COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..9317 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 592..3007 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3577..5921 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5932..6279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 note possible pseudo, frameshifted assembly_gap 6454..8891 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence02 source 1..6217 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 655..2645 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2679..3029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 assembly_gap 3258..6035 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence03 source 1..6355 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 270..2974 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3467..5874 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence04 source 1..3742 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 588..3234 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence05 source 1..9587 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 27..572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 assembly_gap 577..3055 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3105..3245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 assembly_gap 3562..6003 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6026..6370 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 assembly_gap 6542..9045 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9053..9409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00060 note possible pseudo, frameshifted sequence06 source 1..9439 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(301..477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 assembly_gap 633..2948 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3032..3256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 assembly_gap 3582..5889 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5903..6184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(6069..6428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 assembly_gap 6439..8868 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9080..9397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 sequence07 source 1..3296 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 348..734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 sequence08 source 1..15319 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 515..3006 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3063..3251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 assembly_gap 3558..5942 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6152..6421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 assembly_gap 6441..9106 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9780..11881 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12028..12363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 assembly_gap 12386..15135 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence09 source 1..6139 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 186..2695 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2849..3154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 note possible pseudo, internal stop codon, frameshifted assembly_gap 3309..5931 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence10 source 1..9451 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 37..360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 assembly_gap 600..2817 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2868..3125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 assembly_gap 3282..5900 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6465..9109 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence11 source 1..3439 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 630..2939 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence12 source 1..3512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(16..165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(149..436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 note possible pseudo, frameshifted assembly_gap 659..2940 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence13 source 1..3159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 561..1456 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1720..2766 product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004270929.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 sequence14 source 1..12333 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(19..420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 assembly_gap 522..3142 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3750..6170 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6354..9103 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9669..11798 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12004..12219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 note possible pseudo, internal stop codon, frameshifted sequence15 source 1..6390 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 184..2791 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3355..5779 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5802..5969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(5946..6089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 note possible pseudo, frameshifted sequence16 source 1..1078 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(268..377) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA complement(402..477) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA complement(484..561) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 rRNA complement(571..679) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence17 source 1..3515 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 163..372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 note possible pseudo, frameshifted assembly_gap 771..2675 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2769..3107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 3118..3477 product D-tyrosyl-tRNA(Tyr) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266965.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 sequence18 source 1..6902 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(344..655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 assembly_gap 702..3212 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3271..3591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 note possible pseudo, frameshifted assembly_gap 3789..6350 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence19 source 1..1989 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 643..751 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 tRNA 761..837 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA 844..919 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 rRNA 943..1052 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 tRNA 1061..1135 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA 1140..1213 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 1220..1296 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 1301..1378 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 1389..1464 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 1468..1543 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 1572..1647 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 1654..1737 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 1743..1818 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 1827..1902 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 1914..1987 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 sequence20 source 1..6514 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(210..440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 assembly_gap 557..3045 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3309..3536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 note possible pseudo, frameshifted assembly_gap 3603..5789 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence21 source 1..2703 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2153..2539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 sequence22 source 1..3248 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 525..2754 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence23 source 1..9206 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 373..3013 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3309..5918 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6465..9046 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence24 source 1..3931 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(474..905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 note possible pseudo, internal stop codon, frameshifted assembly_gap 957..3449 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence25 source 1..1267 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(565..641) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(647..722) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(821..1207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 sequence26 source 1..6206 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 19..234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 note possible pseudo, internal stop codon, frameshifted assembly_gap 420..3012 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3334..3555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 assembly_gap 3574..5954 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence27 source 1..14246 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 78..323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 assembly_gap 996..2357 estimated_length known gap_type within scaffold linkage_evidence paired-ends rRNA 2618..2726 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 tRNA 2742..2816 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 2969..4693 product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047951.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 4871..6109 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 6134..7381 product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047945.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 7394..8587 product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385258.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene ygeW CDS 8608..10089 product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 10130..11599 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104497.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 11712..12383 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948381.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 12726..13619 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 sequence28 source 1..1325 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 192..578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 note possible pseudo, frameshifted CDS 500..826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 note possible pseudo, frameshifted sequence29 source 1..3775 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 230..466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 assembly_gap 486..3228 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence30 source 1..6837 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 611..3083 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3290..3733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 assembly_gap 3906..6287 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence31 source 1..3418 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 660..2926 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence32 source 1..6172 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(236..490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 assembly_gap 530..2720 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3191..5603 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5796..6065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048073.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 sequence33 source 1..1976539 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 69..305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 578..745 product DUF1427 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417708.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 765..917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 996..2132 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 2351..2854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(2851..3987) product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947923.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 4114..5523 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861997.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 5529..6152 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243137.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene tmk CDS 6155..6484 product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384432.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 6497..7459 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404855.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 7461..8369 product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 8454..8624 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363046.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 8810..9487 product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459567.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 9490..10017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 10028..10759 product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 10762..11601 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435873.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene rsmI CDS complement(11683..11925) product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388120.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 12131..13084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 13087..14925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 14935..16293 product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963634.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(16298..16768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 16948..17526 product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963791.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 17523..18035 product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947935.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 18102..19451 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 19545..20498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 20511..21947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 21988..23442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 23754..25685 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene metG CDS 25697..26446 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966271.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 26718..27755 product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947942.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 27827..28369 product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437901.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene rnmV CDS 28369..29217 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966268.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene rsmA CDS 29281..30372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 30433..30993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 31003..31422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 31429..32181 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897834.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene lgt CDS 32193..32732 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964725.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 32737..33516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 33569..34168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 34316..35392 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947946.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 35389..36084 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404917.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 36093..37301 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404919.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(37375..37740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 37851..38039 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430011.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(38056..39573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 39737..40519 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905410.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(40603..41052) product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048323.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 41157..41897 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943860.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 41957..42571 product SafA/ExsA family spore coat assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986322.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene safA CDS 42755..43708 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416574.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 43790..44854 product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966251.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 45081..47108 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387654.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 47212..48663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(48716..49051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(49081..50205) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966194.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 50349..51341 product CotS family spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966193.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 51325..51606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 51617..52513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 52518..53534 product CotS family spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947964.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(53562..54674) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966190.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 54826..55818 product CotS family spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947965.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 55950..56822 product sporulation peptidase YabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947966.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene yabG CDS 56834..58147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 58399..58656 product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966187.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 58994..60556 product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947967.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 60662..61510 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947969.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene ispE CDS 61514..62248 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391622.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 62336..62542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 62553..64100 product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947970.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 64084..65181 product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947971.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 65178..66332 product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947972.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 66417..67046 product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947973.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene spoIIR CDS complement(67059..68186) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966180.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 68330..69685 product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947975.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene ypeB CDS 69744..69929 product small, acid-soluble spore protein, alpha/beta type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774238.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 70045..71025 product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947976.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 71049..71855 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene murI CDS 71873..72286 product DUF1934 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966177.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(72328..73683) product arginine utilization transcriptional regulator RocR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110073.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene rocR CDS 73989..75023 product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene kdd CDS 75038..76300 product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene ablA CDS 76312..77322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367345.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 77319..78893 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015882.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 78904..80463 product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 80456..81244 product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 81427..82059 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082876.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 82208..83806 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 84282..88211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(88607..88972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(88912..89820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 assembly_gap 88981..89069 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 90044..90796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 90884..92440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(92462..93277) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(93283..93687) product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 93837..94232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 94251..94898 product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964656.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene fsa CDS 95131..96084 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359188.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene glpX CDS 96370..97341 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359188.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene glpX CDS 97560..98945 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947979.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene rho CDS 99056..99268 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355803.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene rpmE CDS 99323..99901 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966171.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 99906..100118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 100332..102179 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868953.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 102226..103146 product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167205.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 103196..104113 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003394571.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene pstC CDS 104110..104970 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994147.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene pstA CDS 105037..105837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986229.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(105878..106648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 106761..108716 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461330.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 108728..109735 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391327.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 110136..111215 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene cobT CDS 111212..111748 product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680310.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene cobU CDS 111745..112479 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948521.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene cobS CDS 112488..113060 product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964694.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene cobC CDS 113061..113762 product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948604.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 113762..114037 product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003492574.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 114021..114707 product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948605.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene cbiQ CDS 114728..116152 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964683.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 116149..117075 product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963902.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene cbiB CDS 117072..118082 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680725.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 118075..118917 product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964680.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 118886..120199 product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964684.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 120196..120561 product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812305.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 120552..121163 product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680526.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 121165..122229 product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669153.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene cbiD CDS 122201..122764 product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680295.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene cbiE CDS 122754..123284 product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680297.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene cbiT CDS 123281..123925 product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964688.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 123930..124682 product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948631.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene cobM CDS 124679..125623 product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681802.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene cbiG CDS 125625..126344 product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681809.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene cobJ CDS 126341..127066 product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681810.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene cobK CDS 127063..128232 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963422.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene hemA CDS 128196..128819 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948606.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 128812..129675 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963424.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene hemC CDS 129685..131145 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948608.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene cobA CDS 131135..132100 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963427.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene hemB CDS 132111..133376 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963426.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene hemL CDS 133541..134431 product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947980.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 134433..135275 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene prmC CDS 135277..135807 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 135797..136309 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 136395..137468 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene prfA CDS 137514..137891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 137917..138528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 138561..139292 product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388218.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 139307..140350 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966166.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 140360..140806 product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437844.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 140868..141317 product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947986.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene rpiB CDS 141337..141969 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360558.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene upp CDS 141978..142424 product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421374.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 142544..143569 product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966159.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 143574..144725 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947987.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene wecB CDS 144810..145997 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 146397..146768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 146770..147474 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356899.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 147489..147743 product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356112.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene atpE CDS 147812..148291 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244051.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene atpF CDS 148293..148844 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966152.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 148841..150346 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356056.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene atpA CDS 150370..151215 product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966150.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene atpG CDS 151226..152620 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161587876.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene atpD CDS 152632..153042 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699947.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 153105..153794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 153814..155067 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947989.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene murA CDS 155176..156243 product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947990.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene spoIID CDS 156332..157117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 157233..157487 product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356559.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene spoIIID CDS 157595..158611 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966142.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(158638..159195) product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398420.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene yyaC CDS 159307..159870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(159872..160621) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947991.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 tRNA 160872..160947 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 160955..161030 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 161036..161120 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 161140..161215 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 161223..161298 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 161304..161388 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 161449..161814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 162142..163332 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene metK CDS 163418..163642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 163658..163876 product DUF2922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890856.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 164035..164184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 164253..164798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 164773..166986 product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 167004..168626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 168536..169267 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357235.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 169969..170493 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene raiA CDS complement(170503..171423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 171734..174235 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947996.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene secA CDS 174344..175381 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181244843.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene prfB CDS complement(175572..175901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 assembly_gap 175927..176179 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 176747..176944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(176927..177697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(177702..179063) product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947998.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 179351..182050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 182129..184225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 184448..185524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 185683..186618 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384427.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 186722..188773 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948117.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 189250..189744 product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868903.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 189754..190302 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583282.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 190302..190703 product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 190718..192511 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene nuoF CDS 192527..194263 product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 194479..194724 product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868899.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 194733..195764 product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868900.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene hydE CDS 195776..197191 product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868901.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene hydG CDS 197203..198393 product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925073.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene hydF CDS 198657..200357 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987082.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 200583..200738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 200752..201318 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880943.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 201525..201875 product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869442.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 201875..202300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 202310..203548 product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 203538..203870 product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081549.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 203873..204580 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(204619..205137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(205215..207149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(207271..208431) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814920.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 208582..209397 product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430209.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 209409..209855 product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358683.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 210032..210979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 211182..211706 product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810340.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 211709..212764 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053095240.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 212761..213513 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496386.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 213527..214627 product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156275681.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(214647..214967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 215162..215791 product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700956.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene ppaX CDS 215870..216859 product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103297.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene ccpA CDS 216914..217867 product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963746.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 217877..219328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(219364..220314) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986908.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene arcC CDS complement(220433..220885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 note possible pseudo, frameshifted CDS complement(220867..221751) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861433.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene argF CDS complement(221787..223016) product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385506.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene arcA CDS 223083..223271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 223515..224843 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861407.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 224864..226282 product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095368.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 226558..227133 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679998.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(227172..228410) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846833.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 228582..229046 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283897.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(229139..230047) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439388.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 230180..231214 product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939164.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 231284..232360 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356041.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(232508..233788) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948141.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 234030..234869 product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002349114.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 234872..235708 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439367.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene panB CDS 235721..236566 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene panC CDS 236563..236943 product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490184.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene panD CDS 237022..238497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 238634..239359 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963591.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 239352..241007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679395.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 241322..242257 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 242268..243509 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966048.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(243636..244691) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986537.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 244965..246248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 246250..247101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 247200..248894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 248957..249346 product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963397.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 249604..250413 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948213.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene thiD CDS 250403..251596 product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225706.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene cytX CDS 251571..252377 product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene thiM CDS 252364..252993 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene thiE CDS 253173..254210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 254212..256068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 256158..257063 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964846.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(257074..258396) product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964864.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 258565..259335 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948483.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 259513..260439 product DUF5692 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948196.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 260564..263638 product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948191.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene addB CDS 263635..266847 product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989936.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene addA CDS 266925..267611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 267850..269163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 note possible pseudo, frameshifted CDS 269130..269984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 note possible pseudo, frameshifted CDS 269996..270277 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004714840.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 270301..271563 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098119.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(272138..273445) product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015878.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 273677..274291 product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582974.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 274308..275531 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258083.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 275549..276685 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987105.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene nagA CDS 276894..277940 product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966912.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 278113..278385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 278551..280623 product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048343.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 280788..281783 product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166915.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene dhaK CDS 281799..282440 product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166473.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene dhaL CDS 282446..282829 product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017697966.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene dhaM CDS 282965..283315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 283325..283735 product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035740.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 assembly_gap 284178..284788 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 285363..285929 product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 286028..287668 product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047923.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene hcp CDS complement(287711..288886) product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964224.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 289285..291270 product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439994.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 291443..292171 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438111.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 292175..293470 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681529.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 293899..297102 product SNF2 helicase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986302.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 297246..297641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03430 note possible pseudo, frameshifted CDS 297715..297867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 297973..299394 product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986523.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene treP CDS 299508..301154 product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986524.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene treC CDS 301189..301905 product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405408.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene treR CDS complement(301985..304570) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948126.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene adhE CDS 304940..305809 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362794.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(305898..308927) product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167510.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene pulA CDS 309120..311360 product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 311582..312631 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene carA CDS 312642..315815 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene carB CDS 316109..316753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 317084..318217 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966309.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 318386..323518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(323454..323741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 323811..325124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 325206..326516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 326762..327514 product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761976.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene estA CDS 327527..328711 product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867389.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(328749..329090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(329152..331083) product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986707.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 331240..332952 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948922.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(332966..333760) product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(334346..336307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(336412..336978) product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963915.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene pdxT CDS complement(336980..337849) product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963914.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene pdxS CDS complement(337969..338799) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454666.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene nadC CDS complement(338783..340066) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430790.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(340071..340970) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454668.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene nadA CDS 341667..343238 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 343381..343542 product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393739.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 343943..345037 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947948.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 345163..345684 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343928.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 345674..347719 product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271984.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 347882..348847 product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964089.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene cbiM CDS 348848..349630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 349657..350382 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964091.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 350522..351697 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963641.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 351708..352433 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963642.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 352421..353593 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963643.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 353604..354287 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965730.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 354265..355734 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965729.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 355800..356240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(356295..356471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 356657..357205 product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 357885..358250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 358257..360410 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947999.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 360424..361578 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 361825..362511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 362753..363331 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948000.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(363364..364605) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048260.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 364757..366550 product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048396.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(366582..369149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 369418..369846 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene tsaE CDS 369846..370556 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966124.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene tsaB CDS 370549..371001 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966125.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene rimI CDS 371058..371678 product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080265.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 371742..372818 product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490874.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 372836..374113 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene aroA CDS 374106..375206 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964214.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene aroC CDS 375194..376012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 376292..377146 product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048249.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 377159..378538 product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene gltA CDS 378760..379845 product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680420.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene yedE CDS 379835..380050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 380055..380276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 380419..380664 product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357396.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(380766..381068) product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986755.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 381190..381477 product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070523.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 381464..382117 product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393576.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(382199..382861) product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355974.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 383028..383249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(383373..384623) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738818.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(384638..385810) product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356440.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 386094..387542 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398698.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(387559..388185) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393623.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(388206..390401) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964842.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(390395..391093) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964843.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 391251..393173 product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518851.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 393173..394351 product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963900.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene yhbH CDS 394351..395631 product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518852.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 395705..396538 product transcription antiterminator SacY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244589.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene sacY CDS 396741..398114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 398129..399070 product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 399076..400086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 400205..403096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 tRNA complement(403249..403324) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(403434..403724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(403780..404154) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048257.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(404167..406446) product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964344.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene helD CDS complement(406555..406725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 406914..408755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(408820..408951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 409030..409803 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015684.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 409793..411565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(411638..412063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 412192..412614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 412611..413513 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986890.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(413508..414032) product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963969.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 414130..414621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 414626..415120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 415117..416655 product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584022.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 416840..418141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(418172..419041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(419053..419445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 419660..420304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(420367..421296) product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948010.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene fba CDS complement(421401..421805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(421783..422475) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 422632..423711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 423713..425176 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399675.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene gltX CDS complement(425227..427140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 427308..428966 product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948012.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 429085..430467 product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891177.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 430479..431825 product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898040.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(431975..432238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 432429..433100 product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963992.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene sdaAB CDS 433115..433987 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356262.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene sdaAA CDS complement(434243..434422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(434434..434973) product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(435134..435640) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963995.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene pssA CDS 435804..436460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 436502..436930 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355850.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 436991..437863 product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356507.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 437925..438557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(438600..439220) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142687.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(439224..441038) product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948014.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 441160..442191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 442377..443045 product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964005.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene sleB CDS 443431..444348 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene cysK CDS 444354..444905 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948016.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene cysE CDS complement(444898..445179) product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257138.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(445192..445536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(445533..446534) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948017.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene queG CDS 446624..447268 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene nth CDS 447315..448745 product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986179.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 448833..449780 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 449773..450903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 450893..453067 product DUF4129 domain-containing transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242683.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 tRNA 453078..453163 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 453294..453950 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355768.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene trmB CDS 453961..454881 product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964404.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene hprK CDS complement(454903..455553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 455660..457132 product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986513.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 457125..458207 product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986766.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 458194..459294 product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986515.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(459328..459582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 459787..460554 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434193.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(460551..461366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(461359..462018) product RNA polymerase sigma-I factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075366282.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene sigI CDS 462153..463148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 463737..464513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 464527..465177 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016564.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 465183..465989 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099728.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(466052..467779) product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771340.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 467994..468887 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948132.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 468897..469586 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814304.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 469588..470973 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948133.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 470970..472364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814307.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 472526..474211 product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460315.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 474224..475435 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228203.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 475455..475949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 475998..476477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 476487..477044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 477056..477973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 477989..478540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 478546..479631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 479636..480496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 480508..482862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 482889..485177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(485619..486896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 487018..488376 product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 488511..488978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(488988..489716) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987079.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 489872..490870 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964900.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 490875..491579 product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964899.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 491700..492260 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080601.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 492272..493078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 493207..493524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(493585..494631) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459712.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(494677..495216) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(495481..496479) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048270.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene trpS CDS 496953..497540 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583630.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(497813..499732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 499874..500176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(500200..500322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 500533..501813 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948514.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene brnQ CDS 501839..502078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 502155..504500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 504514..505758 product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966849.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(505764..506207) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966110.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 506304..508169 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986476.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 508326..510122 product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986475.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 510136..510360 product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358284.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(510378..511547) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048322.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 512023..513297 product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272513.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 assembly_gap 515309..516112 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 516808..519156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 519279..519455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 519516..519713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 520398..523922 product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948832.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene nifJ CDS complement(523946..524092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 524498..524935 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762309.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 525049..525411 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 525417..527474 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965539.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(527510..528970) product beta-Ala-His dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287514.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene pepD CDS 529168..529428 product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874410.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene ptsH CDS 529437..530189 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963554.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 530202..531125 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963555.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene pfkB CDS 531131..531577 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963556.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 531592..532947 product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071540970.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(532971..533126) product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948231.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 533247..533945 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965712.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 534042..534884 product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360232.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene cdaA CDS 534857..536062 product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048337.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 536078..537682 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966358.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 537825..538907 product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048335.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene buk CDS 538904..539806 product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357252.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene ptb CDS 539826..540893 product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048334.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene buk CDS 540905..541585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 541611..541820 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357528.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 541844..542914 product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357407.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 542914..543666 product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 543668..544198 product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357379.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 544330..545361 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902589.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 545419..546537 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902588.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 546530..548182 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896074.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 548198..549019 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966224.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(549039..549821) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002455962.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(549823..551520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 551672..552169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 552190..553830 product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 554048..555394 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048332.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene glmM CDS 555707..557536 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene glmS CDS 557685..558107 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964324.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 558151..558630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 558747..559751 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462034.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 559897..560685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 561005..561493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(561565..563349) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(563362..565125) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 565458..567473 product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881407.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(567526..567804) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080314.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 568039..568410 product DUF6514 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357321.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 568448..568807 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963811.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene acpS CDS 568812..570311 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963812.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 570373..570987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 571001..572152 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963814.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene alr CDS 572277..572597 product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963815.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 572569..572913 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 573204..574034 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389978.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 574027..574965 product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 575377..576225 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099535.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 576615..577301 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene ftsE CDS 577291..578178 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene ftsX CDS 578200..579366 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 579650..580093 product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966355.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 580144..580980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 581193..581414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 assembly_gap 581581..581896 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(582453..583916) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048125.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 584103..584684 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768871.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 584795..585580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 585736..586803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965633.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 586807..587490 product YveK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966325.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 587708..588484 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966326.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 588671..589333 product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986983.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 589335..590063 product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986981.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 590141..590797 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966354.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 590811..591854 product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966353.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 591864..592985 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 593009..594109 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240438.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 594562..595875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 597035..598219 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875977.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 598287..599411 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706040.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene ugd CDS 599422..600951 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454106.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene murJ CDS 601046..602005 product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966201.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 602121..603824 product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 604012..604185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 604404..605312 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048121.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene galU CDS 605595..606107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 606109..606729 product class D sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047728.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 606739..607590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 607750..608250 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025078.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 608312..610870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 610948..611832 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582695.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 612093..613280 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461034.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 613288..614397 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461035.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 614406..615944 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454106.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene murJ CDS 615950..617287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 617309..618730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 618732..619925 product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609547.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 619944..621047 product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 621098..622411 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048117.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 622466..624295 product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048118.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 624308..625405 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 625436..626182 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048115.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 626186..627202 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096185.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 627221..627871 product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048102.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 627911..629152 product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965615.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 629133..630449 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868281.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 630461..632323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 632307..633878 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460880.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene murJ CDS 633897..635285 product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048281.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene pepV CDS 635378..636322 product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816491.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 636335..637339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(637403..637981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 638328..639188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 639562..639726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 639975..641495 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922740.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene hutH CDS 641507..643153 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416707.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene hutU CDS 643165..644061 product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765436.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene ftcD CDS 644072..645322 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673322.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene hutI CDS 645334..645972 product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666838.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 646149..646808 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460716.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 646983..647246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 note possible pseudo, internal stop codon, frameshifted CDS 647240..648139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 note possible pseudo, frameshifted CDS 648350..648586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(649113..650081) product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048100.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene pdaA CDS complement(650078..651136) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986916.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(651129..652331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986915.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(652342..657162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986914.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 657293..659086 product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453998.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene pepF CDS 659474..661552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 661680..662843 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733138.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(662905..663558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(663601..664503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 664650..665906 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357289.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(665954..666373) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048199.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(666432..667841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 667928..668068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 668200..669018 product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360523.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(669042..670739) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948742.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene argS CDS complement(671046..671633) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016461.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene plsY CDS 671935..672504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(672600..673751) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048446.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 673861..674583 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438111.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(674631..676760) product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965967.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene pulA CDS 676968..677822 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272216.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 677878..678489 product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357726.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 678695..680317 product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964175.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene glgP CDS complement(680330..680920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 681058..681465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(681520..682362) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811761.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 682532..683854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 683996..684652 product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902988.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 684649..685311 product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902990.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 685411..686310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(686405..687874) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949007.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 687991..688932 product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943378.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 688946..690016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(690039..692012) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965839.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 692168..692965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(693005..694744) product ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964273.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 694857..695321 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948171.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene rnhA CDS 695483..697036 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392169.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene pckA CDS 697210..697635 product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964367.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 assembly_gap 698011..698436 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(698519..698797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 tRNA 698972..699046 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 699156..699518 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391740.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 699685..700659 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964403.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene glpX CDS 700809..701357 product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943961.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene thpR CDS 701371..702012 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948136.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 702018..702272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 702293..702844 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881124.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 702917..704329 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986917.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 704433..705278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 705290..706177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 706218..708032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 708043..708702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047840.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 708751..708969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 709172..709327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 709473..709901 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965432.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene mraZ CDS 709923..710852 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene rsmH CDS 710882..711346 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358710.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 711374..713512 product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949034.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 713570..716362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 716373..717332 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358738.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene mraY CDS 717343..718455 product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949037.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene spoVE CDS 718457..719557 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232184.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene murG CDS 719609..720358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 720355..721059 product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965423.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 721064..721420 product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358761.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 721423..721731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 721704..722141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07220 note possible pseudo, frameshifted CDS 722383..723645 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047886.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene ftsA CDS 723667..724743 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene ftsZ CDS 724914..725804 product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170291042.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene spoIIGA CDS 725809..726534 product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965002.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene sigE CDS 726605..727378 product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965003.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene sigG CDS 727541..727816 product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392374.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 727969..728424 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene nrdR CDS 728440..730470 product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963802.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 730552..731043 product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene nrdG CDS 731048..731809 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986855.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene pgeF CDS 731822..732514 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986854.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 732525..733922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 734148..735485 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986849.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 735470..736789 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene der CDS 736791..737792 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986847.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 737899..739380 product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986845.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene spoIVA CDS complement(739509..739634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 740057..740896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 740901..741602 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965420.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 741599..742048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 742063..742320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 742333..743100 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897805.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 743115..743597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 743670..743948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07460 assembly_gap 744096..744385 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 745132..747921 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene ileS CDS 747983..749050 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358508.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene aroB CDS 749053..749745 product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965416.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 749754..750536 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358658.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene aroF CDS 750690..750974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 750987..751592 product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949040.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 751745..753097 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582603.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 753111..753470 product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986701.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 753486..754319 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986700.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 754310..755170 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986699.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 755184..755537 product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047760.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 755561..756010 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948972.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 756115..756267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 756357..756731 product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461119.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 756803..757249 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965414.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene lspA CDS 757264..758187 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965413.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 758199..758735 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583925.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene pyrR CDS complement(758815..760545) product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986453.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 760627..761421 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897787.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene dapF CDS 761478..762638 product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880128.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 762757..763635 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 763647..763922 product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388626.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 763938..764555 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965025.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene gmk CDS 764548..764772 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388622.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene rpoZ CDS 764786..765964 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene coaBC CDS 766023..768419 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087118642.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene priA CDS 768432..768881 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388617.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene def CDS 768886..769815 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene fmt CDS 769827..770510 product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047881.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 770569..771897 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene rsmB CDS 771902..772927 product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986842.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene rlmN CDS 772940..773662 product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034581407.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 773659..775326 product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986841.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene pknB CDS 775339..776217 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986840.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene rsgA CDS 776217..776864 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431138.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene rpe CDS 776869..777504 product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965038.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 777570..777722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(777950..778141) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene rpmB CDS 778376..778726 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395974.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 778745..780388 product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454872.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 780453..782507 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene recG CDS 782610..782807 product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422115.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 783135..784499 product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020063.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene gdhA CDS 784601..785155 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene rsmD CDS 785158..785649 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388467.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene coaD CDS complement(785633..786775) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438084.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 786827..787627 product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232221.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(787596..788819) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388463.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 788938..789942 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene pta CDS 789981..791180 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986808.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 791302..791793 product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419111.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 791806..791982 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965052.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene rpmF CDS 792098..793096 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047867.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene plsX CDS 793201..793434 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene acpP CDS 793541..794248 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440969.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene rnc CDS 794306..795316 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965056.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 795391..795651 product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392468.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 795793..799338 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene smc CDS 799340..800245 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393780.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene ftsY CDS 800310..800642 product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369323.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 800658..801998 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362591.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene ffh CDS 802033..802278 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene rpsP CDS 802294..802521 product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362589.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 802575..803078 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene rimM CDS 803075..803815 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965065.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene trmD CDS 803936..804283 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362586.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene rplS CDS 804355..805224 product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236706.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene ylqF CDS 805214..805969 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245658.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene rnhB CDS 805978..806337 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438259.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 806557..808077 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 808087..809148 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965090.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene dprA CDS 809208..811259 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047858.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene topA CDS 811434..811964 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172636479.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene hslV CDS 811984..813372 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene hslU CDS 813389..814168 product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362579.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene codY CDS 814366..815064 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965093.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene rpsB CDS 815130..816047 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384678.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene tsf CDS 816135..816845 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965095.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene pyrH CDS 816864..817421 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene frr CDS 817424..817609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 817687..818451 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 818465..819253 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 819390..820193 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965100.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 820190..821335 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986796.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene dxr CDS 821348..822358 product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384669.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene rseP CDS 822376..823425 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986795.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene ispG CDS 823444..824070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 824086..828390 product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 828540..828995 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965104.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene rimP CDS 828998..830056 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986792.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene nusA CDS 830060..830326 product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 830319..830654 product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288509.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 830641..832767 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965108.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene infB CDS 832784..833134 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene rbfA CDS 833127..834101 product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965110.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 834098..834955 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene truB CDS 834966..835874 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986788.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 835990..836253 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388351.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene rpsO CDS 836439..838547 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965114.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene pnp CDS 838631..839890 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986786.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 839894..840334 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942240.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene dut CDS 840382..840630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 840697..841884 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986785.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene dapG CDS 842028..842732 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388341.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 842801..845038 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965118.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 845221..846561 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene rimO CDS 846545..847063 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362543.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene pgsA CDS 847228..848256 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene recA CDS 848315..848938 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723881.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene recX CDS 848944..849933 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670942.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 849930..851360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 851384..851623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 851636..852292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 852451..853998 product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965122.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene rny CDS 854151..854411 product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965123.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 854563..854937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 854955..856148 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986780.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 856251..857687 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene purB CDS 857815..858603 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360723.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene proC CDS 858808..859806 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(859809..860084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(860152..860421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 860566..861204 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986377.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene lexA CDS complement(861232..862497) product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(862626..862880) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965139.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene hfq CDS complement(862920..863867) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene miaA CDS complement(863876..865786) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965141.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene mutL CDS complement(865791..868394) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047675.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene mutS CDS complement(868446..869780) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965143.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene miaB CDS 869912..870058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(870128..870958) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965145.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(870967..871488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(871606..872625) product CotS family spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986383.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 tRNA 872750..872826 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 assembly_gap 873354..873775 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(874292..875455) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964332.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(875448..875963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08810 note possible pseudo, frameshifted CDS complement(876032..876352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 note possible pseudo, frameshifted CDS complement(876349..876717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(876775..877524) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359153.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(877537..878289) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986945.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(878491..878928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965441.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(878938..879669) product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965442.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(879681..880352) product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965443.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(880349..881212) product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965444.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(881215..882261) product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965445.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene flhF CDS complement(882258..884324) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359159.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene flhA CDS complement(884339..886153) product fused FliR family export protein/FlhB family type III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986950.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(886158..886427) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816214.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene fliQ CDS complement(886449..887207) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359303.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene fliP CDS complement(887191..887532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(887542..888000) product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965451.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(888003..888749) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986952.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(888742..889551) product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986953.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(889548..889751) product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870069.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(889765..890682) product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986954.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(890686..891093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(891110..892360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(892357..892800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(892812..894125) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047906.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene fliI CDS complement(894122..894874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(894858..895874) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359190.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene fliG CDS complement(895880..897442) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986960.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene fliF CDS complement(897467..897763) product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965462.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene fliE CDS complement(897773..898195) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986962.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene flgC CDS complement(898207..898611) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361361.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene flgB CDS complement(898866..899246) product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987025.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene fliS CDS complement(899252..899602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(899615..899956) product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987027.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(900074..900412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(900409..901956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(901958..902179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(902167..902586) product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987029.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene fliW CDS complement(902596..903462) product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene flgL CDS complement(903471..905207) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987031.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene flgK CDS complement(905219..905644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(905641..905919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(905985..907097) product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987032.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene fliY CDS complement(907090..908079) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987033.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene fliM CDS complement(908093..908482) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965515.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(908495..908854) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965516.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(908871..909044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(909053..909466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 note possible pseudo, frameshifted CDS complement(909480..911471) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987035.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(911473..912249) product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359187.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(912254..913297) product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987036.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(913300..913782) product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359122.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(913799..914245) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987037.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(914258..916018) product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965523.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(916155..916484) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461958.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 916687..917502 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048269.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene yidA CDS complement(918018..919118) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438644.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(919103..919792) product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964614.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(919838..920962) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene rpoD CDS complement(920986..922773) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene dnaG CDS complement(922905..923909) product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 924090..925142 product CotS family spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964610.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(925167..927797) product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene ppdK CDS complement(927893..928567) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358068.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(928782..929339) product DUF4342 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357722.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(929356..930081) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047994.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene recO CDS complement(930102..930995) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964607.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene era CDS complement(930988..931398) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357963.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(931500..932198) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358036.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(932208..932711) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430894.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene ybeY CDS complement(932717..934762) product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047997.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(934767..935732) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816443.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(935747..936934) product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047998.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene yqfD CDS complement(936946..937218) product sporulation protein YqfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392128.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene yqfC CDS complement(937326..937769) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964601.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(937786..937962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(938115..938453) product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(938478..939770) product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964598.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene mtaB CDS complement(939773..940516) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(940528..941466) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964596.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene prmA CDS complement(941581..942723) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048002.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene dnaJ CDS complement(942778..944592) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357980.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene dnaK CDS complement(944612..945214) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964593.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene grpE CDS complement(945227..946252) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357960.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene hrcA CDS complement(946372..947475) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964591.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene hemW CDS complement(947475..949277) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964590.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene lepA CDS 949502..951013 product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114980448.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 951076..952497 product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114980448.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(952576..953640) product stage II sporulation protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964588.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(953699..954676) product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048007.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene gpr CDS 954855..955121 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene rpsT CDS complement(955148..956134) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430958.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene holA CDS complement(956150..958237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(958247..958504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(958592..959104) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251052.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(959248..961839) product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948276.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(962040..962720) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948136.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(962720..962884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(962860..964044) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439074.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 964175..965155 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948775.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(965218..965751) product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963535.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 tRNA complement(965873..965969) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(966042..967949) product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048014.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene selB CDS complement(967961..969346) product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048015.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene selA CDS complement(969356..970288) product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012159590.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene selD CDS complement(970435..970980) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890711.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 971091..972314 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048018.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(972335..972721) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816830.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(972906..975377) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene leuS CDS complement(975660..976001) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene rsfS CDS complement(976340..976582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 assembly_gap 976654..977074 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(977086..977385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(977477..978547) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048020.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(978531..979112) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360010.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene yqeK CDS complement(979117..979719) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460892.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene nadD assembly_gap 980092..980928 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(981141..981440) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358089.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene yhbY CDS complement(981460..982725) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene obgE CDS complement(982740..983282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(983377..983643) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene rpmA CDS complement(983678..983989) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964569.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene rplU CDS complement(984098..985489) product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438072.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(985494..986183) product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048024.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(986176..988017) product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(988020..988796) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964565.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(988806..989462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(989537..990664) product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene rodA CDS complement(990721..990993) product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419058.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene minE CDS complement(991005..991802) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964562.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene minD CDS complement(991821..992441) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024932954.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene minC CDS complement(992591..995095) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964560.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(995108..995614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(995628..996449) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383273.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene mreC CDS complement(996464..997501) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403487.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(997524..998213) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964554.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene radC CDS complement(998218..998793) product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226290.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(998799..999056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(999183..999848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(999957..1000553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(1000745..1001386) product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964931.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(1001388..1001882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 tRNA complement(1002067..1002150) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(1002179..1002724) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964415.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(1002721..1003326) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475784.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene coaE CDS complement(1003336..1005885) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048038.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene polA CDS 1006022..1006348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 tRNA 1006421..1006507 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 1006610..1007707 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965433.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene ychF CDS complement(1007726..1010086) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545339.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(1010180..1010857) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964853.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene deoC CDS complement(1011001..1011444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(1011441..1011884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(1011901..1012863) product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939562.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(1012877..1014772) product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251037.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(1014769..1015119) product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250172.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(1015134..1015586) product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251035.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(1015588..1015929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(1015926..1016174) product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146635.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(1016167..1016502) product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244302.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene mnhG CDS complement(1016499..1016753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(1016750..1017268) product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249569.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(1017281..1017940) product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene hypB CDS complement(1017942..1018283) product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933459.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene hypA CDS complement(1018291..1019373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(1019373..1019762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(1019783..1020787) product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964127.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene hypE CDS complement(1020797..1021885) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545661.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene hypD CDS complement(1021872..1022093) product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868354.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(1022084..1024342) product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964128.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene hypF CDS 1024583..1024987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358659.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(1025029..1027647) product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986942.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 1027809..1029440 product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(1029474..1031375) product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047676.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(1031377..1031964) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439452.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(1031961..1032623) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358949.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene cmk CDS complement(1032665..1033027) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172959.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene aroH CDS complement(1033038..1034261) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(1034367..1035248) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(1035367..1036140) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948033.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene surE CDS 1036219..1036869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(1036832..1037410) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948135.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(1037473..1038915) product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048253.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(1039068..1039832) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048251.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(1039834..1041438) product LytS/YhcK type 5TM receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048252.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(1041451..1042158) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435147.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 1042334..1042894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(1042990..1044267) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392338.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(1044264..1045253) product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986740.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(1045333..1046463) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965357.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(1046502..1046915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(1046869..1047438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(1047493..1048065) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402814.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene scpB CDS complement(1048053..1048796) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965361.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(1048808..1049428) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902398.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(1049429..1050514) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965362.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(1050581..1051738) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428267.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(1051861..1053186) product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986425.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(1053199..1054017) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965364.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(1054032..1055204) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965365.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(1055292..1056170) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390088.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene xerD CDS complement(1056239..1056436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(1056446..1057036) product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358910.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene spoIIM CDS complement(1057141..1057674) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428379.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(1057730..1058539) product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358896.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene spo0A CDS complement(1058679..1059890) product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene spoIVB CDS complement(1060067..1061761) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986438.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene recN CDS complement(1061772..1062224) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(1062246..1063097) product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(1063144..1063956) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(1063969..1065828) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene dxs CDS complement(1065838..1066419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986441.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(1067092..1067967) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(1067957..1068214) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942410.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(1068202..1069419) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438130.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene xseA CDS complement(1069412..1070344) product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272419.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(1070337..1070750) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene nusB CDS complement(1070764..1070988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(1071006..1071521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(1071596..1071988) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(1072134..1072628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(1072696..1073289) product stage III sporulation protein AG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358958.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene spoIIIAG CDS complement(1073300..1073875) product stage III sporulation protein AF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359093.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene spoIIIAF CDS complement(1073881..1075029) product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358911.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene spoIIIAE CDS complement(1075039..1075425) product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359080.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene spoIIIAD CDS complement(1075439..1075639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(1075652..1076170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(1076182..1077141) product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438117.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene spoIIIAA CDS complement(1077224..1077688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428343.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(1077752..1078309) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene efp CDS complement(1078353..1079423) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965395.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(1079416..1079859) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964217.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene aroQ CDS complement(1079923..1080789) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060947.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(1080811..1081299) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964216.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(1081305..1081817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(1081827..1082264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(1082266..1083084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(1083094..1083453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(1083450..1083872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(1083881..1084279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(1084281..1084697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(1084697..1085194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(1085207..1085965) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948927.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(1086000..1086377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(1086436..1087626) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546785.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(1087649..1088707) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386380.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(1088727..1090385) product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460315.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(1090444..1090947) product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393068.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(1091051..1091737) product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene sigK CDS complement(1091856..1092491) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986880.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene udk CDS complement(1092493..1093716) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(1093719..1094372) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986882.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(1094398..1095408) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964992.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene mltG CDS complement(1095424..1097244) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene typA CDS complement(1097332..1097799) product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583841.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(1097815..1098159) product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460709.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(1098176..1099840) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(1099996..1100448) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385810.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(1100622..1100753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(1100766..1102607) product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541602.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene feoB CDS complement(1102607..1102837) product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392697.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(1102886..1103593) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963470.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene sfsA CDS complement(1103656..1103931) product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810865.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(1103996..1104409) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440635.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene ruvX CDS complement(1104419..1105399) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393143.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(1105425..1105679) product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025772973.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(1105721..1108357) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986885.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene alaS CDS complement(1108646..1109644) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440854.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(1109655..1110167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(1110252..1111322) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965531.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene mnmA CDS complement(1111338..1111757) product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene nifU CDS complement(1111759..1112946) product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene nifS CDS complement(1112949..1113392) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391911.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(1113537..1114844) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546821.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 1114936..1115691 product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861474.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(1115794..1115994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 1116206..1117390 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392508.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene gltS CDS complement(1117405..1118493) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene hisC CDS complement(1118702..1119613) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963832.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene murB CDS complement(1119730..1120446) product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048308.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(1120514..1122358) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene uvrC CDS complement(1122370..1122984) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357583.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(1123057..1124484) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048310.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(1124487..1125701) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963827.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(1125714..1126133) product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963826.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(1126228..1126809) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047960.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(1126852..1129665) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401468.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene uvrA CDS complement(1129826..1131775) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357634.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene uvrB CDS complement(1131887..1133728) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233080.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene asnB CDS complement(1133754..1134518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 note possible pseudo, frameshifted CDS complement(1134582..1136141) product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene tndX CDS complement(1136212..1136346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 1136521..1136970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(1136976..1137602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(1137711..1138424) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233736.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(1138434..1141613) product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070740.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(1141635..1142558) product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(1142580..1143743) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484770.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(1143758..1145275) product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070743.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 1145450..1146259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 1146275..1146409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 1146393..1147892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 1147858..1149465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 1149711..1150355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(1150427..1150708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 1150960..1152966 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964908.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 1153195..1153869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 assembly_gap 1154403..1154849 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1155213..1155803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(1155901..1156803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(1156870..1158087) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(1158182..1159465) product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091662698.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 assembly_gap 1159982..1160159 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1160171..1160581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(1160815..1162008) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357628.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(1162141..1163178) product tungsten cofactor oxidoreductase radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868082.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(1163293..1164351) product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860813.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene orr CDS complement(1164362..1165708) product GlmL-related ornithine degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895468.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(1165698..1167896) product D-ornithine 4,5-aminomutase subunit OraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895465.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene oraE CDS complement(1167911..1168267) product ornithine aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434665.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(1168280..1169701) product 2-amino-4-oxopentanoate thiolase subunit OrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032507361.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene ortB CDS complement(1169703..1170005) product 2-amino-4-oxopentanoate thiolase subunit OrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860811.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene ortA CDS complement(1170017..1171054) product 2,4-diaminopentanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895461.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene ord CDS complement(1171310..1172689) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860810.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(1172739..1173977) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986909.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(1174083..1174346) product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986911.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(1174351..1175067) product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(1175405..1177192) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048075.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene aspS CDS complement(1177211..1178461) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048076.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene hisS CDS 1178856..1179050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(1179151..1180452) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene rmuC CDS complement(1180502..1180642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(1180823..1182238) product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048077.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(1182248..1182430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(1182493..1183110) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965570.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(1183122..1183604) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048079.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene dtd CDS complement(1183638..1185746) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048080.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(1186070..1186372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 note possible pseudo, frameshifted CDS complement(1186375..1188756) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861665.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene recJ CDS complement(1188859..1189722) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048082.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene secF CDS complement(1189737..1190975) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048083.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene secD CDS complement(1190995..1191654) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(1191739..1192239) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869802.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(1192242..1193600) product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048084.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene scfB CDS complement(1193660..1193800) product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357718.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene scfA CDS complement(1193930..1194322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(1194371..1195507) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene tgt CDS complement(1195518..1196543) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene queA CDS complement(1196597..1197598) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene ruvB CDS complement(1197609..1198208) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene ruvA CDS complement(1198219..1198713) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene ruvC CDS complement(1198788..1199354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357907.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(1199419..1200159) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(1200239..1200610) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812273.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(1200607..1201266) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965593.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(1201259..1201921) product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437523.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 1202015..1202209 product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813569.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(1202250..1203671) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048092.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(1203679..1204521) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245785.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(1204579..1205463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(1205540..1205770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(1205775..1206440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(1206557..1207225) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963474.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 1207330..1208343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 tRNA complement(1208415..1208490) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(1208548..1210353) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048095.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene hflX CDS 1210514..1211041 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048096.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene hpt CDS complement(1211061..1211696) product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418439.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene yunB CDS complement(1211772..1213193) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986390.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 1213435..1215756 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048098.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(1215766..1216332) product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254415.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(1216343..1216699) product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene spoVAE CDS complement(1216701..1217717) product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965601.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene spoVAD CDS complement(1217734..1218195) product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403642.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene spoVAC CDS complement(1218200..1218343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(1218412..1219164) product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403644.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene sigF CDS complement(1219180..1219605) product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357714.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene spoIIAB CDS complement(1219619..1219954) product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357811.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene spoIIAA CDS complement(1220081..1220746) product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391936.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(1220965..1221357) product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964225.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 1221511..1222353 product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393316.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene speE CDS complement(1222367..1222843) product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925080.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(1222856..1223281) product nucleoside recognition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868940.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(1223339..1223578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(1223575..1224825) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392743.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene dinB CDS complement(1224966..1225433) product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948159.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(1225457..1226215) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(1226276..1227964) product TaqI-like C-terminal specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099504.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(1227978..1229309) product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947940.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 1229420..1230658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 1230718..1231920 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861720.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 1232024..1232824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(1232836..1233201) product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680676.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(1233198..1234460) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016211.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(1234475..1235899) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964632.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(1236031..1237527) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987067.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene glpK CDS complement(1237546..1238361) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705540.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(1238734..1238976) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(1239153..1240193) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948469.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene arsB CDS complement(1240472..1240780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(1240960..1242150) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048275.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(1242519..1242713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 1242866..1244023 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 1244091..1245308 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene tyrS CDS complement(1245357..1246943) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504021.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 1247068..1248747 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948836.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(1248756..1250612) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986153.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(1250828..1251298) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582990.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene folK CDS complement(1251295..1252131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(1252128..1252898) product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082504.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene folE2 CDS complement(1252902..1253255) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389277.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene queD CDS complement(1253384..1254535) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865390.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(1254590..1255186) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949003.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 1255378..1255542 product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393739.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(1255582..1256115) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963735.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 1256185..1256628 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966812.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 1256702..1259146 product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966263.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 1259164..1267647 product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963929.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 1267803..1268396 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656023.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 1268571..1269344 product histidinol phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966014.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(1269371..1269739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(1269736..1270638) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230010.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(1270820..1272529) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966455.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(1272602..1273294) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016734.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(1273307..1274296) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582848.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(1274286..1275107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582849.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(1275170..1276522) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021134739.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene rlmD CDS complement(1276547..1277680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(1277787..1278419) product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940854.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(1278693..1279964) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868255.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(1280360..1281259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 note possible pseudo, frameshifted CDS complement(1281253..1281939) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460716.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(1282008..1282250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(1282351..1282548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(1282638..1283336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 1283519..1284277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(1284289..1284564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(1284729..1286093) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948912.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(1286361..1287050) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583690.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(1287545..1289071) product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705934.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(1289305..1290297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 note possible pseudo, internal stop codon CDS complement(1290310..1290816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 note possible pseudo, internal stop codon CDS complement(1290993..1292117) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986590.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(1292349..1293665) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 1293961..1294506 product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393991.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(1294637..1295251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(1295506..1295973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 1295927..1296868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 1297223..1297777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(1297814..1299181) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048300.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene rlmD CDS complement(1299327..1300331) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895580.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(1300433..1302187) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048303.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene pyk CDS complement(1302205..1303173) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene pfkA CDS complement(1303541..1307011) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963838.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(1307023..1308333) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963836.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(1308401..1309351) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963835.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene whiA CDS complement(1309360..1310673) product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048305.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(1310673..1311548) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene rapZ CDS complement(1311565..1312302) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436256.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(1312907..1313812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(1313974..1314543) product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869131.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(1314543..1316306) product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869130.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene iorA CDS complement(1316326..1317231) product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048127.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(1317302..1317967) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582682.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(1318378..1319109) product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048195.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene pflA CDS complement(1319123..1321348) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048196.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene pflB CDS complement(1321843..1322859) product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048128.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(1322874..1323422) product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428581.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene yfcE CDS complement(1323400..1323942) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080594.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(1324035..1325360) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948975.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(1325494..1325949) product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048129.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(1326102..1328462) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965637.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(1328478..1330838) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048131.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(1330933..1331676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(1331753..1332193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(1332275..1333162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(1333246..1333854) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357976.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(1333973..1336333) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357703.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene pheT CDS complement(1336345..1337364) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403382.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene pheS CDS complement(1337673..1338434) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965655.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(1338440..1339099) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357824.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(1339119..1340480) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048134.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(1340589..1340948) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965656.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene rplT CDS complement(1340970..1341167) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942164.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene rpmI CDS complement(1341191..1341712) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965658.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene infC CDS complement(1341879..1343792) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene thrS CDS complement(1344085..1344993) product putative sporulation protein YtxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048137.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene ytxC CDS complement(1345059..1345826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439005.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 tRNA complement(1345901..1345975) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(1345987..1346062) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(1346071..1346146) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(1346150..1346226) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(1346232..1346307) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(1346376..1347080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(1347347..1348225) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965667.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene hslO CDS 1348397..1348540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(1348544..1349281) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 1349358..1350317 product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966201.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(1350391..1350621) product small, acid-soluble spore protein, alpha/beta type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965669.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(1350665..1351630) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963504.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(1351632..1352606) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963503.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(1352618..1353562) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963502.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(1353576..1354538) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963501.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(1354583..1356295) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963500.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 1356695..1357687 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357473.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 1357727..1358611 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene dapA CDS 1358622..1359377 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965675.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene dapB CDS 1359436..1360593 product aminotransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434582.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(1360665..1361198) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015829.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 1361311..1362033 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965677.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene dapD CDS complement(1362060..1362683) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965678.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(1362770..1363363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(1363475..1364248) product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048155.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene pdaB CDS 1364377..1364565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 1364674..1364916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 1365045..1365566 product DUF4364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891708.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(1365584..1365775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(1365850..1367142) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(1367308..1368234) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949049.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(1368360..1371011) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048157.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(1371033..1371185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(1371479..1371967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 1372109..1373119 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048162.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 1373168..1373935 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357525.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 1373925..1374722 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963937.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(1374761..1376506) product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022903.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(1376508..1376909) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022904.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(1377030..1379621) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948176.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene clpB CDS complement(1379634..1380239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(1380343..1381638) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948172.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(1381749..1381925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(1381998..1382936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(1383024..1383566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(1383763..1384158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(1384203..1385378) product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986928.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 1385827..1386591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(1386606..1387100) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986929.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(1387168..1387554) product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941534.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(1387934..1388395) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401351.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene def CDS complement(1388415..1389329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(1389332..1390276) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986479.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene moaA CDS complement(1390289..1392157) product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986480.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(1392162..1393349) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986481.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 1393458..1393955 product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817323.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(1393967..1394200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(1394193..1394915) product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980351.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(1395061..1395489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943965.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(1395622..1397361) product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986411.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(1397377..1399167) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene nuoF CDS complement(1399178..1399543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082448.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(1399540..1400034) product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868903.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(1400175..1401239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(1401236..1401916) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032499.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(1401922..1402491) product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176066.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(1402664..1404373) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431795.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene ptsP CDS complement(1404394..1404654) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422895.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(1404676..1405161) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473667.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(1405268..1406101) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987040.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(1406220..1406855) product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359170.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(1406858..1408240) product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986932.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(1408233..1410005) product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033047490.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(1410010..1410333) product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986934.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(1410326..1411315) product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986935.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(1411349..1411942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(1411956..1412462) product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986937.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(1412478..1414388) product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986938.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(1414375..1414701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015807.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(1414831..1416519) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964339.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(1416431..1417030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(1417102..1417698) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(1417701..1418423) product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359294.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(1418495..1419898) product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964336.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 1420191..1421306 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 1421400..1422893 product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949021.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene spoVB CDS 1423102..1423221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(1423346..1424233) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964578.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(1424236..1425273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 1425406..1426368 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(1426612..1426731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(1426902..1427402) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392726.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 1427523..1428293 product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986405.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 1428300..1429598 product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359027.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 1429573..1429968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(1430058..1430675) product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966211.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene thiT tRNA 1430971..1431046 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(1431115..1431513) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene ndk CDS 1431587..1432528 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(1432620..1433249) product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(1433254..1434621) product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(1434623..1436386) product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878662.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(1436398..1436991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(1437002..1437310) product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(1437322..1437738) product ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869272.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(1437754..1439712) product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(1439727..1440764) product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869715.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(1440770..1441102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(1441334..1442230) product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947908.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(1442434..1443372) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964370.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(1443372..1443797) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964369.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(1443934..1445133) product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400106.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene megL CDS complement(1445296..1446855) product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947911.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(1446852..1447508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(1447624..1447983) product C-GCAxxG-C-C family (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890718.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 1448153..1450414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(1450438..1451799) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017139.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(1452007..1453527) product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986430.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene yjeM CDS complement(1453924..1454265) product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359645.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(1454312..1457002) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948194.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(1457029..1457697) product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356857.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene hypB CDS complement(1457911..1458471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(1458675..1460060) product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939479.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(1460117..1460500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 note possible pseudo, frameshifted CDS complement(1460596..1460790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 note possible pseudo, frameshifted CDS 1460968..1462314 product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964062.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(1462340..1463407) product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226178.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene orr CDS complement(1463536..1464333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(1464359..1464973) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945866.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(1464992..1466011) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948771.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(1466027..1466809) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948770.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(1466820..1467701) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948769.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(1467694..1468926) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948768.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(1468937..1469614) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262999.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 1469843..1470901 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986923.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(1470907..1471287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948794.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(1471336..1472682) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948793.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 1472917..1473720 product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861091.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene zupT CDS complement(1473762..1474085) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595964.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(1474142..1474345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(1474466..1474951) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(1475067..1475945) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643926.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(1475998..1477347) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461270.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene nhaC CDS complement(1477573..1478994) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939914.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(1479335..1479772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(1479968..1480516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(1480751..1481608) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814610.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(1481741..1482085) product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355771.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 1482156..1482857 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964407.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(1483011..1484687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(1484813..1486288) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256247.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(1486285..1487829) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256246.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 1488451..1488882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(1488941..1489330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(1489463..1489903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(1490537..1490695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 note possible pseudo, internal stop codon, frameshifted CDS complement(1491134..1491298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 note possible pseudo, frameshifted CDS complement(1491586..1492254) product IS21-like element ISMac3 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021079.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene istB note possible pseudo, frameshifted CDS complement(1492268..1493464) product IS21-like element ISMac9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022071.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene istA CDS complement(1494007..1494960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(1495636..1495911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(1496250..1497119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 note possible pseudo, frameshifted CDS complement(1497116..1497412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 note possible pseudo, internal stop codon, frameshifted tmRNA complement(1497556..1497907) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(1497911..1498375) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene smpB CDS complement(1498520..1499239) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986547.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(1499232..1499891) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358158.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(1499907..1500698) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047707.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(1500700..1502028) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986965.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene argH CDS complement(1502025..1503233) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986966.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(1503380..1505512) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene rnr CDS complement(1505523..1506074) product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583840.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(1506125..1506694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(1506862..1508883) product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(1508907..1509143) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905643.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene secG CDS complement(1509331..1510629) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948030.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene eno CDS complement(1510651..1512183) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene gpmI CDS complement(1512195..1512941) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene tpiA CDS complement(1512998..1514185) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(1514263..1515273) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948756.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene gap CDS complement(1515332..1516354) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964027.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(1516690..1518030) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170876203.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene rpoN CDS complement(1518219..1519154) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356209.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(1519147..1520232) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357224.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(1520245..1521765) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948025.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(1521829..1522890) product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357021.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(1523267..1524418) product glycine/sarcosine/betaine reductase complex component C subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430750.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene grdD CDS complement(1524430..1525965) product glycine/sarcosine/betaine reductase complex component C subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897537.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene grdC CDS complement(1526040..1527341) product glycine reductase complex selenoprotein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011345263.1 transl_table 11 codon_start 1 transl_except (pos:1526298..1526300,aa:Sec) note codon on position 348 is selenocysteine opal codon. locus_tag LOCUS_15410 gene grdB CDS complement(1527361..1527834) product glycine/sarcosine/betaine reductase complex component A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:P26970 transl_table 11 codon_start 1 transl_except (pos:1527706..1527708,aa:Sec) note codon on position 43 is selenocysteine opal codon. locus_tag LOCUS_15420 gene grdA CDS complement(1527849..1529135) product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948884.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(1529213..1529539) product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416870.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(1529550..1530479) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416869.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene trxB CDS complement(1530494..1530874) product GrdX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948883.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(1531229..1532074) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948024.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(1532087..1532554) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356826.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene trmL assembly_gap 1532864..1533522 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1533553..1533831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 1534111..1535466 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(1535510..1536652) product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808433.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 1536718..1537737 product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009879610.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene splB tRNA complement(1537814..1537904) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(1537914..1537988) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS 1538126..1538413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 note possible pseudo, frameshifted CDS 1538539..1538721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 1538738..1539739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869080.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(1539796..1540629) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964017.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(1540714..1541370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(1541382..1543742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(1543739..1544356) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062281570.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(1544353..1545966) product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392966.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(1545956..1546798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 1547201..1547638 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392635.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(1547721..1548572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(1548718..1549986) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681109.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(1549999..1550925) product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048526434.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(1550968..1551477) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222818.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(1551634..1553043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(1553175..1553873) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110707.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene deoD CDS complement(1554086..1554295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(1554333..1555016) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 1555096..1556262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 1556259..1556525 product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356363.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 1556531..1557301 product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948004.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(1557360..1557848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 1557929..1558747 product RMD1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943194.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(1558771..1561224) product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948003.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 1561404..1561553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 1561618..1562277 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(1562369..1562698) product DUF1904 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895429.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(1562709..1563863) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963477.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(1563928..1564335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(1564540..1564920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(1565020..1565352) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948586.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(1565496..1566149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(1566330..1567520) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532677.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(1567595..1568335) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene fabG CDS complement(1568450..1569829) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022819390.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(1569846..1571396) product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(1571638..1573383) product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048183.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(1573460..1573882) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390712.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(1573935..1574924) product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048184.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(1574884..1575405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(1575418..1576557) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048186.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(1576800..1579259) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948516.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 1579405..1580487 product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048266.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(1580506..1582536) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387654.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(1582969..1584000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 note possible pseudo, frameshifted CDS complement(1584147..1585493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(1585638..1586015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964271.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(1586029..1587420) product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(1587756..1588241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(1588228..1589085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 note possible pseudo, frameshifted CDS complement(1589144..1589596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 1589761..1590417 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 1590414..1591763 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822525.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(1591832..1592269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(1592366..1593274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 note possible pseudo, frameshifted assembly_gap 1593452..1593658 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1594168..1596498) product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861838.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(1596578..1597813) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032507458.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(1597864..1598682) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030645.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(1598682..1599524) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(1599524..1600534) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356351.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(1600671..1601603) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582429.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(1601606..1602574) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582430.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene hflK CDS complement(1602765..1603085) product putative heavy metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725735.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(1603104..1603421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 1603601..1603858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 1604016..1606130 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964227.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(1606166..1607521) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103658.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(1607736..1608293) product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015758443.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(1608419..1609219) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359375.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(1609351..1610292) product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966129.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene galT CDS complement(1610336..1611151) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112888.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(1611164..1612081) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546228.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(1612128..1613354) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257891.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(1613405..1614424) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(1614502..1616781) product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886611.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 1617075..1617716 product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene pgmB CDS complement(1617765..1618631) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459274.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(1618637..1619476) product YjjW family glycine radical enzyme activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099548.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(1619473..1620957) product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099547.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(1621056..1621946) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356163.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(1621943..1623388) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948219.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(1623482..1624888) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene nhaC CDS 1625228..1625452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(1625459..1626007) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420885.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene pyrE CDS complement(1626018..1626914) product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048207.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(1626907..1627638) product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965939.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(1627628..1628479) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361662.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene pyrF CDS complement(1628457..1629668) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048209.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(1629670..1630101) product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(1630094..1631026) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene pyrB CDS complement(1631187..1631720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 1631809..1632003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(1632033..1632428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(1632451..1633203) product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965945.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(1633208..1633561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(1633563..1634801) product DUF1576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869156.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(1635518..1635928) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393982.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(1636020..1636694) product heparan-alpha-glucosaminide N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458912.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(1636712..1637662) product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965723.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(1637653..1638741) product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965722.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(1638713..1639618) product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965721.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(1639752..1640516) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949043.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(1640620..1641792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 1641960..1642403 product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047979.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 1642420..1642797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(1642945..1643889) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048420.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(1644010..1644591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(1644731..1645879) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949044.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 1645983..1646792 product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518967.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 1647204..1648244 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 1648246..1649061 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 1649055..1649837 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 1649838..1650896 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459712.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(1650942..1651472) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963743.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 1651654..1652166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(1652308..1652796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(1652808..1653953) product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080082.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(1653953..1654438) product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080084.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(1654419..1654904) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080086.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 note possible pseudo, internal stop codon CDS complement(1655028..1655912) product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080087.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(1655909..1657783) product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080094.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(1657794..1659242) product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250171.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(1659239..1659598) product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250172.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(1659601..1660344) product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080100.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(1660334..1660579) product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080102.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(1660572..1660895) product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080104.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene mnhG CDS complement(1660897..1661145) product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250176.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(1661145..1661618) product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080108.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(1661642..1661911) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894377.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 1662164..1663117 product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942059.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(1663206..1663586) product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048271.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 1663772..1664197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(1664289..1665050) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920766.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(1665047..1666375) product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438631.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene pabB CDS complement(1666368..1666943) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861216.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(1667026..1667283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(1667390..1667569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(1667618..1668349) product putative 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966888.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene queE CDS complement(1668350..1668775) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663812.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene queD CDS complement(1668775..1669452) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443906.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene queC CDS complement(1669449..1670213) product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358645.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(1670210..1671208) product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966885.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 1671459..1672508 product GerMN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943078.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(1672549..1673268) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963752.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(1673392..1674684) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398851.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene lysA CDS complement(1674867..1676633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 1676731..1678191 product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986513.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 1679016..1679258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 1679264..1680358 product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963918.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(1680338..1681012) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986483.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(1681015..1681704) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986484.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(1681721..1682539) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986485.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(1682652..1683068) product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582698.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(1683238..1685277) product DUF1923 family maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865200.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 1685461..1686528 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963632.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(1686542..1686811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048073.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(1687088..1688149) product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948166.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(1688297..1688929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966625.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 tRNA 1689088..1689161 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(1689165..1689743) product sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963528.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(1689755..1690672) product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399984.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene glsA CDS complement(1690675..1691526) product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154857.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene citG CDS complement(1691516..1692016) product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016309.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene citX CDS complement(1692013..1693020) product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016310.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene citC CDS complement(1693043..1694584) product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272879.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene citF CDS complement(1694589..1695464) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679317.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(1695478..1695738) product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816323.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene citD CDS complement(1695747..1696304) product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(1696315..1697157) product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048346.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(1697301..1698578) product methylaspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680089.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(1698595..1700052) product methylaspartate mutase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680091.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(1700065..1701453) product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682340.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene glmL CDS complement(1701469..1701888) product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816944.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene glmS CDS complement(1701910..1702869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(1703084..1703617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 1703943..1705190 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072045.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(1705217..1706701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(1706800..1709304) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966852.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(1709449..1710015) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963361.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 1710167..1711012 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948026.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 1711679..1711978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(1712069..1712794) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048203.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(1712869..1713462) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene yihA CDS complement(1713466..1715775) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357593.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene lon CDS complement(1715905..1717584) product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392067.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene lonB CDS complement(1717673..1718968) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene clpX CDS complement(1718983..1719570) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene clpP CDS complement(1719621..1720913) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965929.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene tig CDS complement(1721028..1721354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(1721430..1722275) product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948181.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(1722279..1723061) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048205.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(1723024..1723242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(1723239..1724063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 tRNA complement(1724150..1724225) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA complement(1724240..1724316) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA complement(1724346..1724422) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(1724429..1724502) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(1724509..1724584) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(1724590..1724673) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA complement(1724680..1724755) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA complement(1724777..1724852) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA complement(1724856..1724931) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA complement(1724937..1725013) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(1725018..1725094) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA complement(1725101..1725174) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA complement(1725178..1725253) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 CDS complement(1725319..1725801) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357651.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(1725815..1726420) product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965953.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(1726368..1727168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 note possible pseudo, frameshifted CDS complement(1727158..1728159) product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 1728298..1729671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048221.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 1729716..1729865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(1729894..1731534) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913630.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(1731617..1732588) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966903.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(1732588..1733598) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966904.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(1733614..1734546) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966905.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(1734559..1735479) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966906.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(1735937..1737364) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048223.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene gatB CDS complement(1737379..1738830) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048224.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene gatA CDS complement(1738842..1739129) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034582121.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene gatC CDS complement(1739147..1739413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(1739410..1741404) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene ligA CDS complement(1741417..1744704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(1744821..1745120) product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357450.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(1745185..1745913) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234935.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(1745906..1747246) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431793.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(1747258..1747857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 1748012..1748197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(1748308..1749471) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948736.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(1749568..1750500) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895228.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 1750692..1752065 product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503865.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(1752087..1753328) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964705.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene purD CDS complement(1753338..1754831) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964704.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene purH CDS complement(1754806..1755399) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047940.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene purN CDS complement(1755387..1756379) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964702.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene purM CDS complement(1756381..1757787) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047942.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene purF CDS complement(1757772..1759961) product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene purL CDS complement(1759954..1760448) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene purE CDS complement(1760450..1761562) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081519.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene purK CDS complement(1761564..1762226) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666779.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene purQ CDS complement(1762223..1762471) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275007.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene purS CDS complement(1762468..1763178) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047943.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(1763237..1764661) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047961.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 assembly_gap 1765323..1765844 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1766465..1767085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 1767261..1767884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(1768004..1768309) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817080.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(1768302..1768589) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671306.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(1768715..1771990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(1771987..1773714) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966556.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(1773747..1774187) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583010.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(1774305..1775369) product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592702.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(1775498..1777030) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene guaA CDS complement(1777040..1778494) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965988.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene guaB CDS 1778861..1779001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 1779226..1779543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17930 note possible pseudo, internal stop codon, frameshifted CDS 1779537..1780436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 note possible pseudo, frameshifted CDS complement(1780571..1782838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(1783088..1783255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(1783207..1783440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 repeat_region 1784134..1784766 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaattccaatatggtccgattaaaac CDS complement(1785003..1785212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(1785212..1785739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 note possible pseudo, frameshifted CDS complement(1785874..1786215) product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922600.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(1786221..1787129) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(1787141..1788097) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256415.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(1788113..1789438) product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(1789452..1790582) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259630.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(1790593..1791495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(1791504..1792388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(1792400..1792777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(1792833..1793003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(1793133..1793792) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963563.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(1793785..1794954) product two-component sensor histidine kinase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227983.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene degS CDS complement(1795192..1796343) product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene larC CDS complement(1796346..1797107) product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene larB CDS complement(1797111..1797914) product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964093.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene larE CDS 1798140..1799360 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(1799431..1800063) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748775.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(1800081..1801979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(1802079..1802432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(1802729..1804348) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene groL CDS complement(1804369..1804656) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(1805062..1805493) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357848.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(1805505..1806380) product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048247.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(1806384..1807199) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888021.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(1807301..1809001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 1809188..1809511 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357302.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene trxA CDS 1809511..1810347 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357673.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(1810378..1811673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(1811713..1813440) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963765.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 1813722..1813916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(1813983..1814825) product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(1814839..1815444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(1815771..1816736) product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048184.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(1816749..1817528) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048185.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(1817541..1818479) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048186.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(1818460..1819215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(1819228..1820007) product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(1820178..1822094) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 1822241..1822885 product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966000.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(1822896..1825133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(1825491..1826513) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene tsaD CDS complement(1826564..1827265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(1827267..1827650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(1827862..1828422) product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361269.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(1828503..1829081) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(1829176..1830291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 1830393..1830653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(1830719..1831708) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964738.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene galE CDS complement(1831719..1832654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(1832659..1833816) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016043.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(1833819..1834805) product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080138.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene galT CDS complement(1834938..1837019) product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226869.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(1837020..1838966) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575935.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(1838983..1839825) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(1839825..1840742) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582885.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(1840804..1842084) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530183.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 assembly_gap 1842626..1843061 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1843629..1844639) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966245.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(1844781..1846151) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443143.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(1846351..1847232) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451047.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(1847330..1848337) product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422090.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(1848340..1848807) product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422094.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(1848819..1849583) product proline reductase cluster protein PrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047874.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene prdD CDS complement(1849636..1850361) product D-proline reductase (dithiol) protein PrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013362442.1 transl_table 11 codon_start 1 transl_except (pos:1849909..1849911,aa:Sec) note codon on position 151 is selenocysteine opal codon. locus_tag LOCUS_18610 gene prdB CDS complement(1850358..1850606) product CBO2463/CBO2479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393252.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(1850617..1852710) product D-proline reductase (dithiol) proprotein PrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047876.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene prdA CDS complement(1852728..1854032) product proline reductase-associated electron transfer protein PrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986834.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene prdC CDS complement(1854253..1855992) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388461.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(1856160..1857035) product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966831.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(1857035..1857883) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966832.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene accD CDS complement(1857895..1859235) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(1859250..1859672) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048424.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene fabZ CDS complement(1859674..1860141) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966835.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene accB CDS complement(1860146..1861378) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene fabF CDS complement(1861389..1862120) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene fabG CDS complement(1862122..1863048) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048428.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene fabD CDS complement(1863049..1863993) product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene fabK CDS complement(1863993..1864223) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359433.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene acpP CDS complement(1864237..1865196) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(1865197..1865658) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048431.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(1865887..1866672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(1866709..1866900) product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965947.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(1867097..1868014) product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048393.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 1868095..1868544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 1868561..1868998 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385810.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(1868988..1869440) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948218.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(1869447..1870202) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356746.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(1870489..1872852) product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254583.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(1872998..1877281) product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048163.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(1877480..1877977) product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966802.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 1878505..1879509 product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene asnA CDS complement(1879557..1879733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(1879746..1881308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(1881317..1883944) product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene mrfA CDS 1884195..1885805 product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 1885811..1886026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 1886178..1887779 product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(1887784..1888461) product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860636.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene cwlD CDS complement(1888562..1888954) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357662.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene rpsI CDS complement(1888985..1889419) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003494906.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene rplM CDS complement(1889544..1890278) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048349.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene truA CDS complement(1890281..1891075) product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(1891072..1891932) product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(1891917..1892759) product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(1892833..1893180) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357477.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene rplQ CDS complement(1893193..1894140) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357472.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(1894201..1894821) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357283.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene rpsD CDS complement(1894840..1895037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(1894992..1895513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(1895531..1895908) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene rpsM CDS complement(1896117..1896335) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene infA CDS complement(1896353..1896622) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966390.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(1896634..1897383) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357322.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene map CDS complement(1897380..1898033) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357697.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(1898054..1899328) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357569.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene secY CDS complement(1899331..1899771) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene rplO CDS complement(1899785..1899967) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357637.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene rpmD CDS complement(1899982..1900479) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966395.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene rpsE CDS complement(1900499..1900867) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357434.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene rplR CDS complement(1900886..1901428) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene rplF CDS complement(1901452..1901850) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357687.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene rpsH CDS complement(1901877..1902062) product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966399.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(1902079..1902621) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966400.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene rplE CDS complement(1902643..1902966) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357467.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene rplX CDS complement(1902985..1903353) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene rplN CDS complement(1903379..1903633) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene rpsQ CDS complement(1903656..1903868) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357691.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene rpmC CDS complement(1903858..1904298) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene rplP CDS complement(1904323..1904595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(1904592..1904735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(1904760..1905434) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene rpsC CDS complement(1905461..1905796) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966407.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene rplV CDS complement(1905815..1906096) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357326.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene rpsS CDS complement(1906160..1906987) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene rplB CDS complement(1907052..1907351) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357444.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene rplW CDS complement(1907351..1907971) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357518.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene rplD CDS complement(1907996..1908376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(1908401..1909030) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966412.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene rplC CDS complement(1909087..1909395) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966413.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene rpsJ CDS complement(1909711..1910115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19370 assembly_gap 1910218..1910669 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1911142..1913220) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene fusA CDS complement(1913315..1913785) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966417.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene rpsG CDS complement(1913918..1914292) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545079.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene rpsL CDS complement(1914347..1914589) product 50S ribosomal protein L7ae-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048355.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(1914708..1918235) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048356.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene rpoC CDS complement(1918304..1919167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(1919172..1922546) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048357.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene rpoB CDS complement(1922806..1923174) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357259.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene rplL CDS complement(1923204..1923701) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966423.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene rplJ CDS complement(1923906..1924601) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene rplA CDS complement(1924660..1925085) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene rplK CDS complement(1925114..1925632) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene nusG CDS complement(1925673..1925876) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357558.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene secE CDS complement(1925900..1926049) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene rpmG CDS complement(1926213..1926617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(1926726..1927928) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393939.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene tuf CDS complement(1927948..1928394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19540 tRNA complement(1928592..1928667) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 CDS complement(1928732..1929373) product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357363.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene sigH CDS complement(1929446..1929964) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003394990.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(1929966..1930742) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357423.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene rlmB CDS complement(1930758..1931531) product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421197.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene thyX CDS complement(1931548..1931961) product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930887.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 1932057..1932581 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868582.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(1932609..1934012) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048360.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene cysS CDS complement(1934264..1935718) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399675.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene gltX CDS complement(1935817..1936782) product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099543.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene ilvA CDS 1937117..1937530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(1937595..1938770) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986712.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(1938763..1939491) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966816.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(1939493..1939969) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene ispF CDS complement(1940180..1942303) product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(1942468..1943142) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966461.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene ispD CDS complement(1943151..1944278) product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966462.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(1944392..1944871) product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896172.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 1945082..1945477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048365.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(1945537..1946592) product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393302.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene disA CDS complement(1946598..1947962) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085202.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene radA CDS complement(1948070..1950511) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048366.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(1950525..1951547) product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966467.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(1951549..1952076) product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966468.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(1952088..1952546) product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357349.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(1952724..1952867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(1952867..1953103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(1953193..1955280) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048368.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene fusA CDS 1955510..1956031 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965934.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene lepB CDS complement(1956043..1956693) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene phoU CDS complement(1956708..1957463) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986851.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene pstB CDS complement(1957476..1958348) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405019.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene pstA CDS complement(1958348..1959253) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256174.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene pstC CDS complement(1959305..1960210) product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405017.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(1960347..1962089) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965989.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 1962284..1964416 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966776.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(1964432..1967773) product ribonucleotide reductase N-terminal alpha domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459011.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(1967987..1968832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 1968859..1969464 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356430.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(1969482..1970882) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393286.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(1970895..1972220) product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965585.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(1972207..1973340) product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965586.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 tRNA complement(1973486..1973560) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 assembly_gap 1974125..1975539 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA complement(1975770..1975846) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA complement(1975852..1975927) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 tRNA complement(1976109..1976183) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 rRNA complement(1976199..1976307) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 sequence34 source 1..1036 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence35 source 1..6666 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 260..2876 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3473..6168 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6227..6550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 sequence36 source 1..3415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 539..2850 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence37 source 1..172707 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(662..3091) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947899.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene gyrA CDS complement(3104..5005) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947898.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene gyrB CDS complement(5021..5278) product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359336.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(5345..6454) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359456.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene recF CDS complement(6463..6672) product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963332.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene yaaA CDS complement(6739..7842) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene dnaN CDS complement(8104..9480) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene dnaA CDS 10015..10149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 10207..10551 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene rnpA CDS 10551..10760 product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048456.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene yidD CDS 10775..11452 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359437.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 11470..12096 product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398827.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS 12192..13574 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359423.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene mnmE CDS 13587..15467 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene mnmG CDS 15471..16190 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048453.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene rsmG CDS 16214..17002 product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 gene noc CDS complement(17189..17458) product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140124.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 17549..18316 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS 18318..19109 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048450.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 19212..19703 product DUF4446 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398925.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 19749..20003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(20000..20581) product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815163.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 gene yyaC CDS complement(20640..21683) product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048447.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene ytvI CDS 21749..22042 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355819.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 22039..23757 product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861887.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 23940..25232 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021359871.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 25394..26716 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392811.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene glnA CDS 26730..27323 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227937.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 27310..27888 product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892314.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 gene yedF CDS 27903..28160 product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361815.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 28192..29040 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966986.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 29041..29262 product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003639829.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 29337..29624 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966984.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene rpsF CDS 29644..30081 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359348.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene ssb CDS 30112..30351 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966982.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene rpsR CDS 30450..30773 product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420530.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 30776..31738 product YybS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048443.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 31765..33747 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397329.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 33744..34190 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048442.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene rplI CDS 34205..36079 product Lon family ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048441.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene lonC CDS 36091..37425 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966975.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(37458..39374) product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964368.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 39485..40303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 40480..41862 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 41867..43153 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048438.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 tRNA 43319..43393 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 tRNA 43397..43472 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 tRNA 43478..43554 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 tRNA 43560..43635 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 CDS complement(43891..44256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 assembly_gap 44265..44401 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(44473..44841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(44995..45978) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048435.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(45968..46906) product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048434.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 47084..48430 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813688.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(48444..49640) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048419.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 49816..49998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(50023..50187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(50284..51180) product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359449.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 51397..52656 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS complement(52669..53844) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 53949..54737 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 54749..55837 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963785.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 55878..56357 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048404.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene rlmH CDS 56526..57893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 58054..59262 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986414.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 59278..60603 product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387108.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(60611..61255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425116.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 61308..61457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 61477..62412 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014525052.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene rbsK CDS 62409..62804 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716152.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene rbsD CDS 62817..64316 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189455.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene rbsA CDS 64329..65258 product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463702.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene rbsC CDS 65273..66181 product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419502.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene rbsB CDS 66243..67241 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860719.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 67366..68178 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392214.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(68181..68717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(68720..69988) product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459114.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(70224..70841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272208.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(71040..71789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 72092..73126 product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365711.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene mglB CDS 73193..74701 product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903113.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene mglA CDS 74716..75726 product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707760.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene mglC CDS complement(75757..76509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(76643..77266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 77778..78548 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439548.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 78560..79201 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722217.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 79210..79890 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423753.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 79987..80808 product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965890.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene speD CDS 81042..82559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(82593..83993) product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356603.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 84106..85503 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 85845..87236 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948326.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene asnS CDS 87406..87915 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(87926..88339) product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545623.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 88775..90217 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450718.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene proS CDS complement(90242..91228) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402184.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(91282..91854) product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419819.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(92032..99282) product DUF11 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952003.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 99426..100541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 100612..101019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964252.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 101124..101387 product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966918.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 101396..103831 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948919.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 103846..104058 product copper ion binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461873.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(104067..105251) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948943.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(105317..106192) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453971.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 106314..107243 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948815.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 107431..107835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(107876..108799) product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964372.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene rocF CDS complement(108741..108893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 109118..109963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 110265..111686 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047909.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene cls CDS 111758..112411 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048397.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 112572..114152 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250383.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 114375..115031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(115048..115194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 115193..116743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 116818..117498 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271956.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(117514..119376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(119389..120213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584075.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS 120325..121347 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359384.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 121406..122524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 122615..122779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 122884..123993 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene ugpC CDS 124007..124933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 124939..125955 product maltose operon transcriptional repressor MalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219042.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene malR CDS 125994..126698 product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966508.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(126738..127910) product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(127913..128272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 128384..128722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966502.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 tRNA 128818..128893 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 tRNA 129030..129105 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 CDS complement(129132..129629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21220 tRNA 129798..129873 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 CDS complement(129942..131315) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966501.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene murC CDS 131528..132340 product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966500.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene purR CDS 132429..132710 product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966499.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene spoVG CDS 132864..134237 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048387.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene glmU CDS 134254..135207 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359343.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(135233..136579) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945505.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene gdhA CDS 136789..137466 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 137471..138877 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048386.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 138952..140079 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048385.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 140361..140930 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene pth CDS 140942..144445 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048383.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene mfd CDS 144491..145489 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048382.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 145593..145745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 145876..146430 product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966490.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene spoVT CDS 146492..148036 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966489.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 148043..149476 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099544.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene mazG CDS 149597..149872 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966487.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 149942..150199 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966486.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 150352..150633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 150651..151073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS 151077..151400 product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359350.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 151469..151870 product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359471.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 tRNA 152099..152188 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 tRNA 152196..152272 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 tRNA 152277..152353 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 CDS 152609..154987 product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966481.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene spoIIE CDS 155090..156466 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966480.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene tilS CDS 156459..157001 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416006.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene hpt CDS 157070..158887 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene ftsH CDS 158899..159300 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS 159461..159820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 159839..160171 product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902663.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS 160186..161334 product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 161431..162207 product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359441.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 162212..163174 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene dusB CDS 163261..163785 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391695.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 163796..164725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391696.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 164932..165414 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene greA CDS 165431..166951 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048371.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene lysS tRNA 167104..167178 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00700 rRNA 167916..169432 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 rRNA 169532..172438 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 rRNA 172470..172579 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 tRNA 172595..172669 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00710 sequence38 source 1..1140 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(21..96) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00720 tRNA complement(107..184) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00730 tRNA complement(189..265) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00740 tRNA complement(272..345) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00750 tRNA complement(350..424) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00760 rRNA complement(433..541) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00100 sequence39 source 1..1522 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence40 source 1..6440 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 227..2882 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3146..5834 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA complement(5836..5911) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00770 sequence41 source 1..3401 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 77..517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21590 note possible pseudo, frameshifted assembly_gap 573..2902 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3155..3343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 note possible pseudo, frameshifted sequence42 source 1..1090 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence43 source 1..5820 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..506 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000654739.1:aminopeptidase locus_tag LOCUS_21610 assembly_gap 537..2620 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3215..5638 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence44 source 1..1098 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(456..532) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00780 tRNA complement(538..613) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00790 CDS complement(712..957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21620 sequence45 source 1..1531 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(176..1357) product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770310.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 sequence46 source 1..15605 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 263..2773 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3282..5813 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5873..6121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(6183..6377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21650 assembly_gap 6448..9064 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9103..9255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21660 assembly_gap 9693..11904 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 12509..15009 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15270..15581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 sequence47 source 1..8130 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 978..2275 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA 2313..2388 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00800 rRNA 2412..2521 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00110 CDS 2729..3241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 3398..4570 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974707.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS 4581..5969 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861407.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS 5988..7424 product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 sequence48 source 1..3661 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 657..3129 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3169..3345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21720 sequence49 source 1..6317 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 299..3014 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3221..5778 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5819..6001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21730 note possible pseudo, frameshifted sequence50 source 1..9506 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 570..2977 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3170..3610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 note possible pseudo, frameshifted CDS 3702..3839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21750 note possible pseudo, frameshifted assembly_gap 3895..6308 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6519..6776 product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359336.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 assembly_gap 6941..8614 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence51 source 1..3686 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(71..346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21770 note possible pseudo, frameshifted assembly_gap 430..3069 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence52 source 1..6791 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 533..3287 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3474..6220 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence53 source 1..3826 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 935..3222 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence54 source 1..205630 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(750..1694) product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545618.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(1706..2836) product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582673.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(2856..3152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(3172..3477) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546290.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(3470..4048) product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(4317..4589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(4630..4899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(5055..7154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(7380..8282) product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 8427..9422 product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356366.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(9535..10038) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048158.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(10069..10563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(11402..11995) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963454.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene recR CDS complement(12008..12346) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(12429..12851) product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868117.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(12864..13262) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544930.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(13271..14875) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003394606.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene dnaX tRNA complement(15227..15320) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00810 CDS complement(15416..15718) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306389.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS 15886..17322 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387186.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(17345..18055) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS 18225..19406 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879038.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(19459..20688) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583127.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 gene trxB CDS complement(20733..21266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(21301..21528) product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496691.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(21544..22215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 22429..23319 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949120.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(23316..23534) product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391985.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 23605..24171 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392954.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(24222..26630) product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964971.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(26642..28069) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene glgA CDS complement(28084..29199) product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene glgD CDS complement(29214..30359) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(30371..32272) product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100880.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene glgB CDS complement(32533..33879) product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(33896..35233) product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036277.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(35254..38472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582531.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(38565..39416) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(39429..40322) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083605764.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(40399..41751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(41871..42878) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964012.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(43071..43919) product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902122.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(43930..45603) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 tRNA complement(45791..45880) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00820 CDS 46013..46321 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389622.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 46325..46942 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082842.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 46947..47735 product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082840.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene fetB CDS complement(47730..48176) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027934.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene tadA CDS 48302..48703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(48712..49089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(49105..49494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(49599..50387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(50567..51775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(52081..54000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(54069..55121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(55134..55280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(55267..57987) product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117924.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(58000..60210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(60191..61171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(61184..61747) product DUF3780 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117920.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(61747..64854) product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117919.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 tRNA complement(65134..65210) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00830 CDS complement(65277..65450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 65656..67038 product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(67131..67871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(67995..68207) product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363259.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 68432..69523 product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393239.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(69539..70873) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene mgtE CDS complement(71309..72946) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948187.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(73275..74183) product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(74177..75268) product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948815.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(75316..77241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(77252..78490) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948915.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(78487..80067) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861073.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(80045..81088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476120.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 81328..81612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 81767..83413 product PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705542.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 83416..84201 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771957.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 84310..85992 product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415176.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene malL CDS complement(86614..86799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 note possible pseudo, internal stop codon, frameshifted CDS complement(87111..87338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS complement(87793..87969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 88321..88689 product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966283.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 88701..89066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966282.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 89078..89338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(89348..89833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(89847..90461) product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(90391..91113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(91400..91738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22630 repeat_region 91987..97320 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttaatccctttctagggaaatagaattctaac CDS complement(97553..97840) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256456.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene cas2 CDS complement(97852..98826) product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926120.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene cas1 CDS complement(98828..99391) product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118772.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene cas4 CDS complement(99397..100182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(100182..102176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(102124..102828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(102834..103841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(103834..106647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(106751..107686) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900902.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(107716..108084) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230640.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene mgsA CDS complement(108135..108647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 108789..109889 product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659266.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(109940..110863) product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(110926..111513) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963654.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(111670..112938) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709916.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(113127..113939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(113953..115635) product alpha-glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910456.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(115687..116586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(116728..117615) product maltosaccharide ABC transporter permease MalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022608.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene malD CDS complement(117615..118880) product maltosaccharide ABC transporter permease MalC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194993.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene malC CDS complement(118958..120223) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709916.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS 120503..121909 product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392194.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 121902..122759 product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861057.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 122773..123405 product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987042.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 123405..123740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 123737..124072 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965797.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(124098..125513) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771063.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(125519..126664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(126676..128169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(128171..130309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942102.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 130441..131331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 131433..132017 product rubrerythrin RubY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965865.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene rubY CDS 132159..133715 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233752.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 133923..134117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 134305..135483 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544926.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 135756..137369 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022649.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene ppcA CDS complement(137409..138689) product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641774.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(138709..139824) product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 140115..141434 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948273.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(141471..143153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948484.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(143271..144800) product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436996.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(144821..145996) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861662.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(146170..146484) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870220.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(146997..147347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23070 assembly_gap 147454..148023 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(148917..149870) product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949075.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(149883..150356) product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358709.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(150539..151780) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897793.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 assembly_gap 152691..152973 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(153567..154211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(154217..155848) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660927.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(155894..156958) product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 assembly_gap 157719..157962 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(158709..159557) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356230.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS complement(159685..160161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451211.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(160177..161451) product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(161593..162393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948399.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 162572..164584 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986325.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 assembly_gap 165185..165587 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(166096..166818) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(166920..169217) product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818738.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(169322..169516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(169534..169689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 169913..170521 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 170608..171369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(171442..172551) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890698.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 tRNA complement(172704..172780) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00840 tRNA complement(172826..172917) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00850 tRNA complement(172944..173034) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00860 CDS 173208..173486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 assembly_gap 173549..173894 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 173936..174178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(174503..175786) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947906.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 gene serS CDS complement(176101..177009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 177071..177256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(177288..178388) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(178451..178963) product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963338.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(178973..179743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS complement(179755..181170) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015261871.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS complement(181148..181831) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(181904..182383) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963337.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 tRNA complement(182477..182552) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00870 tRNA complement(182563..182639) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00880 rRNA complement(182648..182757) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00120 assembly_gap 183062..183597 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 185001..186160 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(186809..187246) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986971.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS complement(187364..188521) product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048339.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene iadA CDS complement(188569..190116) product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016083.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene yfcC CDS complement(190277..192223) product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439994.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 tRNA complement(192324..192397) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00890 tRNA complement(192402..192476) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00900 assembly_gap 192859..193955 estimated_length known gap_type within scaffold linkage_evidence paired-ends rRNA complement(193956..195765) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 56 percent of the 23S ribosomal RNA locus_tag LOCUS_r00130 assembly_gap 195985..196716 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 197370..198683 product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289416.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 tRNA complement(198778..198853) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00910 tRNA complement(198862..198937) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00920 tRNA complement(198943..199026) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00930 tRNA complement(199033..199108) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00940 tRNA complement(199137..199212) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00950 tRNA complement(199216..199291) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00960 tRNA complement(199302..199379) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00970 tRNA complement(199384..199460) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00980 tRNA complement(199467..199540) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00990 tRNA complement(199545..199619) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01000 assembly_gap 199690..200859 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(201621..201866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 assembly_gap 201943..202866 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(203344..203841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 203964..204320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 204565..205053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23450 tRNA complement(205087..205161) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01010 tRNA complement(205173..205248) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01020 tRNA complement(205257..205332) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01030 tRNA complement(205338..205421) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01040 tRNA complement(205428..205503) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01050 tRNA complement(205532..205609) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01060 sequence55 source 1..1128 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 166..525 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965516.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 538..732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(755..910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23480 sequence56 source 1..8044 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(360..1724) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869134.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(1845..3209) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene murD CDS complement(3223..3795) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947917.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(3891..4115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(4146..4700) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947937.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(5053..7284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 rRNA complement(7666..7775) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00140 tRNA complement(7799..7874) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01070 tRNA complement(7881..7958) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01080