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS 61476..63446 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227746.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS complement(63735..64496) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973625.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS complement(64576..65499) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088611.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS 65639..66643 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931174.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS 66673..67659 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814852.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS 67670..68623 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064103.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS complement(68633..69190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS complement(69269..70249) product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525053.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS 70362..74480 product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241751.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS 74526..74729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS 74740..76320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS 76323..77012 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS complement(77080..77547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS complement(77749..78027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS complement(78108..79079) product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198488.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS complement(79221..80693) product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188420.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS 80862..81818 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640150.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 gene gcvA CDS 81897..83066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS 83413..85320 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 gene glgB CDS 85280..87649 product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257045.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS 87657..90983 product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389295.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 gene treS assembly_gap 91562..93006 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 93022..96624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS 96615..98906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS 98974..99366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS 99367..99627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 99704..99979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS complement(100010..101455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS 101890..104037 product regulatory protein NosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004345196.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS 104059..105039 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083152.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS 105166..105600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS complement(106057..106686) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088037.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(106683..108146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS complement(108191..108508) product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088238.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS complement(108505..108990) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088234.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS complement(108994..109794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS 109939..112071 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258959.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 gene glgX CDS 112138..113949 product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388264.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 gene treZ CDS 113942..119020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS 119184..119588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS 119679..121892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS complement(121908..123320) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085906.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS complement(123317..123982) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707717.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS complement(123979..124335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS 124540..124863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS 124878..125336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS 125519..126745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS complement(127010..128002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS 128307..130370 product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529393.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS 130367..130627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS complement(130644..131456) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906792.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS complement(131464..131805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS 132032..133153 product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527120.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS 133192..133710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS complement(133735..134898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS complement(134998..136110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS complement(136268..138226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS 138526..139410 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039919.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS complement(139423..141090) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706481.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS 141257..142060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS 142173..142343 product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS 142459..143526 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086540.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS 143837..146521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS 146851..148659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS complement(148694..149746) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083827.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS complement(149751..150410) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088064.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS 150513..151013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS complement(150902..151339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS complement(151379..154483) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS complement(154497..155696) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142490.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS complement(155983..156564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS complement(156561..157847) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201245837.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS complement(157981..158457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS complement(158554..158745) product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039992.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS 158904..159383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS 159516..160028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS 160132..160407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS 160412..162613 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921601.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS complement(162627..162992) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406684.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS complement(162989..164128) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837658.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS complement(164125..166197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS complement(166487..168145) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526456.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS complement(168260..168940) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186405.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS complement(169438..170430) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806967.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS 170576..171064 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966628.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS 171242..172447 product 3-hydroxybenzoate 6-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706103.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS 172483..173520 product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289858.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 gene gtdA CDS 173594..174298 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812732.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS 174312..174953 product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930265.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 gene maiA CDS complement(175000..175893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS complement(175877..176479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS 176768..177616 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227006.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS 177814..178902 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204927.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS 179090..180052 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807825.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS 180058..180786 product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082425.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS complement(180766..181878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS complement(182139..182678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS 182977..183960 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931174.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS complement(184021..184932) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705260.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS 185120..186418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS 186536..187390 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222556.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS 187413..188255 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085046.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS complement(188399..189301) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808483.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS 189440..190765 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809837.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS 190790..191260 product aromatic-ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064204.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS complement(191270..192040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS complement(192069..193061) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038796.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS complement(193205..193681) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188566.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS 194017..195375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS complement(195409..197619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS 197744..199102 product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388441.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS complement(199183..199650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS complement(199845..200315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS complement(200613..202133) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094267720.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 gene malQ CDS complement(202243..204723) product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993423.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 gene glgP CDS complement(204771..206222) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817363.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 gene glgA CDS complement(206222..207481) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706551.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 gene glgC CDS complement(207673..209733) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035667.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 gene glgX CDS complement(209730..211913) product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283726.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 gene glgB CDS complement(212046..213293) product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS complement(213379..214932) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526156.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS complement(215251..215733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS 215927..217204 product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275477.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS 217334..219088 product phage integrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900397.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS complement(220443..221444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS complement(221511..222764) product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253454.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 gene repA CDS 223331..224719 product replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194484.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS 224923..226170 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227739.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS 226167..227240 product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227740.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS 227371..228468 product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976142.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 sequence012 source 1..226104 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 536..1330 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089545.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS 1527..2219 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191689.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS 2216..3658 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064046.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 gene hemN CDS 3945..5948 product phage integrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900397.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS complement(7386..8414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS complement(8428..9609) product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035215636.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 gene repA CDS 10415..11809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS complement(11820..13133) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173812.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS complement(13173..13346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS 13538..14503 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525156.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS 14808..15836 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039103.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS 15881..16564 product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086623.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS 16582..17571 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809384.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS 17660..18637 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810803.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS 18657..19577 product DUF1932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494215.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS 19578..20516 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086620.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS 20617..21060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS 21062..21916 product gallate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS 21918..22880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS 22886..23887 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028002248.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS 23889..24860 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064939.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS 25028..25630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS complement(25652..27034) product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266356.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS 27217..28002 product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461722.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS complement(28070..29197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS complement(29505..29891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS 29890..31047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS complement(31238..32155) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978674.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS 32279..32764 product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142147.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS 33182..34183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS complement(34222..34671) product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969413.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS complement(34770..35288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS 35307..36572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS 36577..37233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS complement(37151..38167) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966596.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS 38290..38637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS 38664..39503 product gallate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 CDS complement(39626..40345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS complement(40494..41945) product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040124.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 gene hpnE CDS 42150..42914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS 42848..43132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS complement(43129..43977) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531519.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS 44086..44919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329945.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS 44959..45990 product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705074.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS 46098..46577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS 46592..46810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS 46807..47274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS complement(47321..47818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS complement(48123..48899) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966024.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS complement(48896..49603) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088320.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS complement(49629..50537) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088324.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS complement(50540..51574) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088323.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS complement(51607..52890) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175401.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS complement(52962..53957) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088321.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS 54222..54440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS 54532..54945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS 55912..56109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34930 note possible pseudo, frameshifted CDS complement(56123..57283) product App1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887835.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS complement(57418..57849) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535286.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS complement(57890..58351) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194168.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS 58534..59541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS 59601..60140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS 60362..60799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS complement(60741..63194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS 63364..64056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS 64097..65104 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943314.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS 65146..65568 product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729173.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS 65765..68977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS complement(69006..69647) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104896.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS complement(69641..70741) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088017.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS 70971..71363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS complement(71380..72063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS 72267..74045 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193473.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS complement(74055..75149) product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098212.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 gene modC CDS complement(75146..75826) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 gene modB CDS complement(75823..76635) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 gene modA CDS 76851..77807 product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193901.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS 77960..79780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS 79783..82848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS complement(82870..84498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS 85020..86768 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205414.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 note possible pseudo, frameshifted CDS complement(86923..87510) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522993.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS complement(87507..87725) product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191306.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS complement(87761..88636) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193270.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS complement(88660..89445) product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120785.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 gene ssuC CDS complement(89417..89836) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920799.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS complement(89873..90850) product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091913.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS complement(90955..91515) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142759.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 gene ssuE CDS 91799..94723 product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187995.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS 94720..95541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS 95538..96476 product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188558.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS complement(96541..97428) product DUF1775 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975355.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS complement(97440..99752) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550100.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS complement(99823..100242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS complement(100264..100845) product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193433.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 gene cobC CDS complement(100838..101671) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191554.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS complement(101668..102696) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193123.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 gene cobT CDS complement(102787..103878) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926108.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS complement(103875..104786) product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174539.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 gene cbiB CDS complement(104786..105355) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229235.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 gene cobO CDS complement(105382..106029) product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082592.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 gene bluB CDS complement(106522..110568) product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114926.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 gene cobN CDS complement(110581..110919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS complement(110916..111380) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088234.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS complement(111427..113532) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089686.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS complement(113900..114247) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143803.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS complement(114260..115282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS complement(115294..115701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35440 note possible pseudo, frameshifted CDS complement(115698..116447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35450 note possible pseudo, frameshifted CDS complement(116444..117271) product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392605.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 gene cobI CDS complement(117268..118581) product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631406.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS complement(118571..119680) product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258428.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS complement(119718..120401) product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999239.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 gene cbiC CDS complement(120398..121303) product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034944231.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS complement(121300..122112) product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392606.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 gene cobM CDS complement(122136..122780) product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086058.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS 123762..125630 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931557.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS 125645..126967 product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038178.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS 126964..127533 product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552342.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 gene cobU CDS 127815..128759 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228165.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS 128763..129821 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228166.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS 129818..130630 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228167.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS 130918..131748 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494169.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS complement(131820..132113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS complement(132215..133273) product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919057.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS complement(133260..134975) product arylsulfatase AtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106692.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 gene atsA CDS complement(135073..136038) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS complement(136053..136973) product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525033.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 gene catA CDS complement(137019..137309) product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190652.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 gene catC CDS complement(137332..138480) product muconate cycloisomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113308.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS 138593..139474 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089870.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS complement(139496..140323) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533811.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS 140501..141202 product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929696.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS 141222..141896 product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807676.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS 141923..143128 product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039581.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 gene pcaF CDS 143387..144157 product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064708.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS 144502..145308 product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088414.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 gene pcaD CDS 145381..146601 product benzoate/H(+) symporter BenE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206210.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 gene benE CDS complement(146591..147526) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552076.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 CDS 147761..148888 product muconate/chloromuconate family cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540534.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS 148933..149847 product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525033.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 gene catA CDS 149960..151381 product benzoate 1,2-dioxygenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529144.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 gene benA CDS 151396..151881 product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206213.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 gene benB CDS 151933..152940 product benzoate 1,2-dioxygenase electron transfer component BenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109537.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 gene benC CDS 153003..153779 product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113313.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS 153825..155201 product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206209.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS 155270..156094 product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088209.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS 156332..158611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS complement(158636..158989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS complement(159168..159533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS 159685..161121 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS complement(161356..161739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS complement(161936..162391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS complement(162752..163141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS 163683..165383 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815908.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 gene leuA CDS 165713..166378 product LuxR family transcriptional regulator AbaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208103.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 gene abaR CDS 166522..167142 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168199.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS 167144..167839 product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765563.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS 167999..169549 product DUF4331 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929156.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS 169561..170658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS 170627..171742 product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS 171966..173210 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392245.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS complement(173258..174550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS 174769..176202 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS complement(176321..176800) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971093.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS 176816..177157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS complement(177209..177682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS complement(177728..177994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS complement(178094..178444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS complement(178782..179138) product glyoxalase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632403.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS complement(179954..181369) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190401.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS complement(181403..181909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS 182205..184211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS complement(184324..185319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS complement(185366..186397) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389676.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS complement(186394..187467) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064236.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS 187671..191666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS complement(191685..192440) product ZIP family zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225190.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS complement(192520..192942) product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523721.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS complement(192936..194234) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401398.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS complement(194263..195021) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401395.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS complement(195029..195607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS 195883..196701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS 196698..199109 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941614.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS 199106..200149 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS complement(200136..204464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS complement(204475..205578) product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706047.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS 206027..208777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS 209473..211740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS complement(211861..212760) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061538724.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS 213017..213841 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086453.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS 213914..215665 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086450.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS 215655..216002 product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086452.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS 216048..217040 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064939.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS complement(217050..218171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS complement(218526..219665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS complement(219812..220795) product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089498.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 gene gnd CDS complement(220904..221965) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551441.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS 222140..225433 product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 sequence013 source 1..214029 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(551..2341) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 gene ptsP CDS complement(2440..2709) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS complement(2721..3131) product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198014.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS complement(3163..3693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS 3843..4349 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815191.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS complement(4438..5448) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807146.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 gene lipA CDS complement(5445..6143) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038550.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 gene lipB CDS 6297..7010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS complement(6994..7272) product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818417.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS complement(7360..8259) product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189800.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS complement(8306..9454) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064727.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS complement(9534..10145) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522936.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS complement(10145..10471) product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS complement(10641..11759) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038743784.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS complement(11845..12285) product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813670.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS 12582..13586 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521908.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 gene hemB CDS 13587..14756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS complement(14778..15254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS complement(15235..16206) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809398.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS 16308..18176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS 18286..18939 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063801.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS 19022..19594 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194029.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 gene ruvA CDS complement(19608..20102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS complement(20117..20653) product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529535.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS 20752..21810 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814231.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 gene ruvB CDS complement(21845..22249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS complement(22420..23385) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195809.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS complement(23385..24269) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813860.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS complement(24359..25564) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185183.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS complement(25601..26395) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813858.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS complement(26395..27171) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065077.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS complement(27168..27977) product IclR family transcriptional regulator BlcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974399.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 gene blcR CDS complement(28362..28802) product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946364.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS complement(28956..29396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS complement(29628..30260) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814875.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS complement(30409..30732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS complement(30729..32024) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926799.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS complement(32186..34387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS complement(34384..35820) product DUF3391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349264.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS complement(35932..36366) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310848.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS 36484..37617 product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067131.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS 37827..38657 product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024324407.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS 38724..39911 product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090562.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 gene pobA CDS 39998..40303 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234413.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS complement(40324..41235) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815255.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 tRNA complement(41423..41498) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(41596..42276) product response regulator transcription factor EsaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189647.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 gene esaR CDS complement(42299..44617) product sensor histidine kinase EsaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189034.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 gene esaS CDS complement(44813..45418) product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188929.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 CDS complement(45415..46734) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929882.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 gene rsmB CDS 46881..47597 product GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050480010.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS 47648..48073 product BLUF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055933.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 CDS 48465..48638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36870 CDS complement(48933..49403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36880 CDS complement(49796..49963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36890 CDS 50293..50712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36900 CDS complement(50841..51827) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531268.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS complement(52021..53337) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS complement(53334..53648) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707788.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS complement(53686..54258) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS complement(54255..54974) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929689.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 gene queC CDS complement(54986..56239) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS complement(56336..57376) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088482926.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS 57512..58309 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338755.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 gene cysQ CDS complement(58398..61022) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525850.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS 61131..61619 product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551114.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS 61666..62583 product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039011.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 gene birA CDS 62583..63377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS complement(63429..65207) product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552132.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS complement(65505..66503) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 gene gap CDS complement(66579..68627) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930131.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 gene tkt CDS 68806..69384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS complement(69716..70072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS 69966..70676 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927035.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS 70673..71905 product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527722.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS complement(71927..72739) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931197.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS complement(72775..76761) product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009241452.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS 77009..79696 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196324.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 gene glnE CDS 79693..80400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS 80375..81283 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530905.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS complement(81340..82203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534300.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS complement(82642..83628) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947147.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 gene corA CDS complement(83815..84753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS complement(84847..85290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS complement(85315..86016) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346925.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS complement(86488..87195) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064061.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS complement(87362..88255) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550822.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 gene sucD CDS complement(88294..89454) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812749.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 gene sucC CDS complement(89833..90420) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930990.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 gene recX CDS complement(90451..91518) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189458.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 gene recA CDS 91677..92348 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS 92398..93948 product sensor histidine kinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526207.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS complement(93950..95104) product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189171.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 gene rodA CDS complement(95181..97217) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 gene mrdA note possible pseudo, internal stop codon CDS complement(97333..97854) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189260.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 gene mreD CDS complement(97851..98756) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189331.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 gene mreC note possible pseudo, frameshifted CDS complement(98806..99849) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS 100228..100527 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189769.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 gene gatC CDS 100536..102014 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525859.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 gene gatA CDS 102023..103474 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552444.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 gene gatB CDS complement(103628..104308) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217982.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 gene pyrE CDS 104329..105129 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815212.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS complement(105193..105864) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814899.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS complement(105864..107045) product DUF1615 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122578.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS 107101..107739 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072952.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS complement(107764..108696) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099360.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS complement(108832..110436) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387908.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS complement(110478..111269) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809257.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS complement(111293..111820) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568255.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS 111931..112365 product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 gene trxC CDS complement(112387..113910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS 114039..115325 product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197818.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS complement(115322..117472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS complement(117495..118316) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 gene pyrF CDS complement(118441..119811) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522085.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 gene purB CDS complement(120026..120790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS 121170..122162 product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390594.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS 122193..123791 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390595.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS 123781..124836 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390596.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS 124836..125132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37540 CDS 125129..126055 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390597.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS 126087..127358 product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729093.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS 127348..128649 product URC4/urg3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729094.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS 128711..129340 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947952.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 gene upp CDS 129340..130680 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390598.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS 130710..131327 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931185.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS 131527..132708 product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198305.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS 132705..133289 product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817748.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 gene metW CDS 133373..134842 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812393.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS complement(134868..135290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS 135323..135733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS 135894..136436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS 136433..137731 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812401.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS 137780..138820 product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812403.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS complement(138872..139924) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189686.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS 140073..142637 product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814429.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 CDS 142630..144036 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550859.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 CDS 144039..144818 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064975.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 gene rsmA CDS complement(144929..145111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS complement(145090..145485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37740 CDS complement(145519..145917) product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194152.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS complement(146177..148471) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938729.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS 148580..150619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS 150705..151379 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338585.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS 151457..152431 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194308.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 gene thiL CDS 152428..152958 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194201.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 note possible pseudo, frameshifted CDS 153116..153619 product nicotinamide-nucleotide amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389623.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS 153616..154542 product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339315.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS 154599..155555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS complement(155603..156643) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194041.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 gene holA CDS complement(156648..157136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS complement(157142..159769) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810256.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 gene leuS CDS complement(159802..160242) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205242.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS complement(160247..160903) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194134.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS complement(160919..161758) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557251.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 gene dapB CDS complement(161770..162303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37900 note possible pseudo, frameshifted CDS 162404..162832 product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 gene fur CDS complement(162876..163820) product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195225.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 gene hprK CDS complement(163858..164328) product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534308.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 gene ptsN CDS complement(164554..164892) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195219.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 gene raiA CDS 165155..165958 product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287376.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS 166015..166689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS 166730..167518 product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS 167705..168181 product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704409.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 gene ppdD CDS 168647..170350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS complement(170384..170866) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 gene moaC CDS 170936..172522 product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189765.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS complement(172547..172915) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 CDS 173105..173761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS 173767..174522 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039565.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 note possible pseudo, internal stop codon, frameshifted CDS 174557..174976 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064111.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS 175079..177355 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813909.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS 177427..178125 product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037901.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS 178136..179251 product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS 179515..179859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38090 CDS 180028..180309 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767847.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS 180302..180877 product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970806.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS complement(180884..182080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38120 CDS 182257..182760 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614296.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 gene bfr CDS complement(182864..183220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS complement(183264..183935) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS complement(183935..184564) product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809123.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS complement(184918..187815) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526066.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 gene uvrA CDS 187938..189815 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009950383.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS 189852..190253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38190 CDS complement(190275..191654) product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225850.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS complement(191756..194017) product D-(-)-3-hydroxybutyrate oligomer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532230.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS complement(194219..196102) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198363.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 gene recQ CDS 196244..196816 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806953.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 gene ssb CDS 196904..197266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS 197377..198369 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941999.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS 198391..199227 product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 gene cysT CDS 199224..200150 product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942001.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 gene cysW CDS 200215..201201 product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942002.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS 201484..202503 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087175.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS 202642..203475 product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926820.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 gene cysT CDS 203475..204350 product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534651.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 gene cysW CDS 204357..205421 product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821532.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS 205504..206532 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244659.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS 206607..207563 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815068.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS 207563..208672 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262109.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS 208678..209472 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388756.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS 209523..210128 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968293.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS complement(210139..211086) product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193901.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS complement(211247..212407) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039549.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 gene mnmA CDS complement(212404..212907) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194031.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 sequence014 source 1..201869 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 406..1608 product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039581.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 gene pcaF CDS complement(1639..1860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS complement(2005..2412) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086787.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 CDS complement(2466..3647) product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 CDS complement(3653..4093) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395796.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS complement(4220..7405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS complement(7505..7780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS 8024..8533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS complement(8655..8861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38490 assembly_gap 8874..8883 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8942..9205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38500 CDS 9326..11020 product phage integrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900397.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS complement(11046..11309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38520 CDS 11328..12482 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085906.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS complement(12712..13446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS 14050..14535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38550 note possible pseudo, frameshifted CDS 14613..14792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38560 CDS complement(14977..15432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38570 CDS complement(15487..16302) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551552.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 CDS complement(16390..16821) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933626.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 CDS 17211..17666 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091672.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS 17777..19408 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808619.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 gene groL CDS 19519..20172 product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183858629.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 CDS 20346..21191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38630 CDS complement(21229..21441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38640 CDS 21880..22974 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257479.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 CDS 22953..24395 product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267578.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS 24392..26116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS 26113..27129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS 27425..28516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS complement(28591..31266) product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706484.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 gene mprF CDS complement(31315..32127) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551552.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS complement(32263..32757) product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147117.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 CDS complement(32804..34498) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037028.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS complement(34495..35832) product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706123.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS complement(35829..36992) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706126.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 CDS complement(36997..37536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS 37535..39526 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029300896.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 CDS 39824..40279 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087013.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS complement(40344..41840) product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102868.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 CDS complement(41837..43522) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523287.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS complement(43675..44529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS 44798..45250 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091672.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS 45397..46065 product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070597.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS 46289..46813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS complement(46847..48922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS complement(48953..49693) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958593.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 CDS 50074..50310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS 50411..51367 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403237.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS complement(51346..52356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS complement(52465..52932) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187137.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 CDS complement(53060..53377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS 53601..54158 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187137.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS complement(54184..54507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS 54574..56097 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140648.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS 56457..56849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38950 assembly_gap 57297..58406 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(58604..59407) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085954781.1 transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS 59768..60937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS complement(61369..62079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38980 note possible pseudo, internal stop codon, frameshifted CDS complement(62131..62316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38990 note possible pseudo, internal stop codon, frameshifted CDS complement(62515..62892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39000 CDS 63043..63318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39010 tRNA complement(63568..63652) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 64424..64762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS 64895..65743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS complement(65835..67124) product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967584.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS complement(67263..67490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39050 CDS complement(67739..68035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39060 CDS 68086..71637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39070 CDS complement(71658..73163) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS 73273..74316 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975816.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 gene pta CDS 74304..75074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS complement(75174..75515) product sulfite:cytochrome C oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172935.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 CDS complement(75527..76753) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965461.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 CDS complement(77002..78690) product cobalt chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387960.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 CDS complement(78690..79640) product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003523293.1 transl_table 11 codon_start 1 locus_tag LOCUS_39140 gene cobS CDS complement(79680..80486) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312277.1 transl_table 11 codon_start 1 locus_tag LOCUS_39150 CDS 80633..82438 product sulfoacetaldehyde acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808155.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 gene xsc CDS 82545..83576 product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207160.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 CDS 83685..84089 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061778.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS 84102..85541 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975813.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 CDS 85625..86707 product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975809.1 transl_table 11 codon_start 1 locus_tag LOCUS_39200 gene tauA CDS 86790..87614 product taurine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975810.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 CDS 87607..88503 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975811.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 CDS 88789..89976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39230 CDS 90120..91124 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027614.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS complement(91105..91383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS 91271..92458 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227054.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS 92530..94830 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525850.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS 94939..95193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS complement(95231..99070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS complement(99158..101362) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105404.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 CDS 101540..101989 product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103716.1 transl_table 11 codon_start 1 locus_tag LOCUS_39310 gene cadR CDS complement(101945..102385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS complement(102499..102894) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056419.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS complement(102891..104348) product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275381.1 transl_table 11 codon_start 1 locus_tag LOCUS_39340 CDS complement(104345..107188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39350 CDS complement(107346..108629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39360 CDS 109199..110392 product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035215636.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 gene repA CDS 110392..111540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS 112199..112651 product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970313.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS 112923..113171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS 113168..113938 product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266861.1 transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS 114199..115515 product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523292.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS 115517..116530 product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188282.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS 116533..117819 product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113728.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS complement(117908..118477) product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089470.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 gene msuE CDS complement(118622..119818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39460 CDS complement(119831..120634) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089193.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 CDS complement(120628..121671) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089194.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS complement(121682..122707) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089195.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS complement(122829..123794) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767686.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 CDS complement(123893..125509) product rhodanese homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103706.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 CDS complement(125509..126084) product 3-mercaptopropionate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113364.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 CDS complement(126131..127366) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113359.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 CDS 127540..128646 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138358771.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS 128803..131730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS complement(131756..132856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS 133134..135533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS 135601..138609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS complement(138622..139521) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525156.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 CDS 139621..140580 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809986.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 CDS 140595..142724 product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930644.1 transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS 142717..143493 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225713.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS 143504..144949 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192785.1 transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS 145026..145766 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083381.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS 145941..147038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS complement(147081..147887) product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035524.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 gene dkgB CDS complement(147932..149164) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705534.1 transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS complement(149239..150186) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811189.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS complement(150206..150946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS complement(150946..152073) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706082.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS complement(152114..154249) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856231.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 CDS 155814..156380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39720 CDS complement(156551..156895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39730 CDS 157173..158318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39740 CDS 158479..159012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39750 CDS 159086..160042 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490825.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 CDS 160195..161706 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122652.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 CDS 161732..162697 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817045.1 transl_table 11 codon_start 1 locus_tag LOCUS_39780 CDS 162708..163769 product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085467.1 transl_table 11 codon_start 1 locus_tag LOCUS_39790 CDS 163929..165302 product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142441.1 transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS 165380..166093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS 166213..167469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401394.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 CDS 167501..168379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS 168636..170099 product pyochelin biosynthesis salicyl-AMP ligase PchD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114688.1 transl_table 11 codon_start 1 locus_tag LOCUS_39840 gene pchD CDS 170096..170575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39850 CDS 170572..171717 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175116.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS 171683..172732 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810803.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS 172755..173510 product Asp/Glu racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807356.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS complement(173545..175467) product FAD-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966821.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 CDS complement(175588..176535) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064997.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 CDS 177180..178589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39910 CDS 178640..179182 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 CDS 179565..180587 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083522.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 CDS 180717..181712 product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930250.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 CDS 181716..182783 product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137395785.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 CDS 182809..183660 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089654.1 transl_table 11 codon_start 1 locus_tag LOCUS_39960 CDS 183657..184730 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969402.1 transl_table 11 codon_start 1 locus_tag LOCUS_39970 CDS 184755..185444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973993.1 transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS 185448..186299 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067241.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS complement(186353..187861) product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063719.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 CDS complement(187903..188907) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811475.1 transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS 189029..189511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40020 CDS 189591..190961 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494221.1 transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS 190964..192952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087043.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 CDS 192945..195116 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087042.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 CDS 195113..195625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087041.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 CDS 195628..196146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS 196143..198446 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087039.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 CDS 198901..199554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40090 note possible pseudo, frameshifted CDS 199554..200012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40100 CDS 200072..201559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215945.1 transl_table 11 codon_start 1 locus_tag LOCUS_40110 sequence015 source 1..194131 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(457..771) product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144175.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 CDS complement(856..2412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40130 note possible pseudo, frameshifted CDS complement(2412..3758) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530044.1 transl_table 11 codon_start 1 locus_tag LOCUS_40140 CDS 3750..4547 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036609.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 CDS complement(4647..4889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40160 CDS 5012..5938 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088245.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 CDS complement(5942..7135) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704591.1 transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS complement(7198..7695) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811310.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 CDS complement(7759..8661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40200 CDS complement(8774..10051) product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266648.1 transl_table 11 codon_start 1 locus_tag LOCUS_40210 gene lplT CDS 10234..11331 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208091.1 transl_table 11 codon_start 1 locus_tag LOCUS_40220 gene alr CDS 11369..11740 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 gene arfB CDS complement(11749..12942) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189788.1 transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS 13102..14472 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193568.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 gene radA CDS 14499..14897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS 15003..15926 product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188924.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 CDS 15943..16152 product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814195.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS 16313..17197 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522850.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 gene purU CDS 17220..17672 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814197.1 transl_table 11 codon_start 1 locus_tag LOCUS_40300 CDS 17674..18636 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189905.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS 18654..19226 product DUF2946 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142820828.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 CDS complement(19295..20182) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552489.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 tRNA 20428..20503 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(22519..25701) product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 CDS complement(25805..26881) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104341.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 CDS complement(26871..28196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40360 CDS complement(28186..29748) product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103418.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 CDS complement(29859..29990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40380 CDS complement(29962..30684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40390 CDS complement(30987..32792) product DUF927 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948071.1 transl_table 11 codon_start 1 locus_tag LOCUS_40400 CDS complement(32789..33793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40410 CDS complement(33786..34052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40420 CDS complement(34065..34289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40430 CDS complement(34647..35804) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036647.1 transl_table 11 codon_start 1 locus_tag LOCUS_40440 CDS 36149..36742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40450 CDS 36877..37284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40460 CDS 37477..38148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40470 CDS complement(38189..39466) product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198058.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 CDS complement(39590..40231) product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768608.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 CDS 40273..41181 product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704527.1 transl_table 11 codon_start 1 locus_tag LOCUS_40500 CDS complement(41290..41712) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809299.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 CDS complement(41803..42579) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204885.1 transl_table 11 codon_start 1 locus_tag LOCUS_40520 CDS complement(42589..43374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40530 CDS complement(43483..45351) product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817018.1 transl_table 11 codon_start 1 locus_tag LOCUS_40540 CDS 45668..46201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40550 CDS complement(46213..47280) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114172.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 CDS complement(47304..48392) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975407.1 transl_table 11 codon_start 1 locus_tag LOCUS_40570 CDS 48502..49356 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538077.1 transl_table 11 codon_start 1 locus_tag LOCUS_40580 gene rlmJ CDS 49438..51348 product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097695.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS 51476..52087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40600 note possible pseudo, frameshifted CDS complement(52131..53285) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194199.1 transl_table 11 codon_start 1 locus_tag LOCUS_40610 gene tgt CDS complement(53394..53780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40620 CDS complement(53850..55040) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538740.1 transl_table 11 codon_start 1 locus_tag LOCUS_40630 gene queA CDS 55178..57175 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917883.1 transl_table 11 codon_start 1 locus_tag LOCUS_40640 gene recG note possible pseudo, internal stop codon, frameshifted CDS complement(57204..58031) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192993.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 gene panC CDS complement(58065..58868) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687894.1 transl_table 11 codon_start 1 locus_tag LOCUS_40660 gene panB CDS 58930..59853 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811203.1 transl_table 11 codon_start 1 locus_tag LOCUS_40670 CDS 59978..60169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS 60264..60743 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811209.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 CDS 60893..62521 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815895.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 CDS complement(62593..63027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40710 CDS 63186..64097 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 gene ubiA CDS 64184..64645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40730 CDS 64761..65549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40740 CDS complement(65659..66114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40750 note possible pseudo, frameshifted CDS complement(66192..67004) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522133.1 transl_table 11 codon_start 1 locus_tag LOCUS_40760 gene proC CDS 67183..68457 product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811716.1 transl_table 11 codon_start 1 locus_tag LOCUS_40770 CDS 68600..69571 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807415.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 CDS complement(69597..70529) product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704184.1 transl_table 11 codon_start 1 locus_tag LOCUS_40790 CDS complement(70624..71328) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527690.1 transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS 71507..72385 product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218487.1 transl_table 11 codon_start 1 locus_tag LOCUS_40810 gene pilT note possible pseudo, internal stop codon CDS 72528..73382 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814620.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS complement(73422..74060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40830 CDS complement(74057..74635) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196857.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS complement(74738..75115) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525681.1 transl_table 11 codon_start 1 locus_tag LOCUS_40850 CDS 75123..76022 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196861.1 transl_table 11 codon_start 1 locus_tag LOCUS_40860 gene rsmI CDS complement(76132..76737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40870 CDS 76865..78328 product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931196.1 transl_table 11 codon_start 1 locus_tag LOCUS_40880 gene tldD CDS 78622..79749 product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550019.1 transl_table 11 codon_start 1 locus_tag LOCUS_40890 gene aroG CDS complement(79871..80440) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 transl_table 11 codon_start 1 locus_tag LOCUS_40900 CDS 80549..80944 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339147.1 transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS complement(81024..81311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40920 CDS complement(81623..83185) product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192871.1 transl_table 11 codon_start 1 locus_tag LOCUS_40930 CDS complement(83182..84471) product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536181.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 CDS complement(84503..86425) product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192719.1 transl_table 11 codon_start 1 locus_tag LOCUS_40950 CDS 86933..87682 product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840119.1 transl_table 11 codon_start 1 locus_tag LOCUS_40960 gene otsB CDS 88025..89407 product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191255.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 gene otsA CDS complement(89495..90376) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929571.1 transl_table 11 codon_start 1 locus_tag LOCUS_40980 CDS complement(90370..90939) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811244.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 CDS 90987..91928 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523123.1 transl_table 11 codon_start 1 locus_tag LOCUS_41000 gene argC CDS complement(92022..92792) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195817.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 CDS complement(92831..93472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41020 CDS complement(93506..94153) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818284.1 transl_table 11 codon_start 1 locus_tag LOCUS_41030 gene rsmG CDS complement(94161..96149) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195816.1 transl_table 11 codon_start 1 locus_tag LOCUS_41040 gene mnmG CDS complement(96204..96410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS complement(96581..97474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS 97629..97913 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813217.1 transl_table 11 codon_start 1 locus_tag LOCUS_41070 CDS complement(97956..98327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41080 CDS 98401..99009 product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083981.1 transl_table 11 codon_start 1 locus_tag LOCUS_41090 gene gstA CDS complement(99055..100635) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192088.1 transl_table 11 codon_start 1 locus_tag LOCUS_41100 CDS complement(100665..101840) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524778.1 transl_table 11 codon_start 1 locus_tag LOCUS_41110 CDS complement(101851..102888) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191693.1 transl_table 11 codon_start 1 locus_tag LOCUS_41120 CDS complement(102889..104862) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535437.1 transl_table 11 codon_start 1 locus_tag LOCUS_41130 assembly_gap 105211..107165 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 107463..108362 product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 transl_table 11 codon_start 1 locus_tag LOCUS_41140 gene nhaR CDS complement(108437..108949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS 109622..110332 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930986.1 transl_table 11 codon_start 1 locus_tag LOCUS_41160 CDS 110596..111360 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 transl_table 11 codon_start 1 locus_tag LOCUS_41170 CDS 111504..112376 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 transl_table 11 codon_start 1 locus_tag LOCUS_41180 CDS 112470..113177 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189079.1 transl_table 11 codon_start 1 locus_tag LOCUS_41190 CDS complement(113200..114438) product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112811.1 transl_table 11 codon_start 1 locus_tag LOCUS_41200 CDS complement(114738..115238) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256868.1 transl_table 11 codon_start 1 locus_tag LOCUS_41210 CDS 115445..116920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41220 CDS complement(117227..118060) product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533219.1 transl_table 11 codon_start 1 locus_tag LOCUS_41230 CDS complement(118060..118407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41240 CDS complement(118415..119047) product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161139422.1 transl_table 11 codon_start 1 locus_tag LOCUS_41250 CDS complement(119050..121104) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533221.1 transl_table 11 codon_start 1 locus_tag LOCUS_41260 gene ctaD CDS complement(121101..122060) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971124.1 transl_table 11 codon_start 1 locus_tag LOCUS_41270 gene coxB CDS complement(122065..122745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41280 CDS complement(122742..123539) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063174003.1 transl_table 11 codon_start 1 locus_tag LOCUS_41290 CDS complement(123679..125496) product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525144.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 CDS complement(125621..126007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS 126046..126576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41320 CDS complement(126670..127968) product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812238.1 transl_table 11 codon_start 1 locus_tag LOCUS_41330 CDS 128122..128454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41340 CDS 128513..129403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41350 CDS complement(129435..129860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41360 CDS complement(129883..131679) product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036090.1 transl_table 11 codon_start 1 locus_tag LOCUS_41370 CDS complement(131842..132171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41380 CDS 132341..132823 product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197812.1 transl_table 11 codon_start 1 locus_tag LOCUS_41390 CDS complement(132837..134582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41400 CDS complement(134928..136706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41410 CDS complement(136998..137894) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530857.1 transl_table 11 codon_start 1 locus_tag LOCUS_41420 CDS 138064..139020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41430 CDS complement(139023..140456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41440 CDS 140436..141077 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926361.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 CDS complement(141111..142301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41460 CDS 142410..143456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41470 CDS 143460..143633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41480 CDS 143972..144745 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404765.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 CDS 144882..145880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41500 CDS complement(145905..147167) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090620535.1 transl_table 11 codon_start 1 locus_tag LOCUS_41510 CDS complement(147378..148061) product DUF799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103486.1 transl_table 11 codon_start 1 locus_tag LOCUS_41520 CDS complement(148107..148475) product DUF4810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198227.1 transl_table 11 codon_start 1 locus_tag LOCUS_41530 CDS complement(148472..149158) product CsgG/HfaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552263.1 transl_table 11 codon_start 1 locus_tag LOCUS_41540 CDS complement(149313..150140) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 transl_table 11 codon_start 1 locus_tag LOCUS_41550 CDS 150407..150625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41560 CDS complement(150740..151165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41570 CDS complement(151622..152710) product DUF3883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338943.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 CDS complement(152834..155332) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196276.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 gene gyrB CDS complement(155418..156530) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196275.1 transl_table 11 codon_start 1 locus_tag LOCUS_41600 gene dnaN CDS complement(156765..158174) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040794.1 transl_table 11 codon_start 1 locus_tag LOCUS_41610 gene dnaA CDS 158592..158726 product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214728.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 gene rpmH CDS 158744..159160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41630 CDS 159197..159562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41640 CDS 159559..161220 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927254.1 transl_table 11 codon_start 1 locus_tag LOCUS_41650 gene yidC CDS 161296..162702 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524586.1 transl_table 11 codon_start 1 locus_tag LOCUS_41660 gene mnmE CDS complement(163474..164115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41670 CDS complement(164145..166145) product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195204.1 transl_table 11 codon_start 1 locus_tag LOCUS_41680 CDS 166232..167218 product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 transl_table 11 codon_start 1 locus_tag LOCUS_41690 CDS 167218..167790 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 transl_table 11 codon_start 1 locus_tag LOCUS_41700 CDS 167804..168466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41710 CDS 168463..169233 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809590.1 transl_table 11 codon_start 1 locus_tag LOCUS_41720 CDS complement(169400..169903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41730 CDS 170349..172157 product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393021.1 transl_table 11 codon_start 1 locus_tag LOCUS_41740 CDS 172247..173017 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994212.1 transl_table 11 codon_start 1 locus_tag LOCUS_41750 CDS 173033..173902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41760 CDS complement(173925..174677) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205980.1 transl_table 11 codon_start 1 locus_tag LOCUS_41770 CDS complement(174763..175992) product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 transl_table 11 codon_start 1 locus_tag LOCUS_41780 CDS 176218..176826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41790 CDS complement(176975..179170) product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925701.1 transl_table 11 codon_start 1 locus_tag LOCUS_41800 CDS complement(179196..179879) product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204015.1 transl_table 11 codon_start 1 locus_tag LOCUS_41810 CDS 180043..180975 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266649.1 transl_table 11 codon_start 1 locus_tag LOCUS_41820 CDS complement(181049..181387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41830 CDS complement(181492..182919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41840 CDS 182906..184615 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522947.1 transl_table 11 codon_start 1 locus_tag LOCUS_41850 gene argS CDS 184612..185370 product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197747.1 transl_table 11 codon_start 1 locus_tag LOCUS_41860 CDS 185448..186089 product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096976.1 transl_table 11 codon_start 1 locus_tag LOCUS_41870 gene dsbA CDS 186240..186761 product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936242.1 transl_table 11 codon_start 1 locus_tag LOCUS_41880 gene lptA CDS 186761..187546 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195214.1 transl_table 11 codon_start 1 locus_tag LOCUS_41890 gene lptB CDS 187569..189086 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195216.1 transl_table 11 codon_start 1 locus_tag LOCUS_41900 CDS 189220..190473 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194083.1 transl_table 11 codon_start 1 locus_tag LOCUS_41910 CDS complement(190511..191230) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194189.1 transl_table 11 codon_start 1 locus_tag LOCUS_41920 CDS 191332..192120 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 transl_table 11 codon_start 1 locus_tag LOCUS_41930 CDS complement(192190..193869) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527788.1 transl_table 11 codon_start 1 locus_tag LOCUS_41940 sequence016 source 1..173331 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 556..753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41950 CDS 935..2764 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033452234.1 transl_table 11 codon_start 1 locus_tag LOCUS_41960 CDS complement(3137..4810) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085507.1 transl_table 11 codon_start 1 locus_tag LOCUS_41970 CDS complement(4824..6098) product monooxygenase YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232789.1 transl_table 11 codon_start 1 locus_tag LOCUS_41980 gene yjiB CDS 6455..7072 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046120731.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 CDS complement(7054..7884) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731385.1 transl_table 11 codon_start 1 locus_tag LOCUS_42000 CDS complement(7916..9286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42010 CDS complement(9290..9727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42020 CDS complement(9750..10550) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043677442.1 transl_table 11 codon_start 1 locus_tag LOCUS_42030 CDS complement(10565..12805) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467867.1 transl_table 11 codon_start 1 locus_tag LOCUS_42040 CDS 13010..13372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42050 CDS 13381..13785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42060 CDS 13782..14213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42070 CDS 14287..15558 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729591.1 transl_table 11 codon_start 1 locus_tag LOCUS_42080 CDS 15652..16218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42090 CDS complement(16268..17197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42100 CDS complement(17392..18915) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337338.1 transl_table 11 codon_start 1 locus_tag LOCUS_42110 CDS complement(18928..19875) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557395.1 transl_table 11 codon_start 1 locus_tag LOCUS_42120 CDS complement(19889..20104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42130 CDS complement(20101..21318) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814298.1 transl_table 11 codon_start 1 locus_tag LOCUS_42140 CDS complement(21319..22224) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387968.1 transl_table 11 codon_start 1 locus_tag LOCUS_42150 CDS complement(22395..23480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42160 CDS 23661..24731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42170 CDS complement(24714..25511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42180 CDS 25688..27319 product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 transl_table 11 codon_start 1 locus_tag LOCUS_42190 CDS complement(27341..28141) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467026.1 transl_table 11 codon_start 1 locus_tag LOCUS_42200 CDS 28302..28994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42210 CDS complement(28991..29530) product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095285.1 transl_table 11 codon_start 1 locus_tag LOCUS_42220 CDS complement(29573..30973) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211172.1 transl_table 11 codon_start 1 locus_tag LOCUS_42230 CDS complement(31114..32424) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896236.1 transl_table 11 codon_start 1 locus_tag LOCUS_42240 CDS complement(32439..33008) product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095285.1 transl_table 11 codon_start 1 locus_tag LOCUS_42250 CDS complement(33029..34429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42260 CDS complement(34773..35780) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 transl_table 11 codon_start 1 locus_tag LOCUS_42270 CDS 35909..37048 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531761.1 transl_table 11 codon_start 1 locus_tag LOCUS_42280 CDS complement(37069..37323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42290 CDS complement(37800..38570) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283886.1 transl_table 11 codon_start 1 locus_tag LOCUS_42300 CDS complement(38594..39652) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112789.1 transl_table 11 codon_start 1 locus_tag LOCUS_42310 CDS complement(39649..40932) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400917.1 transl_table 11 codon_start 1 locus_tag LOCUS_42320 CDS complement(40951..41688) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084311.1 transl_table 11 codon_start 1 locus_tag LOCUS_42330 CDS complement(41685..43970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42340 CDS complement(43967..44911) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089798.1 transl_table 11 codon_start 1 locus_tag LOCUS_42350 CDS complement(44947..45933) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877605.1 transl_table 11 codon_start 1 locus_tag LOCUS_42360 CDS complement(45930..46403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42370 CDS complement(46419..47132) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086937.1 transl_table 11 codon_start 1 locus_tag LOCUS_42380 CDS 47499..48839 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114846.1 transl_table 11 codon_start 1 locus_tag LOCUS_42390 CDS complement(48734..49162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42400 CDS complement(49661..50896) product ISL3-like element ISMac21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 transl_table 11 codon_start 1 locus_tag LOCUS_42410 CDS complement(50930..51139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42420 CDS 51630..52028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42430 CDS 52264..52452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42440 CDS 52449..52724 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192868.1 transl_table 11 codon_start 1 locus_tag LOCUS_42450 CDS complement(52936..53973) product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140590772.1 transl_table 11 codon_start 1 locus_tag LOCUS_42460 CDS 54315..54830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42470 CDS complement(54840..55157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42480 CDS 55062..57260 product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104112.1 transl_table 11 codon_start 1 locus_tag LOCUS_42490 CDS complement(57308..57604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42500 CDS 57847..58257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42510 CDS complement(58431..59873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42520 CDS 59872..60219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42530 CDS 60359..60670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42540 CDS 60764..61237 product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932287.1 transl_table 11 codon_start 1 locus_tag LOCUS_42550 CDS complement(61368..61673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42560 CDS 61823..62617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42570 CDS complement(62689..62994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42580 CDS 63622..64152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42590 CDS 64176..64364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42600 CDS complement(64806..65120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42610 CDS complement(65225..65584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42620 CDS complement(65581..66351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42630 CDS complement(66433..66624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42640 CDS complement(66729..67016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42650 CDS complement(67013..67324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42660 CDS complement(67351..67968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42670 CDS complement(67965..68126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42680 CDS complement(68108..68428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42690 CDS complement(68430..68645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42700 CDS complement(68789..69850) product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 transl_table 11 codon_start 1 locus_tag LOCUS_42710 CDS 70362..71375 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052727998.1 transl_table 11 codon_start 1 locus_tag LOCUS_42720 CDS 71455..72366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42730 CDS complement(72391..73914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42740 CDS complement(73908..74762) product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948031.1 transl_table 11 codon_start 1 locus_tag LOCUS_42750 CDS complement(74759..77404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42760 CDS complement(77444..77659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42770 CDS 77818..79032 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975712.1 transl_table 11 codon_start 1 locus_tag LOCUS_42780 CDS complement(79029..80543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42790 CDS complement(80543..81412) product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084309.1 transl_table 11 codon_start 1 locus_tag LOCUS_42800 CDS 81707..81961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42810 CDS complement(82178..83053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42820 CDS complement(83068..83352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42830 CDS 83976..86618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42840 CDS 87360..87989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42850 CDS complement(88260..88472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42860 CDS complement(88602..88811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42870 CDS complement(88808..89659) product IS21-like element ISMac3 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021079.1 transl_table 11 codon_start 1 locus_tag LOCUS_42880 gene istB CDS complement(89604..91121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42890 CDS complement(91105..91560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42900 CDS 91915..93243 product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917061.1 transl_table 11 codon_start 1 locus_tag LOCUS_42910 CDS 93243..94040 product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899491.1 transl_table 11 codon_start 1 locus_tag LOCUS_42920 CDS 94037..94243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42930 CDS 94426..94647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42940 CDS complement(94667..94873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42950 CDS complement(95353..95535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42960 CDS 95538..95795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42970 CDS complement(96170..98506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42980 CDS complement(98837..99322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42990 CDS complement(99683..101728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43000 CDS complement(101744..103981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43010 CDS complement(104236..104469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43020 CDS complement(104705..105865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43030 CDS complement(106455..107471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43040 CDS 107988..108203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43050 CDS complement(108291..108551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43060 CDS complement(108659..109168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43070 CDS complement(109199..109675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43080 CDS 109721..110080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43090 CDS complement(110226..110645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43100 CDS complement(110885..111328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43110 CDS complement(112011..113942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43120 CDS complement(113935..115215) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301909.1 transl_table 11 codon_start 1 locus_tag LOCUS_43130 CDS complement(115693..116127) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087886.1 transl_table 11 codon_start 1 locus_tag LOCUS_43140 CDS complement(116124..116606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43150 CDS 116835..118610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43160 CDS complement(118709..119356) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118644.1 transl_table 11 codon_start 1 locus_tag LOCUS_43170 CDS complement(119353..120639) product DUF1173 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529857.1 transl_table 11 codon_start 1 locus_tag LOCUS_43180 CDS complement(120727..121707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43190 CDS complement(121751..123244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43200 CDS 123743..123916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43210 CDS 124023..124847 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582622.1 transl_table 11 codon_start 1 locus_tag LOCUS_43220 CDS 124847..125941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43230 CDS complement(125998..126555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43240 CDS complement(126723..127730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43250 CDS 127840..128082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43260 CDS 128339..128530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43270 CDS complement(128795..129016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43280 CDS 128904..130154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43290 CDS complement(130975..131502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43300 CDS complement(131391..132368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43310 CDS complement(132487..132936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43320 CDS 133076..133537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43330 CDS 133719..134075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43340 CDS 134077..134448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43350 CDS 134445..134666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43360 CDS 134659..134790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43370 CDS 134853..135524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43380 CDS 135582..137096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43390 CDS 137227..137571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43400 CDS 137568..138044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43410 CDS 138070..138798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43420 CDS complement(139059..140348) product replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194484.1 transl_table 11 codon_start 1 locus_tag LOCUS_43430 CDS complement(141456..141758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43440 CDS 142124..142483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43450 CDS 142483..143001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43460 CDS 142998..143309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43470 CDS 143306..143647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43480 CDS 143631..146111 product type IV secretion system protein PtlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815859.1 transl_table 11 codon_start 1 locus_tag LOCUS_43490 gene ptlC CDS 146108..146455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43500 CDS 146460..147488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43510 CDS 147501..148199 product P-type DNA transfer protein VirB5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011264014.1 transl_table 11 codon_start 1 locus_tag LOCUS_43520 gene virB5 CDS 148212..148946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43530 CDS 148943..149938 product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891495.1 transl_table 11 codon_start 1 locus_tag LOCUS_43540 gene virB9 CDS 149935..151257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43550 CDS 151269..152309 product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034519683.1 transl_table 11 codon_start 1 locus_tag LOCUS_43560 gene virB11 CDS 152309..155086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43570 CDS 155154..155819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43580 CDS 155849..159151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43590 CDS 159177..159521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43600 CDS 159600..160619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43610 CDS 161163..161630 product DM13 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704152.1 transl_table 11 codon_start 1 locus_tag LOCUS_43620 CDS complement(161929..162405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43630 CDS 162468..162818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43640 CDS 162868..163116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43650 CDS 163360..164958 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037320.1 transl_table 11 codon_start 1 locus_tag LOCUS_43660 CDS complement(165101..166318) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085615.1 transl_table 11 codon_start 1 locus_tag LOCUS_43670 CDS complement(166311..166886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43680 CDS complement(166898..167221) product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083869.1 transl_table 11 codon_start 1 locus_tag LOCUS_43690 CDS complement(167237..168436) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083868.1 transl_table 11 codon_start 1 locus_tag LOCUS_43700 CDS complement(168931..170034) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543370.1 transl_table 11 codon_start 1 locus_tag LOCUS_43710 CDS complement(170200..170910) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973919.1 transl_table 11 codon_start 1 locus_tag LOCUS_43720 CDS complement(170907..171665) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385621.1 transl_table 11 codon_start 1 locus_tag LOCUS_43730 CDS complement(171662..172681) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538210.1 transl_table 11 codon_start 1 locus_tag LOCUS_43740 misc_feature complement(172696..>173331) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887358.1:branched-chain amino acid ABC transporter permease locus_tag LOCUS_43750 sequence017 source 1..169933 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 482..1117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43760 CDS 1119..1862 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 transl_table 11 codon_start 1 locus_tag LOCUS_43770 CDS complement(1864..3267) product oxalate/formate MFS antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085933.1 transl_table 11 codon_start 1 locus_tag LOCUS_43780 gene oxlT CDS complement(3284..4804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43790 CDS 5442..6491 product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097520.1 transl_table 11 codon_start 1 locus_tag LOCUS_43800 gene galT CDS 6600..7121 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 transl_table 11 codon_start 1 locus_tag LOCUS_43810 CDS 7358..9541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43820 CDS complement(9611..10360) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526980.1 transl_table 11 codon_start 1 locus_tag LOCUS_43830 CDS complement(10437..11516) product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010438666.1 transl_table 11 codon_start 1 locus_tag LOCUS_43840 gene hppD CDS complement(11825..11944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43850 CDS complement(11994..12992) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159689211.1 transl_table 11 codon_start 1 locus_tag LOCUS_43860 CDS 13152..14003 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 transl_table 11 codon_start 1 locus_tag LOCUS_43870 CDS 14031..16106 product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 transl_table 11 codon_start 1 locus_tag LOCUS_43880 CDS 16106..17917 product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 transl_table 11 codon_start 1 locus_tag LOCUS_43890 CDS 17926..18294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43900 CDS 18299..19378 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529351.1 transl_table 11 codon_start 1 locus_tag LOCUS_43910 CDS 19412..20383 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086618.1 transl_table 11 codon_start 1 locus_tag LOCUS_43920 CDS 20515..21627 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521477.1 transl_table 11 codon_start 1 locus_tag LOCUS_43930 CDS complement(21709..23025) product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931072.1 transl_table 11 codon_start 1 locus_tag LOCUS_43940 gene paaF CDS complement(23169..24695) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029259.1 transl_table 11 codon_start 1 locus_tag LOCUS_43950 CDS 24914..26569 product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186941.1 transl_table 11 codon_start 1 locus_tag LOCUS_43960 gene paaN CDS 26580..27383 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389695.1 transl_table 11 codon_start 1 locus_tag LOCUS_43970 CDS complement(27514..28653) product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816013.1 transl_table 11 codon_start 1 locus_tag LOCUS_43980 CDS complement(28657..29481) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053070.1 transl_table 11 codon_start 1 locus_tag LOCUS_43990 CDS complement(29496..31523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44000 CDS complement(31628..32836) product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618909.1 transl_table 11 codon_start 1 locus_tag LOCUS_44010 CDS complement(32849..33337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44020 CDS complement(33334..34413) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941317.1 transl_table 11 codon_start 1 locus_tag LOCUS_44030 CDS complement(34766..35857) product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199195.1 transl_table 11 codon_start 1 locus_tag LOCUS_44040 gene paaK CDS complement(35895..36677) product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199193.1 transl_table 11 codon_start 1 locus_tag LOCUS_44050 gene paaC CDS complement(36690..36986) product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551024.1 transl_table 11 codon_start 1 locus_tag LOCUS_44060 gene paaB CDS complement(37014..38021) product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523130.1 transl_table 11 codon_start 1 locus_tag LOCUS_44070 gene paaA CDS complement(38573..39778) product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096788.1 transl_table 11 codon_start 1 locus_tag LOCUS_44080 gene fdhA CDS complement(39919..40362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44090 CDS complement(40475..40987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44100 CDS complement(41059..42183) product YbdK family carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195787.1 transl_table 11 codon_start 1 locus_tag LOCUS_44110 CDS complement(42185..43378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44120 CDS complement(43385..44233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44130 CDS 44503..45228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44140 CDS complement(45171..48041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44150 CDS 48317..48754 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931065.1 transl_table 11 codon_start 1 locus_tag LOCUS_44160 CDS 48751..49935 product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538642.1 transl_table 11 codon_start 1 locus_tag LOCUS_44170 CDS 49986..50300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44180 CDS 50408..50638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44190 CDS 50825..51190 product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 transl_table 11 codon_start 1 locus_tag LOCUS_44200 CDS 51261..53690 product DUF3772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064141.1 transl_table 11 codon_start 1 locus_tag LOCUS_44210 CDS 53763..54830 product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036611.1 transl_table 11 codon_start 1 locus_tag LOCUS_44220 CDS 55132..55896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44230 CDS complement(55919..57316) product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463318.1 transl_table 11 codon_start 1 locus_tag LOCUS_44240 CDS complement(57328..58620) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808102.1 transl_table 11 codon_start 1 locus_tag LOCUS_44250 CDS complement(58617..59279) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383446.1 transl_table 11 codon_start 1 locus_tag LOCUS_44260 CDS complement(59276..60331) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808104.1 transl_table 11 codon_start 1 locus_tag LOCUS_44270 CDS complement(60375..61352) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814852.1 transl_table 11 codon_start 1 locus_tag LOCUS_44280 CDS complement(61395..62138) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810391.1 transl_table 11 codon_start 1 locus_tag LOCUS_44290 CDS complement(62143..63474) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227747.1 transl_table 11 codon_start 1 locus_tag LOCUS_44300 CDS complement(63490..64914) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086065.1 transl_table 11 codon_start 1 locus_tag LOCUS_44310 CDS complement(64921..66351) product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086079.1 transl_table 11 codon_start 1 locus_tag LOCUS_44320 gene hydA CDS 66615..67340 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086078.1 transl_table 11 codon_start 1 locus_tag LOCUS_44330 CDS 67478..68200 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104658.1 transl_table 11 codon_start 1 locus_tag LOCUS_44340 CDS 68206..68730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44350 CDS 69059..69841 product OBAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994179.1 transl_table 11 codon_start 1 locus_tag LOCUS_44360 CDS complement(69881..70183) product AzlD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522986.1 transl_table 11 codon_start 1 locus_tag LOCUS_44370 CDS complement(70180..70917) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550326.1 transl_table 11 codon_start 1 locus_tag LOCUS_44380 CDS 71033..71491 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522988.1 transl_table 11 codon_start 1 locus_tag LOCUS_44390 CDS complement(71602..73074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44400 CDS complement(74339..75535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44410 CDS complement(75549..76343) product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194446.1 transl_table 11 codon_start 1 locus_tag LOCUS_44420 gene parA CDS complement(77752..79059) product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085289.1 transl_table 11 codon_start 1 locus_tag LOCUS_44430 CDS complement(79320..80813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44440 CDS complement(80810..81661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44450 CDS 82118..83398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44460 CDS 83851..84243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44470 CDS 84323..84592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44480 CDS complement(84607..85362) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085479.1 transl_table 11 codon_start 1 locus_tag LOCUS_44490 CDS 85473..88037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44500 CDS 88176..88628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44510 CDS 88640..89245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44520 CDS complement(89267..90697) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116611749.1 transl_table 11 codon_start 1 locus_tag LOCUS_44530 CDS 90994..91644 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327233.1 transl_table 11 codon_start 1 locus_tag LOCUS_44540 CDS 91661..93436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44550 CDS 93539..94408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44560 CDS complement(94567..96018) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140648.1 transl_table 11 codon_start 1 locus_tag LOCUS_44570 CDS complement(96554..98017) product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968814.1 transl_table 11 codon_start 1 locus_tag LOCUS_44580 CDS complement(98162..99892) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810951.1 transl_table 11 codon_start 1 locus_tag LOCUS_44590 CDS complement(99994..100302) product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568502.1 transl_table 11 codon_start 1 locus_tag LOCUS_44600 CDS complement(100318..101187) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810948.1 transl_table 11 codon_start 1 locus_tag LOCUS_44610 CDS complement(101180..102064) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810946.1 transl_table 11 codon_start 1 locus_tag LOCUS_44620 CDS complement(102061..103146) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810943.1 transl_table 11 codon_start 1 locus_tag LOCUS_44630 CDS complement(103148..104230) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040012.1 transl_table 11 codon_start 1 locus_tag LOCUS_44640 CDS complement(104221..105837) product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526148.1 transl_table 11 codon_start 1 locus_tag LOCUS_44650 gene glpD CDS 105973..106770 product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931049.1 transl_table 11 codon_start 1 locus_tag LOCUS_44660 CDS 106937..107887 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064939.1 transl_table 11 codon_start 1 locus_tag LOCUS_44670 CDS 107946..108764 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085037.1 transl_table 11 codon_start 1 locus_tag LOCUS_44680 CDS complement(108908..109972) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523466.1 transl_table 11 codon_start 1 locus_tag LOCUS_44690 CDS complement(110057..111241) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704591.1 transl_table 11 codon_start 1 locus_tag LOCUS_44700 CDS complement(111288..112703) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762889.1 transl_table 11 codon_start 1 locus_tag LOCUS_44710 CDS 112818..113765 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408081.1 transl_table 11 codon_start 1 locus_tag LOCUS_44720 CDS complement(113814..114584) product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004547148.1 transl_table 11 codon_start 1 locus_tag LOCUS_44730 CDS complement(114592..115635) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840243.1 transl_table 11 codon_start 1 locus_tag LOCUS_44740 CDS complement(115678..116208) product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703350.1 transl_table 11 codon_start 1 locus_tag LOCUS_44750 CDS complement(116226..117203) product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206907.1 transl_table 11 codon_start 1 locus_tag LOCUS_44760 CDS complement(117227..118006) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703348.1 transl_table 11 codon_start 1 locus_tag LOCUS_44770 CDS complement(118003..118479) product aromatic-ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206909.1 transl_table 11 codon_start 1 locus_tag LOCUS_44780 CDS complement(118517..119791) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074154.1 transl_table 11 codon_start 1 locus_tag LOCUS_44790 CDS complement(119824..120372) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206910.1 transl_table 11 codon_start 1 locus_tag LOCUS_44800 CDS complement(120387..120797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387554.1 transl_table 11 codon_start 1 locus_tag LOCUS_44810 CDS complement(120844..122016) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369891.1 transl_table 11 codon_start 1 locus_tag LOCUS_44820 CDS 122415..123566 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200062.1 transl_table 11 codon_start 1 locus_tag LOCUS_44830 CDS 123586..124632 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195812.1 transl_table 11 codon_start 1 locus_tag LOCUS_44840 CDS 124629..126485 product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813865.1 transl_table 11 codon_start 1 locus_tag LOCUS_44850 CDS 126482..127252 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813864.1 transl_table 11 codon_start 1 locus_tag LOCUS_44860 CDS 127370..127888 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206969.1 transl_table 11 codon_start 1 locus_tag LOCUS_44870 CDS 127938..129233 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814774.1 transl_table 11 codon_start 1 locus_tag LOCUS_44880 CDS 129507..130175 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931025.1 transl_table 11 codon_start 1 locus_tag LOCUS_44890 CDS 130180..131313 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931024.1 transl_table 11 codon_start 1 locus_tag LOCUS_44900 CDS 131310..131693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44910 CDS 131756..132934 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064468.1 transl_table 11 codon_start 1 locus_tag LOCUS_44920 CDS complement(132960..133877) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195540.1 transl_table 11 codon_start 1 locus_tag LOCUS_44930 CDS 133991..135337 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557408.1 transl_table 11 codon_start 1 locus_tag LOCUS_44940 CDS complement(135700..136278) product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339294.1 transl_table 11 codon_start 1 locus_tag LOCUS_44950 CDS complement(136334..137317) product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 transl_table 11 codon_start 1 locus_tag LOCUS_44960 CDS complement(137368..138006) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267941.1 transl_table 11 codon_start 1 locus_tag LOCUS_44970 CDS complement(138131..139450) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969972.1 transl_table 11 codon_start 1 locus_tag LOCUS_44980 CDS complement(139483..139851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44990 CDS 139885..140085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45000 CDS complement(140105..140539) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532413.1 transl_table 11 codon_start 1 locus_tag LOCUS_45010 CDS complement(140586..141305) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811176.1 transl_table 11 codon_start 1 locus_tag LOCUS_45020 CDS 141448..142395 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036906.1 transl_table 11 codon_start 1 locus_tag LOCUS_45030 CDS complement(142662..143798) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072305.1 transl_table 11 codon_start 1 locus_tag LOCUS_45040 gene ald CDS complement(143968..144192) product formate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190152.1 transl_table 11 codon_start 1 locus_tag LOCUS_45050 CDS complement(144189..145022) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809308.1 transl_table 11 codon_start 1 locus_tag LOCUS_45060 gene fdhD CDS complement(145025..147892) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527515.1 transl_table 11 codon_start 1 locus_tag LOCUS_45070 gene fdhF CDS complement(147922..149463) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064348.1 transl_table 11 codon_start 1 locus_tag LOCUS_45080 CDS complement(149460..149906) product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064347.1 transl_table 11 codon_start 1 locus_tag LOCUS_45090 CDS 150383..151630 product oxalate/formate MFS antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085934.1 transl_table 11 codon_start 1 locus_tag LOCUS_45100 gene oxlT CDS 151894..153687 product oxalyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085941.1 transl_table 11 codon_start 1 locus_tag LOCUS_45110 gene oxc CDS 153736..154989 product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726706.1 transl_table 11 codon_start 1 locus_tag LOCUS_45120 gene frc CDS 155012..155614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45130 CDS complement(155726..156850) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529079.1 transl_table 11 codon_start 1 locus_tag LOCUS_45140 gene alr CDS complement(156847..158235) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 transl_table 11 codon_start 1 locus_tag LOCUS_45150 CDS complement(158391..159701) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085010.1 transl_table 11 codon_start 1 locus_tag LOCUS_45160 CDS 159962..161497 product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105794.1 transl_table 11 codon_start 1 locus_tag LOCUS_45170 CDS complement(161502..162122) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962190.1 transl_table 11 codon_start 1 locus_tag LOCUS_45180 CDS 162370..162813 product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726705.1 transl_table 11 codon_start 1 locus_tag LOCUS_45190 CDS 162863..164110 product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085940.1 transl_table 11 codon_start 1 locus_tag LOCUS_45200 gene frc CDS 164417..164725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45210 CDS 164745..165575 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941720.1 transl_table 11 codon_start 1 locus_tag LOCUS_45220 gene sucD CDS 165603..166370 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965702.1 transl_table 11 codon_start 1 locus_tag LOCUS_45230 CDS 166409..167431 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257908.1 transl_table 11 codon_start 1 locus_tag LOCUS_45240 CDS 167490..168416 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390154.1 transl_table 11 codon_start 1 locus_tag LOCUS_45250 CDS complement(168417..168596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45260 CDS 168766..169884 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269378.1 transl_table 11 codon_start 1 locus_tag LOCUS_45270 sequence018 source 1..168746 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 773..907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45280 CDS 1036..1545 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391058.1 transl_table 11 codon_start 1 locus_tag LOCUS_45290 CDS complement(1951..2265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45300 CDS complement(2479..2844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45310 CDS complement(2876..5515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45320 CDS complement(5612..6334) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948152.1 transl_table 11 codon_start 1 locus_tag LOCUS_45330 CDS complement(6338..6673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45340 CDS complement(6670..9792) product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 transl_table 11 codon_start 1 locus_tag LOCUS_45350 CDS complement(9808..10986) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942781.1 transl_table 11 codon_start 1 locus_tag LOCUS_45360 CDS complement(10998..12278) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941495.1 transl_table 11 codon_start 1 locus_tag LOCUS_45370 CDS complement(12389..12742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45380 CDS 12931..13395 product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768479.1 transl_table 11 codon_start 1 locus_tag LOCUS_45390 gene cadR CDS complement(13748..14290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45400 CDS complement(14457..14849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45410 CDS complement(14901..18020) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 transl_table 11 codon_start 1 locus_tag LOCUS_45420 CDS complement(18034..19149) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 transl_table 11 codon_start 1 locus_tag LOCUS_45430 CDS complement(19146..19775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45440 CDS complement(19787..21043) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201245837.1 transl_table 11 codon_start 1 locus_tag LOCUS_45450 CDS complement(21171..21530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45460 CDS complement(21597..21935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45470 CDS complement(21990..22292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45480 CDS 22544..22945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45490 CDS complement(23250..23564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45500 CDS 23757..24443 product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815117.1 transl_table 11 codon_start 1 locus_tag LOCUS_45510 CDS 24440..25798 product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266840.1 transl_table 11 codon_start 1 locus_tag LOCUS_45520 CDS complement(25950..26249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45530 CDS 26314..28785 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205309.1 transl_table 11 codon_start 1 locus_tag LOCUS_45540 CDS 28978..29511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45550 CDS complement(29598..31541) product cytochrome c/FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115264.1 transl_table 11 codon_start 1 locus_tag LOCUS_45560 CDS 31638..32087 product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103716.1 transl_table 11 codon_start 1 locus_tag LOCUS_45570 gene cadR CDS complement(32129..32512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45580 CDS complement(32515..33138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45590 CDS complement(33149..36298) product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704244.1 transl_table 11 codon_start 1 locus_tag LOCUS_45600 CDS complement(36295..37974) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936048.1 transl_table 11 codon_start 1 locus_tag LOCUS_45610 CDS complement(37980..39272) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817191.1 transl_table 11 codon_start 1 locus_tag LOCUS_45620 CDS complement(39367..39777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45630 CDS 39901..40299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45640 CDS complement(40332..40757) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816523.1 transl_table 11 codon_start 1 locus_tag LOCUS_45650 gene cueR CDS 40997..41242 product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770077.1 transl_table 11 codon_start 1 locus_tag LOCUS_45660 CDS complement(41265..42527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45670 CDS 42902..43225 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039907.1 transl_table 11 codon_start 1 locus_tag LOCUS_45680 CDS 43251..43760 product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184724.1 transl_table 11 codon_start 1 locus_tag LOCUS_45690 CDS 43772..44275 product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140066.1 transl_table 11 codon_start 1 locus_tag LOCUS_45700 CDS 44356..44859 product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184680.1 transl_table 11 codon_start 1 locus_tag LOCUS_45710 CDS 44879..45952 product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272375.1 transl_table 11 codon_start 1 locus_tag LOCUS_45720 gene arsB CDS 45971..46156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45730 CDS 46216..46497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45740 CDS 47126..47503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45750 CDS 47664..47954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45760 CDS 48157..49908 product DUF3141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946767.1 transl_table 11 codon_start 1 locus_tag LOCUS_45770 CDS 49936..50607 product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966090.1 transl_table 11 codon_start 1 locus_tag LOCUS_45780 CDS 50628..51995 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946756.1 transl_table 11 codon_start 1 locus_tag LOCUS_45790 CDS 52055..52282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45800 CDS 52328..52978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45810 CDS 53049..53393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45820 CDS 53493..55394 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528329.1 transl_table 11 codon_start 1 locus_tag LOCUS_45830 gene ftsH CDS complement(55416..55901) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967571.1 transl_table 11 codon_start 1 locus_tag LOCUS_45840 CDS complement(55903..58164) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921601.1 transl_table 11 codon_start 1 locus_tag LOCUS_45850 CDS complement(58295..58576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45860 CDS complement(58709..59212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45870 CDS complement(59366..59827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45880 CDS complement(59953..60666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45890 CDS complement(61013..61360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45900 CDS complement(61376..61831) product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064916.1 transl_table 11 codon_start 1 locus_tag LOCUS_45910 CDS complement(61862..62440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45920 CDS complement(62482..63885) product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529973.1 transl_table 11 codon_start 1 locus_tag LOCUS_45930 CDS complement(63926..65389) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529972.1 transl_table 11 codon_start 1 locus_tag LOCUS_45940 CDS complement(65386..65706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45950 CDS complement(65843..66214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45960 CDS complement(66420..69368) product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138082.1 transl_table 11 codon_start 1 locus_tag LOCUS_45970 CDS complement(69705..71228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45980 CDS 71547..72524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45990 CDS 72524..74266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46000 CDS 74263..74817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46010 CDS 74826..75758 product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920548.1 transl_table 11 codon_start 1 locus_tag LOCUS_46020 CDS 76380..76727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46030 CDS complement(76882..77805) product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085952.1 transl_table 11 codon_start 1 locus_tag LOCUS_46040 CDS complement(78129..79925) product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527189.1 transl_table 11 codon_start 1 locus_tag LOCUS_46050 gene gcl CDS 80668..80889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46060 CDS complement(81036..81260) product formate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190152.1 transl_table 11 codon_start 1 locus_tag LOCUS_46070 assembly_gap 81492..82406 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(82588..85482) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809310.1 transl_table 11 codon_start 1 locus_tag LOCUS_46080 gene fdhF CDS complement(85494..87053) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064348.1 transl_table 11 codon_start 1 locus_tag LOCUS_46090 CDS complement(87050..87538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46100 CDS 87718..88800 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151633682.1 transl_table 11 codon_start 1 locus_tag LOCUS_46110 CDS 88969..89394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46120 note possible pseudo, internal stop codon CDS 89401..89709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46130 CDS complement(89726..90139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103354.1 transl_table 11 codon_start 1 locus_tag LOCUS_46140 CDS complement(90136..90843) product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010208432.1 transl_table 11 codon_start 1 locus_tag LOCUS_46150 CDS 92028..92999 product plasmid replication initiator TrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942817.1 transl_table 11 codon_start 1 locus_tag LOCUS_46160 gene trfA CDS 93697..93939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46170 CDS 94764..94985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46180 CDS complement(95201..95515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46190 CDS complement(95795..96163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46200 CDS 96262..96522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46210 note possible pseudo, frameshifted CDS complement(96719..97120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46220 CDS 97455..97592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46230 CDS complement(97857..98870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46240 CDS 99050..99559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46250 CDS complement(99675..100334) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556057.1 transl_table 11 codon_start 1 locus_tag LOCUS_46260 CDS complement(100343..101380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46270 CDS 101462..101881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46280 CDS 101920..102267 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389703.1 transl_table 11 codon_start 1 locus_tag LOCUS_46290 CDS complement(102321..102722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46300 CDS complement(103013..103639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46310 CDS 103876..104550 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937491.1 transl_table 11 codon_start 1 locus_tag LOCUS_46320 gene modB CDS 104600..105352 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937488.1 transl_table 11 codon_start 1 locus_tag LOCUS_46330 gene modA CDS 105349..106134 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190506.1 transl_table 11 codon_start 1 locus_tag LOCUS_46340 CDS 106139..106744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46350 CDS complement(107277..110600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46360 CDS complement(110786..111286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46370 assembly_gap 111372..111381 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(112238..112726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46380 CDS 112905..114038 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064346.1 transl_table 11 codon_start 1 locus_tag LOCUS_46390 CDS complement(114063..114938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46400 CDS complement(114952..116262) product MSMEG_0569 family flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891990.1 transl_table 11 codon_start 1 locus_tag LOCUS_46410 CDS complement(116317..116610) product MSMEG_0570 family nitrogen starvation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891991.1 transl_table 11 codon_start 1 locus_tag LOCUS_46420 CDS complement(116621..117832) product MSMEG_0565 family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876802.1 transl_table 11 codon_start 1 locus_tag LOCUS_46430 CDS complement(117829..118857) product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061160.1 transl_table 11 codon_start 1 locus_tag LOCUS_46440 CDS complement(118850..119461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46450 CDS complement(119477..120622) product MSMEG_0568 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876804.1 transl_table 11 codon_start 1 locus_tag LOCUS_46460 CDS complement(120650..121684) product aliphatic nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877947.1 transl_table 11 codon_start 1 locus_tag LOCUS_46470 CDS complement(121698..122180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46480 CDS 122550..123926 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400962.1 transl_table 11 codon_start 1 locus_tag LOCUS_46490 CDS 124342..124815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46500 CDS complement(124965..126245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46510 CDS complement(126583..126846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46520 CDS complement(126996..127748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46530 CDS 127831..128418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46540 CDS 128415..129002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46550 CDS 129153..130292 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525689.1 transl_table 11 codon_start 1 locus_tag LOCUS_46560 CDS complement(130797..131918) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543370.1 transl_table 11 codon_start 1 locus_tag LOCUS_46570 CDS complement(132008..133717) product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206151.1 transl_table 11 codon_start 1 locus_tag LOCUS_46580 CDS 133954..134763 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090568.1 transl_table 11 codon_start 1 locus_tag LOCUS_46590 CDS 134804..136660 product feruloyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267921.1 transl_table 11 codon_start 1 locus_tag LOCUS_46600 CDS 136684..137451 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090570.1 transl_table 11 codon_start 1 locus_tag LOCUS_46610 CDS 137529..138536 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930624.1 transl_table 11 codon_start 1 locus_tag LOCUS_46620 CDS 138640..140361 product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190081.1 transl_table 11 codon_start 1 locus_tag LOCUS_46630 CDS 140408..141265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46640 CDS 141356..143878 product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205538.1 transl_table 11 codon_start 1 locus_tag LOCUS_46650 CDS 143944..144366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46660 CDS 144438..145145 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094039.1 transl_table 11 codon_start 1 locus_tag LOCUS_46670 CDS 145135..146373 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094037.1 transl_table 11 codon_start 1 locus_tag LOCUS_46680 CDS 146434..146826 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095326.1 transl_table 11 codon_start 1 locus_tag LOCUS_46690 CDS 146823..147833 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003116094.1 transl_table 11 codon_start 1 locus_tag LOCUS_46700 CDS 147833..149323 product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095324.1 transl_table 11 codon_start 1 locus_tag LOCUS_46710 CDS 149320..150204 product ChbG/HpnK family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853020.1 transl_table 11 codon_start 1 locus_tag LOCUS_46720 CDS complement(150309..154592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46730 CDS complement(154489..156450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46740 note possible pseudo, frameshifted CDS 156669..157043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46750 CDS 157163..158218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46760 CDS 158215..160917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46770 CDS complement(160919..161416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46780 CDS complement(161470..161994) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810097.1 transl_table 11 codon_start 1 locus_tag LOCUS_46790 CDS 162048..163613 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064158.1 transl_table 11 codon_start 1 locus_tag LOCUS_46800 CDS 163657..165393 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175139359.1 transl_table 11 codon_start 1 locus_tag LOCUS_46810 CDS 165469..166584 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523466.1 transl_table 11 codon_start 1 locus_tag LOCUS_46820 CDS 166617..167609 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015041576.1 transl_table 11 codon_start 1 locus_tag LOCUS_46830 CDS complement(167773..167982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46840 rRNA complement(168204..168309) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence019 source 1..162320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46850 CDS 343..915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46860 CDS complement(1004..2350) product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267555.1 transl_table 11 codon_start 1 locus_tag LOCUS_46870 gene glnT CDS complement(2347..3852) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388051.1 transl_table 11 codon_start 1 locus_tag LOCUS_46880 CDS complement(3876..5273) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707798.1 transl_table 11 codon_start 1 locus_tag LOCUS_46890 CDS complement(5299..6666) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529984.1 transl_table 11 codon_start 1 locus_tag LOCUS_46900 CDS complement(6670..7449) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112938.1 transl_table 11 codon_start 1 locus_tag LOCUS_46910 CDS complement(7446..8774) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530907.1 transl_table 11 codon_start 1 locus_tag LOCUS_46920 CDS complement(8822..9214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46930 CDS 9102..10133 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 transl_table 11 codon_start 1 locus_tag LOCUS_46940 CDS 10140..10991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46950 CDS 11152..12096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46960 CDS 12093..13112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46970 CDS 13103..13672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46980 CDS 13669..14664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46990 CDS 15154..16470 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706620.1 transl_table 11 codon_start 1 locus_tag LOCUS_47000 gene aceA CDS 16687..17622 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521279.1 transl_table 11 codon_start 1 locus_tag LOCUS_47010 CDS 17839..18309 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812977.1 transl_table 11 codon_start 1 locus_tag LOCUS_47020 CDS complement(18394..19203) product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 transl_table 11 codon_start 1 locus_tag LOCUS_47030 CDS complement(19194..19520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47040 CDS complement(19510..20445) product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 transl_table 11 codon_start 1 locus_tag LOCUS_47050 CDS 20507..21508 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191597.1 transl_table 11 codon_start 1 locus_tag LOCUS_47060 gene mltG CDS 21530..22141 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527198.1 transl_table 11 codon_start 1 locus_tag LOCUS_47070 gene tmk CDS 22138..23154 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192693.1 transl_table 11 codon_start 1 locus_tag LOCUS_47080 CDS 23154..23525 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036225.1 transl_table 11 codon_start 1 locus_tag LOCUS_47090 CDS 23571..24356 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192025.1 transl_table 11 codon_start 1 locus_tag LOCUS_47100 CDS 24353..25075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47110 CDS 25310..26329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47120 tRNA complement(26492..26584) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(26647..27885) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191166.1 transl_table 11 codon_start 1 locus_tag LOCUS_47130 CDS complement(27982..29316) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026262905.1 transl_table 11 codon_start 1 locus_tag LOCUS_47140 gene tilS CDS complement(29285..30256) product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193249.1 transl_table 11 codon_start 1 locus_tag LOCUS_47150 CDS complement(30281..30931) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820119.1 transl_table 11 codon_start 1 locus_tag LOCUS_47160 CDS complement(30932..32311) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192752.1 transl_table 11 codon_start 1 locus_tag LOCUS_47170 gene cysS CDS 32439..33008 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191635.1 transl_table 11 codon_start 1 locus_tag LOCUS_47180 CDS 33011..33511 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193779.1 transl_table 11 codon_start 1 locus_tag LOCUS_47190 CDS complement(33769..33957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47200 CDS 34229..35098 product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527169.1 transl_table 11 codon_start 1 locus_tag LOCUS_47210 CDS complement(35103..37409) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196461.1 transl_table 11 codon_start 1 locus_tag LOCUS_47220 gene clpA CDS complement(37406..37756) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194131.1 transl_table 11 codon_start 1 locus_tag LOCUS_47230 gene clpS CDS 37950..38192 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 transl_table 11 codon_start 1 locus_tag LOCUS_47240 CDS 38574..39122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47250 CDS 39134..39874 product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192823.1 transl_table 11 codon_start 1 locus_tag LOCUS_47260 CDS complement(40420..41313) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064436.1 transl_table 11 codon_start 1 locus_tag LOCUS_47270 CDS complement(41504..42118) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976134.1 transl_table 11 codon_start 1 locus_tag LOCUS_47280 CDS complement(42195..42653) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930412.1 transl_table 11 codon_start 1 locus_tag LOCUS_47290 CDS complement(42653..44200) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029259.1 transl_table 11 codon_start 1 locus_tag LOCUS_47300 CDS complement(44197..44976) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389695.1 transl_table 11 codon_start 1 locus_tag LOCUS_47310 CDS complement(44993..46231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47320 CDS complement(46512..47951) product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083901.1 transl_table 11 codon_start 1 locus_tag LOCUS_47330 gene boxB CDS complement(47984..49651) product 2,3-epoxybenzoyl-CoA dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921378.1 transl_table 11 codon_start 1 locus_tag LOCUS_47340 gene boxC CDS complement(49812..50729) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083896.1 transl_table 11 codon_start 1 locus_tag LOCUS_47350 CDS 50872..51375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47360 CDS 51456..53024 product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 transl_table 11 codon_start 1 locus_tag LOCUS_47370 CDS 53021..53839 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812222.1 transl_table 11 codon_start 1 locus_tag LOCUS_47380 CDS 53836..55002 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966696.1 transl_table 11 codon_start 1 locus_tag LOCUS_47390 CDS 55082..55963 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 transl_table 11 codon_start 1 locus_tag LOCUS_47400 CDS 55976..56998 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040564.1 transl_table 11 codon_start 1 locus_tag LOCUS_47410 CDS 56995..57783 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 transl_table 11 codon_start 1 locus_tag LOCUS_47420 CDS 57783..58514 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 transl_table 11 codon_start 1 locus_tag LOCUS_47430 CDS complement(58516..59019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47440 CDS complement(59000..60211) product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536056.1 transl_table 11 codon_start 1 locus_tag LOCUS_47450 CDS complement(60226..62385) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963893.1 transl_table 11 codon_start 1 locus_tag LOCUS_47460 CDS complement(62401..63027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47470 CDS complement(63068..64144) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 transl_table 11 codon_start 1 locus_tag LOCUS_47480 CDS complement(64163..64564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47490 CDS 64776..66719 product TAT-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205031.1 transl_table 11 codon_start 1 locus_tag LOCUS_47500 gene nosZ CDS 66790..68973 product NosR/NirI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536481.1 transl_table 11 codon_start 1 locus_tag LOCUS_47510 CDS 68970..69407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47520 CDS 69410..70681 product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550379.1 transl_table 11 codon_start 1 locus_tag LOCUS_47530 CDS 70653..71657 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539779.1 transl_table 11 codon_start 1 locus_tag LOCUS_47540 CDS 71671..72492 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192012.1 transl_table 11 codon_start 1 locus_tag LOCUS_47550 CDS 72489..73010 product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192269.1 transl_table 11 codon_start 1 locus_tag LOCUS_47560 CDS 73119..74738 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086113.1 transl_table 11 codon_start 1 locus_tag LOCUS_47570 CDS complement(74773..75033) product cytochrome C oxidase subunit IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113239.1 transl_table 11 codon_start 1 locus_tag LOCUS_47580 CDS complement(75030..75656) product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085996.1 transl_table 11 codon_start 1 locus_tag LOCUS_47590 CDS complement(75706..76173) product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 transl_table 11 codon_start 1 locus_tag LOCUS_47600 gene nsrR CDS complement(76397..76684) product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312329.1 transl_table 11 codon_start 1 locus_tag LOCUS_47610 CDS 76884..77360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47620 CDS complement(77457..78806) product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089820.1 transl_table 11 codon_start 1 locus_tag LOCUS_47630 CDS 78940..80115 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405859.1 transl_table 11 codon_start 1 locus_tag LOCUS_47640 CDS 80327..81130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47650 CDS complement(81218..82309) product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010438666.1 transl_table 11 codon_start 1 locus_tag LOCUS_47660 gene hppD CDS complement(82327..83580) product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 transl_table 11 codon_start 1 locus_tag LOCUS_47670 CDS complement(83596..84390) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195287.1 transl_table 11 codon_start 1 locus_tag LOCUS_47680 CDS complement(84390..85331) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810324.1 transl_table 11 codon_start 1 locus_tag LOCUS_47690 CDS complement(85428..86411) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039423.1 transl_table 11 codon_start 1 locus_tag LOCUS_47700 CDS 86556..87059 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266690.1 transl_table 11 codon_start 1 locus_tag LOCUS_47710 CDS complement(87082..93261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47720 CDS complement(93283..94122) product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941377.1 transl_table 11 codon_start 1 locus_tag LOCUS_47730 tRNA complement(94261..94337) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(94614..94690) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(94723..95184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47740 CDS complement(95281..95643) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197408.1 transl_table 11 codon_start 1 locus_tag LOCUS_47750 CDS complement(95661..98084) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193113.1 transl_table 11 codon_start 1 locus_tag LOCUS_47760 gene pheT CDS complement(98100..99143) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926359.1 transl_table 11 codon_start 1 locus_tag LOCUS_47770 gene pheS CDS complement(99283..99639) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225461.1 transl_table 11 codon_start 1 locus_tag LOCUS_47780 gene rplT CDS complement(99665..99868) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191477.1 transl_table 11 codon_start 1 locus_tag LOCUS_47790 gene rpmI CDS complement(100039..100521) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446215.1 transl_table 11 codon_start 1 locus_tag LOCUS_47800 gene infC CDS complement(100653..102572) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812608.1 transl_table 11 codon_start 1 locus_tag LOCUS_47810 gene thrS CDS complement(102774..103244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47820 CDS complement(103393..103971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47830 CDS complement(104116..106440) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192485.1 transl_table 11 codon_start 1 locus_tag LOCUS_47840 CDS 107193..109301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47850 CDS complement(109398..110717) product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202907611.1 transl_table 11 codon_start 1 locus_tag LOCUS_47860 CDS complement(110763..112409) product DNA alkylation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027581.1 transl_table 11 codon_start 1 locus_tag LOCUS_47870 CDS complement(112452..112967) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193935.1 transl_table 11 codon_start 1 locus_tag LOCUS_47880 CDS complement(113024..114673) product 3-(methylthio)propionyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 transl_table 11 codon_start 1 locus_tag LOCUS_47890 CDS 114985..115431 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813871.1 transl_table 11 codon_start 1 locus_tag LOCUS_47900 gene msrB CDS 115428..116081 product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192037.1 transl_table 11 codon_start 1 locus_tag LOCUS_47910 CDS 116086..116355 product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199503.1 transl_table 11 codon_start 1 locus_tag LOCUS_47920 CDS 116415..117230 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191958.1 transl_table 11 codon_start 1 locus_tag LOCUS_47930 CDS 117452..117589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47940 CDS complement(117611..118282) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 transl_table 11 codon_start 1 locus_tag LOCUS_47950 CDS 118266..118952 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447512.1 transl_table 11 codon_start 1 locus_tag LOCUS_47960 CDS complement(118986..121433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536019.1 transl_table 11 codon_start 1 locus_tag LOCUS_47970 CDS complement(121651..122025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47980 CDS complement(122172..122567) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049863.1 transl_table 11 codon_start 1 locus_tag LOCUS_47990 CDS complement(122612..123151) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814412.1 transl_table 11 codon_start 1 locus_tag LOCUS_48000 gene def CDS complement(123151..123393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48010 assembly_gap 123445..124054 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 124129..125277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48020 CDS 125511..125864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48030 CDS complement(126071..126958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48040 CDS complement(127154..127495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48050 CDS 127427..128692 product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 transl_table 11 codon_start 1 locus_tag LOCUS_48060 CDS complement(128873..130180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48070 CDS complement(130177..131145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48080 CDS complement(131160..131864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48090 CDS complement(131922..132086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48100 CDS complement(132079..132300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48110 CDS complement(132297..132677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48120 CDS complement(132678..133013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48130 CDS 133261..133710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48140 CDS 133760..134779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48150 CDS 134943..135254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48160 CDS 135438..135812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48170 CDS 136032..136340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48180 note possible pseudo, internal stop codon CDS 136499..136702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48190 CDS 136804..137616 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175245.1 transl_table 11 codon_start 1 locus_tag LOCUS_48200 CDS complement(137902..140256) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951014.1 transl_table 11 codon_start 1 locus_tag LOCUS_48210 gene ligA CDS 140594..140737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48220 CDS 140749..141072 product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103139.1 transl_table 11 codon_start 1 locus_tag LOCUS_48230 CDS 141328..141726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48240 CDS complement(141854..142183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48250 CDS 142610..142936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48260 CDS complement(143060..144058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48270 CDS complement(144624..145856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48280 CDS 146168..146821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48290 CDS complement(146987..147976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48300 CDS complement(147973..148506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48310 CDS complement(148802..149782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48320 CDS complement(149782..150603) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582622.1 transl_table 11 codon_start 1 locus_tag LOCUS_48330 CDS complement(150600..150767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48340 CDS complement(150788..151852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48350 CDS complement(152135..152695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48360 CDS 152925..153461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48370 CDS 153463..153951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48380 CDS 153948..154259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48390 CDS 154266..154595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48400 CDS 154579..157038 product VirB4 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528660.1 transl_table 11 codon_start 1 locus_tag LOCUS_48410 CDS 157039..157266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48420 CDS 157415..157819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48430 CDS 157832..158845 product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845459.1 transl_table 11 codon_start 1 locus_tag LOCUS_48440 CDS 158866..159585 product P-type DNA transfer protein VirB5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103177.1 transl_table 11 codon_start 1 locus_tag LOCUS_48450 gene virB5 CDS 159603..160292 product virB8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974428.1 transl_table 11 codon_start 1 locus_tag LOCUS_48460 CDS 160292..161128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48470 sequence020 source 1..159758 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(167..904) product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193701.1 transl_table 11 codon_start 1 locus_tag LOCUS_48480 CDS complement(991..1533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48490 assembly_gap 1545..1554 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1794..2987) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189839.1 transl_table 11 codon_start 1 locus_tag LOCUS_48500 CDS complement(3050..3379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48510 CDS complement(3376..4104) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931455.1 transl_table 11 codon_start 1 locus_tag LOCUS_48520 CDS complement(4136..4579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48530 CDS complement(4605..5447) product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189409.1 transl_table 11 codon_start 1 locus_tag LOCUS_48540 gene htpX CDS complement(5550..6548) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064701.1 transl_table 11 codon_start 1 locus_tag LOCUS_48550 gene fmt CDS complement(6545..7060) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807300.1 transl_table 11 codon_start 1 locus_tag LOCUS_48560 gene def CDS 7286..8485 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064703.1 transl_table 11 codon_start 1 locus_tag LOCUS_48570 gene dprA CDS 8562..9014 product DUF494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815964.1 transl_table 11 codon_start 1 locus_tag LOCUS_48580 CDS complement(9116..10141) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522118.1 transl_table 11 codon_start 1 locus_tag LOCUS_48590 gene secF CDS complement(10168..12048) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064324.1 transl_table 11 codon_start 1 locus_tag LOCUS_48600 gene secD CDS complement(12115..12438) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 transl_table 11 codon_start 1 locus_tag LOCUS_48610 gene yajC tRNA complement(12660..12736) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(12905..13306) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224774.1 transl_table 11 codon_start 1 locus_tag LOCUS_48620 gene rplQ CDS complement(13430..14416) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197925.1 transl_table 11 codon_start 1 locus_tag LOCUS_48630 gene rpoA CDS complement(14575..15198) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197926.1 transl_table 11 codon_start 1 locus_tag LOCUS_48640 gene rpsD CDS complement(15398..15802) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197937.1 transl_table 11 codon_start 1 locus_tag LOCUS_48650 gene rpsK CDS complement(15833..16198) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197938.1 transl_table 11 codon_start 1 locus_tag LOCUS_48660 gene rpsM CDS complement(16377..16595) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521905.1 transl_table 11 codon_start 1 locus_tag LOCUS_48670 gene infA CDS complement(16603..17913) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197940.1 transl_table 11 codon_start 1 locus_tag LOCUS_48680 gene secY CDS complement(17926..18366) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064755.1 transl_table 11 codon_start 1 locus_tag LOCUS_48690 gene rplO CDS complement(18400..18582) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202755.1 transl_table 11 codon_start 1 locus_tag LOCUS_48700 gene rpmD CDS complement(18602..19060) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806923.1 transl_table 11 codon_start 1 locus_tag LOCUS_48710 gene rpsE CDS complement(19133..19501) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064756.1 transl_table 11 codon_start 1 locus_tag LOCUS_48720 gene rplR CDS complement(19513..20046) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064757.1 transl_table 11 codon_start 1 locus_tag LOCUS_48730 gene rplF CDS complement(20060..20455) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185153.1 transl_table 11 codon_start 1 locus_tag LOCUS_48740 gene rpsH CDS complement(20480..20785) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197948.1 transl_table 11 codon_start 1 locus_tag LOCUS_48750 gene rpsN CDS complement(20794..21348) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806918.1 transl_table 11 codon_start 1 locus_tag LOCUS_48760 gene rplE CDS complement(21361..21678) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806917.1 transl_table 11 codon_start 1 locus_tag LOCUS_48770 gene rplX CDS complement(21701..22060) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197951.1 transl_table 11 codon_start 1 locus_tag LOCUS_48780 gene rplN CDS complement(22342..22860) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064337.1 transl_table 11 codon_start 1 locus_tag LOCUS_48790 CDS complement(22953..23240) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690077.1 transl_table 11 codon_start 1 locus_tag LOCUS_48800 gene rpsQ CDS complement(23237..23437) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806912.1 transl_table 11 codon_start 1 locus_tag LOCUS_48810 gene rpmC CDS complement(23452..23868) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806911.1 transl_table 11 codon_start 1 locus_tag LOCUS_48820 gene rplP CDS complement(23881..24702) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185240.1 transl_table 11 codon_start 1 locus_tag LOCUS_48830 gene rpsC CDS complement(24719..25048) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925688.1 transl_table 11 codon_start 1 locus_tag LOCUS_48840 gene rplV CDS complement(25061..25336) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806908.1 transl_table 11 codon_start 1 locus_tag LOCUS_48850 gene rpsS CDS complement(25352..26176) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806907.1 transl_table 11 codon_start 1 locus_tag LOCUS_48860 gene rplB CDS complement(26176..26490) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806906.1 transl_table 11 codon_start 1 locus_tag LOCUS_48870 gene rplW CDS complement(26487..27107) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199276.1 transl_table 11 codon_start 1 locus_tag LOCUS_48880 gene rplD CDS complement(27107..27778) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521904.1 transl_table 11 codon_start 1 locus_tag LOCUS_48890 gene rplC CDS complement(27989..28300) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199280.1 transl_table 11 codon_start 1 locus_tag LOCUS_48900 gene rpsJ CDS complement(28392..29582) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198356.1 transl_table 11 codon_start 1 locus_tag LOCUS_48910 gene tuf tRNA complement(29622..29696) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(29757..29830) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(29944..30029) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(30254..30979) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038721.1 transl_table 11 codon_start 1 locus_tag LOCUS_48920 CDS complement(31130..31918) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522001.1 transl_table 11 codon_start 1 locus_tag LOCUS_48930 gene trpC CDS complement(31915..32955) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186823.1 transl_table 11 codon_start 1 locus_tag LOCUS_48940 gene trpD CDS complement(32979..34046) product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040210.1 transl_table 11 codon_start 1 locus_tag LOCUS_48950 gene ltaE CDS complement(34043..34636) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186792.1 transl_table 11 codon_start 1 locus_tag LOCUS_48960 CDS complement(34648..36123) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186866.1 transl_table 11 codon_start 1 locus_tag LOCUS_48970 gene trpE CDS complement(36411..37085) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531889.1 transl_table 11 codon_start 1 locus_tag LOCUS_48980 CDS complement(37272..38690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48990 CDS complement(38758..39180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49000 CDS complement(39282..40862) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704414.1 transl_table 11 codon_start 1 locus_tag LOCUS_49010 gene thiE CDS complement(40868..41695) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957509.1 transl_table 11 codon_start 1 locus_tag LOCUS_49020 CDS complement(41727..41942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49030 CDS complement(41939..43000) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199940.1 transl_table 11 codon_start 1 locus_tag LOCUS_49040 CDS complement(43004..44869) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038764.1 transl_table 11 codon_start 1 locus_tag LOCUS_49050 gene thiC CDS complement(45131..45811) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522003.1 transl_table 11 codon_start 1 locus_tag LOCUS_49060 gene rpe CDS 45984..47363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49070 CDS 47360..49333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49080 CDS 49503..52013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49090 CDS 52057..52425 product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186878.1 transl_table 11 codon_start 1 locus_tag LOCUS_49100 gene apaG CDS 52475..54526 product site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194398.1 transl_table 11 codon_start 1 locus_tag LOCUS_49110 CDS complement(54611..54790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49120 CDS 54814..55527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49130 CDS 55565..56755 product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 transl_table 11 codon_start 1 locus_tag LOCUS_49140 CDS 56888..58843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49150 CDS 58847..59458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49160 CDS 59462..61459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49170 CDS complement(61475..62545) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092092.1 transl_table 11 codon_start 1 locus_tag LOCUS_49180 CDS 62686..64314 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099178.1 transl_table 11 codon_start 1 locus_tag LOCUS_49190 CDS complement(64357..65403) product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 transl_table 11 codon_start 1 locus_tag LOCUS_49200 CDS complement(65556..66191) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632821.1 transl_table 11 codon_start 1 locus_tag LOCUS_49210 CDS complement(66188..66895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49220 CDS complement(66892..67065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49230 CDS complement(67093..67731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49240 CDS 67868..71431 product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523124.1 transl_table 11 codon_start 1 locus_tag LOCUS_49250 CDS complement(71498..72106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49260 CDS complement(72163..72831) product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770558.1 transl_table 11 codon_start 1 locus_tag LOCUS_49270 CDS 73137..73679 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 transl_table 11 codon_start 1 locus_tag LOCUS_49280 CDS 73743..74369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49290 note possible pseudo, internal stop codon CDS 74495..75070 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691360.1 transl_table 11 codon_start 1 locus_tag LOCUS_49300 CDS complement(75513..77384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49310 CDS complement(77381..78019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49320 CDS complement(78022..79989) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403633.1 transl_table 11 codon_start 1 locus_tag LOCUS_49330 CDS complement(80115..82163) product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815333.1 transl_table 11 codon_start 1 locus_tag LOCUS_49340 CDS 82397..83338 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721044.1 transl_table 11 codon_start 1 locus_tag LOCUS_49350 CDS 84983..87547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49360 CDS complement(87795..88991) product IS4-like element ISRm16 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537933.1 transl_table 11 codon_start 1 locus_tag LOCUS_49370 CDS complement(89212..91371) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195838.1 transl_table 11 codon_start 1 locus_tag LOCUS_49380 CDS complement(91622..92719) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524502.1 transl_table 11 codon_start 1 locus_tag LOCUS_49390 gene hemE CDS 92810..93478 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550955.1 transl_table 11 codon_start 1 locus_tag LOCUS_49400 CDS 93486..94490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49410 CDS 94490..94996 product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090000.1 transl_table 11 codon_start 1 locus_tag LOCUS_49420 CDS 95194..95997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972674.1 transl_table 11 codon_start 1 locus_tag LOCUS_49430 CDS complement(96018..97937) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 transl_table 11 codon_start 1 locus_tag LOCUS_49440 CDS complement(98091..98678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49450 CDS complement(99118..99534) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 transl_table 11 codon_start 1 locus_tag LOCUS_49460 CDS complement(99618..101021) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185243.1 transl_table 11 codon_start 1 locus_tag LOCUS_49470 gene atpD CDS complement(101050..101928) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195831.1 transl_table 11 codon_start 1 locus_tag LOCUS_49480 gene atpG CDS complement(101966..103519) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524507.1 transl_table 11 codon_start 1 locus_tag LOCUS_49490 gene atpA CDS complement(103620..104153) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195829.1 transl_table 11 codon_start 1 locus_tag LOCUS_49500 CDS complement(104156..104626) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185283.1 transl_table 11 codon_start 1 locus_tag LOCUS_49510 CDS complement(104682..104930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49520 CDS complement(104989..105873) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214802.1 transl_table 11 codon_start 1 locus_tag LOCUS_49530 gene atpB CDS complement(105875..106381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49540 CDS 106570..108768 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265516.1 transl_table 11 codon_start 1 locus_tag LOCUS_49550 CDS complement(108823..109722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49560 CDS complement(109784..110629) product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532966.1 transl_table 11 codon_start 1 locus_tag LOCUS_49570 CDS complement(110695..111501) product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205448.1 transl_table 11 codon_start 1 locus_tag LOCUS_49580 gene hpaI CDS complement(111608..112114) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258478.1 transl_table 11 codon_start 1 locus_tag LOCUS_49590 CDS complement(112118..112306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49600 CDS 112344..113066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49610 CDS complement(113077..114957) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550744.1 transl_table 11 codon_start 1 locus_tag LOCUS_49620 CDS complement(114995..115948) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198015.1 transl_table 11 codon_start 1 locus_tag LOCUS_49630 gene gshB CDS complement(115960..117126) product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039217.1 transl_table 11 codon_start 1 locus_tag LOCUS_49640 CDS complement(117137..119017) product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191791.1 transl_table 11 codon_start 1 locus_tag LOCUS_49650 CDS complement(119106..120401) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522914.1 transl_table 11 codon_start 1 locus_tag LOCUS_49660 gene gshA CDS complement(120677..122143) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707418.1 transl_table 11 codon_start 1 locus_tag LOCUS_49670 gene amt CDS complement(122178..122516) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 transl_table 11 codon_start 1 locus_tag LOCUS_49680 CDS complement(122529..123278) product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811028.1 transl_table 11 codon_start 1 locus_tag LOCUS_49690 CDS 123501..125024 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550927.1 transl_table 11 codon_start 1 locus_tag LOCUS_49700 CDS complement(125102..125866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49710 CDS complement(126034..128757) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197743.1 transl_table 11 codon_start 1 locus_tag LOCUS_49720 gene metH CDS complement(128866..129918) product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204527.1 transl_table 11 codon_start 1 locus_tag LOCUS_49730 CDS complement(130186..131319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49740 CDS complement(131483..133798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49750 CDS complement(133977..134243) product DUF3567 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189087.1 transl_table 11 codon_start 1 locus_tag LOCUS_49760 CDS complement(134319..135476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49770 CDS 135506..136450 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536264.1 transl_table 11 codon_start 1 locus_tag LOCUS_49780 CDS 136461..136946 product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113919.1 transl_table 11 codon_start 1 locus_tag LOCUS_49790 CDS 137041..137697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49800 CDS 137858..139054 product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 transl_table 11 codon_start 1 locus_tag LOCUS_49810 CDS 139150..140037 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114511.1 transl_table 11 codon_start 1 locus_tag LOCUS_49820 CDS 140228..141889 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090268.1 transl_table 11 codon_start 1 locus_tag LOCUS_49830 CDS 141976..143472 product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194074.1 transl_table 11 codon_start 1 locus_tag LOCUS_49840 CDS 143474..144604 product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 transl_table 11 codon_start 1 locus_tag LOCUS_49850 gene glcE CDS 144714..145976 product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522135.1 transl_table 11 codon_start 1 locus_tag LOCUS_49860 gene glcF CDS complement(146025..146441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49870 CDS complement(146528..147481) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623287.1 transl_table 11 codon_start 1 locus_tag LOCUS_49880 CDS complement(147558..148187) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507867.1 transl_table 11 codon_start 1 locus_tag LOCUS_49890 CDS 148256..148924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49900 CDS 149101..150591 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 transl_table 11 codon_start 1 locus_tag LOCUS_49910 gene glpK CDS 150732..151400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49920 CDS complement(151390..152268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49930 CDS complement(152275..152805) product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815996.1 transl_table 11 codon_start 1 locus_tag LOCUS_49940 CDS 153237..153947 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263566.1 transl_table 11 codon_start 1 locus_tag LOCUS_49950 CDS 153944..155161 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517213.1 transl_table 11 codon_start 1 locus_tag LOCUS_49960 CDS 155154..155921 product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475395.1 transl_table 11 codon_start 1 locus_tag LOCUS_49970 CDS 155924..157210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49980 CDS 157291..158442 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184777.1 transl_table 11 codon_start 1 locus_tag LOCUS_49990 CDS 158432..159286 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038759.1 transl_table 11 codon_start 1 locus_tag LOCUS_50000 CDS complement(159313..159633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50010 sequence021 source 1..158848 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(554..644) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(742..2037) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186129.1 transl_table 11 codon_start 1 locus_tag LOCUS_50020 gene serS CDS complement(2164..3126) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186453.1 transl_table 11 codon_start 1 locus_tag LOCUS_50030 gene ispH CDS complement(3126..3569) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186190.1 transl_table 11 codon_start 1 locus_tag LOCUS_50040 CDS 3642..4316 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482037.1 transl_table 11 codon_start 1 locus_tag LOCUS_50050 gene radC CDS 4403..5071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50060 CDS complement(5087..5482) product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526443.1 transl_table 11 codon_start 1 locus_tag LOCUS_50070 CDS complement(5521..5718) product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770077.1 transl_table 11 codon_start 1 locus_tag LOCUS_50080 CDS complement(5822..6490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50090 CDS 6558..7472 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526405.1 transl_table 11 codon_start 1 locus_tag LOCUS_50100 CDS complement(7512..8690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50110 CDS 8814..9398 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967669.1 transl_table 11 codon_start 1 locus_tag LOCUS_50120 CDS 9412..11367 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074150.1 transl_table 11 codon_start 1 locus_tag LOCUS_50130 CDS 11445..12611 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186167.1 transl_table 11 codon_start 1 locus_tag LOCUS_50140 CDS 12656..14494 product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204930.1 transl_table 11 codon_start 1 locus_tag LOCUS_50150 CDS 14491..18624 product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204931.1 transl_table 11 codon_start 1 locus_tag LOCUS_50160 tRNA 18692..18766 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 18877..20109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50170 CDS 20291..21724 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543824.1 transl_table 11 codon_start 1 locus_tag LOCUS_50180 CDS 21784..22575 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807436.1 transl_table 11 codon_start 1 locus_tag LOCUS_50190 gene moeB CDS 22601..23503 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139985.1 transl_table 11 codon_start 1 locus_tag LOCUS_50200 CDS 23572..24495 product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808362.1 transl_table 11 codon_start 1 locus_tag LOCUS_50210 gene rocF CDS complement(24569..26257) product sodium-dependent inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096931.1 transl_table 11 codon_start 1 locus_tag LOCUS_50220 CDS complement(26531..29287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50230 CDS 29942..30088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50240 CDS 30225..30647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50250 CDS complement(30804..33263) product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104887.1 transl_table 11 codon_start 1 locus_tag LOCUS_50260 CDS 33399..34073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173306.1 transl_table 11 codon_start 1 locus_tag LOCUS_50270 CDS complement(34024..35247) product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 transl_table 11 codon_start 1 locus_tag LOCUS_50280 CDS complement(35277..37082) product LodA/GoxA family CTQ-dependent oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918443.1 transl_table 11 codon_start 1 locus_tag LOCUS_50290 CDS complement(37174..38400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50300 CDS complement(38632..38832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50310 CDS complement(38971..41097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50320 CDS complement(41217..42038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50330 CDS complement(42055..43008) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931529.1 transl_table 11 codon_start 1 locus_tag LOCUS_50340 CDS complement(43062..44030) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813988.1 transl_table 11 codon_start 1 locus_tag LOCUS_50350 CDS complement(44164..45135) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105417854.1 transl_table 11 codon_start 1 locus_tag LOCUS_50360 CDS complement(45132..46394) product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811299.1 transl_table 11 codon_start 1 locus_tag LOCUS_50370 CDS complement(46433..47719) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114300.1 transl_table 11 codon_start 1 locus_tag LOCUS_50380 CDS 47734..47955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50390 CDS complement(48022..48924) product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765839.1 transl_table 11 codon_start 1 locus_tag LOCUS_50400 gene glxR CDS complement(48968..49762) product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 transl_table 11 codon_start 1 locus_tag LOCUS_50410 CDS complement(49867..51198) product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268234.1 transl_table 11 codon_start 1 locus_tag LOCUS_50420 gene gudD CDS complement(51279..52253) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039572.1 transl_table 11 codon_start 1 locus_tag LOCUS_50430 CDS complement(52525..53064) product DUF3455 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088492.1 transl_table 11 codon_start 1 locus_tag LOCUS_50440 CDS 53500..55305 product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640391.1 transl_table 11 codon_start 1 locus_tag LOCUS_50450 CDS complement(55404..56012) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473863.1 transl_table 11 codon_start 1 locus_tag LOCUS_50460 CDS 56393..57112 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969661.1 transl_table 11 codon_start 1 locus_tag LOCUS_50470 CDS complement(57308..58066) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400058.1 transl_table 11 codon_start 1 locus_tag LOCUS_50480 CDS 58165..58995 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103399.1 transl_table 11 codon_start 1 locus_tag LOCUS_50490 CDS 59009..59914 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103398.1 transl_table 11 codon_start 1 locus_tag LOCUS_50500 CDS 59959..60924 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088799.1 transl_table 11 codon_start 1 locus_tag LOCUS_50510 CDS 61016..61615 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088798.1 transl_table 11 codon_start 1 locus_tag LOCUS_50520 CDS 61606..62895 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088797.1 transl_table 11 codon_start 1 locus_tag LOCUS_50530 CDS 63022..63615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50540 CDS 63799..66399 product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223614.1 transl_table 11 codon_start 1 locus_tag LOCUS_50550 CDS 66695..68266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50560 note possible pseudo, frameshifted CDS complement(68288..70420) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113651.1 transl_table 11 codon_start 1 locus_tag LOCUS_50570 gene glgX CDS 70711..72159 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140648.1 transl_table 11 codon_start 1 locus_tag LOCUS_50580 CDS 72277..73758 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143420.1 transl_table 11 codon_start 1 locus_tag LOCUS_50590 CDS 73882..75360 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140648.1 transl_table 11 codon_start 1 locus_tag LOCUS_50600 CDS complement(75376..76449) product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037017.1 transl_table 11 codon_start 1 locus_tag LOCUS_50610 CDS complement(76562..77854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50620 CDS 78073..78282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50630 CDS complement(78364..79059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50640 CDS complement(79759..81123) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268730.1 transl_table 11 codon_start 1 locus_tag LOCUS_50650 CDS complement(81120..83045) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204799.1 transl_table 11 codon_start 1 locus_tag LOCUS_50660 CDS complement(83218..83952) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082761.1 transl_table 11 codon_start 1 locus_tag LOCUS_50670 CDS complement(83965..84630) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389842.1 transl_table 11 codon_start 1 locus_tag LOCUS_50680 CDS complement(84630..85373) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389841.1 transl_table 11 codon_start 1 locus_tag LOCUS_50690 CDS complement(85663..86733) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104093.1 transl_table 11 codon_start 1 locus_tag LOCUS_50700 CDS complement(86872..87777) product glutamate/aspartate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531996.1 transl_table 11 codon_start 1 locus_tag LOCUS_50710 CDS 88069..88878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50720 CDS complement(89058..91604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50730 CDS 91858..93339 product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552132.1 transl_table 11 codon_start 1 locus_tag LOCUS_50740 CDS complement(93391..94167) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529934.1 transl_table 11 codon_start 1 locus_tag LOCUS_50750 CDS 94339..95181 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194057.1 transl_table 11 codon_start 1 locus_tag LOCUS_50760 CDS 95166..96173 product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194214.1 transl_table 11 codon_start 1 locus_tag LOCUS_50770 CDS 96190..96846 product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267366.1 transl_table 11 codon_start 1 locus_tag LOCUS_50780 CDS 96961..97923 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589805.1 transl_table 11 codon_start 1 locus_tag LOCUS_50790 CDS complement(98050..98985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50800 CDS complement(99113..100309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50810 CDS complement(100338..101063) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244755.1 transl_table 11 codon_start 1 locus_tag LOCUS_50820 CDS 101307..102284 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148287.1 transl_table 11 codon_start 1 locus_tag LOCUS_50830 CDS complement(102288..104339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50840 CDS complement(104332..105750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50850 CDS complement(105980..106891) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813145.1 transl_table 11 codon_start 1 locus_tag LOCUS_50860 CDS complement(106995..108815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50870 CDS 109007..109600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50880 CDS complement(109623..110300) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256674.1 transl_table 11 codon_start 1 locus_tag LOCUS_50890 CDS complement(110318..111904) product glucan biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925635.1 transl_table 11 codon_start 1 locus_tag LOCUS_50900 CDS complement(111991..113412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50910 CDS complement(113883..115166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50920 CDS complement(115734..115985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50930 CDS 116193..116516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50940 CDS 116680..117057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50950 CDS complement(117127..117600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50960 CDS 117782..118030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50970 CDS complement(118215..119246) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402990.1 transl_table 11 codon_start 1 locus_tag LOCUS_50980 CDS complement(119416..121287) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383165.1 transl_table 11 codon_start 1 locus_tag LOCUS_50990 CDS complement(121305..123119) product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186431.1 transl_table 11 codon_start 1 locus_tag LOCUS_51000 gene msbA CDS complement(123088..123897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51010 CDS complement(123884..124666) product glycosyltransferase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092770985.1 transl_table 11 codon_start 1 locus_tag LOCUS_51020 CDS 124953..125894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51030 CDS complement(125917..127032) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043922219.1 transl_table 11 codon_start 1 locus_tag LOCUS_51040 CDS 129049..129417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51050 CDS 129839..130183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51060 CDS complement(130313..131326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51070 CDS complement(131323..132525) product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035215636.1 transl_table 11 codon_start 1 locus_tag LOCUS_51080 gene repA CDS complement(132592..133863) product replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194484.1 transl_table 11 codon_start 1 locus_tag LOCUS_51090 CDS 134946..135443 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731391.1 transl_table 11 codon_start 1 locus_tag LOCUS_51100 CDS 135458..136129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51110 CDS complement(136175..137119) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815222.1 transl_table 11 codon_start 1 locus_tag LOCUS_51120 CDS 137209..138294 product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815224.1 transl_table 11 codon_start 1 locus_tag LOCUS_51130 CDS complement(138407..140512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51140 CDS complement(140509..141345) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975248.1 transl_table 11 codon_start 1 locus_tag LOCUS_51150 CDS 141539..142111 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258478.1 transl_table 11 codon_start 1 locus_tag LOCUS_51160 CDS 142133..143182 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 transl_table 11 codon_start 1 locus_tag LOCUS_51170 CDS 143179..144960 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812261.1 transl_table 11 codon_start 1 locus_tag LOCUS_51180 CDS 144957..146087 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812264.1 transl_table 11 codon_start 1 locus_tag LOCUS_51190 CDS 146098..147219 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812266.1 transl_table 11 codon_start 1 locus_tag LOCUS_51200 CDS 147255..148739 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063680.1 transl_table 11 codon_start 1 locus_tag LOCUS_51210 CDS complement(148775..149314) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388009.1 transl_table 11 codon_start 1 locus_tag LOCUS_51220 CDS complement(149382..150521) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036379.1 transl_table 11 codon_start 1 locus_tag LOCUS_51230 CDS complement(150518..151111) product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036380.1 transl_table 11 codon_start 1 locus_tag LOCUS_51240 CDS complement(151108..151971) product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036381.1 transl_table 11 codon_start 1 locus_tag LOCUS_51250 CDS complement(151968..155165) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036382.1 transl_table 11 codon_start 1 locus_tag LOCUS_51260 CDS complement(155215..156510) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195471.1 transl_table 11 codon_start 1 locus_tag LOCUS_51270 CDS 156526..157485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51280 CDS 157678..158190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51290 misc_feature complement(158279..>158848) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974961.1:TRAP transporter large permease subunit locus_tag LOCUS_51300 sequence022 source 1..157960 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 516..1670 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113083.1 transl_table 11 codon_start 1 locus_tag LOCUS_51310 gene gcvT CDS 1784..2161 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001355634.1 transl_table 11 codon_start 1 locus_tag LOCUS_51320 gene gcvH CDS 2297..5185 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195877.1 transl_table 11 codon_start 1 locus_tag LOCUS_51330 gene gcvP CDS 5224..6615 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113084.1 transl_table 11 codon_start 1 locus_tag LOCUS_51340 CDS complement(6653..6847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51350 CDS complement(6987..7160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51360 CDS complement(7253..7753) product gluconokinase, GntK/IdnK-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107130.1 transl_table 11 codon_start 1 locus_tag LOCUS_51370 CDS 7960..8979 product LacI family DNA-binding transcriptional regulator GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107131.1 transl_table 11 codon_start 1 locus_tag LOCUS_51380 gene gntR CDS 9053..9898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51390 CDS complement(10025..11128) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534774.1 transl_table 11 codon_start 1 locus_tag LOCUS_51400 gene aroC CDS complement(11217..11696) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193328.1 transl_table 11 codon_start 1 locus_tag LOCUS_51410 CDS complement(11772..12716) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838116.1 transl_table 11 codon_start 1 locus_tag LOCUS_51420 CDS complement(12743..13957) product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036153.1 transl_table 11 codon_start 1 locus_tag LOCUS_51430 gene kbl CDS complement(14053..15225) product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536360.1 transl_table 11 codon_start 1 locus_tag LOCUS_51440 CDS 15296..15691 product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812700.1 transl_table 11 codon_start 1 locus_tag LOCUS_51450 CDS 15695..17101 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931317.1 transl_table 11 codon_start 1 locus_tag LOCUS_51460 CDS complement(17175..17639) product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185972.1 transl_table 11 codon_start 1 locus_tag LOCUS_51470 CDS complement(17626..18243) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930239.1 transl_table 11 codon_start 1 locus_tag LOCUS_51480 CDS complement(18236..18538) product DUF2818 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813915.1 transl_table 11 codon_start 1 locus_tag LOCUS_51490 CDS complement(18549..20060) product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 transl_table 11 codon_start 1 locus_tag LOCUS_51500 gene nuoN CDS complement(20083..21624) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 transl_table 11 codon_start 1 locus_tag LOCUS_51510 CDS complement(21646..23691) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208277753.1 transl_table 11 codon_start 1 locus_tag LOCUS_51520 gene nuoL CDS complement(23712..24029) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 transl_table 11 codon_start 1 locus_tag LOCUS_51530 gene nuoK CDS complement(24026..24700) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185672.1 transl_table 11 codon_start 1 locus_tag LOCUS_51540 CDS complement(24740..25228) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186558.1 transl_table 11 codon_start 1 locus_tag LOCUS_51550 gene nuoI CDS complement(25232..26293) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813926.1 transl_table 11 codon_start 1 locus_tag LOCUS_51560 gene nuoH CDS complement(26304..28634) product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186393.1 transl_table 11 codon_start 1 locus_tag LOCUS_51570 gene nuoG CDS complement(28723..30072) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813930.1 transl_table 11 codon_start 1 locus_tag LOCUS_51580 gene nuoF CDS complement(30069..30566) product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813932.1 transl_table 11 codon_start 1 locus_tag LOCUS_51590 gene nuoE CDS complement(30563..31816) product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 transl_table 11 codon_start 1 locus_tag LOCUS_51600 CDS complement(31827..32426) product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186121.1 transl_table 11 codon_start 1 locus_tag LOCUS_51610 CDS complement(32453..32929) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 transl_table 11 codon_start 1 locus_tag LOCUS_51620 CDS complement(32974..33333) product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186624.1 transl_table 11 codon_start 1 locus_tag LOCUS_51630 tRNA complement(33515..33599) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(33893..34318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51640 CDS complement(34347..35093) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813996.1 transl_table 11 codon_start 1 locus_tag LOCUS_51650 gene tpiA CDS complement(35102..36088) product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196428.1 transl_table 11 codon_start 1 locus_tag LOCUS_51660 CDS complement(36094..38406) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526459.1 transl_table 11 codon_start 1 locus_tag LOCUS_51670 gene pnp CDS complement(38610..38879) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185828.1 transl_table 11 codon_start 1 locus_tag LOCUS_51680 gene rpsO CDS complement(39046..40230) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968655.1 transl_table 11 codon_start 1 locus_tag LOCUS_51690 CDS complement(40311..41345) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204325.1 transl_table 11 codon_start 1 locus_tag LOCUS_51700 gene tsaD CDS 41414..42046 product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037167.1 transl_table 11 codon_start 1 locus_tag LOCUS_51710 CDS 42361..43629 product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882726.1 transl_table 11 codon_start 1 locus_tag LOCUS_51720 CDS 43664..44560 product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096249.1 transl_table 11 codon_start 1 locus_tag LOCUS_51730 gene ntrB CDS 44589..45383 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367094.1 transl_table 11 codon_start 1 locus_tag LOCUS_51740 CDS complement(45546..45884) product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812453.1 transl_table 11 codon_start 1 locus_tag LOCUS_51750 gene fdx CDS complement(45899..47767) product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938156.1 transl_table 11 codon_start 1 locus_tag LOCUS_51760 gene hscA CDS complement(47801..48319) product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202016.1 transl_table 11 codon_start 1 locus_tag LOCUS_51770 gene hscB CDS complement(48426..48749) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 transl_table 11 codon_start 1 locus_tag LOCUS_51780 gene iscA CDS complement(48754..49149) product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812460.1 transl_table 11 codon_start 1 locus_tag LOCUS_51790 gene iscU CDS complement(49192..50412) product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524724.1 transl_table 11 codon_start 1 locus_tag LOCUS_51800 CDS complement(50499..51032) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 transl_table 11 codon_start 1 locus_tag LOCUS_51810 gene iscR CDS complement(51408..53549) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199587.1 transl_table 11 codon_start 1 locus_tag LOCUS_51820 gene uvrB CDS 53694..54893 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816819.1 transl_table 11 codon_start 1 locus_tag LOCUS_51830 CDS 55160..56506 product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185678.1 transl_table 11 codon_start 1 locus_tag LOCUS_51840 gene phaZ CDS 56499..57212 product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186213.1 transl_table 11 codon_start 1 locus_tag LOCUS_51850 gene rsxB CDS 57218..57853 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813856.1 transl_table 11 codon_start 1 locus_tag LOCUS_51860 gene nth CDS 57899..58105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51870 CDS 58130..58459 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096316.1 transl_table 11 codon_start 1 locus_tag LOCUS_51880 CDS 58726..59613 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813022.1 transl_table 11 codon_start 1 locus_tag LOCUS_51890 CDS complement(59752..60774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51900 CDS complement(60839..62116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51910 CDS 62458..63735 product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265576.1 transl_table 11 codon_start 1 locus_tag LOCUS_51920 CDS complement(63887..65611) product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004342954.1 transl_table 11 codon_start 1 locus_tag LOCUS_51930 CDS 65669..68149 product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195264.1 transl_table 11 codon_start 1 locus_tag LOCUS_51940 gene nirB CDS 68194..68601 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936225.1 transl_table 11 codon_start 1 locus_tag LOCUS_51950 gene nirD CDS 68636..71446 product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936224.1 transl_table 11 codon_start 1 locus_tag LOCUS_51960 CDS 71587..72537 product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522867.1 transl_table 11 codon_start 1 locus_tag LOCUS_51970 gene ybiB CDS 72551..73456 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198742.1 transl_table 11 codon_start 1 locus_tag LOCUS_51980 gene cobA CDS 73485..74699 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190760.1 transl_table 11 codon_start 1 locus_tag LOCUS_51990 CDS 74942..75154 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190342.1 transl_table 11 codon_start 1 locus_tag LOCUS_52000 gene rpsU CDS 75261..75707 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190948.1 transl_table 11 codon_start 1 locus_tag LOCUS_52010 CDS 75717..76079 product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820700.1 transl_table 11 codon_start 1 locus_tag LOCUS_52020 CDS 76379..79666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52030 CDS complement(79777..80511) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 transl_table 11 codon_start 1 locus_tag LOCUS_52040 CDS complement(80508..81317) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227934.1 transl_table 11 codon_start 1 locus_tag LOCUS_52050 CDS complement(81322..82176) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018191.1 transl_table 11 codon_start 1 locus_tag LOCUS_52060 CDS complement(82183..83064) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944005.1 transl_table 11 codon_start 1 locus_tag LOCUS_52070 CDS complement(83148..84287) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888753.1 transl_table 11 codon_start 1 locus_tag LOCUS_52080 CDS complement(84449..85819) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522380.1 transl_table 11 codon_start 1 locus_tag LOCUS_52090 gene pmbA CDS 85885..86412 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814897.1 transl_table 11 codon_start 1 locus_tag LOCUS_52100 gene yjgA CDS 86405..87013 product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064299.1 transl_table 11 codon_start 1 locus_tag LOCUS_52110 gene mog CDS complement(87107..87883) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193377.1 transl_table 11 codon_start 1 locus_tag LOCUS_52120 gene cysE CDS complement(87967..88824) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544079.1 transl_table 11 codon_start 1 locus_tag LOCUS_52130 CDS 88974..89957 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 transl_table 11 codon_start 1 locus_tag LOCUS_52140 CDS 89985..92588 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193335.1 transl_table 11 codon_start 1 locus_tag LOCUS_52150 gene mutS CDS 92585..93418 product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 transl_table 11 codon_start 1 locus_tag LOCUS_52160 CDS 93415..94224 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524730.1 transl_table 11 codon_start 1 locus_tag LOCUS_52170 CDS 94336..95994 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813705.1 transl_table 11 codon_start 1 locus_tag LOCUS_52180 CDS 96006..96863 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193658.1 transl_table 11 codon_start 1 locus_tag LOCUS_52190 gene kdsA CDS 96878..97168 product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813702.1 transl_table 11 codon_start 1 locus_tag LOCUS_52200 CDS 97272..98558 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065136.1 transl_table 11 codon_start 1 locus_tag LOCUS_52210 gene eno CDS 98700..98978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52220 CDS 98985..99608 product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088324.1 transl_table 11 codon_start 1 locus_tag LOCUS_52230 gene pnuC CDS 99649..100353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52240 CDS complement(100363..101328) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550203.1 transl_table 11 codon_start 1 locus_tag LOCUS_52250 gene hslO CDS 101591..102394 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191514.1 transl_table 11 codon_start 1 locus_tag LOCUS_52260 CDS 102462..103337 product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689749.1 transl_table 11 codon_start 1 locus_tag LOCUS_52270 CDS 103350..104102 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705158.1 transl_table 11 codon_start 1 locus_tag LOCUS_52280 CDS 104273..105292 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195141.1 transl_table 11 codon_start 1 locus_tag LOCUS_52290 CDS complement(105408..106379) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203577.1 transl_table 11 codon_start 1 locus_tag LOCUS_52300 gene xerD CDS complement(106381..107355) product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063889.1 transl_table 11 codon_start 1 locus_tag LOCUS_52310 CDS 107522..108427 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814325.1 transl_table 11 codon_start 1 locus_tag LOCUS_52320 CDS complement(108424..109539) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189719.1 transl_table 11 codon_start 1 locus_tag LOCUS_52330 gene queG CDS 109522..110013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52340 note possible pseudo, frameshifted CDS 110010..111398 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247543.1 transl_table 11 codon_start 1 locus_tag LOCUS_52350 CDS complement(111464..112117) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171830.1 transl_table 11 codon_start 1 locus_tag LOCUS_52360 CDS 112158..114149 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194266.1 transl_table 11 codon_start 1 locus_tag LOCUS_52370 gene mutL CDS complement(114192..117257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52380 CDS 118045..120768 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820240.1 transl_table 11 codon_start 1 locus_tag LOCUS_52390 gene acnA CDS 120901..122823 product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085439.1 transl_table 11 codon_start 1 locus_tag LOCUS_52400 CDS complement(122860..123291) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479700.1 transl_table 11 codon_start 1 locus_tag LOCUS_52410 CDS complement(123414..124064) product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192135.1 transl_table 11 codon_start 1 locus_tag LOCUS_52420 gene leuE CDS complement(124245..124475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52430 CDS complement(124587..125504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52440 CDS complement(125566..127377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52450 CDS complement(127734..128936) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 transl_table 11 codon_start 1 locus_tag LOCUS_52460 CDS complement(129163..129516) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102247109.1 transl_table 11 codon_start 1 locus_tag LOCUS_52470 CDS complement(129513..130010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52480 CDS complement(130054..132447) product copper-translocating P-type ATPase CopA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 transl_table 11 codon_start 1 locus_tag LOCUS_52490 gene copA1 CDS complement(132556..133686) product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 transl_table 11 codon_start 1 locus_tag LOCUS_52500 CDS 133976..134785 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551552.1 transl_table 11 codon_start 1 locus_tag LOCUS_52510 CDS complement(135121..135507) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946033.1 transl_table 11 codon_start 1 locus_tag LOCUS_52520 tRNA complement(135668..135743) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(135790..135865) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(135886..135961) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS complement(136117..136917) product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190050.1 transl_table 11 codon_start 1 locus_tag LOCUS_52530 gene tcdA CDS complement(136923..137687) product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186614.1 transl_table 11 codon_start 1 locus_tag LOCUS_52540 gene ybgF CDS complement(137689..138225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52550 CDS complement(138317..139681) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931417.1 transl_table 11 codon_start 1 locus_tag LOCUS_52560 gene tolB CDS complement(139753..141711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52570 CDS 142212..143462 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186490.1 transl_table 11 codon_start 1 locus_tag LOCUS_52580 CDS 143564..144001 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814871.1 transl_table 11 codon_start 1 locus_tag LOCUS_52590 gene nrdR CDS 144115..144687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52600 CDS 144695..145405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52610 CDS 145402..146697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52620 CDS 146955..147428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52630 CDS 147459..148610 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527563.1 transl_table 11 codon_start 1 locus_tag LOCUS_52640 gene ribD CDS 148647..149267 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 transl_table 11 codon_start 1 locus_tag LOCUS_52650 CDS 149397..150512 product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186115.1 transl_table 11 codon_start 1 locus_tag LOCUS_52660 gene ribBA CDS 150515..150982 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186056.1 transl_table 11 codon_start 1 locus_tag LOCUS_52670 gene ribH CDS 150979..151458 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808599.1 transl_table 11 codon_start 1 locus_tag LOCUS_52680 gene nusB CDS 151497..152681 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194932.1 transl_table 11 codon_start 1 locus_tag LOCUS_52690 CDS 152695..153126 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201529.1 transl_table 11 codon_start 1 locus_tag LOCUS_52700 gene ybgC CDS 153123..153830 product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186467.1 transl_table 11 codon_start 1 locus_tag LOCUS_52710 gene tolQ CDS 153892..154263 product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814643.1 transl_table 11 codon_start 1 locus_tag LOCUS_52720 gene tolR CDS 154263..155480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52730 CDS 155609..156259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52740 sequence023 source 1..152773 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 844..1116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52750 CDS complement(1181..1480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52760 CDS 1443..2570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52770 CDS complement(2835..3173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52780 CDS complement(3490..3669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52790 note possible pseudo, internal stop codon, frameshifted CDS 4046..5230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52800 CDS complement(5307..6278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52810 CDS complement(6297..7007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52820 CDS complement(7004..7405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52830 CDS complement(7479..9179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52840 CDS complement(9742..9999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52850 CDS 10075..10371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52860 CDS 10442..10960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52870 CDS 10938..11471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52880 CDS complement(11422..11940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52890 CDS 11980..12399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52900 CDS complement(12573..13655) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188583328.1 transl_table 11 codon_start 1 locus_tag LOCUS_52910 assembly_gap 14580..15569 estimated_length known gap_type within scaffold linkage_evidence paired-ends repeat_region 16226..16663 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tcggccgcgcaggccgctt CDS 16805..18550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52920 CDS 18565..19464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52930 CDS 19506..20552 product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957412.1 transl_table 11 codon_start 1 locus_tag LOCUS_52940 gene csy3 CDS 20564..21124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52950 CDS 22262..23092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52960 assembly_gap 25703..26058 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 26107..26352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52970 CDS 26483..27565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52980 CDS 27672..31046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52990 CDS 30992..33304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53000 CDS complement(33399..33698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53010 assembly_gap 33704..33713 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 33744..35723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53020 CDS 35960..36361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53030 CDS 36493..37110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53040 CDS 37217..38881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53050 CDS 38991..39239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53060 CDS 39274..39717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53070 CDS 39714..39917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53080 CDS complement(39981..40799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53090 CDS complement(42454..43401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53100 CDS complement(43421..44923) product GumC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583709.1 transl_table 11 codon_start 1 locus_tag LOCUS_53110 CDS 45382..46617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53120 CDS 46640..47620 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061733.1 transl_table 11 codon_start 1 locus_tag LOCUS_53130 CDS 47617..48810 product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061734.1 transl_table 11 codon_start 1 locus_tag LOCUS_53140 CDS 49047..50669 product O-antigen translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061735.1 transl_table 11 codon_start 1 locus_tag LOCUS_53150 CDS 50722..51750 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008838931.1 transl_table 11 codon_start 1 locus_tag LOCUS_53160 CDS 52273..53052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53170 CDS 53177..54358 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936352.1 transl_table 11 codon_start 1 locus_tag LOCUS_53180 CDS 54376..55767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53190 CDS 56433..57272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53200 CDS 57326..58486 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484336.1 transl_table 11 codon_start 1 locus_tag LOCUS_53210 CDS 58473..59360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53220 CDS 59357..60241 product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963505.1 transl_table 11 codon_start 1 locus_tag LOCUS_53230 CDS 60262..62142 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 transl_table 11 codon_start 1 locus_tag LOCUS_53240 gene asnB CDS 62142..63104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53250 CDS 63101..64369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53260 CDS 64366..65646 product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875980.1 transl_table 11 codon_start 1 locus_tag LOCUS_53270 CDS complement(65658..67016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53280 CDS complement(67060..67677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53290 CDS complement(68959..69372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53300 CDS 69570..70961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53310 CDS 70969..72468 product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349461.1 transl_table 11 codon_start 1 locus_tag LOCUS_53320 gene viaA CDS 72465..73310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53330 CDS complement(73318..73692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53340 CDS 74279..74524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53350 CDS 74638..75885 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227054.1 transl_table 11 codon_start 1 locus_tag LOCUS_53360 CDS 76144..77334 product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815956.1 transl_table 11 codon_start 1 locus_tag LOCUS_53370 CDS complement(77676..79478) product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095196.1 transl_table 11 codon_start 1 locus_tag LOCUS_53380 gene arsA CDS complement(79509..80288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53390 note possible pseudo, internal stop codon CDS complement(80289..80771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53400 note possible pseudo, internal stop codon CDS complement(80764..82719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53410 CDS complement(82848..83918) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272375.1 transl_table 11 codon_start 1 locus_tag LOCUS_53420 gene arsB CDS complement(83937..84440) product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184680.1 transl_table 11 codon_start 1 locus_tag LOCUS_53430 CDS complement(84447..84770) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039907.1 transl_table 11 codon_start 1 locus_tag LOCUS_53440 CDS complement(84829..85605) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189368.1 transl_table 11 codon_start 1 locus_tag LOCUS_53450 note possible pseudo, internal stop codon CDS complement(85633..85752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53460 note possible pseudo, internal stop codon CDS 85899..86327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53470 CDS complement(86350..88956) product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549921.1 transl_table 11 codon_start 1 locus_tag LOCUS_53480 gene tssH CDS complement(88990..89286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53490 CDS 89292..90050 product type IVB secretion system protein IcmH/DotU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521948.1 transl_table 11 codon_start 1 locus_tag LOCUS_53500 gene icmH CDS complement(90220..90876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53510 CDS complement(90886..92025) product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 transl_table 11 codon_start 1 locus_tag LOCUS_53520 CDS complement(92031..93047) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 transl_table 11 codon_start 1 locus_tag LOCUS_53530 CDS complement(93177..93662) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061729.1 transl_table 11 codon_start 1 locus_tag LOCUS_53540 CDS complement(95002..95430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53550 CDS 95429..96370 product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 transl_table 11 codon_start 1 locus_tag LOCUS_53560 gene nhaR CDS 96494..97567 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967605.1 transl_table 11 codon_start 1 locus_tag LOCUS_53570 CDS 97748..98446 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521332.1 transl_table 11 codon_start 1 locus_tag LOCUS_53580 CDS 98467..98793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53590 CDS 98786..99253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53600 CDS 99406..99810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53610 CDS complement(100023..100922) product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922721.1 transl_table 11 codon_start 1 locus_tag LOCUS_53620 CDS complement(101020..101493) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532155.1 transl_table 11 codon_start 1 locus_tag LOCUS_53630 CDS complement(101707..102186) product Dot/Icm type IV secretion system effector PhnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957793.1 transl_table 11 codon_start 1 locus_tag LOCUS_53640 gene phnB CDS complement(103367..103585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53650 CDS complement(104056..104724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53660 CDS 104902..105219 product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337920.1 transl_table 11 codon_start 1 locus_tag LOCUS_53670 CDS 105576..108983 product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010793829.1 transl_table 11 codon_start 1 locus_tag LOCUS_53680 gene recC CDS 108976..112620 product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103276.1 transl_table 11 codon_start 1 locus_tag LOCUS_53690 gene recB CDS 112617..114677 product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114993.1 transl_table 11 codon_start 1 locus_tag LOCUS_53700 gene recD CDS complement(114969..115964) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808748.1 transl_table 11 codon_start 1 locus_tag LOCUS_53710 CDS complement(116023..116952) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966109.1 transl_table 11 codon_start 1 locus_tag LOCUS_53720 CDS complement(117030..118766) product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318618.1 transl_table 11 codon_start 1 locus_tag LOCUS_53730 CDS 118877..119857 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036922.1 transl_table 11 codon_start 1 locus_tag LOCUS_53740 CDS complement(119870..120271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53750 CDS 120594..121076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53760 CDS complement(121164..121391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53770 CDS 121753..122406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53780 CDS 122489..123514 product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072067.1 transl_table 11 codon_start 1 locus_tag LOCUS_53790 CDS 123511..124344 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072068.1 transl_table 11 codon_start 1 locus_tag LOCUS_53800 CDS 124409..125377 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037382345.1 transl_table 11 codon_start 1 locus_tag LOCUS_53810 CDS 125512..126576 product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139076345.1 transl_table 11 codon_start 1 locus_tag LOCUS_53820 CDS 126981..128243 product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528722.1 transl_table 11 codon_start 1 locus_tag LOCUS_53830 CDS 128240..128896 product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765392.1 transl_table 11 codon_start 1 locus_tag LOCUS_53840 CDS 128968..129594 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085692.1 transl_table 11 codon_start 1 locus_tag LOCUS_53850 CDS complement(130072..131070) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064800.1 transl_table 11 codon_start 1 locus_tag LOCUS_53860 CDS complement(131169..132197) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529415.1 transl_table 11 codon_start 1 locus_tag LOCUS_53870 CDS complement(132284..133291) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 transl_table 11 codon_start 1 locus_tag LOCUS_53880 CDS 133956..134870 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085817.1 transl_table 11 codon_start 1 locus_tag LOCUS_53890 CDS 134909..135328 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253940.1 transl_table 11 codon_start 1 locus_tag LOCUS_53900 CDS 135325..135624 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253939.1 transl_table 11 codon_start 1 locus_tag LOCUS_53910 CDS 135661..136635 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809986.1 transl_table 11 codon_start 1 locus_tag LOCUS_53920 CDS 136687..137751 product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139076345.1 transl_table 11 codon_start 1 locus_tag LOCUS_53930 CDS 137797..138747 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016558605.1 transl_table 11 codon_start 1 locus_tag LOCUS_53940 CDS 138848..140239 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253941.1 transl_table 11 codon_start 1 locus_tag LOCUS_53950 CDS complement(140285..140974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53960 CDS complement(140988..141425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807254.1 transl_table 11 codon_start 1 locus_tag LOCUS_53970 CDS complement(141435..141869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064705.1 transl_table 11 codon_start 1 locus_tag LOCUS_53980 CDS complement(141875..142195) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298602.1 transl_table 11 codon_start 1 locus_tag LOCUS_53990 CDS 142277..143161 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807247.1 transl_table 11 codon_start 1 locus_tag LOCUS_54000 CDS complement(143177..143656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967553.1 transl_table 11 codon_start 1 locus_tag LOCUS_54010 CDS complement(143671..144228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54020 CDS 144332..145231 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085908.1 transl_table 11 codon_start 1 locus_tag LOCUS_54030 CDS 145355..146356 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040703.1 transl_table 11 codon_start 1 locus_tag LOCUS_54040 CDS 146419..147357 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064800.1 transl_table 11 codon_start 1 locus_tag LOCUS_54050 CDS 147362..148420 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244689.1 transl_table 11 codon_start 1 locus_tag LOCUS_54060 gene pgl CDS 148441..151086 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974570.1 transl_table 11 codon_start 1 locus_tag LOCUS_54070 gene acnA CDS 151106..151861 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929763.1 transl_table 11 codon_start 1 locus_tag LOCUS_54080 misc_feature complement(151919..>152773) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969733.1:tripartite tricarboxylate transporter substrate binding protein BugD locus_tag LOCUS_54090 sequence024 source 1..109658 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 232..456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54100 CDS complement(453..782) product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086297.1 transl_table 11 codon_start 1 locus_tag LOCUS_54110 gene soxZ CDS complement(792..1271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54120 CDS complement(1288..2625) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880096.1 transl_table 11 codon_start 1 locus_tag LOCUS_54130 CDS complement(2698..3978) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 transl_table 11 codon_start 1 locus_tag LOCUS_54140 CDS complement(3975..4277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54150 CDS 4693..4872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54160 CDS 5035..5997 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808079.1 transl_table 11 codon_start 1 locus_tag LOCUS_54170 CDS 6195..7841 product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200871.1 transl_table 11 codon_start 1 locus_tag LOCUS_54180 CDS complement(7851..9101) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383307.1 transl_table 11 codon_start 1 locus_tag LOCUS_54190 CDS complement(9104..9427) product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083869.1 transl_table 11 codon_start 1 locus_tag LOCUS_54200 CDS complement(9721..10896) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731407.1 transl_table 11 codon_start 1 locus_tag LOCUS_54210 CDS 11016..11948 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061538724.1 transl_table 11 codon_start 1 locus_tag LOCUS_54220 CDS 12204..13391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54230 CDS complement(13401..14867) product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084183.1 transl_table 11 codon_start 1 locus_tag LOCUS_54240 CDS 15029..16759 product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130977582.1 transl_table 11 codon_start 1 locus_tag LOCUS_54250 CDS 17105..18157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54260 CDS complement(18168..18938) product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813919.1 transl_table 11 codon_start 1 locus_tag LOCUS_54270 CDS complement(18949..20187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208108.1 transl_table 11 codon_start 1 locus_tag LOCUS_54280 CDS complement(20191..23352) product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208107.1 transl_table 11 codon_start 1 locus_tag LOCUS_54290 CDS complement(23342..24442) product ArsO family NAD(P)H-dependent flavin-containing monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043376805.1 transl_table 11 codon_start 1 locus_tag LOCUS_54300 CDS complement(24444..24764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54310 CDS complement(24829..26604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54320 CDS complement(26588..27799) product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 transl_table 11 codon_start 1 locus_tag LOCUS_54330 gene nifS CDS complement(27810..28175) product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 transl_table 11 codon_start 1 locus_tag LOCUS_54340 gene nifU CDS complement(28198..29376) product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112567.1 transl_table 11 codon_start 1 locus_tag LOCUS_54350 CDS complement(30215..30574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54360 CDS complement(30690..31328) product response regulator FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085544.1 transl_table 11 codon_start 1 locus_tag LOCUS_54370 gene fixJ CDS complement(31310..33058) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114131.1 transl_table 11 codon_start 1 locus_tag LOCUS_54380 CDS 33276..34247 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970169.1 transl_table 11 codon_start 1 locus_tag LOCUS_54390 CDS complement(34252..37773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54400 CDS complement(37790..39358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54410 CDS complement(39402..40799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54420 CDS complement(40753..42651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54430 CDS complement(42648..43154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54440 CDS complement(43184..43516) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562568.1 transl_table 11 codon_start 1 locus_tag LOCUS_54450 CDS complement(43528..44787) product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139992.1 transl_table 11 codon_start 1 locus_tag LOCUS_54460 CDS complement(44784..45779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54470 CDS complement(45841..46305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54480 CDS complement(46443..47324) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104418.1 transl_table 11 codon_start 1 locus_tag LOCUS_54490 CDS 47389..48864 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090321.1 transl_table 11 codon_start 1 locus_tag LOCUS_54500 CDS complement(49208..49651) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207464.1 transl_table 11 codon_start 1 locus_tag LOCUS_54510 CDS 49830..51293 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115242.1 transl_table 11 codon_start 1 locus_tag LOCUS_54520 CDS 51398..52666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54530 CDS complement(52735..52899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54540 CDS complement(53123..55255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54550 CDS complement(55484..55861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54560 CDS 56029..56709 product serine esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013614293.1 transl_table 11 codon_start 1 locus_tag LOCUS_54570 CDS 56755..57024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54580 CDS complement(57135..57878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54590 CDS complement(57897..59018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54600 CDS 59214..59495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54610 CDS complement(60023..61456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54620 CDS 61626..62639 product catalase family peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549880.1 transl_table 11 codon_start 1 locus_tag LOCUS_54630 CDS complement(62674..65598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54640 CDS 66378..67700 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088858.1 transl_table 11 codon_start 1 locus_tag LOCUS_54650 CDS 67910..68215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54660 CDS complement(68202..68951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54670 CDS complement(69008..69217) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196837.1 transl_table 11 codon_start 1 locus_tag LOCUS_54680 CDS complement(69284..69547) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809486.1 transl_table 11 codon_start 1 locus_tag LOCUS_54690 gene infA CDS 69742..70095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54700 CDS complement(70162..70395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54710 CDS complement(70425..71291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54720 CDS complement(71506..72159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54730 CDS 72453..73370 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194310.1 transl_table 11 codon_start 1 locus_tag LOCUS_54740 CDS 73606..74292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54750 CDS complement(74320..75255) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064585.1 transl_table 11 codon_start 1 locus_tag LOCUS_54760 CDS complement(75257..76006) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064586.1 transl_table 11 codon_start 1 locus_tag LOCUS_54770 CDS complement(76017..77468) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929684.1 transl_table 11 codon_start 1 locus_tag LOCUS_54780 CDS complement(77473..78453) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196629.1 transl_table 11 codon_start 1 locus_tag LOCUS_54790 CDS complement(78450..79400) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808146.1 transl_table 11 codon_start 1 locus_tag LOCUS_54800 CDS complement(79397..80278) product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446591.1 transl_table 11 codon_start 1 locus_tag LOCUS_54810 gene hpaD CDS complement(80309..81784) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229069.1 transl_table 11 codon_start 1 locus_tag LOCUS_54820 CDS complement(81792..82787) product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063889.1 transl_table 11 codon_start 1 locus_tag LOCUS_54830 CDS complement(82784..84229) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931317.1 transl_table 11 codon_start 1 locus_tag LOCUS_54840 CDS complement(84244..85044) product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113007.1 transl_table 11 codon_start 1 locus_tag LOCUS_54850 gene hpaI CDS complement(85044..85847) product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459750.1 transl_table 11 codon_start 1 locus_tag LOCUS_54860 gene hpaH CDS 85979..86914 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926012.1 transl_table 11 codon_start 1 locus_tag LOCUS_54870 CDS complement(87125..88024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54880 CDS complement(88033..89484) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089157.1 transl_table 11 codon_start 1 locus_tag LOCUS_54890 CDS complement(89510..91060) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390860.1 transl_table 11 codon_start 1 locus_tag LOCUS_54900 CDS complement(91084..91611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54910 CDS complement(91608..91955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54920 CDS 92198..93913 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024666240.1 transl_table 11 codon_start 1 locus_tag LOCUS_54930 CDS 94183..95637 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384943.1 transl_table 11 codon_start 1 locus_tag LOCUS_54940 gene aspA CDS 95870..97165 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192723.1 transl_table 11 codon_start 1 locus_tag LOCUS_54950 CDS 97213..98067 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528056.1 transl_table 11 codon_start 1 locus_tag LOCUS_54960 CDS complement(98131..99801) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930332.1 transl_table 11 codon_start 1 locus_tag LOCUS_54970 CDS 100013..100591 product lpg2434 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948137.1 transl_table 11 codon_start 1 locus_tag LOCUS_54980 CDS complement(100853..101737) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423235.1 transl_table 11 codon_start 1 locus_tag LOCUS_54990 CDS 101876..104101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55000 CDS 104243..107035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55010 CDS 107170..108000 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103399.1 transl_table 11 codon_start 1 locus_tag LOCUS_55020 CDS 108048..109013 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088799.1 transl_table 11 codon_start 1 locus_tag LOCUS_55030 sequence025 source 1..98104 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55040 CDS 605..892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55050 CDS complement(1434..1835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55060 CDS complement(1884..3167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55070 CDS 3386..3553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55080 CDS 4258..5142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55090 note possible pseudo, frameshifted CDS complement(5076..7172) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051509115.1 transl_table 11 codon_start 1 locus_tag LOCUS_55100 CDS complement(7381..7596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55110 CDS complement(7826..8254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55120 CDS complement(8793..9488) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930489.1 transl_table 11 codon_start 1 locus_tag LOCUS_55130 CDS complement(9744..10358) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036904.1 transl_table 11 codon_start 1 locus_tag LOCUS_55140 CDS complement(10612..11502) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173642.1 transl_table 11 codon_start 1 locus_tag LOCUS_55150 CDS 12208..12426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55160 CDS complement(12829..13158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55170 CDS complement(13535..13945) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814742.1 transl_table 11 codon_start 1 locus_tag LOCUS_55180 CDS complement(14896..16203) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525075.1 transl_table 11 codon_start 1 locus_tag LOCUS_55190 CDS complement(16196..16666) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529094.1 transl_table 11 codon_start 1 locus_tag LOCUS_55200 CDS complement(16663..16830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55210 note possible pseudo, frameshifted CDS complement(16830..17027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55220 CDS complement(17137..17571) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143935.1 transl_table 11 codon_start 1 locus_tag LOCUS_55230 CDS complement(17830..17949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55240 CDS 18338..18838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55250 CDS 18921..20630 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390495.1 transl_table 11 codon_start 1 locus_tag LOCUS_55260 CDS 21396..22193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55270 CDS 22316..24436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55280 CDS complement(24545..24709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55290 CDS 25340..25633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55300 CDS complement(25718..26005) product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266599.1 transl_table 11 codon_start 1 locus_tag LOCUS_55310 gene tnpB CDS 26598..26921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55320 CDS 27006..27239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55330 CDS complement(27274..27669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55340 CDS complement(28041..28346) product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195767.1 transl_table 11 codon_start 1 locus_tag LOCUS_55350 CDS complement(28715..29773) product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103420.1 transl_table 11 codon_start 1 locus_tag LOCUS_55360 CDS 29906..30175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55370 CDS complement(30336..30650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55380 CDS complement(30671..30907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55390 CDS complement(31000..31833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55400 CDS complement(31830..32150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55410 CDS complement(32159..35188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55420 CDS complement(35181..35354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55430 CDS complement(35362..35901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55440 CDS complement(35813..38149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55450 CDS complement(38146..39201) product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034519683.1 transl_table 11 codon_start 1 locus_tag LOCUS_55460 gene virB11 CDS complement(39219..40598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55470 CDS complement(40643..41566) product TrbG/VirB9 family P-type conjugative transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162050504.1 transl_table 11 codon_start 1 locus_tag LOCUS_55480 CDS complement(41563..42318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55490 CDS complement(42320..43060) product P-type DNA transfer protein VirB5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103177.1 transl_table 11 codon_start 1 locus_tag LOCUS_55500 gene virB5 CDS complement(43057..44094) product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974426.1 transl_table 11 codon_start 1 locus_tag LOCUS_55510 CDS 44204..44410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55520 CDS complement(44455..46938) product VirB4 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035201479.1 transl_table 11 codon_start 1 locus_tag LOCUS_55530 CDS complement(47131..47466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55540 CDS complement(47482..47787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55550 CDS complement(47787..48263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55560 CDS complement(48282..48785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55570 CDS 49182..49589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55580 CDS complement(50374..50529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55590 CDS 50785..51006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55600 CDS complement(51013..51240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55610 CDS 51538..51741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55620 CDS 51982..52209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55630 CDS complement(52821..53273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55640 CDS 53366..53794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55650 CDS complement(53712..54839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55660 assembly_gap 54887..56841 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 57160..57498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55670 note possible pseudo, internal stop codon, frameshifted CDS 57449..57628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55680 note possible pseudo, internal stop codon, frameshifted CDS 57779..58066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55690 note possible pseudo, internal stop codon CDS 58547..58720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55700 CDS 58847..59212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55710 CDS 59220..59663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55720 CDS complement(59708..61321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55730 CDS complement(61325..62128) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103625.1 transl_table 11 codon_start 1 locus_tag LOCUS_55740 CDS complement(62363..65476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55750 CDS complement(65583..68141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55760 assembly_gap 66155..66164 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 68705..70600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55770 CDS 70610..71299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55780 CDS 71262..71519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55790 CDS 71631..72749 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 transl_table 11 codon_start 1 locus_tag LOCUS_55800 CDS complement(73012..73776) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811135.1 transl_table 11 codon_start 1 locus_tag LOCUS_55810 CDS 74389..74802 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524104.1 transl_table 11 codon_start 1 locus_tag LOCUS_55820 CDS complement(74837..75691) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102956.1 transl_table 11 codon_start 1 locus_tag LOCUS_55830 CDS complement(75670..76629) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087852.1 transl_table 11 codon_start 1 locus_tag LOCUS_55840 CDS complement(77299..77721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55850 CDS complement(77718..78086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55860 note possible pseudo, frameshifted CDS complement(78149..78487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55870 CDS complement(78905..79450) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368006.1 transl_table 11 codon_start 1 locus_tag LOCUS_55880 CDS complement(79702..81558) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206058.1 transl_table 11 codon_start 1 locus_tag LOCUS_55890 CDS complement(81713..82870) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921524.1 transl_table 11 codon_start 1 locus_tag LOCUS_55900 CDS complement(82982..84010) product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206164.1 transl_table 11 codon_start 1 locus_tag LOCUS_55910 CDS complement(84033..85766) product arylsulfatase AtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106692.1 transl_table 11 codon_start 1 locus_tag LOCUS_55920 gene atsA CDS complement(85797..86912) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543370.1 transl_table 11 codon_start 1 locus_tag LOCUS_55930 CDS complement(87074..87499) product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083199.1 transl_table 11 codon_start 1 locus_tag LOCUS_55940 CDS 87622..88536 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532449.1 transl_table 11 codon_start 1 locus_tag LOCUS_55950 CDS complement(88632..89597) product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090349.1 transl_table 11 codon_start 1 locus_tag LOCUS_55960 CDS complement(89597..90841) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393543.1 transl_table 11 codon_start 1 locus_tag LOCUS_55970 CDS complement(90875..91519) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971183.1 transl_table 11 codon_start 1 locus_tag LOCUS_55980 CDS complement(91531..92487) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813902.1 transl_table 11 codon_start 1 locus_tag LOCUS_55990 CDS complement(92533..94050) product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050980078.1 transl_table 11 codon_start 1 locus_tag LOCUS_56000 CDS complement(94050..94916) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813498.1 transl_table 11 codon_start 1 locus_tag LOCUS_56010 CDS complement(94959..95864) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030811.1 transl_table 11 codon_start 1 locus_tag LOCUS_56020 CDS complement(95897..96922) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085528.1 transl_table 11 codon_start 1 locus_tag LOCUS_56030 sequence026 source 1..89955 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(462..2432) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188376.1 transl_table 11 codon_start 1 locus_tag LOCUS_56040 gene acs CDS 2602..3198 product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448628.1 transl_table 11 codon_start 1 locus_tag LOCUS_56050 CDS 3362..4888 product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814384.1 transl_table 11 codon_start 1 locus_tag LOCUS_56060 CDS complement(4985..5710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56070 CDS complement(5756..7150) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522601.1 transl_table 11 codon_start 1 locus_tag LOCUS_56080 CDS complement(7282..8223) product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926822.1 transl_table 11 codon_start 1 locus_tag LOCUS_56090 CDS 8255..9181 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 transl_table 11 codon_start 1 locus_tag LOCUS_56100 CDS 9196..10164 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765784.1 transl_table 11 codon_start 1 locus_tag LOCUS_56110 CDS 10173..12275 product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036209.1 transl_table 11 codon_start 1 locus_tag LOCUS_56120 CDS 12283..13401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56130 note possible pseudo, internal stop codon CDS complement(13419..14084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56140 CDS complement(14235..15977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56150 tRNA complement(14569..14664) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(16162..17169) product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378609.1 transl_table 11 codon_start 1 locus_tag LOCUS_56160 CDS complement(17191..18627) product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087741.1 transl_table 11 codon_start 1 locus_tag LOCUS_56170 CDS complement(18723..19892) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553207.1 transl_table 11 codon_start 1 locus_tag LOCUS_56180 CDS complement(19889..22384) product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187774.1 transl_table 11 codon_start 1 locus_tag LOCUS_56190 CDS complement(22389..25943) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205417.1 transl_table 11 codon_start 1 locus_tag LOCUS_56200 CDS complement(26046..28637) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039712.1 transl_table 11 codon_start 1 locus_tag LOCUS_56210 CDS 28708..29169 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197479.1 transl_table 11 codon_start 1 locus_tag LOCUS_56220 CDS 29166..29675 product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811812.1 transl_table 11 codon_start 1 locus_tag LOCUS_56230 CDS complement(29664..30233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56240 CDS 31035..32867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56250 CDS 32927..34834 product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 transl_table 11 codon_start 1 locus_tag LOCUS_56260 gene cysN CDS 35108..35482 product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192320.1 transl_table 11 codon_start 1 locus_tag LOCUS_56270 CDS 35490..36440 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550079.1 transl_table 11 codon_start 1 locus_tag LOCUS_56280 CDS 36448..37911 product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267578.1 transl_table 11 codon_start 1 locus_tag LOCUS_56290 CDS 37952..39562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56300 CDS complement(39779..40237) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103738.1 transl_table 11 codon_start 1 locus_tag LOCUS_56310 CDS complement(40289..41248) product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142190.1 transl_table 11 codon_start 1 locus_tag LOCUS_56320 CDS complement(41310..42293) product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 transl_table 11 codon_start 1 locus_tag LOCUS_56330 CDS complement(42290..43858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56340 CDS complement(43858..45081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56350 CDS complement(45086..46018) product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017275914.1 transl_table 11 codon_start 1 locus_tag LOCUS_56360 CDS complement(46028..46741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56370 CDS complement(46785..47684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56380 CDS complement(47677..49266) product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704484.1 transl_table 11 codon_start 1 locus_tag LOCUS_56390 CDS complement(49263..49985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56400 CDS complement(49982..50857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56410 CDS complement(50888..51829) product chain length determinant protein tyrosine kinase EpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106760242.1 transl_table 11 codon_start 1 locus_tag LOCUS_56420 gene epsG CDS complement(51829..53250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56430 CDS complement(53261..54151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56440 CDS complement(54148..55062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56450 CDS 55529..56623 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922545.1 transl_table 11 codon_start 1 locus_tag LOCUS_56460 CDS 56664..57764 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734411.1 transl_table 11 codon_start 1 locus_tag LOCUS_56470 CDS 57847..58716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56480 CDS 58713..59177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56490 CDS 59174..59668 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578443.1 transl_table 11 codon_start 1 locus_tag LOCUS_56500 CDS complement(59702..60433) product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189973.1 transl_table 11 codon_start 1 locus_tag LOCUS_56510 gene ubiE CDS complement(60448..60858) product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 transl_table 11 codon_start 1 locus_tag LOCUS_56520 CDS 60946..61932 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929877.1 transl_table 11 codon_start 1 locus_tag LOCUS_56530 CDS 62022..62579 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064951.1 transl_table 11 codon_start 1 locus_tag LOCUS_56540 CDS complement(62586..66500) product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189879.1 transl_table 11 codon_start 1 locus_tag LOCUS_56550 CDS complement(66674..67903) product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202972.1 transl_table 11 codon_start 1 locus_tag LOCUS_56560 gene argJ CDS complement(67950..70685) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194125.1 transl_table 11 codon_start 1 locus_tag LOCUS_56570 gene secA CDS 70848..71150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56580 tRNA complement(71219..71294) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS complement(71334..71852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56590 CDS complement(71856..72473) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185176.1 transl_table 11 codon_start 1 locus_tag LOCUS_56600 CDS complement(72584..73348) product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199892.1 transl_table 11 codon_start 1 locus_tag LOCUS_56610 CDS complement(73371..74771) product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815816.1 transl_table 11 codon_start 1 locus_tag LOCUS_56620 CDS complement(74796..75395) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064798.1 transl_table 11 codon_start 1 locus_tag LOCUS_56630 gene petA CDS 75557..76069 product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192898.1 transl_table 11 codon_start 1 locus_tag LOCUS_56640 gene mscL CDS complement(76066..77097) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399975.1 transl_table 11 codon_start 1 locus_tag LOCUS_56650 gene pdxA CDS complement(77118..77870) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202811.1 transl_table 11 codon_start 1 locus_tag LOCUS_56660 CDS 77886..79064 product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521939.1 transl_table 11 codon_start 1 locus_tag LOCUS_56670 CDS complement(79246..80046) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815810.1 transl_table 11 codon_start 1 locus_tag LOCUS_56680 gene tatC CDS complement(80043..80537) product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531855.1 transl_table 11 codon_start 1 locus_tag LOCUS_56690 gene tatB CDS complement(80638..80895) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815808.1 transl_table 11 codon_start 1 locus_tag LOCUS_56700 gene tatA CDS complement(81077..81424) product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185206.1 transl_table 11 codon_start 1 locus_tag LOCUS_56710 CDS complement(81447..81845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814593.1 transl_table 11 codon_start 1 locus_tag LOCUS_56720 CDS complement(81873..82223) product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927225.1 transl_table 11 codon_start 1 locus_tag LOCUS_56730 CDS complement(82220..82615) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095888.1 transl_table 11 codon_start 1 locus_tag LOCUS_56740 gene hisI CDS complement(82629..83105) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527779.1 transl_table 11 codon_start 1 locus_tag LOCUS_56750 CDS complement(83098..84027) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194150.1 transl_table 11 codon_start 1 locus_tag LOCUS_56760 CDS complement(84116..84772) product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268716.1 transl_table 11 codon_start 1 locus_tag LOCUS_56770 gene pdeM CDS complement(84792..85433) product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927138.1 transl_table 11 codon_start 1 locus_tag LOCUS_56780 gene slmA CDS complement(85597..86289) product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815194.1 transl_table 11 codon_start 1 locus_tag LOCUS_56790 CDS complement(86289..87200) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200214.1 transl_table 11 codon_start 1 locus_tag LOCUS_56800 gene argB CDS 87431..87940 product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064916.1 transl_table 11 codon_start 1 locus_tag LOCUS_56810 CDS 87999..89087 product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389388.1 transl_table 11 codon_start 1 locus_tag LOCUS_56820 gene dmeF sequence027 source 1..83682 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(156..398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56830 CDS complement(634..957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56840 CDS complement(1119..1325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56850 CDS complement(1516..1818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56860 CDS 1708..1959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56870 CDS complement(2324..3952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56880 CDS complement(3949..4920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56890 CDS complement(4935..5636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56900 CDS complement(5690..5956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56910 CDS complement(5847..6068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56920 CDS complement(6065..6445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56930 CDS complement(6447..6803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56940 CDS complement(6984..7463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56950 assembly_gap 7580..10709 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11043..12872) product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226485.1 transl_table 11 codon_start 1 locus_tag LOCUS_56960 CDS 13177..13842 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226204.1 transl_table 11 codon_start 1 locus_tag LOCUS_56970 CDS 13930..14277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56980 CDS complement(14649..14903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56990 CDS complement(15176..15634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57000 CDS complement(15666..16466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57010 CDS 17070..17927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57020 CDS 17810..20011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57030 CDS complement(20092..21084) product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529607.1 transl_table 11 codon_start 1 locus_tag LOCUS_57040 CDS complement(21257..23578) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938729.1 transl_table 11 codon_start 1 locus_tag LOCUS_57050 CDS complement(23626..24990) product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104856.1 transl_table 11 codon_start 1 locus_tag LOCUS_57060 gene dctA CDS complement(25323..26405) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001572362.1 transl_table 11 codon_start 1 locus_tag LOCUS_57070 CDS complement(26772..27029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57080 note possible pseudo, frameshifted CDS complement(27716..28123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57090 CDS 28427..28786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57100 CDS 29261..29785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57110 CDS 29782..31353 product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189815.1 transl_table 11 codon_start 1 locus_tag LOCUS_57120 gene ubiB CDS 31542..33002 product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 transl_table 11 codon_start 1 locus_tag LOCUS_57130 CDS 33106..33411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57140 CDS 33437..34102 product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807035.1 transl_table 11 codon_start 1 locus_tag LOCUS_57150 CDS 34176..35966 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189849.1 transl_table 11 codon_start 1 locus_tag LOCUS_57160 gene aspS CDS 36081..36341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57170 CDS 36437..36952 product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189197.1 transl_table 11 codon_start 1 locus_tag LOCUS_57180 gene nudB CDS 36956..37774 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113649.1 transl_table 11 codon_start 1 locus_tag LOCUS_57190 CDS 37851..39182 product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807044.1 transl_table 11 codon_start 1 locus_tag LOCUS_57200 gene clsB CDS complement(39176..40018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57210 CDS complement(40106..40453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57220 CDS 40523..41629 product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104885.1 transl_table 11 codon_start 1 locus_tag LOCUS_57230 CDS complement(41640..44297) product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626250.1 transl_table 11 codon_start 1 locus_tag LOCUS_57240 CDS 44483..44962 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811322.1 transl_table 11 codon_start 1 locus_tag LOCUS_57250 CDS 44955..46361 product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211273.1 transl_table 11 codon_start 1 locus_tag LOCUS_57260 CDS complement(46405..47196) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085663.1 transl_table 11 codon_start 1 locus_tag LOCUS_57270 CDS 47355..47924 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192666.1 transl_table 11 codon_start 1 locus_tag LOCUS_57280 gene dcd CDS 48089..48967 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928448.1 transl_table 11 codon_start 1 locus_tag LOCUS_57290 CDS 48981..49415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57300 CDS complement(49422..50618) product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040791.1 transl_table 11 codon_start 1 locus_tag LOCUS_57310 CDS complement(50690..51607) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530154.1 transl_table 11 codon_start 1 locus_tag LOCUS_57320 CDS complement(51783..52262) product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192692.1 transl_table 11 codon_start 1 locus_tag LOCUS_57330 CDS 52339..52743 product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689264.1 transl_table 11 codon_start 1 locus_tag LOCUS_57340 CDS 52836..53456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57350 CDS 53533..55236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57360 CDS 55236..56054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57370 CDS complement(56128..56631) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523329.1 transl_table 11 codon_start 1 locus_tag LOCUS_57380 CDS complement(56889..57131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57390 CDS 57025..57747 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073705.1 transl_table 11 codon_start 1 locus_tag LOCUS_57400 CDS 57744..57956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57410 CDS complement(57987..58379) product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057670999.1 transl_table 11 codon_start 1 locus_tag LOCUS_57420 CDS complement(58498..60018) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 transl_table 11 codon_start 1 locus_tag LOCUS_57430 CDS 60021..60395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57440 CDS complement(60490..61740) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810865.1 transl_table 11 codon_start 1 locus_tag LOCUS_57450 gene dinB CDS 61930..62196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57460 CDS 62548..63426 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551552.1 transl_table 11 codon_start 1 locus_tag LOCUS_57470 CDS complement(63464..63826) product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227402.1 transl_table 11 codon_start 1 locus_tag LOCUS_57480 CDS 63926..65674 product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268710.1 transl_table 11 codon_start 1 locus_tag LOCUS_57490 CDS 65817..66845 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388793.1 transl_table 11 codon_start 1 locus_tag LOCUS_57500 CDS 66965..67300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57510 CDS complement(67393..67971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57520 CDS complement(68114..68563) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195485.1 transl_table 11 codon_start 1 locus_tag LOCUS_57530 CDS complement(68632..70014) product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114467.1 transl_table 11 codon_start 1 locus_tag LOCUS_57540 CDS complement(70004..70807) product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193651.1 transl_table 11 codon_start 1 locus_tag LOCUS_57550 gene hutG CDS complement(70804..71868) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532676.1 transl_table 11 codon_start 1 locus_tag LOCUS_57560 CDS complement(71996..72367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57570 tRNA 72791..72865 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA 72924..72999 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS 73168..74352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57580 CDS complement(74451..74966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57590 CDS complement(74963..75334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57600 CDS 75222..75443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57610 CDS 75581..77206 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315794.1 transl_table 11 codon_start 1 locus_tag LOCUS_57620 CDS 77589..80381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57630 CDS 80405..81316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57640 CDS 81557..81907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57650 CDS complement(81921..82478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57660 CDS 82595..83368 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036975.1 transl_table 11 codon_start 1 locus_tag LOCUS_57670 sequence028 source 1..77994 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57680 CDS 433..1452 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224149877.1 transl_table 11 codon_start 1 locus_tag LOCUS_57690 CDS complement(1735..4437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57700 CDS complement(4516..5598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57710 CDS complement(6388..9138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57720 CDS 9422..10054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57730 assembly_gap 9850..9859 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9955..10611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57740 CDS 10577..10780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57750 CDS complement(10820..12775) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266176.1 transl_table 11 codon_start 1 locus_tag LOCUS_57760 CDS complement(13878..14201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57770 CDS 14333..15133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57780 CDS complement(15207..15518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57790 CDS 15411..15629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57800 CDS complement(15626..15931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57810 CDS complement(15891..17324) product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926802.1 transl_table 11 codon_start 1 locus_tag LOCUS_57820 CDS complement(17337..18221) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931174.1 transl_table 11 codon_start 1 locus_tag LOCUS_57830 CDS 18458..19399 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089137.1 transl_table 11 codon_start 1 locus_tag LOCUS_57840 CDS complement(19500..20324) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085178.1 transl_table 11 codon_start 1 locus_tag LOCUS_57850 CDS 20543..20773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57860 CDS 20841..22163 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083890.1 transl_table 11 codon_start 1 locus_tag LOCUS_57870 CDS 22179..23618 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083889.1 transl_table 11 codon_start 1 locus_tag LOCUS_57880 CDS 23624..23947 product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083869.1 transl_table 11 codon_start 1 locus_tag LOCUS_57890 CDS 23950..25194 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921354.1 transl_table 11 codon_start 1 locus_tag LOCUS_57900 CDS 25270..26457 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088694.1 transl_table 11 codon_start 1 locus_tag LOCUS_57910 CDS 26490..27350 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088693.1 transl_table 11 codon_start 1 locus_tag LOCUS_57920 CDS 27350..28312 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088692.1 transl_table 11 codon_start 1 locus_tag LOCUS_57930 CDS 28309..29136 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088691.1 transl_table 11 codon_start 1 locus_tag LOCUS_57940 CDS 29129..29872 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088690.1 transl_table 11 codon_start 1 locus_tag LOCUS_57950 CDS 29869..30588 product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113559.1 transl_table 11 codon_start 1 locus_tag LOCUS_57960 CDS complement(30771..31904) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543370.1 transl_table 11 codon_start 1 locus_tag LOCUS_57970 CDS complement(32315..33019) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853488.1 transl_table 11 codon_start 1 locus_tag LOCUS_57980 CDS complement(33016..33588) product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082483.1 transl_table 11 codon_start 1 locus_tag LOCUS_57990 CDS complement(33627..34187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58000 CDS complement(34196..35185) product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813030.1 transl_table 11 codon_start 1 locus_tag LOCUS_58010 CDS complement(35297..35551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58020 CDS 35435..36421 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096239.1 transl_table 11 codon_start 1 locus_tag LOCUS_58030 CDS 36438..36797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58040 CDS complement(37072..38892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58050 CDS 40043..40519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58060 CDS complement(40678..40977) product SWIB/MDM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814592.1 transl_table 11 codon_start 1 locus_tag LOCUS_58070 CDS 41174..41560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58080 CDS 41579..43276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58090 CDS complement(43621..43851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58100 CDS 45072..45527 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072053.1 transl_table 11 codon_start 1 locus_tag LOCUS_58110 CDS 45556..46773 product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974144.1 transl_table 11 codon_start 1 locus_tag LOCUS_58120 CDS 46828..47181 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086888.1 transl_table 11 codon_start 1 locus_tag LOCUS_58130 CDS 47178..48827 product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705923.1 transl_table 11 codon_start 1 locus_tag LOCUS_58140 gene actP CDS 49031..49753 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966768.1 transl_table 11 codon_start 1 locus_tag LOCUS_58150 CDS 49821..50543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58160 CDS complement(50487..50753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58170 note possible pseudo, internal stop codon, frameshifted CDS complement(51063..52505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58180 CDS 54487..54816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58190 CDS complement(54821..55204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58200 CDS complement(55511..55717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58210 CDS complement(55944..56117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58220 CDS 56877..57326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58230 CDS complement(57463..57987) product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175145.1 transl_table 11 codon_start 1 locus_tag LOCUS_58240 CDS complement(58111..58755) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848275.1 transl_table 11 codon_start 1 locus_tag LOCUS_58250 CDS complement(58752..60296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58260 CDS 60366..60824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58270 CDS 61093..62583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58280 CDS complement(62645..63190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58290 CDS complement(63215..63574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58300 CDS 63751..64965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58310 CDS 64962..65873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58320 CDS 66256..67071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58330 CDS 67068..68006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58340 CDS 68505..69107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58350 CDS 69067..70068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58360 CDS 70298..70540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58370 CDS 70829..71116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58380 CDS 71362..71595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58390 assembly_gap 71707..71716 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(72650..72901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58400 CDS 72791..73093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58410 CDS 73283..73564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58420 CDS 73561..73974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58430 CDS complement(74020..74997) product IS630-like element ISBj5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085265.1 transl_table 11 codon_start 1 locus_tag LOCUS_58440 CDS 75474..75716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58450 CDS 75749..76222 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193608.1 transl_table 11 codon_start 1 locus_tag LOCUS_58460 CDS complement(76258..76584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58470 CDS complement(76581..76991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58480 CDS complement(76876..77994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58490 sequence029 source 1..76942 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(554..1432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58500 CDS 1521..2684 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040941552.1 transl_table 11 codon_start 1 locus_tag LOCUS_58510 gene dapE CDS complement(2704..3042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58520 CDS complement(3185..4261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58530 CDS 4549..4818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331494.1 transl_table 11 codon_start 1 locus_tag LOCUS_58540 CDS complement(4846..5562) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192421.1 transl_table 11 codon_start 1 locus_tag LOCUS_58550 CDS complement(5559..7448) product type IV pili methyl-accepting chemotaxis transducer N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193869.1 transl_table 11 codon_start 1 locus_tag LOCUS_58560 CDS 7634..8203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58570 CDS complement(8267..9967) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820458.1 transl_table 11 codon_start 1 locus_tag LOCUS_58580 CDS 9891..10082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58590 CDS 10282..10590 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039127.1 transl_table 11 codon_start 1 locus_tag LOCUS_58600 CDS 10587..12317 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039126.1 transl_table 11 codon_start 1 locus_tag LOCUS_58610 CDS complement(12405..12806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58620 CDS complement(12799..13530) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533626.1 transl_table 11 codon_start 1 locus_tag LOCUS_58630 CDS complement(13527..14615) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645220.1 transl_table 11 codon_start 1 locus_tag LOCUS_58640 CDS complement(14647..16167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085894.1 transl_table 11 codon_start 1 locus_tag LOCUS_58650 CDS 16863..18530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58660 CDS 18536..19270 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632821.1 transl_table 11 codon_start 1 locus_tag LOCUS_58670 CDS 19458..19928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58680 CDS 20152..20328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58690 CDS 20443..20619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58700 CDS 20764..20940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58710 CDS 20994..21554 product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939394.1 transl_table 11 codon_start 1 locus_tag LOCUS_58720 CDS 21563..22879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529404.1 transl_table 11 codon_start 1 locus_tag LOCUS_58730 CDS 22924..23799 product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523372.1 transl_table 11 codon_start 1 locus_tag LOCUS_58740 gene cpaB CDS 23799..25577 product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939396.1 transl_table 11 codon_start 1 locus_tag LOCUS_58750 CDS 25590..25862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58760 CDS 25878..26423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58770 CDS 26435..26929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58780 CDS 26962..27366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58790 CDS 27389..28561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58800 CDS 28573..29934 product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537977.1 transl_table 11 codon_start 1 locus_tag LOCUS_58810 CDS 29942..30916 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537325.1 transl_table 11 codon_start 1 locus_tag LOCUS_58820 CDS 30929..31879 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523363.1 transl_table 11 codon_start 1 locus_tag LOCUS_58830 CDS 31887..33014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58840 CDS 33074..33460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317528.1 transl_table 11 codon_start 1 locus_tag LOCUS_58850 CDS complement(33523..34818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58860 CDS 35115..35678 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036070.1 transl_table 11 codon_start 1 locus_tag LOCUS_58870 gene ahpC CDS 35895..37466 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315309.1 transl_table 11 codon_start 1 locus_tag LOCUS_58880 gene ahpF CDS complement(37537..38208) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388391.1 transl_table 11 codon_start 1 locus_tag LOCUS_58890 CDS complement(38205..40040) product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086890.1 transl_table 11 codon_start 1 locus_tag LOCUS_58900 CDS complement(40176..40817) product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186002.1 transl_table 11 codon_start 1 locus_tag LOCUS_58910 CDS complement(40814..41056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58920 CDS complement(41053..41547) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525946.1 transl_table 11 codon_start 1 locus_tag LOCUS_58930 CDS complement(41614..42015) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531694.1 transl_table 11 codon_start 1 locus_tag LOCUS_58940 CDS complement(42046..42642) product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337073.1 transl_table 11 codon_start 1 locus_tag LOCUS_58950 CDS 42744..43373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58960 CDS complement(43434..44099) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522956.1 transl_table 11 codon_start 1 locus_tag LOCUS_58970 CDS complement(44226..45404) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815952.1 transl_table 11 codon_start 1 locus_tag LOCUS_58980 CDS complement(45485..47326) product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525974.1 transl_table 11 codon_start 1 locus_tag LOCUS_58990 gene aceK CDS complement(47374..48210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59000 CDS complement(48290..48745) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530371.1 transl_table 11 codon_start 1 locus_tag LOCUS_59010 CDS 48808..49866 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815946.1 transl_table 11 codon_start 1 locus_tag LOCUS_59020 CDS complement(50113..50913) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189715.1 transl_table 11 codon_start 1 locus_tag LOCUS_59030 CDS complement(50927..51709) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190040.1 transl_table 11 codon_start 1 locus_tag LOCUS_59040 CDS complement(51709..52311) product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522791.1 transl_table 11 codon_start 1 locus_tag LOCUS_59050 gene gmhB CDS complement(52308..54464) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189008.1 transl_table 11 codon_start 1 locus_tag LOCUS_59060 gene glyS CDS complement(54464..55393) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189444.1 transl_table 11 codon_start 1 locus_tag LOCUS_59070 gene glyQ CDS complement(55501..57033) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064331.1 transl_table 11 codon_start 1 locus_tag LOCUS_59080 gene lnt CDS complement(57030..57914) product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189366.1 transl_table 11 codon_start 1 locus_tag LOCUS_59090 CDS 58038..59075 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199061.1 transl_table 11 codon_start 1 locus_tag LOCUS_59100 CDS 59103..59801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59110 CDS 59830..61356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59120 CDS 61428..61985 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818422.1 transl_table 11 codon_start 1 locus_tag LOCUS_59130 gene hslV CDS 62047..63375 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198316.1 transl_table 11 codon_start 1 locus_tag LOCUS_59140 gene hslU CDS 63482..64750 product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 transl_table 11 codon_start 1 locus_tag LOCUS_59150 gene egtB CDS 64797..65078 product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 transl_table 11 codon_start 1 locus_tag LOCUS_59160 CDS complement(65113..65880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59170 CDS complement(65927..66310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59180 CDS complement(66348..66608) product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814252.1 transl_table 11 codon_start 1 locus_tag LOCUS_59190 gene minE CDS complement(66615..67430) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185427.1 transl_table 11 codon_start 1 locus_tag LOCUS_59200 gene minD CDS complement(67491..68231) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522312.1 transl_table 11 codon_start 1 locus_tag LOCUS_59210 gene minC CDS 68349..69836 product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190957.1 transl_table 11 codon_start 1 locus_tag LOCUS_59220 CDS 69980..70156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59230 CDS 70157..71038 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113649.1 transl_table 11 codon_start 1 locus_tag LOCUS_59240 CDS 71035..72282 product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704806.1 transl_table 11 codon_start 1 locus_tag LOCUS_59250 gene clsB CDS 72345..73283 product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765028.1 transl_table 11 codon_start 1 locus_tag LOCUS_59260 CDS 73513..75561 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479820.1 transl_table 11 codon_start 1 locus_tag LOCUS_59270 gene fusA CDS complement(75562..76509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59280 rRNA complement(76656..76761) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 sequence030 source 1..76123 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 360..599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59290 CDS 1027..1461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59300 CDS 1768..2187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59310 CDS complement(2249..3094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59320 CDS complement(3284..3937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59330 CDS 4380..4868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59340 CDS complement(5204..5551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59350 CDS complement(5643..5828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59360 CDS 6503..8587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59370 CDS complement(9059..9214) product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003468167.1 transl_table 11 codon_start 1 locus_tag LOCUS_59380 CDS 9401..9589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59390 CDS 10105..10356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59400 CDS complement(10363..10809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59410 CDS 10900..11112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59420 CDS complement(11266..11721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59430 CDS complement(11817..13457) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972416.1 transl_table 11 codon_start 1 locus_tag LOCUS_59440 CDS 13499..14239 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081162185.1 transl_table 11 codon_start 1 locus_tag LOCUS_59450 CDS 14272..14493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59460 CDS complement(14796..16469) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085471.1 transl_table 11 codon_start 1 locus_tag LOCUS_59470 CDS complement(16792..17889) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543370.1 transl_table 11 codon_start 1 locus_tag LOCUS_59480 CDS complement(18021..19010) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065024.1 transl_table 11 codon_start 1 locus_tag LOCUS_59490 CDS 19108..19776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59500 CDS complement(19901..20236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59510 CDS complement(20274..20402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59520 assembly_gap 20418..21947 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(22178..23638) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191226.1 transl_table 11 codon_start 1 locus_tag LOCUS_59530 CDS complement(23654..24457) product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889550.1 transl_table 11 codon_start 1 locus_tag LOCUS_59540 gene hpaI CDS complement(24495..25883) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038773.1 transl_table 11 codon_start 1 locus_tag LOCUS_59550 CDS complement(26056..27591) product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 transl_table 11 codon_start 1 locus_tag LOCUS_59560 CDS complement(27658..28638) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083775.1 transl_table 11 codon_start 1 locus_tag LOCUS_59570 CDS 28743..29741 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089777.1 transl_table 11 codon_start 1 locus_tag LOCUS_59580 CDS complement(30120..31250) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930034.1 transl_table 11 codon_start 1 locus_tag LOCUS_59590 CDS complement(31464..31730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59600 CDS complement(31727..32074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59610 assembly_gap 31743..31752 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(32116..32895) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522439.1 transl_table 11 codon_start 1 locus_tag LOCUS_59620 CDS complement(32921..34285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59630 CDS complement(34292..35086) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312496.1 transl_table 11 codon_start 1 locus_tag LOCUS_59640 CDS complement(35175..36143) product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112912.1 transl_table 11 codon_start 1 locus_tag LOCUS_59650 CDS complement(36156..37436) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083890.1 transl_table 11 codon_start 1 locus_tag LOCUS_59660 CDS complement(37447..38436) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064844.1 transl_table 11 codon_start 1 locus_tag LOCUS_59670 CDS complement(38454..39692) product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083760.1 transl_table 11 codon_start 1 locus_tag LOCUS_59680 CDS complement(39731..40732) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039103.1 transl_table 11 codon_start 1 locus_tag LOCUS_59690 CDS complement(40743..41141) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630808.1 transl_table 11 codon_start 1 locus_tag LOCUS_59700 CDS complement(41156..41896) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965238.1 transl_table 11 codon_start 1 locus_tag LOCUS_59710 CDS 42259..44385 product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086230.1 transl_table 11 codon_start 1 locus_tag LOCUS_59720 CDS 44398..45600 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185551.1 transl_table 11 codon_start 1 locus_tag LOCUS_59730 CDS 45612..46742 product pimeloyl-CoA dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090541.1 transl_table 11 codon_start 1 locus_tag LOCUS_59740 gene pimD CDS 46779..47759 product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064450.1 transl_table 11 codon_start 1 locus_tag LOCUS_59750 CDS 47774..48976 product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967073.1 transl_table 11 codon_start 1 locus_tag LOCUS_59760 CDS 48978..49388 product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088090.1 transl_table 11 codon_start 1 locus_tag LOCUS_59770 CDS 49401..50603 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966992.1 transl_table 11 codon_start 1 locus_tag LOCUS_59780 CDS 50618..51616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59790 CDS 51624..52280 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727135.1 transl_table 11 codon_start 1 locus_tag LOCUS_59800 CDS 52286..52939 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727135.1 transl_table 11 codon_start 1 locus_tag LOCUS_59810 CDS 52945..53613 product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086423.1 transl_table 11 codon_start 1 locus_tag LOCUS_59820 CDS 53624..54409 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090581.1 transl_table 11 codon_start 1 locus_tag LOCUS_59830 CDS 54399..54839 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919964.1 transl_table 11 codon_start 1 locus_tag LOCUS_59840 CDS 54979..56091 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523466.1 transl_table 11 codon_start 1 locus_tag LOCUS_59850 CDS complement(56181..57176) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252799.1 transl_table 11 codon_start 1 locus_tag LOCUS_59860 CDS 57303..58478 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222736.1 transl_table 11 codon_start 1 locus_tag LOCUS_59870 CDS 58521..58940 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965610.1 transl_table 11 codon_start 1 locus_tag LOCUS_59880 CDS 58979..59446 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244522.1 transl_table 11 codon_start 1 locus_tag LOCUS_59890 CDS 59461..60723 product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967043.1 transl_table 11 codon_start 1 locus_tag LOCUS_59900 CDS complement(60695..61618) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810803.1 transl_table 11 codon_start 1 locus_tag LOCUS_59910 CDS complement(61795..62664) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047906135.1 transl_table 11 codon_start 1 locus_tag LOCUS_59920 CDS complement(62704..63762) product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013499.1 transl_table 11 codon_start 1 locus_tag LOCUS_59930 gene dmpG CDS complement(63777..64721) product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044321.1 transl_table 11 codon_start 1 locus_tag LOCUS_59940 gene mhpF CDS complement(64732..65709) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815063.1 transl_table 11 codon_start 1 locus_tag LOCUS_59950 CDS complement(65743..66531) product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160712.1 transl_table 11 codon_start 1 locus_tag LOCUS_59960 gene mhpD CDS complement(66549..67505) product 3-carboxyethylcatechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543457.1 transl_table 11 codon_start 1 locus_tag LOCUS_59970 gene mhpB CDS complement(67502..69295) product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007421.1 transl_table 11 codon_start 1 locus_tag LOCUS_59980 CDS 69425..70240 product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301325.1 transl_table 11 codon_start 1 locus_tag LOCUS_59990 CDS complement(70471..70704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60000 CDS 70655..71212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60010 CDS 71262..71882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60020 CDS 71767..73215 product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929886.1 transl_table 11 codon_start 1 locus_tag LOCUS_60030 CDS 73474..73923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60040 CDS complement(74049..75380) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405216.1 transl_table 11 codon_start 1 locus_tag LOCUS_60050 sequence031 source 1..73785 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 510..1601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60060 CDS 1795..2769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60070 CDS complement(3810..4229) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112767.1 transl_table 11 codon_start 1 locus_tag LOCUS_60080 CDS complement(4242..4688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60090 CDS complement(4940..5110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60100 CDS 5065..5766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60110 CDS 5883..6290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60120 CDS 6354..6749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60130 note possible pseudo, internal stop codon CDS 6792..7034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60140 note possible pseudo, internal stop codon CDS complement(7098..7496) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087886.1 transl_table 11 codon_start 1 locus_tag LOCUS_60150 CDS 7848..9104 product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029732907.1 transl_table 11 codon_start 1 locus_tag LOCUS_60160 CDS complement(9424..10356) product ArgP/LysG family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937897.1 transl_table 11 codon_start 1 locus_tag LOCUS_60170 CDS 10630..10857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60180 CDS complement(10943..11398) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036436.1 transl_table 11 codon_start 1 locus_tag LOCUS_60190 CDS complement(11398..11988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60200 CDS complement(11985..13523) product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815842.1 transl_table 11 codon_start 1 locus_tag LOCUS_60210 gene trbL CDS complement(13520..13747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60220 CDS complement(13747..14496) product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039736.1 transl_table 11 codon_start 1 locus_tag LOCUS_60230 gene trbJ CDS complement(14493..14819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60240 CDS complement(14819..16201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60250 CDS complement(16204..16623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60260 CDS complement(16623..17519) product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974834.1 transl_table 11 codon_start 1 locus_tag LOCUS_60270 gene trbG CDS complement(17528..18253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60280 CDS complement(18250..20784) product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974837.1 transl_table 11 codon_start 1 locus_tag LOCUS_60290 CDS complement(20781..21098) product conjugal transfer protein TrbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891626.1 transl_table 11 codon_start 1 locus_tag LOCUS_60300 CDS complement(21102..21482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60310 CDS complement(21511..22476) product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970254.1 transl_table 11 codon_start 1 locus_tag LOCUS_60320 gene trbB CDS complement(22544..22906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60330 CDS 23069..23299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60340 CDS 23371..24375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60350 CDS 24365..24721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60360 CDS complement(24729..25094) product conjugal transfer transcriptional regulator TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039733.1 transl_table 11 codon_start 1 locus_tag LOCUS_60370 gene traJ CDS 25471..25866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60380 CDS 25866..26591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60390 CDS 26591..27031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60400 CDS 27070..29388 product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938884.1 transl_table 11 codon_start 1 locus_tag LOCUS_60410 CDS 29385..31301 product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533272.1 transl_table 11 codon_start 1 locus_tag LOCUS_60420 CDS 31298..31495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60430 CDS 31492..32019 product conjugative transfer signal peptidase TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970269.1 transl_table 11 codon_start 1 locus_tag LOCUS_60440 gene traF CDS 32033..32239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60450 CDS 32242..34836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60460 CDS 35243..36250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60470 CDS complement(36364..37392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60480 CDS complement(37389..38060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60490 CDS 39005..39187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60500 CDS complement(39504..39881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60510 CDS 40240..41091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60520 note possible pseudo, frameshifted CDS 41373..41636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60530 CDS complement(41719..42954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60540 CDS 43380..43649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60550 CDS 44468..45388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60560 CDS 45594..45872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60570 CDS 45898..46419 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812293.1 transl_table 11 codon_start 1 locus_tag LOCUS_60580 CDS complement(46512..47264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60590 assembly_gap 47319..48818 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 48958..49251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60600 CDS 49223..49549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60610 CDS 49716..50132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60620 CDS 50233..53766 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680859.1 transl_table 11 codon_start 1 locus_tag LOCUS_60630 CDS 54434..55348 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529454.1 transl_table 11 codon_start 1 locus_tag LOCUS_60640 CDS complement(55351..55548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60650 CDS 55531..56082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60660 CDS 56225..57124 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143867.1 transl_table 11 codon_start 1 locus_tag LOCUS_60670 CDS complement(57240..57863) product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970175.1 transl_table 11 codon_start 1 locus_tag LOCUS_60680 gene wrbA CDS 58102..59175 product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119474.1 transl_table 11 codon_start 1 locus_tag LOCUS_60690 CDS complement(59236..59895) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064403.1 transl_table 11 codon_start 1 locus_tag LOCUS_60700 CDS 60158..61519 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064402.1 transl_table 11 codon_start 1 locus_tag LOCUS_60710 CDS 61530..62726 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040422.1 transl_table 11 codon_start 1 locus_tag LOCUS_60720 CDS 62723..63511 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808963.1 transl_table 11 codon_start 1 locus_tag LOCUS_60730 CDS 63542..64453 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818697.1 transl_table 11 codon_start 1 locus_tag LOCUS_60740 CDS 64450..65850 product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015243160.1 transl_table 11 codon_start 1 locus_tag LOCUS_60750 CDS 65873..66913 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926712.1 transl_table 11 codon_start 1 locus_tag LOCUS_60760 CDS 66924..67586 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811059.1 transl_table 11 codon_start 1 locus_tag LOCUS_60770 CDS 67583..68872 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811061.1 transl_table 11 codon_start 1 locus_tag LOCUS_60780 CDS 68977..69819 product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925894.1 transl_table 11 codon_start 1 locus_tag LOCUS_60790 CDS 69880..71010 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807998.1 transl_table 11 codon_start 1 locus_tag LOCUS_60800 CDS 71131..71895 product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073859065.1 transl_table 11 codon_start 1 locus_tag LOCUS_60810 CDS 71892..72653 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064586.1 transl_table 11 codon_start 1 locus_tag LOCUS_60820 CDS 72655..73587 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064585.1 transl_table 11 codon_start 1 locus_tag LOCUS_60830 sequence032 source 1..65975 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(9807..50720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60840 assembly_gap 9990..11214 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA complement(14352..14446) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(45498..45581) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS complement(50730..51692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60850 CDS complement(51679..52395) product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944588.1 transl_table 11 codon_start 1 locus_tag LOCUS_60860 CDS complement(52415..54430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60870 CDS complement(54427..56601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60880 CDS complement(56669..58684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60890 CDS complement(58703..59605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60900 CDS complement(59602..61137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60910 CDS complement(62150..63022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60920 CDS complement(63255..63533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60930 CDS complement(64447..64986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60940 sequence033 source 1..66478 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(795..1382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60950 CDS complement(1437..2780) product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 transl_table 11 codon_start 1 locus_tag LOCUS_60960 CDS complement(2805..4451) product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 transl_table 11 codon_start 1 locus_tag LOCUS_60970 CDS complement(4523..5563) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030815.1 transl_table 11 codon_start 1 locus_tag LOCUS_60980 CDS complement(5596..6525) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093421.1 transl_table 11 codon_start 1 locus_tag LOCUS_60990 CDS complement(7174..7599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61000 CDS complement(8178..9188) product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083666.1 transl_table 11 codon_start 1 locus_tag LOCUS_61010 CDS complement(9191..10483) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173981.1 transl_table 11 codon_start 1 locus_tag LOCUS_61020 gene eno CDS complement(10505..11458) product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 transl_table 11 codon_start 1 locus_tag LOCUS_61030 CDS complement(11455..12453) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030815.1 transl_table 11 codon_start 1 locus_tag LOCUS_61040 CDS 12539..12808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61050 CDS complement(12801..13925) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089165.1 transl_table 11 codon_start 1 locus_tag LOCUS_61060 CDS complement(13957..15006) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 transl_table 11 codon_start 1 locus_tag LOCUS_61070 CDS complement(15124..16191) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728080.1 transl_table 11 codon_start 1 locus_tag LOCUS_61080 CDS complement(16195..16923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61090 CDS 17107..17313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61100 CDS complement(17508..18458) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089169.1 transl_table 11 codon_start 1 locus_tag LOCUS_61110 CDS 18653..19783 product FAD-dependent urate hydroxylase HpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384872.1 transl_table 11 codon_start 1 locus_tag LOCUS_61120 gene hpxO CDS 19856..20938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61130 CDS 20935..22608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61140 assembly_gap 22645..22654 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 22834..23148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61150 tRNA 23233..23323 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS 24194..24679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61160 CDS 25028..25519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61170 CDS complement(25640..25870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61180 CDS complement(26201..26533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61190 CDS complement(26533..26793) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809486.1 transl_table 11 codon_start 1 locus_tag LOCUS_61200 gene infA CDS 27401..28363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61210 CDS 28542..29360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61220 CDS 29384..30409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61230 CDS 30409..31569 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921524.1 transl_table 11 codon_start 1 locus_tag LOCUS_61240 CDS 31598..32398 product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 transl_table 11 codon_start 1 locus_tag LOCUS_61250 CDS 32417..33226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61260 assembly_gap 32884..32893 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(33360..33587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61270 CDS complement(33584..33727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61280 CDS complement(34557..36173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61290 CDS complement(36241..36879) product MEDS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970385.1 transl_table 11 codon_start 1 locus_tag LOCUS_61300 CDS 37160..37801 product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039562.1 transl_table 11 codon_start 1 locus_tag LOCUS_61310 CDS complement(37956..39212) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194502.1 transl_table 11 codon_start 1 locus_tag LOCUS_61320 CDS 39293..40669 product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 transl_table 11 codon_start 1 locus_tag LOCUS_61330 gene chrA CDS complement(40973..41401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61340 CDS complement(41468..42388) product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811759.1 transl_table 11 codon_start 1 locus_tag LOCUS_61350 CDS complement(42434..42862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61360 CDS 42970..45231 product arginine/lysine/ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808393.1 transl_table 11 codon_start 1 locus_tag LOCUS_61370 CDS complement(45353..46144) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191586.1 transl_table 11 codon_start 1 locus_tag LOCUS_61380 gene fabI CDS 46367..47053 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810544.1 transl_table 11 codon_start 1 locus_tag LOCUS_61390 gene rimP CDS 47050..48528 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193517.1 transl_table 11 codon_start 1 locus_tag LOCUS_61400 gene nusA CDS 48588..51659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61410 CDS 51730..52095 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199441.1 transl_table 11 codon_start 1 locus_tag LOCUS_61420 gene rbfA CDS 52100..53092 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 transl_table 11 codon_start 1 locus_tag LOCUS_61430 gene truB CDS 53106..54935 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193111.1 transl_table 11 codon_start 1 locus_tag LOCUS_61440 gene typA CDS 55144..56061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61450 CDS 56119..57072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61460 CDS 57253..58191 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009920631.1 transl_table 11 codon_start 1 locus_tag LOCUS_61470 gene dusA CDS 58443..59705 product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275477.1 transl_table 11 codon_start 1 locus_tag LOCUS_61480 CDS complement(59665..60549) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525413.1 transl_table 11 codon_start 1 locus_tag LOCUS_61490 CDS 61110..63296 product regulatory protein NosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004345196.1 transl_table 11 codon_start 1 locus_tag LOCUS_61500 CDS 63406..64311 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083152.1 transl_table 11 codon_start 1 locus_tag LOCUS_61510 CDS 64688..64927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61520 CDS 65138..65848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61530 sequence034 source 1..62679 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(148..966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61540 CDS complement(1133..2056) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193481.1 transl_table 11 codon_start 1 locus_tag LOCUS_61550 CDS 2185..2970 product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211074.1 transl_table 11 codon_start 1 locus_tag LOCUS_61560 gene hpaH CDS 2979..4451 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229069.1 transl_table 11 codon_start 1 locus_tag LOCUS_61570 CDS 4492..5517 product Bug family tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930661.1 transl_table 11 codon_start 1 locus_tag LOCUS_61580 CDS 5555..6802 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729152.1 transl_table 11 codon_start 1 locus_tag LOCUS_61590 CDS 6814..7773 product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815651.1 transl_table 11 codon_start 1 locus_tag LOCUS_61600 CDS 7793..8668 product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523563.1 transl_table 11 codon_start 1 locus_tag LOCUS_61610 CDS 8665..9546 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938174.1 transl_table 11 codon_start 1 locus_tag LOCUS_61620 CDS 9613..10587 product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064450.1 transl_table 11 codon_start 1 locus_tag LOCUS_61630 CDS 10612..12051 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976014.1 transl_table 11 codon_start 1 locus_tag LOCUS_61640 CDS 12069..13220 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097850.1 transl_table 11 codon_start 1 locus_tag LOCUS_61650 CDS 13227..15359 product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925439.1 transl_table 11 codon_start 1 locus_tag LOCUS_61660 CDS 15356..16156 product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027999571.1 transl_table 11 codon_start 1 locus_tag LOCUS_61670 gene hpaI CDS 16211..17539 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 transl_table 11 codon_start 1 locus_tag LOCUS_61680 CDS 17909..19045 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040259.1 transl_table 11 codon_start 1 locus_tag LOCUS_61690 CDS 19269..21071 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175139359.1 transl_table 11 codon_start 1 locus_tag LOCUS_61700 CDS 21068..21919 product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088963.1 transl_table 11 codon_start 1 locus_tag LOCUS_61710 CDS 23007..23753 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807995.1 transl_table 11 codon_start 1 locus_tag LOCUS_61720 CDS 23750..24547 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807987.1 transl_table 11 codon_start 1 locus_tag LOCUS_61730 CDS 24623..25501 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235433858.1 transl_table 11 codon_start 1 locus_tag LOCUS_61740 CDS complement(25508..26803) product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807983.1 transl_table 11 codon_start 1 locus_tag LOCUS_61750 CDS 26988..28223 product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224641.1 transl_table 11 codon_start 1 locus_tag LOCUS_61760 CDS 28245..29660 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 transl_table 11 codon_start 1 locus_tag LOCUS_61770 CDS 29732..30892 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085913.1 transl_table 11 codon_start 1 locus_tag LOCUS_61780 CDS 30892..32574 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193882.1 transl_table 11 codon_start 1 locus_tag LOCUS_61790 CDS complement(32607..33875) product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807983.1 transl_table 11 codon_start 1 locus_tag LOCUS_61800 CDS 34007..34957 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247165.1 transl_table 11 codon_start 1 locus_tag LOCUS_61810 CDS 35146..36309 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931215.1 transl_table 11 codon_start 1 locus_tag LOCUS_61820 CDS 36343..37518 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931674.1 transl_table 11 codon_start 1 locus_tag LOCUS_61830 CDS 37564..38523 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930495.1 transl_table 11 codon_start 1 locus_tag LOCUS_61840 CDS 38520..39947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61850 CDS complement(39964..40284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61860 CDS complement(40869..41282) product IS200/IS605-like element IS609 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604912.1 transl_table 11 codon_start 1 locus_tag LOCUS_61870 gene tnpA CDS 41311..42573 product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309930.1 transl_table 11 codon_start 1 locus_tag LOCUS_61880 CDS complement(42632..43558) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860032.1 transl_table 11 codon_start 1 locus_tag LOCUS_61890 CDS complement(43609..44826) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086703.1 transl_table 11 codon_start 1 locus_tag LOCUS_61900 CDS complement(44847..45638) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192728.1 transl_table 11 codon_start 1 locus_tag LOCUS_61910 CDS 45894..47039 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225722.1 transl_table 11 codon_start 1 locus_tag LOCUS_61920 CDS 47051..47548 product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929580.1 transl_table 11 codon_start 1 locus_tag LOCUS_61930 CDS 47554..48912 product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389228.1 transl_table 11 codon_start 1 locus_tag LOCUS_61940 CDS 48914..49255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 transl_table 11 codon_start 1 locus_tag LOCUS_61950 CDS 49272..50453 product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414142.1 transl_table 11 codon_start 1 locus_tag LOCUS_61960 CDS 50566..51573 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921424.1 transl_table 11 codon_start 1 locus_tag LOCUS_61970 CDS 51630..52799 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086703.1 transl_table 11 codon_start 1 locus_tag LOCUS_61980 CDS 52786..53691 product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446684.1 transl_table 11 codon_start 1 locus_tag LOCUS_61990 CDS 53709..54458 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807992.1 transl_table 11 codon_start 1 locus_tag LOCUS_62000 gene fabG CDS 54480..55685 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925892.1 transl_table 11 codon_start 1 locus_tag LOCUS_62010 CDS 55747..56499 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064586.1 transl_table 11 codon_start 1 locus_tag LOCUS_62020 CDS 56501..57433 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064585.1 transl_table 11 codon_start 1 locus_tag LOCUS_62030 CDS 57469..58623 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807990.1 transl_table 11 codon_start 1 locus_tag LOCUS_62040 CDS 58635..59531 product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925894.1 transl_table 11 codon_start 1 locus_tag LOCUS_62050 CDS 59531..60403 product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064995.1 transl_table 11 codon_start 1 locus_tag LOCUS_62060 CDS 60619..61764 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525210.1 transl_table 11 codon_start 1 locus_tag LOCUS_62070 misc_feature complement(61864..>62679) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815908.1:2-isopropylmalate synthase locus_tag LOCUS_62080 sequence035 source 1..62097 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(238..1446) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 transl_table 11 codon_start 1 locus_tag LOCUS_62090 CDS complement(1487..2623) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207123.1 transl_table 11 codon_start 1 locus_tag LOCUS_62100 CDS complement(2643..3410) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399793.1 transl_table 11 codon_start 1 locus_tag LOCUS_62110 CDS complement(3535..4323) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198410.1 transl_table 11 codon_start 1 locus_tag LOCUS_62120 CDS complement(4468..7974) product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085508.1 transl_table 11 codon_start 1 locus_tag LOCUS_62130 CDS 8124..8585 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089245.1 transl_table 11 codon_start 1 locus_tag LOCUS_62140 CDS complement(8586..9776) product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087191.1 transl_table 11 codon_start 1 locus_tag LOCUS_62150 CDS complement(10115..11866) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175139359.1 transl_table 11 codon_start 1 locus_tag LOCUS_62160 CDS complement(12144..12887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62170 assembly_gap 12282..12291 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13058..13843 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192152.1 transl_table 11 codon_start 1 locus_tag LOCUS_62180 CDS 13843..14496 product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528683.1 transl_table 11 codon_start 1 locus_tag LOCUS_62190 CDS 14511..14930 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191805.1 transl_table 11 codon_start 1 locus_tag LOCUS_62200 CDS complement(14995..15582) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191840.1 transl_table 11 codon_start 1 locus_tag LOCUS_62210 CDS 15681..16382 product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065123.1 transl_table 11 codon_start 1 locus_tag LOCUS_62220 CDS 16395..17033 product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813726.1 transl_table 11 codon_start 1 locus_tag LOCUS_62230 CDS complement(17097..18527) product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928587.1 transl_table 11 codon_start 1 locus_tag LOCUS_62240 CDS 18602..20467 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706842.1 transl_table 11 codon_start 1 locus_tag LOCUS_62250 gene ggt CDS complement(20570..21607) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814170.1 transl_table 11 codon_start 1 locus_tag LOCUS_62260 CDS 21649..22308 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192848.1 transl_table 11 codon_start 1 locus_tag LOCUS_62270 gene rpiA CDS complement(22364..24328) product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554661.1 transl_table 11 codon_start 1 locus_tag LOCUS_62280 gene mnmC CDS complement(24419..24973) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810194.1 transl_table 11 codon_start 1 locus_tag LOCUS_62290 gene efp CDS complement(25084..26118) product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114754.1 transl_table 11 codon_start 1 locus_tag LOCUS_62300 gene earP CDS 26188..28143 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449735.1 transl_table 11 codon_start 1 locus_tag LOCUS_62310 gene uvrC CDS 28130..28642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62320 CDS 28709..29275 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192722.1 transl_table 11 codon_start 1 locus_tag LOCUS_62330 gene pgsA CDS 29272..30168 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257820.1 transl_table 11 codon_start 1 locus_tag LOCUS_62340 CDS complement(30201..32375) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206690.1 transl_table 11 codon_start 1 locus_tag LOCUS_62350 CDS complement(32668..33774) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531877.1 transl_table 11 codon_start 1 locus_tag LOCUS_62360 CDS complement(33787..34110) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205776.1 transl_table 11 codon_start 1 locus_tag LOCUS_62370 CDS complement(34186..34947) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192678.1 transl_table 11 codon_start 1 locus_tag LOCUS_62380 gene cobA CDS complement(34963..35691) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192841.1 transl_table 11 codon_start 1 locus_tag LOCUS_62390 CDS complement(35697..36203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62400 CDS complement(36233..37948) product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553995.1 transl_table 11 codon_start 1 locus_tag LOCUS_62410 CDS 38197..39120 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553932.1 transl_table 11 codon_start 1 locus_tag LOCUS_62420 CDS complement(39331..39903) product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199567.1 transl_table 11 codon_start 1 locus_tag LOCUS_62430 CDS 40098..41054 product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 transl_table 11 codon_start 1 locus_tag LOCUS_62440 CDS 41192..42613 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527476.1 transl_table 11 codon_start 1 locus_tag LOCUS_62450 CDS 42663..43649 product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203830.1 transl_table 11 codon_start 1 locus_tag LOCUS_62460 CDS 43753..44724 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812334.1 transl_table 11 codon_start 1 locus_tag LOCUS_62470 CDS complement(44822..46849) product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191126.1 transl_table 11 codon_start 1 locus_tag LOCUS_62480 CDS complement(46950..47810) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524717.1 transl_table 11 codon_start 1 locus_tag LOCUS_62490 gene folD CDS complement(47876..48502) product oxygen response regulator transcription factor FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 transl_table 11 codon_start 1 locus_tag LOCUS_62500 gene fixJ CDS complement(48499..50910) product oxygen sensor histidine kinase FixL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557112.1 transl_table 11 codon_start 1 locus_tag LOCUS_62510 gene fixL CDS 50825..51127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62520 CDS 51213..53921 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811941.1 transl_table 11 codon_start 1 locus_tag LOCUS_62530 gene aceE CDS 53957..55636 product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063727.1 transl_table 11 codon_start 1 locus_tag LOCUS_62540 gene aceF CDS 55650..57467 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930129.1 transl_table 11 codon_start 1 locus_tag LOCUS_62550 gene lpdA CDS complement(57593..58144) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 transl_table 11 codon_start 1 locus_tag LOCUS_62560 CDS 58271..58909 product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930265.1 transl_table 11 codon_start 1 locus_tag LOCUS_62570 gene maiA CDS 58899..59684 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193202.1 transl_table 11 codon_start 1 locus_tag LOCUS_62580 gene pgeF CDS complement(59613..59879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62590 CDS 60010..61707 product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527151.1 transl_table 11 codon_start 1 locus_tag LOCUS_62600 gene phaC sequence036 source 1..58877 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(319..555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62610 CDS 437..1867 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188973.1 transl_table 11 codon_start 1 locus_tag LOCUS_62620 gene pyk CDS 2094..3143 product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064288.1 transl_table 11 codon_start 1 locus_tag LOCUS_62630 gene fba CDS 3260..4168 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189256.1 transl_table 11 codon_start 1 locus_tag LOCUS_62640 CDS 4474..5730 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389429.1 transl_table 11 codon_start 1 locus_tag LOCUS_62650 CDS complement(5811..6764) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522640.1 transl_table 11 codon_start 1 locus_tag LOCUS_62660 gene trxA CDS 6853..7335 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188932.1 transl_table 11 codon_start 1 locus_tag LOCUS_62670 gene purE CDS 7332..8516 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522681.1 transl_table 11 codon_start 1 locus_tag LOCUS_62680 CDS 8519..9502 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188980.1 transl_table 11 codon_start 1 locus_tag LOCUS_62690 CDS 9559..10557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62700 CDS complement(10580..12013) product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064320.1 transl_table 11 codon_start 1 locus_tag LOCUS_62710 gene dacB CDS 12103..12855 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199104.1 transl_table 11 codon_start 1 locus_tag LOCUS_62720 gene tsaB CDS 12852..13358 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191864.1 transl_table 11 codon_start 1 locus_tag LOCUS_62730 gene rimI CDS 13364..14344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62740 CDS complement(14436..14792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62750 CDS 15095..16342 product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197240.1 transl_table 11 codon_start 1 locus_tag LOCUS_62760 CDS complement(16339..16530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62770 CDS complement(16563..17669) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064710.1 transl_table 11 codon_start 1 locus_tag LOCUS_62780 CDS 17689..18465 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 transl_table 11 codon_start 1 locus_tag LOCUS_62790 CDS 18467..18871 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199336.1 transl_table 11 codon_start 1 locus_tag LOCUS_62800 CDS 18877..19818 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189298.1 transl_table 11 codon_start 1 locus_tag LOCUS_62810 gene ttcA CDS 19883..20533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62820 CDS complement(20556..21392) product DUF6279 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425465.1 transl_table 11 codon_start 1 locus_tag LOCUS_62830 CDS 21427..22797 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064821.1 transl_table 11 codon_start 1 locus_tag LOCUS_62840 gene glmU CDS complement(22876..23826) product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927008.1 transl_table 11 codon_start 1 locus_tag LOCUS_62850 CDS complement(23874..25868) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038717.1 transl_table 11 codon_start 1 locus_tag LOCUS_62860 CDS complement(26052..27008) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815402.1 transl_table 11 codon_start 1 locus_tag LOCUS_62870 CDS 27102..27479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62880 CDS 27574..28200 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197233.1 transl_table 11 codon_start 1 locus_tag LOCUS_62890 CDS complement(28268..28885) product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550362.1 transl_table 11 codon_start 1 locus_tag LOCUS_62900 CDS complement(29036..29893) product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 transl_table 11 codon_start 1 locus_tag LOCUS_62910 gene metF CDS complement(29890..30663) product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532785.1 transl_table 11 codon_start 1 locus_tag LOCUS_62920 CDS complement(30697..32130) product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038714.1 transl_table 11 codon_start 1 locus_tag LOCUS_62930 gene ahcY CDS complement(32337..33443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62940 CDS 33641..34519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62950 CDS 34516..35388 product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174491.1 transl_table 11 codon_start 1 locus_tag LOCUS_62960 CDS 35414..36859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62970 CDS 36888..38753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62980 CDS 38770..42213 product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895493.1 transl_table 11 codon_start 1 locus_tag LOCUS_62990 gene tssM CDS 42195..42869 product type VI secretion system-associated protein TagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106966.1 transl_table 11 codon_start 1 locus_tag LOCUS_63000 gene tagF CDS 42866..44614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63010 CDS 44711..45301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63020 CDS 45391..45981 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965738.1 transl_table 11 codon_start 1 locus_tag LOCUS_63030 CDS 45978..46640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528255.1 transl_table 11 codon_start 1 locus_tag LOCUS_63040 CDS 46668..47489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63050 CDS 47755..50886 product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071738.1 transl_table 11 codon_start 1 locus_tag LOCUS_63060 CDS 50870..52630 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071737.1 transl_table 11 codon_start 1 locus_tag LOCUS_63070 CDS 52623..54356 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071737.1 transl_table 11 codon_start 1 locus_tag LOCUS_63080 CDS 54482..54709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63090 CDS complement(54854..55792) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098402.1 transl_table 11 codon_start 1 locus_tag LOCUS_63100 CDS 55886..56635 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098400.1 transl_table 11 codon_start 1 locus_tag LOCUS_63110 CDS 56723..57709 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037087840.1 transl_table 11 codon_start 1 locus_tag LOCUS_63120 CDS 57956..58510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63130 sequence037 source 1..58730 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 741..1316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63140 CDS complement(1340..1480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63150 CDS complement(1435..1626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63160 note possible pseudo, internal stop codon, frameshifted CDS 2185..3390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63170 CDS 4392..5438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63180 CDS 5435..6460 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030141.1 transl_table 11 codon_start 1 locus_tag LOCUS_63190 CDS 9845..13066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63200 CDS complement(13223..13567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63210 CDS complement(13564..13902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63220 note possible pseudo, frameshifted CDS 13932..14792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63230 CDS complement(15035..15337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63240 CDS complement(15376..17718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63250 CDS complement(17754..17933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63260 CDS complement(18282..18599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63270 CDS complement(18677..19729) product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 transl_table 11 codon_start 1 locus_tag LOCUS_63280 CDS 20019..20276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63290 CDS 20402..21451 product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 transl_table 11 codon_start 1 locus_tag LOCUS_63300 CDS complement(21714..21923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63310 CDS 21846..23474 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211744.1 transl_table 11 codon_start 1 locus_tag LOCUS_63320 CDS 24363..25445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63330 CDS complement(26307..27104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63340 CDS complement(27138..29156) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031066.1 transl_table 11 codon_start 1 locus_tag LOCUS_63350 CDS complement(29153..30463) product BREX system ATP-binding protein BrxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031065.1 transl_table 11 codon_start 1 locus_tag LOCUS_63360 gene brxD CDS complement(30460..33183) product BREX-2 system phosphatase PglZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031062.1 transl_table 11 codon_start 1 locus_tag LOCUS_63370 gene pglZ CDS complement(33180..36875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031061.1 transl_table 11 codon_start 1 locus_tag LOCUS_63380 CDS complement(36962..37510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63390 CDS complement(37507..38076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63400 CDS complement(38112..38474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63410 CDS complement(38705..39778) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104341.1 transl_table 11 codon_start 1 locus_tag LOCUS_63420 CDS complement(39810..40538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63430 CDS complement(40535..41020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63440 CDS complement(41070..41780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63450 CDS complement(41997..45767) product BREX-2 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030180.1 transl_table 11 codon_start 1 locus_tag LOCUS_63460 gene pglX CDS complement(45816..50003) product BREX system serine/threonine kinase PglW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031052.1 transl_table 11 codon_start 1 locus_tag LOCUS_63470 gene pglW CDS complement(50000..50221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63480 CDS 50265..50534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63490 CDS 50678..50896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63500 CDS 50903..51106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63510 CDS complement(51131..51712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63520 CDS complement(51743..52219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63530 CDS complement(52883..54826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63540 CDS complement(54814..55188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63550 CDS complement(55325..56590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63560 CDS complement(57534..58016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63570 sequence038 source 1..56194 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(163..498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63580 CDS complement(641..1510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63590 CDS complement(1871..2221) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065092.1 transl_table 11 codon_start 1 locus_tag LOCUS_63600 CDS complement(2241..3524) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812683.1 transl_table 11 codon_start 1 locus_tag LOCUS_63610 CDS complement(3707..4300) product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446521.1 transl_table 11 codon_start 1 locus_tag LOCUS_63620 gene mobA CDS complement(4297..4599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63630 CDS complement(4602..5726) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532083.1 transl_table 11 codon_start 1 locus_tag LOCUS_63640 gene moaA CDS complement(5815..6369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63650 CDS 6506..7570 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064835.1 transl_table 11 codon_start 1 locus_tag LOCUS_63660 CDS 7678..9591 product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813753.1 transl_table 11 codon_start 1 locus_tag LOCUS_63670 CDS complement(9679..9897) product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523392.1 transl_table 11 codon_start 1 locus_tag LOCUS_63680 CDS complement(9890..11968) product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529393.1 transl_table 11 codon_start 1 locus_tag LOCUS_63690 CDS complement(12125..12760) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188734.1 transl_table 11 codon_start 1 locus_tag LOCUS_63700 CDS complement(12757..14142) product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523251.1 transl_table 11 codon_start 1 locus_tag LOCUS_63710 CDS complement(14233..15900) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813082.1 transl_table 11 codon_start 1 locus_tag LOCUS_63720 CDS complement(16233..16709) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521302.1 transl_table 11 codon_start 1 locus_tag LOCUS_63730 CDS complement(16915..17292) product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198835.1 transl_table 11 codon_start 1 locus_tag LOCUS_63740 CDS 17352..18578 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527177.1 transl_table 11 codon_start 1 locus_tag LOCUS_63750 CDS 18590..19900 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193856.1 transl_table 11 codon_start 1 locus_tag LOCUS_63760 CDS 19903..21318 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192708.1 transl_table 11 codon_start 1 locus_tag LOCUS_63770 gene thrC CDS 21335..21868 product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 transl_table 11 codon_start 1 locus_tag LOCUS_63780 gene mobB CDS 21861..23117 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192374.1 transl_table 11 codon_start 1 locus_tag LOCUS_63790 CDS 23122..23376 product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193789.1 transl_table 11 codon_start 1 locus_tag LOCUS_63800 gene moaD CDS 23545..25497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63810 CDS 25672..27504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63820 note possible pseudo, internal stop codon, frameshifted CDS 27557..28045 product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535771.1 transl_table 11 codon_start 1 locus_tag LOCUS_63830 gene moaE CDS 28051..28452 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810483.1 transl_table 11 codon_start 1 locus_tag LOCUS_63840 gene crcB CDS 28461..29075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63850 CDS 29116..30378 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088825.1 transl_table 11 codon_start 1 locus_tag LOCUS_63860 CDS 30516..33110 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521310.1 transl_table 11 codon_start 1 locus_tag LOCUS_63870 gene clpB CDS 33194..34879 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186553.1 transl_table 11 codon_start 1 locus_tag LOCUS_63880 gene nadB CDS 35200..35775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63890 CDS 35796..36101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63900 CDS complement(36204..36863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63910 CDS complement(37002..38114) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185886.1 transl_table 11 codon_start 1 locus_tag LOCUS_63920 gene nadA CDS 38262..39545 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810358.1 transl_table 11 codon_start 1 locus_tag LOCUS_63930 CDS 39542..41275 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205307.1 transl_table 11 codon_start 1 locus_tag LOCUS_63940 CDS 41396..41941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63950 CDS 41907..42413 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191744.1 transl_table 11 codon_start 1 locus_tag LOCUS_63960 gene rraA tRNA 42444..42520 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 CDS 42633..43100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63970 CDS 43114..43422 product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932697.1 transl_table 11 codon_start 1 locus_tag LOCUS_63980 gene soxZ CDS complement(43436..45046) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037320.1 transl_table 11 codon_start 1 locus_tag LOCUS_63990 tRNA complement(45207..45283) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 CDS complement(45333..46025) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930296.1 transl_table 11 codon_start 1 locus_tag LOCUS_64000 CDS 46077..46805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64010 CDS 46894..47937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64020 CDS complement(47982..49160) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 transl_table 11 codon_start 1 locus_tag LOCUS_64030 CDS complement(49198..50007) product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193435.1 transl_table 11 codon_start 1 locus_tag LOCUS_64040 CDS complement(50139..50537) product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526300.1 transl_table 11 codon_start 1 locus_tag LOCUS_64050 CDS complement(50534..51661) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552347.1 transl_table 11 codon_start 1 locus_tag LOCUS_64060 gene lptG CDS complement(51658..52758) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192178.1 transl_table 11 codon_start 1 locus_tag LOCUS_64070 gene lptF CDS 52786..54264 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821370.1 transl_table 11 codon_start 1 locus_tag LOCUS_64080 CDS 54344..54787 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522571.1 transl_table 11 codon_start 1 locus_tag LOCUS_64090 CDS 54911..56053 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525689.1 transl_table 11 codon_start 1 locus_tag LOCUS_64100 sequence039 source 1..54833 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(36..293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64110 note possible pseudo, frameshifted CDS complement(1107..1445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64120 CDS complement(1719..2897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64130 CDS 3400..3699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64140 CDS 3870..4331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64150 CDS 4451..5332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64160 CDS complement(5947..9459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64170 CDS complement(10121..10963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64180 CDS 11045..11920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64190 CDS 12052..13068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64200 CDS 15197..16507 product replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078378003.1 transl_table 11 codon_start 1 locus_tag LOCUS_64210 CDS 16579..17508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64220 CDS complement(17598..18674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64230 CDS complement(18959..20218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64240 CDS complement(20316..21215) product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705014.1 transl_table 11 codon_start 1 locus_tag LOCUS_64250 CDS complement(21234..21938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64260 CDS complement(21995..22159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64270 CDS complement(22152..22373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64280 CDS complement(22370..22738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64290 CDS complement(22738..23094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64300 CDS complement(23293..23757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64310 CDS 23897..24346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64320 CDS 24381..25859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64330 CDS 25988..26833 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088051.1 transl_table 11 codon_start 1 locus_tag LOCUS_64340 CDS complement(26876..27076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64350 CDS complement(27313..27801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64360 CDS 28124..28768 product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816371.1 transl_table 11 codon_start 1 locus_tag LOCUS_64370 gene gstA CDS complement(28699..29199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64380 note possible pseudo, frameshifted CDS complement(29329..29694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64390 CDS complement(29889..30521) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813020.1 transl_table 11 codon_start 1 locus_tag LOCUS_64400 CDS 30942..31481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64410 CDS 31564..31941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64420 CDS 32093..33061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64430 CDS 33061..34215 product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091813.1 transl_table 11 codon_start 1 locus_tag LOCUS_64440 CDS 34279..35571 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938989.1 transl_table 11 codon_start 1 locus_tag LOCUS_64450 CDS 35699..36769 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124047.1 transl_table 11 codon_start 1 locus_tag LOCUS_64460 CDS 36873..37226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64470 CDS 37578..37877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64480 CDS 38214..40253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64490 CDS complement(40343..40507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64500 CDS complement(40723..42003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64510 CDS complement(42353..42544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64520 CDS complement(42962..43225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64530 CDS 43366..43650 product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045668639.1 transl_table 11 codon_start 1 locus_tag LOCUS_64540 CDS 43647..44000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64550 CDS 44194..44475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64560 CDS 44570..45490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64570 CDS complement(45533..46522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64580 CDS complement(46519..47067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64590 CDS complement(47261..48262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64600 CDS complement(48264..49085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64610 CDS complement(49085..49489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64620 CDS complement(49595..50131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64630 CDS complement(50578..51126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64640 CDS 51363..51881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64650 CDS 51883..52371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64660 CDS 52368..52679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64670 CDS 52686..53015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64680 sequence040 source 1..52832 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 1551..3388 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12935..13606) product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389209.1 transl_table 11 codon_start 1 locus_tag LOCUS_64690 CDS complement(13771..14616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64700 CDS complement(14631..16181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64710 CDS 16403..17401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64720 CDS complement(17465..18406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64730 CDS complement(18741..19190) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116491597.1 transl_table 11 codon_start 1 locus_tag LOCUS_64740 CDS complement(19503..20399) product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391135.1 transl_table 11 codon_start 1 locus_tag LOCUS_64750 gene menA CDS complement(20437..22185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64760 CDS complement(22167..25010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64770 CDS complement(25218..26018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64780 CDS 26197..27339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64790 CDS complement(27358..28002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64800 CDS complement(28112..28678) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058086430.1 transl_table 11 codon_start 1 locus_tag LOCUS_64810 CDS complement(28984..29952) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212346563.1 transl_table 11 codon_start 1 locus_tag LOCUS_64820 CDS 30307..33072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64830 CDS 33140..33610 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202877.1 transl_table 11 codon_start 1 locus_tag LOCUS_64840 CDS 33769..34383 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464880.1 transl_table 11 codon_start 1 locus_tag LOCUS_64850 CDS complement(34368..34682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64860 CDS complement(34754..35776) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951113.1 transl_table 11 codon_start 1 locus_tag LOCUS_64870 CDS complement(35897..37381) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136386085.1 transl_table 11 codon_start 1 locus_tag LOCUS_64880 CDS complement(37410..38114) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812762.1 transl_table 11 codon_start 1 locus_tag LOCUS_64890 CDS 38360..39622 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091472.1 transl_table 11 codon_start 1 locus_tag LOCUS_64900 CDS 39752..40630 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387854.1 transl_table 11 codon_start 1 locus_tag LOCUS_64910 CDS 40627..41547 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185577.1 transl_table 11 codon_start 1 locus_tag LOCUS_64920 CDS 41553..42623 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194906.1 transl_table 11 codon_start 1 locus_tag LOCUS_64930 gene ugpC CDS 42778..44055 product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973678.1 transl_table 11 codon_start 1 locus_tag LOCUS_64940 CDS 44049..45539 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186165.1 transl_table 11 codon_start 1 locus_tag LOCUS_64950 gene zwf CDS complement(45556..47739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64960 CDS 47834..48163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767805.1 transl_table 11 codon_start 1 locus_tag LOCUS_64970 CDS 48160..48606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64980 CDS complement(48815..49993) product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809186.1 transl_table 11 codon_start 1 locus_tag LOCUS_64990 gene ppk2 CDS complement(50066..50692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65000 CDS 50721..51293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65010 CDS complement(51530..52117) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222978.1 transl_table 11 codon_start 1 locus_tag LOCUS_65020 sequence041 source 1..47930 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 354..536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65030 CDS complement(1251..3941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65040 CDS complement(4187..5497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65050 CDS complement(5570..6028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65060 CDS complement(6294..7013) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 transl_table 11 codon_start 1 locus_tag LOCUS_65070 CDS 7322..8266 product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065041.1 transl_table 11 codon_start 1 locus_tag LOCUS_65080 CDS 8288..9013 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072507.1 transl_table 11 codon_start 1 locus_tag LOCUS_65090 CDS complement(8999..9463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65100 CDS complement(9466..9645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65110 CDS 9850..10980 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105223.1 transl_table 11 codon_start 1 locus_tag LOCUS_65120 CDS complement(11020..11145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65130 CDS 11354..20089 product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994041.1 transl_table 11 codon_start 1 locus_tag LOCUS_65140 CDS 20086..21846 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021660.1 transl_table 11 codon_start 1 locus_tag LOCUS_65150 CDS 22184..22549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65160 CDS complement(22739..22900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65170 CDS 23325..25349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65180 CDS 25798..27855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65190 CDS 28181..28888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65200 CDS complement(28922..29833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65210 CDS 29963..31045 product IS5-like element ISGsu3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943399.1 transl_table 11 codon_start 1 locus_tag LOCUS_65220 CDS complement(31214..31387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65230 CDS 31467..32600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65240 CDS 32812..33099 product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693744.1 transl_table 11 codon_start 1 locus_tag LOCUS_65250 CDS 33096..33590 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807613.1 transl_table 11 codon_start 1 locus_tag LOCUS_65260 CDS complement(33524..33880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65270 CDS complement(33990..34304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65280 CDS complement(34355..34546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65290 CDS 34479..35075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65300 CDS 35478..36023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65310 note possible pseudo, frameshifted CDS complement(36038..36409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65320 CDS complement(37076..37513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65330 CDS 37616..37930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65340 note possible pseudo, frameshifted CDS 38100..38378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65350 CDS 38341..38511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65360 CDS 38523..38753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65370 CDS complement(38934..39668) product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267525.1 transl_table 11 codon_start 1 locus_tag LOCUS_65380 CDS complement(39727..41754) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226992700.1 transl_table 11 codon_start 1 locus_tag LOCUS_65390 CDS 42094..43215 product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140316.1 transl_table 11 codon_start 1 locus_tag LOCUS_65400 CDS 43390..44463 product IS5-like element ISMac15 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065538.1 transl_table 11 codon_start 1 locus_tag LOCUS_65410 CDS complement(44713..44937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65420 note possible pseudo, internal stop codon CDS complement(44947..45102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65430 note possible pseudo, internal stop codon assembly_gap 45215..46409 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 47184..47621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65440 CDS 47631..47849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65450 sequence042 source 1..47967 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(391..954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65460 note possible pseudo, frameshifted CDS complement(956..1459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65470 note possible pseudo, frameshifted CDS complement(1519..2055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65480 CDS complement(2088..3839) product cytochrome c biogenesis protein DipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252802.1 transl_table 11 codon_start 1 locus_tag LOCUS_65490 CDS complement(3879..4763) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004546311.1 transl_table 11 codon_start 1 locus_tag LOCUS_65500 CDS 5029..5946 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529397.1 transl_table 11 codon_start 1 locus_tag LOCUS_65510 CDS complement(6244..7920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65520 CDS 8334..9668 product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870375.1 transl_table 11 codon_start 1 locus_tag LOCUS_65530 CDS 9748..11745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65540 CDS 11847..12368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65550 CDS 12365..14824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65560 CDS complement(15115..15267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65570 CDS 15716..15976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65580 CDS 15997..16197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65590 CDS 17900..19387 product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084967.1 transl_table 11 codon_start 1 locus_tag LOCUS_65600 CDS 19443..21014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65610 CDS complement(21335..23971) product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948085.1 transl_table 11 codon_start 1 locus_tag LOCUS_65620 gene mgtA CDS complement(24196..24873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65630 CDS 25564..25974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65640 CDS 26700..26999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65650 CDS 26996..27424 product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918065.1 transl_table 11 codon_start 1 locus_tag LOCUS_65660 gene gspG CDS 27497..27961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65670 CDS 27961..28560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65680 CDS 28597..28845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65690 CDS complement(29606..29893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65700 CDS 30373..30792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65710 CDS complement(31290..32360) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083663.1 transl_table 11 codon_start 1 locus_tag LOCUS_65720 CDS 33033..33455 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530551.1 transl_table 11 codon_start 1 locus_tag LOCUS_65730 gene arsC CDS 33448..34170 product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095191.1 transl_table 11 codon_start 1 locus_tag LOCUS_65740 gene arsH CDS complement(34386..34697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65750 CDS complement(35157..36110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65760 CDS 36245..37123 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556010.1 transl_table 11 codon_start 1 locus_tag LOCUS_65770 CDS complement(37303..38529) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527917.1 transl_table 11 codon_start 1 locus_tag LOCUS_65780 CDS complement(38541..38864) product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083869.1 transl_table 11 codon_start 1 locus_tag LOCUS_65790 CDS complement(38883..40082) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083868.1 transl_table 11 codon_start 1 locus_tag LOCUS_65800 CDS complement(40204..41307) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543370.1 transl_table 11 codon_start 1 locus_tag LOCUS_65810 CDS complement(41332..42042) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973919.1 transl_table 11 codon_start 1 locus_tag LOCUS_65820 CDS complement(42039..42797) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385621.1 transl_table 11 codon_start 1 locus_tag LOCUS_65830 CDS complement(42794..43813) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538210.1 transl_table 11 codon_start 1 locus_tag LOCUS_65840 CDS complement(43829..44689) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887358.1 transl_table 11 codon_start 1 locus_tag LOCUS_65850 CDS complement(44768..45931) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976271.1 transl_table 11 codon_start 1 locus_tag LOCUS_65860 CDS 46155..46742 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083867.1 transl_table 11 codon_start 1 locus_tag LOCUS_65870 CDS 46920..47393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65880 note possible pseudo, internal stop codon, frameshifted CDS 47374..47958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65890 note possible pseudo, internal stop codon, frameshifted sequence043 source 1..46477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 231..1193 product IS5-like element ISPsy2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054991743.1 transl_table 11 codon_start 1 locus_tag LOCUS_65900 CDS 1474..2484 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868863.1 transl_table 11 codon_start 1 locus_tag LOCUS_65910 CDS 3055..3534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65920 CDS complement(3740..4186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65930 CDS 4513..4911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65940 assembly_gap 4733..4742 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5162..6952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65950 CDS 8540..9544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65960 CDS 9793..9993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65970 CDS complement(9891..11153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65980 CDS complement(11488..12417) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974644.1 transl_table 11 codon_start 1 locus_tag LOCUS_65990 CDS 12522..13289 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226013866.1 transl_table 11 codon_start 1 locus_tag LOCUS_66000 CDS 13309..14238 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731487.1 transl_table 11 codon_start 1 locus_tag LOCUS_66010 CDS 15162..15422 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809486.1 transl_table 11 codon_start 1 locus_tag LOCUS_66020 gene infA CDS 15545..15754 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071803.1 transl_table 11 codon_start 1 locus_tag LOCUS_66030 CDS 15803..16012 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222289.1 transl_table 11 codon_start 1 locus_tag LOCUS_66040 CDS 16149..16358 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187926.1 transl_table 11 codon_start 1 locus_tag LOCUS_66050 CDS 16458..17225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66060 CDS complement(17582..18082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66070 CDS complement(18503..19699) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268637.1 transl_table 11 codon_start 1 locus_tag LOCUS_66080 CDS complement(19702..20472) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103625.1 transl_table 11 codon_start 1 locus_tag LOCUS_66090 CDS complement(20562..20786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66100 CDS 21069..21398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66110 CDS complement(21572..21793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66120 CDS complement(21790..22047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66130 CDS complement(22356..22586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66140 CDS 22838..23095 product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 transl_table 11 codon_start 1 locus_tag LOCUS_66150 CDS complement(23708..24154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66160 CDS complement(24208..24726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66170 CDS complement(24750..26108) product type II toxin-antitoxin system HipA family toxin YjjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293112.1 transl_table 11 codon_start 1 locus_tag LOCUS_66180 gene yjjJ CDS 26607..27842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66190 CDS complement(28217..28447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66200 CDS 28469..28798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66210 CDS complement(29445..30443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66220 CDS complement(30440..31642) product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035215636.1 transl_table 11 codon_start 1 locus_tag LOCUS_66230 gene repA CDS 32107..33540 product replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194484.1 transl_table 11 codon_start 1 locus_tag LOCUS_66240 CDS complement(33778..34746) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064939.1 transl_table 11 codon_start 1 locus_tag LOCUS_66250 CDS complement(34779..35648) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064567.1 transl_table 11 codon_start 1 locus_tag LOCUS_66260 CDS complement(35837..37537) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726981.1 transl_table 11 codon_start 1 locus_tag LOCUS_66270 CDS complement(37530..37973) product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250199.1 transl_table 11 codon_start 1 locus_tag LOCUS_66280 CDS complement(37970..39265) product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870830.1 transl_table 11 codon_start 1 locus_tag LOCUS_66290 CDS complement(39273..40091) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521874.1 transl_table 11 codon_start 1 locus_tag LOCUS_66300 CDS complement(40169..41596) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727454.1 transl_table 11 codon_start 1 locus_tag LOCUS_66310 CDS 41774..42727 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064800.1 transl_table 11 codon_start 1 locus_tag LOCUS_66320 CDS 42756..43730 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064800.1 transl_table 11 codon_start 1 locus_tag LOCUS_66330 CDS 43742..44620 product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084309.1 transl_table 11 codon_start 1 locus_tag LOCUS_66340 CDS 44809..45906 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525210.1 transl_table 11 codon_start 1 locus_tag LOCUS_66350 sequence044 source 1..45290 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(927..1082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66360 CDS 1088..1399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66370 CDS complement(1507..3744) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942572.1 transl_table 11 codon_start 1 locus_tag LOCUS_66380 CDS complement(3749..4174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66390 CDS complement(4271..5491) product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946958.1 transl_table 11 codon_start 1 locus_tag LOCUS_66400 gene flgL CDS complement(5571..7571) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112507.1 transl_table 11 codon_start 1 locus_tag LOCUS_66410 gene flgK CDS complement(7612..8532) product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211118.1 transl_table 11 codon_start 1 locus_tag LOCUS_66420 gene flgJ CDS complement(8591..9748) product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550967.1 transl_table 11 codon_start 1 locus_tag LOCUS_66430 CDS complement(9763..10464) product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160434.1 transl_table 11 codon_start 1 locus_tag LOCUS_66440 gene flgH CDS complement(10490..11272) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050114401.1 transl_table 11 codon_start 1 locus_tag LOCUS_66450 gene flgG CDS complement(11567..12298) product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185014.1 transl_table 11 codon_start 1 locus_tag LOCUS_66460 gene flgF CDS complement(12342..13961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66470 CDS complement(13981..14643) product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211112.1 transl_table 11 codon_start 1 locus_tag LOCUS_66480 gene flgD CDS complement(14664..15071) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817176.1 transl_table 11 codon_start 1 locus_tag LOCUS_66490 gene flgC CDS complement(15115..15555) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884702.1 transl_table 11 codon_start 1 locus_tag LOCUS_66500 gene flgB CDS 15674..16414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66510 CDS 16683..16865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66520 CDS 16891..17286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66530 CDS complement(17355..19535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66540 CDS complement(19720..20439) product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198636.1 transl_table 11 codon_start 1 locus_tag LOCUS_66550 CDS complement(20469..21278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66560 CDS complement(21293..22975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66570 CDS complement(22972..25059) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198639.1 transl_table 11 codon_start 1 locus_tag LOCUS_66580 gene flhA CDS complement(25347..26495) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930321.1 transl_table 11 codon_start 1 locus_tag LOCUS_66590 gene flhB CDS complement(26522..27196) product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524402.1 transl_table 11 codon_start 1 locus_tag LOCUS_66600 gene cheZ CDS complement(27189..27587) product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811911.1 transl_table 11 codon_start 1 locus_tag LOCUS_66610 gene cheY CDS complement(27584..28561) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938926.1 transl_table 11 codon_start 1 locus_tag LOCUS_66620 gene motB CDS complement(28588..29448) product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198197.1 transl_table 11 codon_start 1 locus_tag LOCUS_66630 gene motA CDS complement(29530..30795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66640 CDS complement(30808..31347) product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198198.1 transl_table 11 codon_start 1 locus_tag LOCUS_66650 gene flhC CDS complement(31397..31735) product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198199.1 transl_table 11 codon_start 1 locus_tag LOCUS_66660 gene flhD CDS 32125..33147 product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816591.1 transl_table 11 codon_start 1 locus_tag LOCUS_66670 CDS 33376..34254 product flagellin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767010.1 transl_table 11 codon_start 1 locus_tag LOCUS_66680 CDS 34404..35807 product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146764.1 transl_table 11 codon_start 1 locus_tag LOCUS_66690 gene fliD CDS 35926..36363 product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287765.1 transl_table 11 codon_start 1 locus_tag LOCUS_66700 gene fliS CDS 36404..36697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66710 CDS 36775..37845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66720 CDS 37971..39833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327298.1 transl_table 11 codon_start 1 locus_tag LOCUS_66730 CDS 39833..42070 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095715.1 transl_table 11 codon_start 1 locus_tag LOCUS_66740 CDS 42115..43329 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367418.1 transl_table 11 codon_start 1 locus_tag LOCUS_66750 CDS 43331..44692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66760 misc_feature complement(44712..>45290) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_140590772.1:IS630 family transposase locus_tag LOCUS_66770 sequence045 source 1..44166 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 249..674 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188348.1 transl_table 11 codon_start 1 locus_tag LOCUS_66780 CDS complement(656..1435) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186027.1 transl_table 11 codon_start 1 locus_tag LOCUS_66790 CDS 1892..2290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66800 note possible pseudo, frameshifted CDS 2290..3480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66810 note possible pseudo, frameshifted CDS 3526..4764 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085615.1 transl_table 11 codon_start 1 locus_tag LOCUS_66820 CDS complement(5032..5538) product DUF1993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 transl_table 11 codon_start 1 locus_tag LOCUS_66830 CDS complement(5554..6381) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043677442.1 transl_table 11 codon_start 1 locus_tag LOCUS_66840 CDS complement(6391..7224) product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 transl_table 11 codon_start 1 locus_tag LOCUS_66850 CDS complement(7226..8191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66860 CDS complement(8221..10671) product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267184.1 transl_table 11 codon_start 1 locus_tag LOCUS_66870 CDS complement(10709..11758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66880 CDS complement(11839..13206) product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 transl_table 11 codon_start 1 locus_tag LOCUS_66890 CDS complement(13230..14945) product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093045.1 transl_table 11 codon_start 1 locus_tag LOCUS_66900 CDS 15648..15971 product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083869.1 transl_table 11 codon_start 1 locus_tag LOCUS_66910 CDS 16344..17576 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229126.1 transl_table 11 codon_start 1 locus_tag LOCUS_66920 CDS 17573..18322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66930 CDS 18356..20011 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846891.1 transl_table 11 codon_start 1 locus_tag LOCUS_66940 CDS 20060..20410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66950 CDS 20415..21212 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113029.1 transl_table 11 codon_start 1 locus_tag LOCUS_66960 CDS 21209..22513 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729591.1 transl_table 11 codon_start 1 locus_tag LOCUS_66970 CDS 22547..23827 product monooxygenase YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232789.1 transl_table 11 codon_start 1 locus_tag LOCUS_66980 gene yjiB CDS 23885..24916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66990 CDS 24922..25272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67000 CDS 25269..26276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67010 CDS 26305..26727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67020 CDS 26724..27557 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043677442.1 transl_table 11 codon_start 1 locus_tag LOCUS_67030 CDS 27550..28806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67040 CDS 29059..30126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181712483.1 transl_table 11 codon_start 1 locus_tag LOCUS_67050 CDS 30141..30539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67060 CDS 30706..31866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67070 CDS complement(32071..34800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67080 CDS 35061..36287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67090 CDS 36337..37362 product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728110.1 transl_table 11 codon_start 1 locus_tag LOCUS_67100 CDS 37373..38482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67110 CDS complement(38509..39351) product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086938.1 transl_table 11 codon_start 1 locus_tag LOCUS_67120 CDS complement(40043..40591) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816397.1 transl_table 11 codon_start 1 locus_tag LOCUS_67130 CDS complement(40588..41118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67140 CDS complement(41115..42290) product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225706.1 transl_table 11 codon_start 1 locus_tag LOCUS_67150 CDS complement(42287..43192) product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272323.1 transl_table 11 codon_start 1 locus_tag LOCUS_67160 CDS complement(43216..44061) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338042.1 transl_table 11 codon_start 1 locus_tag LOCUS_67170 sequence046 source 1..41726 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(343..555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67180 note possible pseudo, frameshifted CDS complement(522..1310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67190 note possible pseudo, frameshifted CDS complement(1397..2413) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042143812.1 transl_table 11 codon_start 1 locus_tag LOCUS_67200 CDS complement(2604..3935) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265852.1 transl_table 11 codon_start 1 locus_tag LOCUS_67210 CDS complement(3956..5332) product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206209.1 transl_table 11 codon_start 1 locus_tag LOCUS_67220 CDS complement(5373..6149) product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113313.1 transl_table 11 codon_start 1 locus_tag LOCUS_67230 CDS complement(6216..7223) product benzoate 1,2-dioxygenase electron transfer component BenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109537.1 transl_table 11 codon_start 1 locus_tag LOCUS_67240 gene benC CDS complement(7284..7769) product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727999.1 transl_table 11 codon_start 1 locus_tag LOCUS_67250 gene benB CDS complement(7784..9199) product benzoate 1,2-dioxygenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529144.1 transl_table 11 codon_start 1 locus_tag LOCUS_67260 gene benA CDS complement(9334..10248) product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525033.1 transl_table 11 codon_start 1 locus_tag LOCUS_67270 gene catA CDS complement(10307..10597) product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190652.1 transl_table 11 codon_start 1 locus_tag LOCUS_67280 gene catC CDS complement(10654..11781) product muconate/chloromuconate family cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540534.1 transl_table 11 codon_start 1 locus_tag LOCUS_67290 CDS 12017..12946 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552076.1 transl_table 11 codon_start 1 locus_tag LOCUS_67300 CDS complement(12943..14157) product benzoate/H(+) symporter BenE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206210.1 transl_table 11 codon_start 1 locus_tag LOCUS_67310 gene benE CDS complement(14232..15068) product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088414.1 transl_table 11 codon_start 1 locus_tag LOCUS_67320 gene pcaD CDS complement(15065..16270) product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039581.1 transl_table 11 codon_start 1 locus_tag LOCUS_67330 gene pcaF CDS complement(16295..16870) product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807676.1 transl_table 11 codon_start 1 locus_tag LOCUS_67340 CDS complement(16986..17687) product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929696.1 transl_table 11 codon_start 1 locus_tag LOCUS_67350 CDS 17872..18681 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533811.1 transl_table 11 codon_start 1 locus_tag LOCUS_67360 CDS complement(19329..20156) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089154.1 transl_table 11 codon_start 1 locus_tag LOCUS_67370 CDS 20569..21999 product indoleacetamide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921522.1 transl_table 11 codon_start 1 locus_tag LOCUS_67380 gene iaaH CDS complement(22057..23139) product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135465925.1 transl_table 11 codon_start 1 locus_tag LOCUS_67390 CDS complement(23154..23936) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810743.1 transl_table 11 codon_start 1 locus_tag LOCUS_67400 CDS complement(23947..24693) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816696.1 transl_table 11 codon_start 1 locus_tag LOCUS_67410 CDS complement(24693..25628) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810748.1 transl_table 11 codon_start 1 locus_tag LOCUS_67420 CDS complement(25628..26500) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810750.1 transl_table 11 codon_start 1 locus_tag LOCUS_67430 CDS complement(26488..26670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67440 CDS complement(26684..27838) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930732.1 transl_table 11 codon_start 1 locus_tag LOCUS_67450 CDS complement(27888..29423) product indolepyruvate oxidoreductase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086194.1 transl_table 11 codon_start 1 locus_tag LOCUS_67460 CDS complement(29420..31570) product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527966.1 transl_table 11 codon_start 1 locus_tag LOCUS_67470 CDS 31667..32572 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095545.1 transl_table 11 codon_start 1 locus_tag LOCUS_67480 CDS complement(32595..32792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67490 CDS 32903..33877 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807281.1 transl_table 11 codon_start 1 locus_tag LOCUS_67500 CDS 34037..35044 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089142.1 transl_table 11 codon_start 1 locus_tag LOCUS_67510 CDS complement(35221..36411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67520 CDS complement(38228..38773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67530 CDS complement(38804..39703) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206215.1 transl_table 11 codon_start 1 locus_tag LOCUS_67540 CDS complement(39733..41208) product benzaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920255.1 transl_table 11 codon_start 1 locus_tag LOCUS_67550 CDS 41409..41705 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139205698.1 transl_table 11 codon_start 1 locus_tag LOCUS_67560 sequence047 source 1..41113 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 390..1973 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184304236.1 transl_table 11 codon_start 1 locus_tag LOCUS_67570 CDS 1960..3039 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389657.1 transl_table 11 codon_start 1 locus_tag LOCUS_67580 CDS 3039..3959 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389656.1 transl_table 11 codon_start 1 locus_tag LOCUS_67590 CDS complement(5252..5404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67600 CDS complement(5349..5546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67610 CDS 7375..7635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67620 CDS 7917..8213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67630 CDS complement(8248..9186) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970159.1 transl_table 11 codon_start 1 locus_tag LOCUS_67640 CDS 9362..10036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67650 CDS 10033..10893 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970673.1 transl_table 11 codon_start 1 locus_tag LOCUS_67660 CDS 10907..11875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67670 CDS 11889..12542 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968106.1 transl_table 11 codon_start 1 locus_tag LOCUS_67680 CDS 12566..13630 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035552.1 transl_table 11 codon_start 1 locus_tag LOCUS_67690 CDS 13681..14574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112677.1 transl_table 11 codon_start 1 locus_tag LOCUS_67700 CDS 14656..15711 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035552.1 transl_table 11 codon_start 1 locus_tag LOCUS_67710 CDS 15844..16917 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614499.1 transl_table 11 codon_start 1 locus_tag LOCUS_67720 CDS 16988..18052 product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815761.1 transl_table 11 codon_start 1 locus_tag LOCUS_67730 CDS 18052..18906 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526232.1 transl_table 11 codon_start 1 locus_tag LOCUS_67740 gene fghA CDS 19224..20441 product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550272.1 transl_table 11 codon_start 1 locus_tag LOCUS_67750 CDS complement(21108..21584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67760 CDS complement(21983..22195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67770 CDS complement(24219..26582) product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522221.1 transl_table 11 codon_start 1 locus_tag LOCUS_67780 gene xdhB CDS complement(26579..28222) product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527625.1 transl_table 11 codon_start 1 locus_tag LOCUS_67790 gene xdhA CDS 28788..29000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67800 CDS complement(29823..30044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67810 CDS complement(30048..30293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67820 CDS 30213..31046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67830 CDS 32067..32624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67840 CDS 33646..33936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67850 CDS 34240..34740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67860 CDS 35106..35507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67870 CDS 35825..36268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67880 CDS 36445..36894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67890 CDS 37077..37478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67900 CDS complement(37920..38348) product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104311.1 transl_table 11 codon_start 1 locus_tag LOCUS_67910 CDS 39286..40239 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071129.1 transl_table 11 codon_start 1 locus_tag LOCUS_67920 sequence048 source 1..38211 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1230..1664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67930 CDS 1755..2543 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810455.1 transl_table 11 codon_start 1 locus_tag LOCUS_67940 CDS complement(3116..4033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67950 CDS 3998..4219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67960 CDS 5009..6133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67970 CDS 6246..7247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67980 CDS 7449..7856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67990 CDS 8159..9652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68000 CDS complement(10265..10672) product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012112382.1 transl_table 11 codon_start 1 locus_tag LOCUS_68010 CDS complement(10684..11349) product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577776.1 transl_table 11 codon_start 1 locus_tag LOCUS_68020 CDS 11565..11822 product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 transl_table 11 codon_start 1 locus_tag LOCUS_68030 CDS 12096..13199 product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268100.1 transl_table 11 codon_start 1 locus_tag LOCUS_68040 CDS complement(13262..13519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68050 CDS 13816..14616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68060 CDS 15054..15464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68070 CDS 15461..16294 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868408.1 transl_table 11 codon_start 1 locus_tag LOCUS_68080 CDS 16336..17331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68090 CDS 17629..17907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68100 CDS 17904..18509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68110 CDS 18514..19497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68120 CDS complement(19502..20110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68130 CDS 20570..20962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68140 CDS 20962..21441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68150 CDS 21438..21740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68160 CDS 21747..22100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68170 CDS 22229..24637 product VirB4 family type IV secretion/conjugal transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037611.1 transl_table 11 codon_start 1 locus_tag LOCUS_68180 CDS 24634..25032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68190 CDS 25037..26044 product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042069.1 transl_table 11 codon_start 1 locus_tag LOCUS_68200 CDS 26054..26746 product P-type DNA transfer protein VirB5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011264014.1 transl_table 11 codon_start 1 locus_tag LOCUS_68210 gene virB5 CDS 26765..27463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68220 CDS 27460..28974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68230 assembly_gap 28371..28380 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(29162..30838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68240 CDS complement(30857..31231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68250 CDS 31364..31663 product SWIB/MDM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814592.1 transl_table 11 codon_start 1 locus_tag LOCUS_68260 CDS complement(31822..32358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68270 CDS complement(32355..33224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68280 CDS complement(33545..34009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68290 CDS complement(33996..34490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68300 CDS complement(34531..35034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68310 CDS 35356..35892 product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199567.1 transl_table 11 codon_start 1 locus_tag LOCUS_68320 CDS 36149..36406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68330 CDS complement(36380..38056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68340 sequence049 source 1..36612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..601 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942587.1:nucleotide sugar dehydrogenase locus_tag LOCUS_68350 CDS complement(711..1535) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114410.1 transl_table 11 codon_start 1 locus_tag LOCUS_68360 CDS 1674..3389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68370 CDS complement(3442..4728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68380 CDS 5397..6350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68390 CDS complement(6381..7217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68400 CDS 7461..8822 product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082409.1 transl_table 11 codon_start 1 locus_tag LOCUS_68410 CDS complement(8890..9267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68420 CDS complement(9819..9968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68430 CDS complement(10344..12374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68440 CDS complement(12655..13260) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207415.1 transl_table 11 codon_start 1 locus_tag LOCUS_68450 CDS complement(13264..17049) product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074836736.1 transl_table 11 codon_start 1 locus_tag LOCUS_68460 CDS complement(17637..18635) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090573.1 transl_table 11 codon_start 1 locus_tag LOCUS_68470 gene cysK CDS complement(18700..19167) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196360.1 transl_table 11 codon_start 1 locus_tag LOCUS_68480 CDS 19492..19659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68490 CDS complement(19745..21568) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895584.1 transl_table 11 codon_start 1 locus_tag LOCUS_68500 CDS 21727..22599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68510 CDS complement(22642..23544) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839067.1 transl_table 11 codon_start 1 locus_tag LOCUS_68520 CDS complement(23650..23955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68530 CDS complement(23952..24950) product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113104.1 transl_table 11 codon_start 1 locus_tag LOCUS_68540 CDS complement(24955..25821) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113103.1 transl_table 11 codon_start 1 locus_tag LOCUS_68550 CDS complement(25818..26693) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113102.1 transl_table 11 codon_start 1 locus_tag LOCUS_68560 CDS complement(26701..28110) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113101.1 transl_table 11 codon_start 1 locus_tag LOCUS_68570 CDS complement(28127..28369) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135803081.1 transl_table 11 codon_start 1 locus_tag LOCUS_68580 CDS complement(28385..30118) product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113100.1 transl_table 11 codon_start 1 locus_tag LOCUS_68590 CDS complement(30137..30892) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113099.1 transl_table 11 codon_start 1 locus_tag LOCUS_68600 CDS complement(31124..32083) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113092.1 transl_table 11 codon_start 1 locus_tag LOCUS_68610 CDS complement(32080..32880) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113091.1 transl_table 11 codon_start 1 locus_tag LOCUS_68620 CDS complement(32904..33920) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816034.1 transl_table 11 codon_start 1 locus_tag LOCUS_68630 CDS complement(33991..34857) product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036011.1 transl_table 11 codon_start 1 locus_tag LOCUS_68640 sequence050 source 1..36444 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(170..553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68650 CDS 681..1784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68660 note possible pseudo, frameshifted CDS 1808..1987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68670 CDS 1977..2129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68680 CDS complement(2163..3089) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192762.1 transl_table 11 codon_start 1 locus_tag LOCUS_68690 CDS 3163..4983 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065145.1 transl_table 11 codon_start 1 locus_tag LOCUS_68700 CDS 5153..6091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68710 CDS 6170..7234 product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526891.1 transl_table 11 codon_start 1 locus_tag LOCUS_68720 CDS 7257..7745 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189587.1 transl_table 11 codon_start 1 locus_tag LOCUS_68730 gene ybaK CDS complement(7937..8215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68740 CDS complement(8349..9032) product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707003.1 transl_table 11 codon_start 1 locus_tag LOCUS_68750 CDS complement(9115..10389) product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 transl_table 11 codon_start 1 locus_tag LOCUS_68760 CDS 10361..10573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68770 CDS 10665..11378 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522633.1 transl_table 11 codon_start 1 locus_tag LOCUS_68780 gene plsY CDS 11378..11722 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526838.1 transl_table 11 codon_start 1 locus_tag LOCUS_68790 CDS complement(11800..12429) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192132.1 transl_table 11 codon_start 1 locus_tag LOCUS_68800 CDS complement(12518..13417) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193008.1 transl_table 11 codon_start 1 locus_tag LOCUS_68810 CDS complement(13479..14555) product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 transl_table 11 codon_start 1 locus_tag LOCUS_68820 CDS complement(14596..14886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68830 CDS complement(14996..16198) product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 transl_table 11 codon_start 1 locus_tag LOCUS_68840 CDS complement(16620..18038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68850 CDS complement(18100..19830) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191649.1 transl_table 11 codon_start 1 locus_tag LOCUS_68860 gene recJ CDS complement(19827..20735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063646.1 transl_table 11 codon_start 1 locus_tag LOCUS_68870 CDS 20912..22165 product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 transl_table 11 codon_start 1 locus_tag LOCUS_68880 CDS 22158..22895 product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195923.1 transl_table 11 codon_start 1 locus_tag LOCUS_68890 gene lolD CDS 23031..23501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68900 CDS 23614..26424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68910 CDS complement(26493..27554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68920 CDS complement(27567..28532) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226780.1 transl_table 11 codon_start 1 locus_tag LOCUS_68930 CDS complement(28525..29532) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024571137.1 transl_table 11 codon_start 1 locus_tag LOCUS_68940 CDS complement(29621..30484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_68950 CDS 30778..31617 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816840.1 transl_table 11 codon_start 1 locus_tag LOCUS_68960 CDS 31696..32469 product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185567.1 transl_table 11 codon_start 1 locus_tag LOCUS_68970 CDS 32587..33060 product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814615.1 transl_table 11 codon_start 1 locus_tag LOCUS_68980 CDS 33065..34579 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039080.1 transl_table 11 codon_start 1 locus_tag LOCUS_68990 CDS 34702..36318 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811984.1 transl_table 11 codon_start 1 locus_tag LOCUS_69000 gene ggt sequence051 source 1..36124 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(734..1120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69010 CDS complement(1363..1539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69020 note possible pseudo, frameshifted CDS complement(1520..1834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69030 note possible pseudo, frameshifted CDS complement(1779..2225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69040 note possible pseudo, internal stop codon, frameshifted CDS complement(2232..2423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69050 CDS 2455..2673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69060 CDS complement(2809..3156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69070 CDS complement(3240..3695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69080 CDS complement(3735..6932) product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189156.1 transl_table 11 codon_start 1 locus_tag LOCUS_69090 CDS complement(6929..8560) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817192.1 transl_table 11 codon_start 1 locus_tag LOCUS_69100 CDS complement(8563..9930) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189952.1 transl_table 11 codon_start 1 locus_tag LOCUS_69110 CDS complement(10037..10294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69120 CDS complement(10705..11316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69130 CDS complement(11762..13417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69140 CDS complement(13477..13659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69150 CDS complement(13647..14087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69160 CDS complement(14434..14787) product DOPA 4,5-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187860.1 transl_table 11 codon_start 1 locus_tag LOCUS_69170 CDS complement(14888..15250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69180 CDS complement(15632..15829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69190 CDS complement(16034..16591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69200 CDS complement(16617..17177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69210 note possible pseudo, frameshifted CDS 18919..19926 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113485.1 transl_table 11 codon_start 1 locus_tag LOCUS_69220 CDS 19995..22874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69230 CDS 23215..24243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69240 CDS complement(24963..25625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69250 CDS 25702..26163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69260 CDS 26596..26964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69270 CDS 26951..27208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69280 CDS complement(27098..27442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69290 CDS complement(27457..28152) product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933923.1 transl_table 11 codon_start 1 locus_tag LOCUS_69300 CDS complement(28829..29806) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521226.1 transl_table 11 codon_start 1 locus_tag LOCUS_69310 CDS 29994..31340 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201828.1 transl_table 11 codon_start 1 locus_tag LOCUS_69320 CDS 31377..31904 product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552526.1 transl_table 11 codon_start 1 locus_tag LOCUS_69330 gene uraD CDS 32025..32552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69340 CDS 32602..32937 product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975645.1 transl_table 11 codon_start 1 locus_tag LOCUS_69350 gene uraH CDS 32956..33432 product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109548.1 transl_table 11 codon_start 1 locus_tag LOCUS_69360 CDS complement(33643..34026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69370 CDS complement(34244..34666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69380 CDS complement(34694..34990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69390 assembly_gap 34925..34934 estimated_length known gap_type within scaffold linkage_evidence paired-ends misc_feature complement(35233..>36124) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268103.1:CHASE domain-containing protein locus_tag LOCUS_69400 sequence052 source 1..34854 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 621..1682 product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 transl_table 11 codon_start 1 locus_tag LOCUS_69410 CDS 1808..2173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69420 CDS 2173..2448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69430 CDS 2651..2914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69440 CDS 2911..3495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69450 CDS 3541..4188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69460 CDS complement(4925..6640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69470 CDS 7051..7278 product SWIB/MDM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814592.1 transl_table 11 codon_start 1 locus_tag LOCUS_69480 CDS complement(7524..7931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69490 CDS 8275..8490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69500 CDS complement(8545..9282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69510 CDS 9640..10164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69520 CDS 11499..11690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69530 CDS complement(11833..12297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69540 CDS complement(12605..12832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69550 CDS 13030..13407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69560 CDS complement(13784..14113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69570 CDS 14918..15610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69580 CDS 15673..16053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69590 CDS 16165..16338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69600 CDS complement(16481..16711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69610 CDS 17375..17686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69620 CDS complement(17816..18034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69630 CDS 18477..18848 product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142954.1 transl_table 11 codon_start 1 locus_tag LOCUS_69640 CDS 19713..22607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69650 CDS 22938..23183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69660 note possible pseudo, internal stop codon, frameshifted CDS 23355..23687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69670 note possible pseudo, internal stop codon, frameshifted CDS 23961..27500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69680 CDS 27756..28739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69690 CDS 29145..30107 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807544.1 transl_table 11 codon_start 1 locus_tag LOCUS_69700 CDS 30206..31657 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814808.1 transl_table 11 codon_start 1 locus_tag LOCUS_69710 CDS 31673..33019 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244205.1 transl_table 11 codon_start 1 locus_tag LOCUS_69720 CDS 33052..34029 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811399.1 transl_table 11 codon_start 1 locus_tag LOCUS_69730 sequence053 source 1..37021 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(533..919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69740 CDS 1040..1339 product SWIB/MDM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814592.1 transl_table 11 codon_start 1 locus_tag LOCUS_69750 CDS complement(1498..1905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69760 CDS complement(2032..2901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69770 CDS complement(3191..3655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69780 CDS complement(3708..4130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69790 CDS complement(4171..4662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69800 CDS 4995..5531 product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199567.1 transl_table 11 codon_start 1 locus_tag LOCUS_69810 CDS complement(5741..6004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69820 CDS complement(6136..8184) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028176021.1 transl_table 11 codon_start 1 locus_tag LOCUS_69830 assembly_gap 8044..8053 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8473..8853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69840 note possible pseudo, internal stop codon CDS 8902..9534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69850 note possible pseudo, internal stop codon CDS 9587..10111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69860 CDS 10051..10401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69870 CDS 10541..10828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69880 CDS 11027..11335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69890 CDS complement(11947..12411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69900 CDS complement(12516..12902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69910 CDS 12884..13099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69920 CDS 13558..14001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69930 assembly_gap 13777..13786 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14206..14586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69940 note possible pseudo, internal stop codon CDS 14635..15267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69950 note possible pseudo, internal stop codon CDS 15320..15844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69960 CDS 16274..16561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69970 CDS 16760..17068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69980 CDS complement(17680..18144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_69990 CDS complement(18292..18609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70000 CDS complement(18747..19442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70010 CDS 20027..20320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70020 CDS 20406..21071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70030 CDS complement(21158..21346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70040 CDS 21703..23649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70050 CDS 23649..24356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70060 CDS complement(24632..25297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70070 CDS 25428..25619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70080 CDS 25699..26274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70090 CDS 26246..26608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70100 CDS complement(27210..28271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70110 CDS 28527..28781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70120 CDS complement(28966..30249) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522914.1 transl_table 11 codon_start 1 locus_tag LOCUS_70130 gene gshA CDS complement(30513..30812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70140 CDS 30705..31019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70150 CDS 31153..33024 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074086.1 transl_table 11 codon_start 1 locus_tag LOCUS_70160 CDS complement(33708..34022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70170 CDS 33913..34134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70180 CDS 35578..36651 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 transl_table 11 codon_start 1 locus_tag LOCUS_70190 sequence054 source 1..32774 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 412..1377 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250696.1 transl_table 11 codon_start 1 locus_tag LOCUS_70200 CDS 1509..3671 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 transl_table 11 codon_start 1 locus_tag LOCUS_70210 CDS complement(3698..5155) product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929886.1 transl_table 11 codon_start 1 locus_tag LOCUS_70220 CDS complement(5170..6732) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807336.1 transl_table 11 codon_start 1 locus_tag LOCUS_70230 gene trkA CDS 6857..7411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70240 CDS complement(7442..7891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70250 CDS complement(8096..8500) product HI0074 family nucleotidyltransferase substrate-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118912.1 transl_table 11 codon_start 1 locus_tag LOCUS_70260 CDS 8695..11991 product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110527488.1 transl_table 11 codon_start 1 locus_tag LOCUS_70270 gene recC CDS 11988..15629 product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932747.1 transl_table 11 codon_start 1 locus_tag LOCUS_70280 gene recB CDS 15696..17168 product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526224.1 transl_table 11 codon_start 1 locus_tag LOCUS_70290 CDS 17193..19040 product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098543.1 transl_table 11 codon_start 1 locus_tag LOCUS_70300 gene recD CDS complement(19129..19365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70310 CDS complement(19499..20617) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065027.1 transl_table 11 codon_start 1 locus_tag LOCUS_70320 CDS 21285..21707 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192378.1 transl_table 11 codon_start 1 locus_tag LOCUS_70330 CDS complement(21789..22538) product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173829.1 transl_table 11 codon_start 1 locus_tag LOCUS_70340 CDS complement(22794..24185) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932228.1 transl_table 11 codon_start 1 locus_tag LOCUS_70350 CDS 24180..25007 product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522249.1 transl_table 11 codon_start 1 locus_tag LOCUS_70360 CDS 25330..27231 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815090.1 transl_table 11 codon_start 1 locus_tag LOCUS_70370 CDS 27244..28242 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 transl_table 11 codon_start 1 locus_tag LOCUS_70380 CDS 28239..29015 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192006.1 transl_table 11 codon_start 1 locus_tag LOCUS_70390 CDS 29021..30019 product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192829.1 transl_table 11 codon_start 1 locus_tag LOCUS_70400 tRNA 30087..30176 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 CDS complement(30569..30805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70410 CDS complement(30802..31050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70420 CDS 31545..32519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70430 sequence055 source 1..31732 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(666..2162) product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 transl_table 11 codon_start 1 locus_tag LOCUS_70440 CDS complement(2297..3895) product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247315.1 transl_table 11 codon_start 1 locus_tag LOCUS_70450 gene pruA CDS 4136..5137 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930973.1 transl_table 11 codon_start 1 locus_tag LOCUS_70460 CDS 5744..6820 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768050.1 transl_table 11 codon_start 1 locus_tag LOCUS_70470 CDS 7007..7945 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669547.1 transl_table 11 codon_start 1 locus_tag LOCUS_70480 CDS 8112..9293 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626293.1 transl_table 11 codon_start 1 locus_tag LOCUS_70490 CDS 9298..10128 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188908242.1 transl_table 11 codon_start 1 locus_tag LOCUS_70500 CDS 10167..13931 product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195842.1 transl_table 11 codon_start 1 locus_tag LOCUS_70510 gene putA CDS 13948..14418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70520 CDS 14714..15682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70530 CDS complement(15882..16166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70540 CDS complement(16215..16841) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101372.1 transl_table 11 codon_start 1 locus_tag LOCUS_70550 CDS complement(16962..18137) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958306.1 transl_table 11 codon_start 1 locus_tag LOCUS_70560 CDS complement(18149..19834) product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449775.1 transl_table 11 codon_start 1 locus_tag LOCUS_70570 CDS complement(19844..20440) product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809213.1 transl_table 11 codon_start 1 locus_tag LOCUS_70580 CDS complement(20437..21384) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813337.1 transl_table 11 codon_start 1 locus_tag LOCUS_70590 CDS complement(21398..22165) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930110.1 transl_table 11 codon_start 1 locus_tag LOCUS_70600 CDS complement(22206..23390) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897686.1 transl_table 11 codon_start 1 locus_tag LOCUS_70610 CDS 23701..24513 product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064863.1 transl_table 11 codon_start 1 locus_tag LOCUS_70620 gene hutG CDS complement(24692..26218) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526156.1 transl_table 11 codon_start 1 locus_tag LOCUS_70630 CDS complement(26402..27490) product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543120.1 transl_table 11 codon_start 1 locus_tag LOCUS_70640 CDS complement(27480..28733) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523139.1 transl_table 11 codon_start 1 locus_tag LOCUS_70650 CDS 28856..29758 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331304.1 transl_table 11 codon_start 1 locus_tag LOCUS_70660 CDS 29920..30267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70670 CDS 30469..30972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70680 sequence056 source 1..31356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 1358..1942 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2110..3228) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112662.1 transl_table 11 codon_start 1 locus_tag LOCUS_70690 CDS complement(3467..4471) product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098398.1 transl_table 11 codon_start 1 locus_tag LOCUS_70700 CDS complement(4484..4882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70710 assembly_gap 4901..5500 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6084..6518) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193935.1 transl_table 11 codon_start 1 locus_tag LOCUS_70720 CDS complement(6524..7504) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852766.1 transl_table 11 codon_start 1 locus_tag LOCUS_70730 CDS complement(7557..8990) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038653.1 transl_table 11 codon_start 1 locus_tag LOCUS_70740 CDS 9262..9756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70750 CDS complement(9731..11413) product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524564.1 transl_table 11 codon_start 1 locus_tag LOCUS_70760 CDS complement(11413..12375) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256277.1 transl_table 11 codon_start 1 locus_tag LOCUS_70770 CDS complement(12372..14012) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218852620.1 transl_table 11 codon_start 1 locus_tag LOCUS_70780 CDS complement(14009..14767) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939802.1 transl_table 11 codon_start 1 locus_tag LOCUS_70790 CDS complement(14775..15974) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817791.1 transl_table 11 codon_start 1 locus_tag LOCUS_70800 CDS complement(15986..16717) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228020.1 transl_table 11 codon_start 1 locus_tag LOCUS_70810 CDS complement(16723..17694) product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392462.1 transl_table 11 codon_start 1 locus_tag LOCUS_70820 gene fabK CDS complement(17708..18808) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807281.1 transl_table 11 codon_start 1 locus_tag LOCUS_70830 CDS 19049..19396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70840 note possible pseudo, frameshifted CDS complement(19648..19872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70850 CDS 20357..20926 product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 transl_table 11 codon_start 1 locus_tag LOCUS_70860 CDS 21774..22106 product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064047.1 transl_table 11 codon_start 1 locus_tag LOCUS_70870 CDS 22093..22434 product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816743.1 transl_table 11 codon_start 1 locus_tag LOCUS_70880 CDS complement(22742..24043) product replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194484.1 transl_table 11 codon_start 1 locus_tag LOCUS_70890 CDS complement(25167..25568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70900 note possible pseudo, internal stop codon, frameshifted CDS complement(25565..25846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70910 CDS 26240..27322 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001572362.1 transl_table 11 codon_start 1 locus_tag LOCUS_70920 CDS 27692..27940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70930 CDS 29903..30694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70940 sequence057 source 1..30748 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 768..2234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_70950 CDS complement(2270..3262) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329741.1 transl_table 11 codon_start 1 locus_tag LOCUS_70960 CDS complement(3287..4306) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225688.1 transl_table 11 codon_start 1 locus_tag LOCUS_70970 CDS complement(4346..5563) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526008.1 transl_table 11 codon_start 1 locus_tag LOCUS_70980 CDS complement(5560..6372) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389895.1 transl_table 11 codon_start 1 locus_tag LOCUS_70990 CDS complement(6375..7343) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064800.1 transl_table 11 codon_start 1 locus_tag LOCUS_71000 CDS complement(7364..8896) product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921024.1 transl_table 11 codon_start 1 locus_tag LOCUS_71010 CDS complement(8940..9866) product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401703.1 transl_table 11 codon_start 1 locus_tag LOCUS_71020 CDS complement(9875..10645) product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114490.1 transl_table 11 codon_start 1 locus_tag LOCUS_71030 CDS complement(10981..12000) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192815.1 transl_table 11 codon_start 1 locus_tag LOCUS_71040 CDS complement(12065..13042) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083775.1 transl_table 11 codon_start 1 locus_tag LOCUS_71050 CDS complement(13091..13540) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 transl_table 11 codon_start 1 locus_tag LOCUS_71060 CDS complement(13537..14523) product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266314.1 transl_table 11 codon_start 1 locus_tag LOCUS_71070 CDS complement(14520..16193) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086113.1 transl_table 11 codon_start 1 locus_tag LOCUS_71080 CDS complement(16198..17427) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089998.1 transl_table 11 codon_start 1 locus_tag LOCUS_71090 CDS complement(17439..18500) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186177.1 transl_table 11 codon_start 1 locus_tag LOCUS_71100 CDS complement(18509..19282) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889459.1 transl_table 11 codon_start 1 locus_tag LOCUS_71110 CDS complement(19350..20528) product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191856.1 transl_table 11 codon_start 1 locus_tag LOCUS_71120 CDS complement(20564..22657) product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192524.1 transl_table 11 codon_start 1 locus_tag LOCUS_71130 CDS 22909..23358 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811562.1 transl_table 11 codon_start 1 locus_tag LOCUS_71140 CDS 23355..24086 product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888039.1 transl_table 11 codon_start 1 locus_tag LOCUS_71150 CDS complement(24199..25020) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097851.1 transl_table 11 codon_start 1 locus_tag LOCUS_71160 CDS 25211..26416 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185551.1 transl_table 11 codon_start 1 locus_tag LOCUS_71170 CDS 26426..27589 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929935.1 transl_table 11 codon_start 1 locus_tag LOCUS_71180 CDS 27608..28780 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084682.1 transl_table 11 codon_start 1 locus_tag LOCUS_71190 CDS 28798..29559 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064586.1 transl_table 11 codon_start 1 locus_tag LOCUS_71200 CDS 29561..30493 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064585.1 transl_table 11 codon_start 1 locus_tag LOCUS_71210 sequence058 source 1..29861 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(98..424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71220 CDS complement(421..2094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71230 CDS 2258..3211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922267.1 transl_table 11 codon_start 1 locus_tag LOCUS_71240 CDS complement(3672..4139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71250 CDS 4752..6956 product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113558.1 transl_table 11 codon_start 1 locus_tag LOCUS_71260 CDS complement(7245..9101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71270 CDS complement(9458..10168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71280 CDS complement(10644..11174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71290 CDS 11302..11841 product CHRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088650.1 transl_table 11 codon_start 1 locus_tag LOCUS_71300 CDS 12006..12251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71310 CDS 12481..12903 product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012112382.1 transl_table 11 codon_start 1 locus_tag LOCUS_71320 CDS complement(13056..13256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71330 CDS complement(13366..13689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71340 CDS 14036..14221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71350 CDS 14432..14725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71360 CDS 14738..15328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71370 CDS 15606..15890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71380 CDS 15917..16345 product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142976.1 transl_table 11 codon_start 1 locus_tag LOCUS_71390 CDS complement(16718..19387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71400 CDS complement(19384..20310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71410 CDS complement(20307..21425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71420 CDS complement(21607..22953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094616.1 transl_table 11 codon_start 1 locus_tag LOCUS_71430 CDS complement(22987..24750) product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729637.1 transl_table 11 codon_start 1 locus_tag LOCUS_71440 CDS 25630..26445 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917928.1 transl_table 11 codon_start 1 locus_tag LOCUS_71450 CDS 27334..28296 product IS5-like element ISPssy family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923181.1 transl_table 11 codon_start 1 locus_tag LOCUS_71460 CDS 28576..29586 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868863.1 transl_table 11 codon_start 1 locus_tag LOCUS_71470 sequence059 source 1..29407 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 122..445 product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 transl_table 11 codon_start 1 locus_tag LOCUS_71480 CDS 554..1120 product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 transl_table 11 codon_start 1 locus_tag LOCUS_71490 gene iscR CDS 1117..1638 product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384414.1 transl_table 11 codon_start 1 locus_tag LOCUS_71500 gene hscB CDS 1670..2107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388762.1 transl_table 11 codon_start 1 locus_tag LOCUS_71510 CDS 2365..3123 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205679.1 transl_table 11 codon_start 1 locus_tag LOCUS_71520 gene modA CDS complement(3173..3682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71530 CDS 3913..4719 product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818535.1 transl_table 11 codon_start 1 locus_tag LOCUS_71540 CDS 4926..5600 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937491.1 transl_table 11 codon_start 1 locus_tag LOCUS_71550 gene modB CDS 5628..6419 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190506.1 transl_table 11 codon_start 1 locus_tag LOCUS_71560 CDS 6520..6948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71570 CDS complement(6938..7612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71580 CDS complement(7743..8675) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529142.1 transl_table 11 codon_start 1 locus_tag LOCUS_71590 CDS 8894..9763 product ModD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389418.1 transl_table 11 codon_start 1 locus_tag LOCUS_71600 gene modD CDS complement(9765..10010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71610 CDS 10193..10387 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084569.1 transl_table 11 codon_start 1 locus_tag LOCUS_71620 CDS 10404..10676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71630 CDS 10769..11947 product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670052.1 transl_table 11 codon_start 1 locus_tag LOCUS_71640 gene nifS CDS 11947..12159 product putative nitrogen fixation protein NifT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533514.1 transl_table 11 codon_start 1 locus_tag LOCUS_71650 gene nifT CDS 12162..12425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71660 CDS 12422..13606 product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582967.1 transl_table 11 codon_start 1 locus_tag LOCUS_71670 CDS 13914..14756 product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388754.1 transl_table 11 codon_start 1 locus_tag LOCUS_71680 CDS 14769..16367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71690 CDS 16527..17990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71700 CDS 18118..18474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71710 CDS 18530..18889 product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196764.1 transl_table 11 codon_start 1 locus_tag LOCUS_71720 gene cyaY CDS 18950..19186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71730 CDS complement(19195..19878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71740 CDS complement(19921..21072) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971173.1 transl_table 11 codon_start 1 locus_tag LOCUS_71750 CDS 21233..21712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71760 CDS 21729..22016 product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523182.1 transl_table 11 codon_start 1 locus_tag LOCUS_71770 CDS complement(22050..22778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71780 CDS 22944..24494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71790 CDS 24498..25313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71800 CDS complement(25405..25692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71810 CDS complement(25703..25957) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626541.1 transl_table 11 codon_start 1 locus_tag LOCUS_71820 CDS complement(25950..26771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71830 CDS complement(26744..28519) product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114317.1 transl_table 11 codon_start 1 locus_tag LOCUS_71840 CDS complement(28525..28935) product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965250.1 transl_table 11 codon_start 1 locus_tag LOCUS_71850 sequence060 source 1..29387 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71860 CDS 463..1077 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368734.1 transl_table 11 codon_start 1 locus_tag LOCUS_71870 CDS 1198..1368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71880 CDS complement(1586..2074) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390043.1 transl_table 11 codon_start 1 locus_tag LOCUS_71890 CDS complement(2087..2695) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878054.1 transl_table 11 codon_start 1 locus_tag LOCUS_71900 CDS 2849..4006 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207151.1 transl_table 11 codon_start 1 locus_tag LOCUS_71910 CDS 4192..6174 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206058.1 transl_table 11 codon_start 1 locus_tag LOCUS_71920 CDS 6188..7234 product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206057.1 transl_table 11 codon_start 1 locus_tag LOCUS_71930 CDS 7300..8103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_71940 CDS complement(8105..11170) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088782.1 transl_table 11 codon_start 1 locus_tag LOCUS_71950 CDS 11299..12372 product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703864.1 transl_table 11 codon_start 1 locus_tag LOCUS_71960 CDS complement(12378..13076) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040671.1 transl_table 11 codon_start 1 locus_tag LOCUS_71970 CDS 13202..14446 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815469.1 transl_table 11 codon_start 1 locus_tag LOCUS_71980 CDS 14726..15694 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064939.1 transl_table 11 codon_start 1 locus_tag LOCUS_71990 CDS 15703..16938 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064263.1 transl_table 11 codon_start 1 locus_tag LOCUS_72000 CDS 16931..17737 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087141.1 transl_table 11 codon_start 1 locus_tag LOCUS_72010 CDS complement(17867..18064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72020 CDS 18597..18824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72030 CDS complement(19183..20004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72040 CDS 20250..20561 product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196156.1 transl_table 11 codon_start 1 locus_tag LOCUS_72050 CDS complement(20602..20874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72060 CDS 21476..21784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72070 CDS complement(22270..22485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72080 CDS 22375..22602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72090 CDS complement(23017..23955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72100 CDS 25769..26020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72110 CDS complement(26249..26611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72120 CDS 26784..27452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72130 CDS 27597..27914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72140 CDS 27927..28406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72150 CDS 28952..29311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72160 sequence061 source 1..29897 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 356..1021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72170 CDS 1027..2016 product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064872.1 transl_table 11 codon_start 1 locus_tag LOCUS_72180 CDS 2013..2807 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162687994.1 transl_table 11 codon_start 1 locus_tag LOCUS_72190 CDS 2811..3047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72200 CDS 3059..3808 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447049.1 transl_table 11 codon_start 1 locus_tag LOCUS_72210 CDS 4246..5886 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449775.1 transl_table 11 codon_start 1 locus_tag LOCUS_72220 CDS 5928..6860 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064585.1 transl_table 11 codon_start 1 locus_tag LOCUS_72230 CDS 6879..8057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72240 CDS 8064..9521 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930129.1 transl_table 11 codon_start 1 locus_tag LOCUS_72250 gene lpdA CDS 9623..10489 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243002.1 transl_table 11 codon_start 1 locus_tag LOCUS_72260 CDS 10494..11537 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546311.1 transl_table 11 codon_start 1 locus_tag LOCUS_72270 CDS 11509..12252 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942651.1 transl_table 11 codon_start 1 locus_tag LOCUS_72280 CDS 12236..12943 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185649.1 transl_table 11 codon_start 1 locus_tag LOCUS_72290 CDS 13020..14201 product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064652.1 transl_table 11 codon_start 1 locus_tag LOCUS_72300 CDS 14213..14881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72310 CDS 15136..15459 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636365.1 transl_table 11 codon_start 1 locus_tag LOCUS_72320 CDS 15456..16346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72330 note possible pseudo, frameshifted CDS 17172..18008 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764768.1 transl_table 11 codon_start 1 locus_tag LOCUS_72340 CDS complement(17995..18465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72350 CDS complement(18462..18617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72360 assembly_gap 18636..18645 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(18957..19619) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810741.1 transl_table 11 codon_start 1 locus_tag LOCUS_72370 CDS complement(19619..21211) product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226376481.1 transl_table 11 codon_start 1 locus_tag LOCUS_72380 CDS 21513..22520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72390 CDS 22945..23118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72400 CDS complement(23920..24873) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100771272.1 transl_table 11 codon_start 1 locus_tag LOCUS_72410 CDS complement(25050..25679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72420 note possible pseudo, frameshifted CDS complement(25787..26386) product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970111.1 transl_table 11 codon_start 1 locus_tag LOCUS_72430 gene wrbA CDS complement(26519..27421) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173512409.1 transl_table 11 codon_start 1 locus_tag LOCUS_72440 CDS 27618..27992 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976297.1 transl_table 11 codon_start 1 locus_tag LOCUS_72450 CDS 28842..29114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72460 note possible pseudo, internal stop codon, frameshifted sequence062 source 1..29616 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(774..2378) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536557.1 transl_table 11 codon_start 1 locus_tag LOCUS_72470 CDS complement(2606..5194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72480 CDS 5396..5710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72490 CDS complement(5667..9107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72500 CDS complement(9343..9654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72510 CDS 10362..11525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72520 CDS complement(11861..13879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72530 assembly_gap 13859..13868 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13880..16231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72540 CDS complement(16708..16983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72550 CDS complement(17101..17319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72560 CDS complement(17452..18282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72570 CDS 19523..20872 product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217858.1 transl_table 11 codon_start 1 locus_tag LOCUS_72580 CDS 20913..21293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72590 CDS 21422..22405 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550164.1 transl_table 11 codon_start 1 locus_tag LOCUS_72600 CDS complement(22416..23321) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815402.1 transl_table 11 codon_start 1 locus_tag LOCUS_72610 CDS 23399..24664 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 transl_table 11 codon_start 1 locus_tag LOCUS_72620 CDS 24917..25243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72630 CDS complement(25300..25587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72640 CDS 25850..27142 product bifunctional alpha/beta hydrolase/OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085686.1 transl_table 11 codon_start 1 locus_tag LOCUS_72650 CDS complement(27153..28100) product DedA family protein/thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190574.1 transl_table 11 codon_start 1 locus_tag LOCUS_72660 misc_feature complement(28281..>29616) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003818562.1:cytochrome c oxidase accessory protein CcoG locus_tag LOCUS_72670 sequence063 source 1..27084 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..529 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444671.1:efflux RND transporter permease subunit locus_tag LOCUS_72680 CDS complement(646..1653) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965338.1 transl_table 11 codon_start 1 locus_tag LOCUS_72690 CDS complement(1727..2473) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977492.1 transl_table 11 codon_start 1 locus_tag LOCUS_72700 CDS complement(2550..3482) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064585.1 transl_table 11 codon_start 1 locus_tag LOCUS_72710 CDS complement(3484..4233) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064586.1 transl_table 11 codon_start 1 locus_tag LOCUS_72720 CDS complement(4248..4736) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390712.1 transl_table 11 codon_start 1 locus_tag LOCUS_72730 CDS complement(4754..6535) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 transl_table 11 codon_start 1 locus_tag LOCUS_72740 CDS complement(6634..8304) product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091546.1 transl_table 11 codon_start 1 locus_tag LOCUS_72750 CDS complement(8301..8609) product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209030.1 transl_table 11 codon_start 1 locus_tag LOCUS_72760 CDS complement(8698..10344) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967567.1 transl_table 11 codon_start 1 locus_tag LOCUS_72770 CDS 10513..12495 product PAS-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337374.1 transl_table 11 codon_start 1 locus_tag LOCUS_72780 CDS 12488..13204 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337375.1 transl_table 11 codon_start 1 locus_tag LOCUS_72790 CDS 13454..15142 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193882.1 transl_table 11 codon_start 1 locus_tag LOCUS_72800 CDS 15344..15556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72810 CDS complement(15634..15912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72820 CDS 15943..16200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72830 CDS complement(16608..17462) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971279.1 transl_table 11 codon_start 1 locus_tag LOCUS_72840 CDS 17541..18458 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031087.1 transl_table 11 codon_start 1 locus_tag LOCUS_72850 CDS 18546..19247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72860 CDS complement(19304..20818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72870 CDS complement(21277..22869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72880 CDS complement(22881..23255) product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192320.1 transl_table 11 codon_start 1 locus_tag LOCUS_72890 CDS complement(23617..25680) product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228351.1 transl_table 11 codon_start 1 locus_tag LOCUS_72900 sequence064 source 1..26245 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 358..1074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72910 CDS 1186..2370 product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090562.1 transl_table 11 codon_start 1 locus_tag LOCUS_72920 gene pobA CDS complement(2379..2963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72930 note possible pseudo, internal stop codon, frameshifted CDS complement(2944..3417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72940 note possible pseudo, internal stop codon, frameshifted CDS complement(3859..5757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72950 CDS 5857..6291 product organic hydroperoxide resistance protein OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104171.1 transl_table 11 codon_start 1 locus_tag LOCUS_72960 gene ohrR CDS 6443..7195 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191638.1 transl_table 11 codon_start 1 locus_tag LOCUS_72970 gene lexA CDS 7468..7842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_72980 CDS 7928..8935 product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525849.1 transl_table 11 codon_start 1 locus_tag LOCUS_72990 CDS 8932..9516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73000 CDS 9513..10061 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040338.1 transl_table 11 codon_start 1 locus_tag LOCUS_73010 CDS 10158..10661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73020 CDS complement(10743..11384) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302745.1 transl_table 11 codon_start 1 locus_tag LOCUS_73030 gene upp CDS complement(11457..12710) product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064115.1 transl_table 11 codon_start 1 locus_tag LOCUS_73040 CDS 12887..13456 product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186447662.1 transl_table 11 codon_start 1 locus_tag LOCUS_73050 gene paoA CDS 13469..14467 product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102358.1 transl_table 11 codon_start 1 locus_tag LOCUS_73060 CDS 14492..16753 product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085007.1 transl_table 11 codon_start 1 locus_tag LOCUS_73070 CDS 16826..17392 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005374107.1 transl_table 11 codon_start 1 locus_tag LOCUS_73080 CDS complement(17394..17627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73090 CDS 17626..18066 product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765169.1 transl_table 11 codon_start 1 locus_tag LOCUS_73100 CDS 18449..18676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73110 CDS 18859..20193 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021464.1 transl_table 11 codon_start 1 locus_tag LOCUS_73120 CDS 20402..23905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73130 CDS 23926..25677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73140 CDS 25677..26222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73150 sequence065 source 1..26197 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1069..1959) product bifunctional 3-hydroxy-3-isohexenylglutaryl-CoA lyase/hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088593.1 transl_table 11 codon_start 1 locus_tag LOCUS_73160 gene liuE CDS complement(1959..3959) product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035499.1 transl_table 11 codon_start 1 locus_tag LOCUS_73170 CDS complement(3985..4725) product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206449.1 transl_table 11 codon_start 1 locus_tag LOCUS_73180 CDS complement(4788..6395) product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206450.1 transl_table 11 codon_start 1 locus_tag LOCUS_73190 CDS complement(6414..7421) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817045.1 transl_table 11 codon_start 1 locus_tag LOCUS_73200 CDS complement(7418..8539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73210 CDS complement(8814..9953) product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228924.1 transl_table 11 codon_start 1 locus_tag LOCUS_73220 CDS complement(9971..11542) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102517.1 transl_table 11 codon_start 1 locus_tag LOCUS_73230 CDS 11792..12592 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312277.1 transl_table 11 codon_start 1 locus_tag LOCUS_73240 CDS 12597..13040 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965339.1 transl_table 11 codon_start 1 locus_tag LOCUS_73250 CDS 13417..13644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73260 note possible pseudo, frameshifted CDS complement(13694..14296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73270 CDS 14186..14779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73280 CDS complement(14863..15876) product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206164.1 transl_table 11 codon_start 1 locus_tag LOCUS_73290 CDS complement(15873..17684) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206058.1 transl_table 11 codon_start 1 locus_tag LOCUS_73300 CDS 17838..19709 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014493545.1 transl_table 11 codon_start 1 locus_tag LOCUS_73310 CDS 19681..20283 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967489.1 transl_table 11 codon_start 1 locus_tag LOCUS_73320 CDS complement(20287..20766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73330 assembly_gap 20818..21867 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(21873..22829) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926514.1 transl_table 11 codon_start 1 locus_tag LOCUS_73340 CDS complement(22873..24510) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536557.1 transl_table 11 codon_start 1 locus_tag LOCUS_73350 CDS complement(24553..25347) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921388.1 transl_table 11 codon_start 1 locus_tag LOCUS_73360 misc_feature complement(25344..>26197) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812334.1:tripartite tricarboxylate transporter substrate binding protein locus_tag LOCUS_73370 sequence066 source 1..24099 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(395..1441) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 transl_table 11 codon_start 1 locus_tag LOCUS_73380 CDS complement(1534..3069) product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 transl_table 11 codon_start 1 locus_tag LOCUS_73390 CDS complement(3251..3991) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965671.1 transl_table 11 codon_start 1 locus_tag LOCUS_73400 CDS complement(4295..5617) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189990.1 transl_table 11 codon_start 1 locus_tag LOCUS_73410 gene argG CDS complement(5632..5949) product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941982.1 transl_table 11 codon_start 1 locus_tag LOCUS_73420 CDS complement(6109..6552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73430 note possible pseudo, frameshifted CDS complement(7098..8411) product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 transl_table 11 codon_start 1 locus_tag LOCUS_73440 CDS complement(8420..9391) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015041576.1 transl_table 11 codon_start 1 locus_tag LOCUS_73450 CDS 9506..10393 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395910.1 transl_table 11 codon_start 1 locus_tag LOCUS_73460 CDS 10508..12940 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941469.1 transl_table 11 codon_start 1 locus_tag LOCUS_73470 gene ppsA CDS 13145..13522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73480 CDS 13874..14638 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958593.1 transl_table 11 codon_start 1 locus_tag LOCUS_73490 CDS 14668..16749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73500 CDS complement(16792..17568) product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212452.1 transl_table 11 codon_start 1 locus_tag LOCUS_73510 gene fnr CDS complement(17714..18358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73520 CDS complement(18385..18879) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 transl_table 11 codon_start 1 locus_tag LOCUS_73530 CDS 19121..19939 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551552.1 transl_table 11 codon_start 1 locus_tag LOCUS_73540 CDS complement(20058..20903) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551552.1 transl_table 11 codon_start 1 locus_tag LOCUS_73550 CDS complement(20923..21351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73560 CDS complement(21367..21819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73570 CDS 22040..22615 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 transl_table 11 codon_start 1 locus_tag LOCUS_73580 CDS 22840..23049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73590 sequence067 source 1..23373 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(495..2951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73600 CDS complement(3134..5851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73610 CDS complement(5925..6176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73620 CDS 6413..6682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73630 CDS complement(6895..7374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73640 CDS complement(7698..8498) product IS1595-like element ISXca4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037261.1 transl_table 11 codon_start 1 locus_tag LOCUS_73650 note possible pseudo, frameshifted CDS complement(11275..12144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73660 CDS complement(12279..16052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73670 CDS complement(16413..17822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73680 CDS complement(17849..19231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73690 CDS complement(19228..20817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73700 CDS complement(20856..22241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225428.1 transl_table 11 codon_start 1 locus_tag LOCUS_73710 CDS complement(22965..23153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73720 sequence068 source 1..23147 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(481..933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73730 CDS complement(992..1750) product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405283.1 transl_table 11 codon_start 1 locus_tag LOCUS_73740 CDS complement(1767..2504) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191786.1 transl_table 11 codon_start 1 locus_tag LOCUS_73750 gene rlmB CDS complement(2605..4062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73760 CDS complement(4600..5328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73770 CDS 5391..6518 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 transl_table 11 codon_start 1 locus_tag LOCUS_73780 CDS 6592..7176 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091136546.1 transl_table 11 codon_start 1 locus_tag LOCUS_73790 CDS 7224..9224 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366399.1 transl_table 11 codon_start 1 locus_tag LOCUS_73800 CDS 9858..10229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73810 CDS 10323..11006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73820 CDS complement(11040..11858) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200941.1 transl_table 11 codon_start 1 locus_tag LOCUS_73830 CDS complement(12014..12220) product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809188.1 transl_table 11 codon_start 1 locus_tag LOCUS_73840 CDS complement(12226..12630) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844771.1 transl_table 11 codon_start 1 locus_tag LOCUS_73850 CDS complement(12743..16726) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527208.1 transl_table 11 codon_start 1 locus_tag LOCUS_73860 gene purL CDS 16847..17680 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193235.1 transl_table 11 codon_start 1 locus_tag LOCUS_73870 gene map CDS 17721..20372 product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197089.1 transl_table 11 codon_start 1 locus_tag LOCUS_73880 CDS 20479..21540 product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526161.1 transl_table 11 codon_start 1 locus_tag LOCUS_73890 gene mnmH CDS 21592..22386 product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967317.1 transl_table 11 codon_start 1 locus_tag LOCUS_73900 CDS 22476..22694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73910 sequence069 source 1..21598 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(180..383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73920 CDS complement(408..1826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73930 CDS 1899..2213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73940 CDS 2775..3635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_73950 CDS 3632..4588 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970904.1 transl_table 11 codon_start 1 locus_tag LOCUS_73960 CDS complement(5435..7123) product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698054.1 transl_table 11 codon_start 1 locus_tag LOCUS_73970 CDS complement(7185..7529) product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266599.1 transl_table 11 codon_start 1 locus_tag LOCUS_73980 gene tnpB CDS complement(7526..7951) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105580.1 transl_table 11 codon_start 1 locus_tag LOCUS_73990 CDS complement(8373..8873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74000 CDS 9299..9631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74010 CDS 9631..10023 product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622996.1 transl_table 11 codon_start 1 locus_tag LOCUS_74020 gene tnpB CDS 10098..11615 product IS66-like element ISBj7 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084592.1 transl_table 11 codon_start 1 locus_tag LOCUS_74030 CDS complement(11542..12786) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976064.1 transl_table 11 codon_start 1 locus_tag LOCUS_74040 CDS complement(12804..14042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74050 CDS complement(14183..14995) product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532025.1 transl_table 11 codon_start 1 locus_tag LOCUS_74060 CDS complement(14992..15909) product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334456.1 transl_table 11 codon_start 1 locus_tag LOCUS_74070 gene fhcD CDS complement(15906..17588) product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922276.1 transl_table 11 codon_start 1 locus_tag LOCUS_74080 CDS complement(17585..18619) product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061087.1 transl_table 11 codon_start 1 locus_tag LOCUS_74090 CDS 19256..19864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74100 CDS complement(19941..20636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74110 CDS complement(20633..20884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74120 CDS complement(20957..21178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74130 sequence070 source 1..21556 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74140 CDS complement(596..1351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74150 CDS 1838..2722 product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170858.1 transl_table 11 codon_start 1 locus_tag LOCUS_74160 CDS complement(2686..3171) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704664.1 transl_table 11 codon_start 1 locus_tag LOCUS_74170 CDS complement(3168..4157) product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 transl_table 11 codon_start 1 locus_tag LOCUS_74180 CDS 4223..4576 product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040743.1 transl_table 11 codon_start 1 locus_tag LOCUS_74190 CDS 4573..5487 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089792.1 transl_table 11 codon_start 1 locus_tag LOCUS_74200 CDS 5822..6751 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047962736.1 transl_table 11 codon_start 1 locus_tag LOCUS_74210 CDS complement(6768..8096) product alkaline protease secretion protein AprE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082540.1 transl_table 11 codon_start 1 locus_tag LOCUS_74220 gene aprE CDS complement(8110..9954) product alkaline protease secretion ATP-binding protein AprD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082539.1 transl_table 11 codon_start 1 locus_tag LOCUS_74230 gene aprD CDS complement(10399..11181) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053361.1 transl_table 11 codon_start 1 locus_tag LOCUS_74240 CDS 11573..11803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74250 CDS 11907..12095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74260 CDS 12213..12815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74270 note possible pseudo, frameshifted CDS complement(12849..14945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74280 CDS complement(14939..16294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74290 CDS complement(16464..17267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74300 CDS complement(17299..19206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74310 misc_feature complement(19282..>21556) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529849.1:VCBS domain-containing protein locus_tag LOCUS_74320 sequence071 source 1..21231 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1008..1271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74330 CDS complement(1605..4574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74340 CDS 4770..5135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74350 CDS complement(5075..5566) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020097.1 transl_table 11 codon_start 1 locus_tag LOCUS_74360 CDS complement(5617..6126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74370 CDS complement(6156..6647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74380 CDS 6867..7196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74390 CDS complement(7218..7376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74400 CDS complement(7420..7632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74410 CDS 7702..8136 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971139.1 transl_table 11 codon_start 1 locus_tag LOCUS_74420 CDS 8112..8462 product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971138.1 transl_table 11 codon_start 1 locus_tag LOCUS_74430 gene tnpB CDS 8571..10178 product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147237312.1 transl_table 11 codon_start 1 locus_tag LOCUS_74440 CDS complement(10245..10640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74450 CDS 10766..10969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74460 CDS 10990..11244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74470 CDS 11301..12740 product multidrug efflux MFS transporter outer membrane subunit VceC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798631.1 transl_table 11 codon_start 1 locus_tag LOCUS_74480 gene vceC CDS 12797..14026 product multidrug efflux MFS transporter adaptor subunit VceA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625982.1 transl_table 11 codon_start 1 locus_tag LOCUS_74490 gene vceA CDS 14047..15600 product multidrug efflux MFS transporter permease subunit VceB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019055.1 transl_table 11 codon_start 1 locus_tag LOCUS_74500 gene vceB CDS complement(15923..16519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74510 CDS 17465..17896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74520 CDS complement(18760..20634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74530 sequence072 source 1..20446 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(8512..8670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74540 CDS 8756..10105 product IS30-like element ISMsm8 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728521.1 transl_table 11 codon_start 1 locus_tag LOCUS_74550 CDS complement(10718..11041) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165196.1 transl_table 11 codon_start 1 locus_tag LOCUS_74560 assembly_gap 11315..11344 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11354..12703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74570 CDS 12702..13022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74580 CDS 13144..13563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74590 CDS 13538..13705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74600 CDS 13731..14288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74610 CDS 14305..14739 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193608.1 transl_table 11 codon_start 1 locus_tag LOCUS_74620 CDS complement(14779..14916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74630 CDS complement(15297..15974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74640 CDS 15982..16323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74650 CDS 16603..16794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74660 CDS 17125..17850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74670 CDS complement(17911..18114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74680 CDS complement(18233..18712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74690 CDS complement(19223..19927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74700 sequence073 source 1..19984 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 564..1247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74710 CDS complement(1538..1717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74720 CDS complement(1791..2861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74730 CDS 3983..5395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74740 CDS complement(5484..6497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74750 CDS 6598..7059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74760 CDS complement(7388..11251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74770 CDS complement(11331..12107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74780 note possible pseudo, frameshifted CDS complement(13339..13533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74790 CDS 14392..14898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74800 CDS complement(15101..15709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74810 CDS 16170..17219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74820 CDS complement(17862..18188) product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195767.1 transl_table 11 codon_start 1 locus_tag LOCUS_74830 CDS 18836..19078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74840 CDS 19290..19475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74850 sequence074 source 1..19697 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024900397.1:phage integrase family protein locus_tag LOCUS_74860 CDS complement(716..1828) product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103404.1 transl_table 11 codon_start 1 locus_tag LOCUS_74870 CDS complement(1984..4938) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011114777.1 transl_table 11 codon_start 1 locus_tag LOCUS_74880 CDS 5077..5742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74890 CDS 5735..6370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74900 CDS 8521..9051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74910 CDS 9055..10377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74920 CDS 10730..11041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74930 CDS 12383..13822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74940 CDS complement(13884..14183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74950 CDS complement(15190..15930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74960 CDS 16185..16487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74970 CDS 16587..16823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_74980 CDS complement(17140..18747) product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147237312.1 transl_table 11 codon_start 1 locus_tag LOCUS_74990 CDS complement(18856..19206) product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971138.1 transl_table 11 codon_start 1 locus_tag LOCUS_75000 gene tnpB CDS complement(19182..19616) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971139.1 transl_table 11 codon_start 1 locus_tag LOCUS_75010 sequence075 source 1..19367 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 250..1263 product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703864.1 transl_table 11 codon_start 1 locus_tag LOCUS_75020 CDS complement(1269..1472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75030 CDS complement(1469..1855) product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926341.1 transl_table 11 codon_start 1 locus_tag LOCUS_75040 CDS complement(1859..2221) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810617.1 transl_table 11 codon_start 1 locus_tag LOCUS_75050 CDS complement(2218..3342) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269378.1 transl_table 11 codon_start 1 locus_tag LOCUS_75060 CDS complement(3414..4346) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064585.1 transl_table 11 codon_start 1 locus_tag LOCUS_75070 CDS complement(4463..5212) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064586.1 transl_table 11 codon_start 1 locus_tag LOCUS_75080 CDS complement(5229..5723) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390712.1 transl_table 11 codon_start 1 locus_tag LOCUS_75090 CDS complement(5820..7964) product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268335.1 transl_table 11 codon_start 1 locus_tag LOCUS_75100 gene fadB CDS complement(7994..9175) product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192518.1 transl_table 11 codon_start 1 locus_tag LOCUS_75110 CDS complement(9219..11108) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 transl_table 11 codon_start 1 locus_tag LOCUS_75120 CDS complement(11756..12655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75130 CDS complement(12718..14184) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228971.1 transl_table 11 codon_start 1 locus_tag LOCUS_75140 CDS complement(15274..16095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75150 CDS complement(16221..17051) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086453.1 transl_table 11 codon_start 1 locus_tag LOCUS_75160 CDS complement(17198..17629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75170 CDS complement(17945..19081) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772473.1 transl_table 11 codon_start 1 locus_tag LOCUS_75180 sequence076 source 1..19225 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 626..2728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75190 CDS complement(2854..3105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75200 CDS 3262..4110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75210 CDS 4334..6193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75220 CDS 6237..6929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75230 CDS complement(7000..7218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75240 CDS complement(7243..8130) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089137.1 transl_table 11 codon_start 1 locus_tag LOCUS_75250 CDS 8266..9240 product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063889.1 transl_table 11 codon_start 1 locus_tag LOCUS_75260 CDS 9302..10639 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 transl_table 11 codon_start 1 locus_tag LOCUS_75270 CDS 10734..12302 product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226485.1 transl_table 11 codon_start 1 locus_tag LOCUS_75280 CDS 12432..14357 product FAD-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966821.1 transl_table 11 codon_start 1 locus_tag LOCUS_75290 CDS 14853..15962 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543370.1 transl_table 11 codon_start 1 locus_tag LOCUS_75300 CDS 15969..16202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75310 CDS complement(16358..16900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75320 CDS complement(17140..18597) product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088858.1 transl_table 11 codon_start 1 locus_tag LOCUS_75330 sequence077 source 1..18582 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 417..2615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75340 CDS complement(2866..3429) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086804.1 transl_table 11 codon_start 1 locus_tag LOCUS_75350 CDS complement(3384..3590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75360 CDS complement(3699..5651) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531442.1 transl_table 11 codon_start 1 locus_tag LOCUS_75370 CDS complement(5648..6529) product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930547.1 transl_table 11 codon_start 1 locus_tag LOCUS_75380 gene prmB CDS complement(6597..7796) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191377.1 transl_table 11 codon_start 1 locus_tag LOCUS_75390 gene dapE CDS complement(7958..8782) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191680.1 transl_table 11 codon_start 1 locus_tag LOCUS_75400 gene dapD CDS complement(8805..10010) product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198896.1 transl_table 11 codon_start 1 locus_tag LOCUS_75410 gene dapC CDS complement(10128..10604) product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551114.1 transl_table 11 codon_start 1 locus_tag LOCUS_75420 CDS complement(10604..10990) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 transl_table 11 codon_start 1 locus_tag LOCUS_75430 CDS 11001..11174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75440 CDS 11306..14821 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114484320.1 transl_table 11 codon_start 1 locus_tag LOCUS_75450 gene smc CDS 14847..16070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75460 CDS complement(16175..17803) product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742107.1 transl_table 11 codon_start 1 locus_tag LOCUS_75470 sequence078 source 1..18440 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(298..618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75480 CDS complement(642..1790) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228882.1 transl_table 11 codon_start 1 locus_tag LOCUS_75490 CDS 1941..3248 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 transl_table 11 codon_start 1 locus_tag LOCUS_75500 CDS complement(3970..5286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75510 CDS complement(5520..6713) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 transl_table 11 codon_start 1 locus_tag LOCUS_75520 CDS 6934..7605 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809074.1 transl_table 11 codon_start 1 locus_tag LOCUS_75530 CDS 8031..8210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75540 CDS complement(8310..8525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75550 CDS complement(8792..9115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75560 CDS 9652..10386 product translesion DNA synthesis-associated protein ImuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810879.1 transl_table 11 codon_start 1 locus_tag LOCUS_75570 gene imuA CDS 10322..11665 product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550915.1 transl_table 11 codon_start 1 locus_tag LOCUS_75580 CDS 11678..14800 product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063897.1 transl_table 11 codon_start 1 locus_tag LOCUS_75590 CDS 14996..16582 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272601.1 transl_table 11 codon_start 1 locus_tag LOCUS_75600 CDS complement(16812..18161) product IS1182-like element ISPa22 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112390.1 transl_table 11 codon_start 1 locus_tag LOCUS_75610 sequence079 source 1..17963 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 135..293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75620 CDS complement(768..1949) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223851191.1 transl_table 11 codon_start 1 locus_tag LOCUS_75630 CDS 2080..2832 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004351567.1 transl_table 11 codon_start 1 locus_tag LOCUS_75640 CDS complement(3162..5408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75650 CDS complement(5711..7504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75660 CDS 8147..9325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75670 CDS 9389..9550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75680 CDS complement(9878..10666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75690 CDS complement(10650..10925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75700 CDS complement(11011..12021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75710 note possible pseudo, internal stop codon CDS complement(12025..13338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75720 note possible pseudo, internal stop codon, frameshifted CDS 13390..13878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75730 CDS 15294..16625 product replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194484.1 transl_table 11 codon_start 1 locus_tag LOCUS_75740 CDS 16875..17171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75750 note possible pseudo, internal stop codon CDS 17178..17474 product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 transl_table 11 codon_start 1 locus_tag LOCUS_75760 sequence080 source 1..17444 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1217..2155 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821275.1 transl_table 11 codon_start 1 locus_tag LOCUS_75770 CDS 2232..3197 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974584.1 transl_table 11 codon_start 1 locus_tag LOCUS_75780 CDS 3222..3902 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099185.1 transl_table 11 codon_start 1 locus_tag LOCUS_75790 CDS 3913..4833 product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704945.1 transl_table 11 codon_start 1 locus_tag LOCUS_75800 CDS complement(4951..5715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75810 CDS 5846..6862 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001572362.1 transl_table 11 codon_start 1 locus_tag LOCUS_75820 CDS 7182..8330 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034455038.1 transl_table 11 codon_start 1 locus_tag LOCUS_75830 CDS complement(8545..9525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75840 CDS complement(9609..10268) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210025486.1 transl_table 11 codon_start 1 locus_tag LOCUS_75850 CDS 10464..11333 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085067.1 transl_table 11 codon_start 1 locus_tag LOCUS_75860 CDS 11379..12020 product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395868.1 transl_table 11 codon_start 1 locus_tag LOCUS_75870 CDS 12061..13038 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064567.1 transl_table 11 codon_start 1 locus_tag LOCUS_75880 CDS 13084..14034 product Bug family tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039374.1 transl_table 11 codon_start 1 locus_tag LOCUS_75890 CDS 14058..14939 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085064.1 transl_table 11 codon_start 1 locus_tag LOCUS_75900 CDS 15158..16279 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112662.1 transl_table 11 codon_start 1 locus_tag LOCUS_75910 CDS 16284..16637 product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813037.1 transl_table 11 codon_start 1 locus_tag LOCUS_75920 CDS 16634..16837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75930 sequence081 source 1..17164 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 619..1302 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 transl_table 11 codon_start 1 locus_tag LOCUS_75940 CDS 1325..2698 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202892.1 transl_table 11 codon_start 1 locus_tag LOCUS_75950 CDS complement(2714..3400) product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222831.1 transl_table 11 codon_start 1 locus_tag LOCUS_75960 gene lolA CDS complement(3397..6141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_75970 CDS complement(6278..6949) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 transl_table 11 codon_start 1 locus_tag LOCUS_75980 CDS 7158..8114 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065064.1 transl_table 11 codon_start 1 locus_tag LOCUS_75990 gene trxB CDS 8410..8643 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216391.1 transl_table 11 codon_start 1 locus_tag LOCUS_76000 gene rpmB CDS 8673..8843 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185395.1 transl_table 11 codon_start 1 locus_tag LOCUS_76010 gene rpmG CDS complement(9135..10358) product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186237.1 transl_table 11 codon_start 1 locus_tag LOCUS_76020 CDS complement(10580..11839) product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522602.1 transl_table 11 codon_start 1 locus_tag LOCUS_76030 CDS complement(11919..12545) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522603.1 transl_table 11 codon_start 1 locus_tag LOCUS_76040 gene purN CDS 12622..13938 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112748.1 transl_table 11 codon_start 1 locus_tag LOCUS_76050 CDS 13955..14395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76060 CDS 14400..15791 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550337.1 transl_table 11 codon_start 1 locus_tag LOCUS_76070 CDS complement(15796..16680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76080 rRNA complement(16849..16954) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 sequence082 source 1..16991 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 129..204 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 CDS 322..708 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185179.1 transl_table 11 codon_start 1 locus_tag LOCUS_76090 gene secE CDS 722..1300 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525645.1 transl_table 11 codon_start 1 locus_tag LOCUS_76100 gene nusG CDS 1514..1945 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198368.1 transl_table 11 codon_start 1 locus_tag LOCUS_76110 gene rplK CDS 1948..2655 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185135.1 transl_table 11 codon_start 1 locus_tag LOCUS_76120 gene rplA CDS 2871..3461 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199864.1 transl_table 11 codon_start 1 locus_tag LOCUS_76130 gene rplJ CDS 3504..3881 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198366.1 transl_table 11 codon_start 1 locus_tag LOCUS_76140 gene rplL CDS 4192..8316 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198365.1 transl_table 11 codon_start 1 locus_tag LOCUS_76150 gene rpoB CDS 8338..12576 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818292.1 transl_table 11 codon_start 1 locus_tag LOCUS_76160 gene rpoC CDS complement(12652..13176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76170 CDS 13515..13889 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521903.1 transl_table 11 codon_start 1 locus_tag LOCUS_76180 gene rpsL CDS 14064..14534 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198359.1 transl_table 11 codon_start 1 locus_tag LOCUS_76190 gene rpsG CDS 14604..16706 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806902.1 transl_table 11 codon_start 1 locus_tag LOCUS_76200 gene fusA sequence083 source 1..16537 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..621 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004536264.1:fumarylacetoacetate hydrolase family protein locus_tag LOCUS_76210 CDS 1062..1499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76220 CDS complement(1573..2583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76230 note possible pseudo, frameshifted CDS complement(2565..2849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76240 note possible pseudo, frameshifted CDS complement(2996..3883) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808657.1 transl_table 11 codon_start 1 locus_tag LOCUS_76250 CDS 4045..4872 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103399.1 transl_table 11 codon_start 1 locus_tag LOCUS_76260 CDS 4880..5767 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103398.1 transl_table 11 codon_start 1 locus_tag LOCUS_76270 CDS 6141..7655 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081159250.1 transl_table 11 codon_start 1 locus_tag LOCUS_76280 CDS 7683..8651 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040703.1 transl_table 11 codon_start 1 locus_tag LOCUS_76290 CDS 9088..9561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76300 CDS 9762..10835 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448266.1 transl_table 11 codon_start 1 locus_tag LOCUS_76310 CDS 10852..12669 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175139359.1 transl_table 11 codon_start 1 locus_tag LOCUS_76320 CDS complement(12721..13821) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315994.1 transl_table 11 codon_start 1 locus_tag LOCUS_76330 CDS complement(13838..15862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76340 sequence084 source 1..16443 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 366..902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76350 CDS complement(978..2150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76360 CDS complement(2244..2480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76370 CDS 2518..3438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76380 CDS complement(3790..4254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76390 CDS 5330..5761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76400 CDS complement(6018..7259) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706551.1 transl_table 11 codon_start 1 locus_tag LOCUS_76410 gene glgC CDS complement(7502..9784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76420 CDS complement(10226..12436) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225895010.1 transl_table 11 codon_start 1 locus_tag LOCUS_76430 CDS 12661..12888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76440 note possible pseudo, internal stop codon CDS complement(13189..15567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76450 misc_feature complement(15932..>16443) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037044.1:methyl-accepting chemotaxis protein locus_tag LOCUS_76460 sequence085 source 1..16439 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(516..1625) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921524.1 transl_table 11 codon_start 1 locus_tag LOCUS_76470 CDS complement(1687..2817) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089165.1 transl_table 11 codon_start 1 locus_tag LOCUS_76480 CDS complement(2814..3173) product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089166.1 transl_table 11 codon_start 1 locus_tag LOCUS_76490 CDS complement(3188..4141) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089167.1 transl_table 11 codon_start 1 locus_tag LOCUS_76500 CDS complement(4174..5331) product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921526.1 transl_table 11 codon_start 1 locus_tag LOCUS_76510 CDS complement(5719..6774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76520 CDS complement(6793..9267) product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267184.1 transl_table 11 codon_start 1 locus_tag LOCUS_76530 CDS complement(9264..10373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76540 CDS complement(10444..11805) product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 transl_table 11 codon_start 1 locus_tag LOCUS_76550 CDS complement(11829..13514) product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104994.1 transl_table 11 codon_start 1 locus_tag LOCUS_76560 CDS complement(13545..14729) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226918.1 transl_table 11 codon_start 1 locus_tag LOCUS_76570 CDS 14867..15787 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089169.1 transl_table 11 codon_start 1 locus_tag LOCUS_76580 CDS complement(15917..16438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76590 sequence086 source 1..16052 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 382..1299 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816572.1 transl_table 11 codon_start 1 locus_tag LOCUS_76600 CDS complement(1309..2157) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247449.1 transl_table 11 codon_start 1 locus_tag LOCUS_76610 CDS complement(2180..3397) product DUF3182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088961.1 transl_table 11 codon_start 1 locus_tag LOCUS_76620 CDS complement(3503..4408) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080707694.1 transl_table 11 codon_start 1 locus_tag LOCUS_76630 CDS complement(4439..5410) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216974.1 transl_table 11 codon_start 1 locus_tag LOCUS_76640 tRNA complement(5531..5606) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 CDS complement(5807..6823) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813068.1 transl_table 11 codon_start 1 locus_tag LOCUS_76650 CDS complement(6867..9575) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149504110.1 transl_table 11 codon_start 1 locus_tag LOCUS_76660 gene pepN CDS complement(9706..10608) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926448.1 transl_table 11 codon_start 1 locus_tag LOCUS_76670 gene prfB note possible pseudo, frameshifted CDS complement(10727..10900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76680 CDS 10948..11262 product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546253.1 transl_table 11 codon_start 1 locus_tag LOCUS_76690 CDS 11264..13357 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814040.1 transl_table 11 codon_start 1 locus_tag LOCUS_76700 CDS 13387..13545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76710 CDS complement(14109..14666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76720 CDS complement(14692..15252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76730 note possible pseudo, frameshifted CDS 15326..15745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76740 sequence087 source 1..14898 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 712..1734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980499.1 transl_table 11 codon_start 1 locus_tag LOCUS_76750 CDS 1737..2783 product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992272.1 transl_table 11 codon_start 1 locus_tag LOCUS_76760 CDS complement(2821..4386) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536557.1 transl_table 11 codon_start 1 locus_tag LOCUS_76770 CDS 4790..6304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76780 CDS complement(6367..8415) product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889007.1 transl_table 11 codon_start 1 locus_tag LOCUS_76790 gene paaZ CDS complement(8441..9190) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086207.1 transl_table 11 codon_start 1 locus_tag LOCUS_76800 CDS complement(9187..11100) product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813865.1 transl_table 11 codon_start 1 locus_tag LOCUS_76810 CDS complement(11097..12122) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813866.1 transl_table 11 codon_start 1 locus_tag LOCUS_76820 CDS complement(12404..13564) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480157.1 transl_table 11 codon_start 1 locus_tag LOCUS_76830 CDS complement(13561..14253) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523127.1 transl_table 11 codon_start 1 locus_tag LOCUS_76840 misc_feature complement(14260..>14898) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199195.1:phenylacetate-CoA oxygenase/reductase subunit PaaK locus_tag LOCUS_76850 sequence088 source 1..13911 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 617..2101 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530092.1 transl_table 11 codon_start 1 locus_tag LOCUS_76860 CDS complement(2212..2571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76870 note possible pseudo, frameshifted CDS complement(2628..2954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76880 note possible pseudo, frameshifted CDS 3080..3499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76890 CDS 3557..3919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76900 note possible pseudo, frameshifted CDS 3828..4301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76910 CDS complement(4250..4972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76920 CDS complement(5033..5221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76930 note possible pseudo, frameshifted CDS complement(5151..6017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76940 note possible pseudo, frameshifted CDS complement(6084..6239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76950 CDS 6493..6780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76960 CDS complement(7022..7510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76970 CDS complement(7606..7827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76980 CDS complement(7891..8349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_76990 CDS 8648..9967 product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083760.1 transl_table 11 codon_start 1 locus_tag LOCUS_77000 CDS 10047..11039 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038796.1 transl_table 11 codon_start 1 locus_tag LOCUS_77010 CDS 11128..12108 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064800.1 transl_table 11 codon_start 1 locus_tag LOCUS_77020 CDS 12125..12862 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388443.1 transl_table 11 codon_start 1 locus_tag LOCUS_77030 CDS 12873..13736 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185611.1 transl_table 11 codon_start 1 locus_tag LOCUS_77040 gene nadC sequence089 source 1..13883 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1189..1410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77050 CDS 1521..1808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77060 CDS complement(2268..3008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77070 CDS complement(3667..3855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77080 CDS complement(3870..6959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77090 CDS 7746..7970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77100 CDS complement(7866..10565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77110 CDS complement(10562..11068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77120 CDS complement(11406..12248) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 transl_table 11 codon_start 1 locus_tag LOCUS_77130 CDS complement(12245..12781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77140 CDS complement(12819..13334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77150 sequence090 source 1..13079 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 26..1018 product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529607.1 transl_table 11 codon_start 1 locus_tag LOCUS_77160 CDS complement(1099..2850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77170 CDS complement(2837..4042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77180 CDS complement(4213..4692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77190 CDS complement(4689..5450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77200 CDS 6209..6613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77210 CDS complement(6968..7228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77220 CDS complement(7225..8172) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815215.1 transl_table 11 codon_start 1 locus_tag LOCUS_77230 CDS complement(8276..8698) product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089748.1 transl_table 11 codon_start 1 locus_tag LOCUS_77240 gene rnk CDS 9140..9745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77250 CDS 9826..9957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77260 CDS complement(10233..11186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922267.1 transl_table 11 codon_start 1 locus_tag LOCUS_77270 CDS 11351..13021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77280 sequence091 source 1..12837 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 987..2375 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543738.1 transl_table 11 codon_start 1 locus_tag LOCUS_77290 CDS 2509..3216 product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731597.1 transl_table 11 codon_start 1 locus_tag LOCUS_77300 CDS complement(3244..4164) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550801.1 transl_table 11 codon_start 1 locus_tag LOCUS_77310 CDS 4282..5892 product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089156.1 transl_table 11 codon_start 1 locus_tag LOCUS_77320 gene mdlC CDS 5952..7412 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189216.1 transl_table 11 codon_start 1 locus_tag LOCUS_77330 CDS 7526..8761 product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064424.1 transl_table 11 codon_start 1 locus_tag LOCUS_77340 CDS complement(9155..9424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77350 CDS 9347..10057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77360 CDS complement(10447..11232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77370 CDS complement(11285..12253) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039576.1 transl_table 11 codon_start 1 locus_tag LOCUS_77380 CDS complement(12309..12710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77390 sequence092 source 1..12360 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..782 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064634335.1:type IV secretory system conjugative DNA transfer family protein locus_tag LOCUS_77400 CDS 798..1460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77410 CDS 1468..3084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77420 CDS 3081..3746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77430 CDS 3743..4075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77440 CDS complement(4137..4373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77450 CDS complement(4870..9522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77460 CDS 10017..10244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77470 misc_feature complement(10407..>12360) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004200734.1:DNA topoisomerase III locus_tag LOCUS_77480 sequence093 source 1..12325 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 776..1276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77490 CDS complement(1611..3239) product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698054.1 transl_table 11 codon_start 1 locus_tag LOCUS_77500 CDS complement(3321..3662) product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266599.1 transl_table 11 codon_start 1 locus_tag LOCUS_77510 gene tnpB CDS complement(3659..4102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77520 CDS 4476..5207 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 transl_table 11 codon_start 1 locus_tag LOCUS_77530 CDS 5660..6520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77540 CDS complement(6685..7038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77550 CDS complement(7360..7530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77560 CDS 7947..10922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77570 sequence094 source 1..11597 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004197904.1:NADP-dependent malic enzyme locus_tag LOCUS_77580 CDS 886..3273 product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086507.1 transl_table 11 codon_start 1 locus_tag LOCUS_77590 CDS 3270..4592 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086508.1 transl_table 11 codon_start 1 locus_tag LOCUS_77600 CDS 5316..5561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77610 CDS complement(5748..6308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77620 CDS 7895..8077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77630 CDS 8366..8647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77640 CDS complement(9111..9344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77650 CDS 9523..9723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77660 CDS 10115..10318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77670 sequence095 source 1..11230 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 147..359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77680 CDS 371..907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77690 CDS 918..1934 product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845459.1 transl_table 11 codon_start 1 locus_tag LOCUS_77700 CDS 1956..2681 product P-type DNA transfer protein VirB5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103177.1 transl_table 11 codon_start 1 locus_tag LOCUS_77710 gene virB5 CDS 2678..3388 product virB8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974428.1 transl_table 11 codon_start 1 locus_tag LOCUS_77720 assembly_gap 3967..5762 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5787..6740 product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034519683.1 transl_table 11 codon_start 1 locus_tag LOCUS_77730 gene virB11 CDS 6740..8803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77740 CDS 8819..9475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77750 CDS 9483..11084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77760 sequence096 source 1..10200 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(283..492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77770 CDS complement(885..1211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77780 CDS complement(1388..1864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77790 CDS complement(2188..2637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77800 CDS complement(3192..3416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77810 CDS complement(4676..5473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77820 CDS complement(5477..5824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77830 CDS complement(5828..6778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77840 CDS complement(6778..7569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77850 sequence097 source 1..9790 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 548..1408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77860 CDS 1446..2351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77870 CDS 2608..2916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77880 CDS 3074..3268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77890 CDS complement(3373..3717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77900 CDS complement(3828..4523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77910 CDS 5108..5401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77920 CDS 5932..8394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77930 CDS complement(8495..8893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77940 CDS 9332..9526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77950 sequence098 source 1..7544 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1909 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836189.1:ICE nucleation protein locus_tag LOCUS_77960 CDS 2174..3034 product WxcM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771390.1 transl_table 11 codon_start 1 locus_tag LOCUS_77970 CDS 3037..3621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_77980 CDS 3618..4727 product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 transl_table 11 codon_start 1 locus_tag LOCUS_77990 CDS complement(4832..6160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78000 CDS complement(6174..7040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78010 CDS 7214..7360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78020 sequence099 source 1..8138 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 234..557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78030 CDS 814..1041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78040 CDS complement(1170..2168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78050 CDS 2734..3267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78060 CDS 3324..4073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78070 CDS 4267..4536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78080 CDS 4533..4772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78090 CDS 4814..5140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78100 CDS complement(5696..7393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78110 CDS 7768..8031 product SWIB/MDM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814592.1 transl_table 11 codon_start 1 locus_tag LOCUS_78120 sequence100 source 1..8172 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 148..672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78130 CDS 2009..2200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78140 CDS complement(2343..2807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78150 CDS 3541..3918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78160 CDS complement(4297..4626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78170 CDS 5450..6157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78180 CDS 6170..6607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78190 CDS 6719..6892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78200 CDS complement(7056..7328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78210 sequence101 source 1..7993 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1599..1937) product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266599.1 transl_table 11 codon_start 1 locus_tag LOCUS_78220 gene tnpB CDS complement(1934..2362) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105580.1 transl_table 11 codon_start 1 locus_tag LOCUS_78230 CDS complement(2494..3054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78240 CDS 3229..3867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78250 CDS 3940..5643 product phage integrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900397.1 transl_table 11 codon_start 1 locus_tag LOCUS_78260 CDS 5753..6457 product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 transl_table 11 codon_start 1 locus_tag LOCUS_78270 gene istB CDS complement(6411..7025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78280 sequence102 source 1..7274 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 605..3004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78290 CDS complement(3138..3452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78300 CDS 3636..4751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78310 CDS complement(5215..5910) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063801.1 transl_table 11 codon_start 1 locus_tag LOCUS_78320 sequence103 source 1..7259 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 442..624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78330 CDS complement(700..1176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78340 note possible pseudo, internal stop codon, frameshifted CDS complement(1458..1676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78350 CDS complement(1661..1921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78360 note possible pseudo, frameshifted CDS complement(1824..2138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78370 note possible pseudo, frameshifted CDS 2092..2274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78380 CDS complement(2285..2626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78390 note possible pseudo, frameshifted CDS 2922..3110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78400 CDS complement(3446..5185) product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038412.1 transl_table 11 codon_start 1 locus_tag LOCUS_78410 CDS complement(6048..6587) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812734.1 transl_table 11 codon_start 1 locus_tag LOCUS_78420 gene ppa rRNA complement(6938..7043) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 sequence104 source 1..7043 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 529..1041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78430 CDS complement(1116..2015) product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 transl_table 11 codon_start 1 locus_tag LOCUS_78440 gene nhaR CDS 2094..2819 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521332.1 transl_table 11 codon_start 1 locus_tag LOCUS_78450 CDS complement(3021..3347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78460 CDS complement(3917..4168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78470 assembly_gap 4178..5342 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5690..6232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78480 CDS 6560..7006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78490 sequence105 source 1..6533 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(631..1713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78500 CDS complement(1932..2225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78510 CDS 2330..3172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78520 note possible pseudo, frameshifted CDS 3359..3931 product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769175.1 transl_table 11 codon_start 1 locus_tag LOCUS_78530 gene mntP CDS complement(3932..5161) product catalase family peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038980.1 transl_table 11 codon_start 1 locus_tag LOCUS_78540 CDS 5388..5792 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088450.1 transl_table 11 codon_start 1 locus_tag LOCUS_78550 CDS complement(5986..6171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78560 sequence106 source 1..5749 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 820..1128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78570 CDS complement(1311..1703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78580 CDS 2154..3236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78590 CDS 3401..3808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78600 CDS complement(3893..4030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78610 CDS complement(4616..4819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78620 sequence107 source 1..5582 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(368..676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78630 CDS complement(800..2524) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191611.1 transl_table 11 codon_start 1 locus_tag LOCUS_78640 gene ilvD CDS 2624..3550 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204927.1 transl_table 11 codon_start 1 locus_tag LOCUS_78650 CDS 3550..4347 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191241.1 transl_table 11 codon_start 1 locus_tag LOCUS_78660 gene lgt CDS 4358..5068 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531112.1 transl_table 11 codon_start 1 locus_tag LOCUS_78670 gene dnaQ tRNA 5110..5184 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 sequence108 source 1..5106 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(680..1354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78680 CDS complement(1416..3494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78690 CDS complement(3499..4665) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877954.1 transl_table 11 codon_start 1 locus_tag LOCUS_78700 sequence109 source 1..4714 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78710 CDS 331..2013 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193882.1 transl_table 11 codon_start 1 locus_tag LOCUS_78720 CDS complement(2166..2960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78730 CDS 3210..4373 product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133901583.1 transl_table 11 codon_start 1 locus_tag LOCUS_78740 sequence110 source 1..4319 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1683 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001256602.1:response regulator locus_tag LOCUS_78750 CDS complement(2257..2952) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063801.1 transl_table 11 codon_start 1 locus_tag LOCUS_78760 CDS 3330..3671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78770 note possible pseudo, internal stop codon sequence111 source 1..4029 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 150..398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78780 CDS 395..724 product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682305.1 transl_table 11 codon_start 1 locus_tag LOCUS_78790 sequence112 source 1..3618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(346..507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78800 CDS 697..2637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78810 CDS complement(2518..2961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78820 sequence113 source 1..3408 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 843..1979 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405528.1 transl_table 11 codon_start 1 locus_tag LOCUS_78830 sequence114 source 1..3296 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence115 source 1..2894 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(253..1380) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970928.1 transl_table 11 codon_start 1 locus_tag LOCUS_78840 CDS complement(1626..2801) product IS5-like element IS1478 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035783.1 transl_table 11 codon_start 1 locus_tag LOCUS_78850 sequence116 source 1..2787 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(6..1271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78860 CDS 1478..1603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78870 CDS 2027..2725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78880 sequence117 source 1..2645 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 454..834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78890 CDS 996..1553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78900 CDS 1666..1899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78910 CDS complement(1891..2184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78920 sequence118 source 1..2644 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 375..875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78930 CDS 887..1441 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385055.1 transl_table 11 codon_start 1 locus_tag LOCUS_78940 CDS complement(1467..1949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78950 CDS complement(2017..2334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78960 sequence119 source 1..2304 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(348..1523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78970 CDS complement(1560..1925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78980 sequence120 source 1..2141 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence121 source 1..2126 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(144..317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_78990 CDS 234..599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79000 CDS complement(624..1259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79010 sequence122 source 1..2058 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(250..1380) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198441.1 transl_table 11 codon_start 1 locus_tag LOCUS_79020 misc_feature complement(1463..>2058) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064585.1:FAD-binding protein locus_tag LOCUS_79030 sequence123 source 1..1996 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 505..1836 product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090914.1 transl_table 11 codon_start 1 locus_tag LOCUS_79040 gene ltrA sequence124 source 1..1679 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 786..1628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79050 sequence125 source 1..1651 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 346..615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79060 CDS 927..1313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79070 CDS 1383..1556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79080 sequence126 source 1..1569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..669 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206817313.1:response regulator locus_tag LOCUS_79090 sequence127 source 1..1565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(399..1223) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088209.1 transl_table 11 codon_start 1 locus_tag LOCUS_79100 sequence128 source 1..1474 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence129 source 1..1452 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(17..1366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79110 sequence130 source 1..1433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(411..650) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095205.1 transl_table 11 codon_start 1 locus_tag LOCUS_79120 sequence131 source 1..1261 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(51..1124) product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140590772.1 transl_table 11 codon_start 1 locus_tag LOCUS_79130 sequence132 source 1..1251 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence133 source 1..1307 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(117..1145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79140 sequence134 source 1..1300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(130..525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79150 note possible pseudo, frameshifted sequence135 source 1..1279 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence136 source 1..1277 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 375..710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79160 sequence137 source 1..1226 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(149..1180) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010213957.1 transl_table 11 codon_start 1 locus_tag LOCUS_79170 sequence138 source 1..1099 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..660 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207790.1:Glu/Leu/Phe/Val dehydrogenase locus_tag LOCUS_79180 sequence139 source 1..1089 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(846..1016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_79190 sequence140 source 1..1075 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence141 source 1..1063 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence142 source 1..1039 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 325..849 product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551025.1 transl_table 11 codon_start 1 locus_tag LOCUS_79200 gene paaJ