COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..653997 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 249..1184 product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416849.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene ppaC CDS complement(1230..1364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(1554..1739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(1742..1954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(2057..2926) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140423.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(3063..6476) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271582.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene metH CDS complement(6469..8322) product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245847.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(8670..9161) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233034.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 9261..10118 product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886474.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 11817..12776 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964021.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 12787..14439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(14484..14615) product DUF3941 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120851.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(14671..15531) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245785.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 15534..15746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 15736..16578 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245017.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 16591..17070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(17156..17515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(17519..17668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(17776..18588) product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YitU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233007.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene yitU CDS 18729..19508 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233006.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 19559..19867 product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232998.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 20008..21042 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245768.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene argC CDS 21055..22281 product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232989.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene argJ CDS 22292..23071 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232987.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene argB CDS 23068..24225 product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232985.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 24914..25954 product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232984.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 25947..29024 product carbamoyl phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232982.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 29024..29974 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232980.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene argF CDS complement(30247..31062) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434782.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 31205..31384 product YjzC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245356.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(31454..31639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 31841..32569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245223.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 32659..33516 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017650999.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 33631..34581 product transcriptional regulator Med inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245494.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene med CDS 34596..34781 product ComG operon transcriptional repressor ComZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224559.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene comZ CDS complement(34813..35070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 35237..36169 product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232971.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene fabH CDS 36206..37444 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244890.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene fabF CDS 37993..38778 product DUF2268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232967.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 38982..39968 product oligopeptide ABC transporter ATP-binding protein AppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232965.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene appD CDS 39965..40981 product oligopeptide ABC transporter ATP-binding protein AppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232964.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene appF CDS 41089..42738 product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 42913..43863 product oligopeptide ABC transporter permease AppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245828.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene appB CDS 43877..44794 product oligopeptide ABC transporter permease AppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232961.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene appC CDS 45017..45763 product YjbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003239298.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 45918..46403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(46449..47438) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245134.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene trpS CDS complement(47753..48112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 48529..50226 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823441.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 50374..51300 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534165.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 51300..52322 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722317.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 52341..53384 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722316.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 53388..54326 product oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245567.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene oppF CDS 54500..55702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(55743..55928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559971.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 56048..56626 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244921.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 56887..57282 product transcriptional regulator Spx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245483.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene spx CDS complement(57307..57981) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362607.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 58304..58972 product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245194.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene mecA CDS 59060..60583 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799204.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 60677..61852 product competence protein CoiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886479.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene coiA CDS 61920..62072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 62154..63971 product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003393.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene pepF CDS complement(64141..64317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244944.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(64702..65577) product protease adaptor protein SpxH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245184.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene spxH CDS complement(65574..65984) product group 2 truncated hemoglobin YjbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232928.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(66180..66818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(66833..67450) product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232924.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 67555..67938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232922.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 68017..68652 product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081482.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 68674..69468 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232918.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 69476..70366 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079106.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(70541..71293) product bis(5'-nucleosyl)-tetraphosphatase PrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872716.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene prpE CDS complement(71405..72580) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654702.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 72860..74224 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362548.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene mgtE CDS 74247..76100 product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232910.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 76359..77045 product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232909.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene tenA CDS 77042..77662 product thiazole tautomerase TenI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232908.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene tenI CDS 77646..78758 product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245044.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene thiO CDS 78755..78958 product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886482.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene thiS CDS 78962..79729 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886483.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene thiG CDS 79730..80746 product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065417.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene thiF CDS 80834..81607 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232896.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene fabI CDS 81778..82227 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615134.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 82255..82842 product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948952.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 82867..83316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 83395..83814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(83883..85364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 85590..86723 product spore coat protein CotSA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229028.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene cotSA CDS 86739..87848 product spore coat protein CotS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229031.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene cotS CDS 87853..88557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 88463..88699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(88681..89745) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229035.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(89811..90767) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229036.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(90764..92050) product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398478.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 92256..93341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(93362..94153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(94174..94449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 94602..94952 product DUF1360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899662.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(95045..95842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(95948..96661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 96874..97197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 97289..97432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 97475..97756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 97849..97983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 98125..98379 product sporulation-specific transcription regulator SopVIF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232870.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene spoVIF CDS complement(98417..100675) product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245380.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 100830..101057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 101073..101975 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081221.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(101972..102637) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233805.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(103233..103661) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543296.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(103662..104183) product YjcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232861.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(104257..104979) product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245358.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(105084..106139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869230.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 106296..107186 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392729.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 107467..108543 product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104713.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene ssuD CDS 108545..109798 product sugar-binding protein MsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262872.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene msmE CDS 109855..110733 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530308.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 110751..111560 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525205.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 111893..113017 product cystathionine gamma-synthase/O-acetylhomoserine thiolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232857.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene metI CDS 113004..114191 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244787.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene metC CDS 114252..115478 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704717.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 115559..115933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 116096..116758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(117056..117427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(117739..117939) product DUF1272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162789.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 118086..118505 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242890.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(118617..119558) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030277.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 119646..120167 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227595.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 120329..121606 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015207390.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 121615..122256 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948348.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 122256..123491 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888369.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 123514..123768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(123932..125161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 125330..125695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 125695..127260 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730355.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 127476..128867 product aminopeptidase YwaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242515.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene ywaD CDS complement(128926..130494) product YndJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244286.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(130481..131083) product DUF4166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002627.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(131094..131996) product DoxX-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823951.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 132092..132664 product phosphatase PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233157.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene phoE CDS 132740..133597 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963748.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(133676..134014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 134275..135123 product RsbT co-antagonist protein RsbRD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398754.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene rsbRD CDS 135230..135847 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905527.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(135920..137092) product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967159.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene ftsW CDS 137389..138978 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289110.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 139026..139775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 139775..140407 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963768.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 140456..140656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 140698..141852 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723329.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene rodA CDS 141868..142254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 142518..143168 product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966312.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene sigH CDS 143275..144063 product DUF4240 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449124.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 144173..145021 product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233597.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene catE CDS 145297..145797 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236338.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(146150..146638) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284980.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 146863..147882 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171504.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 148002..149126 product two-component sensor histidine kinase DesK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231271.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene desK CDS 149123..149722 product two-component system response regulator DesR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399356.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene desR CDS complement(150359..150844) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 150972..151784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 151806..152345 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167115.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 152543..154303 product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene yesM CDS 154320..155861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 155982..157334 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105221568.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 157511..158509 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228683.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 158524..159843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 159884..160984 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 161098..164100 product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene lacZ CDS 164243..164749 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351221.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 164746..164901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(165753..166508) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224329.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 166668..167900 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398495.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 167968..168504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(168528..169265) product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388708.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 169407..169928 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975339.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 169951..170730 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073567.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 170755..171678 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948544.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 171647..172474 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948543.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 172977..173540 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582541.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(173643..174410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 174613..174981 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227906.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 174985..175494 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244690.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 175463..176047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 176193..176660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 176657..179788 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185141306.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(179845..180186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 180355..181071 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532950.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 181216..182565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 182569..183612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 183797..184120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 184194..185657 product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207627.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(186032..186298) product YiaA/YiaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222348.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(186419..186811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 187166..187300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 187312..187707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 187711..188484 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967096.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 188608..189192 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727419.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(189177..189380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 189558..190409 product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243667.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 190569..191303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 191388..192899 product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802296.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 192912..194006 product GerAB/ArcD/ProY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809697.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 194003..195073 product spore germination protein GerYC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789226.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene gerYC CDS 195132..195749 product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966881.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(196261..197400) product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649088.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(197556..199784) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391529.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene katG CDS 200062..201045 product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 201107..201613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 201606..203570 product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957058.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 203914..204321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 tRNA 204432..204503 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 204650..205240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 205572..206918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 207259..207555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(207556..208551) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 208767..209768 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358408.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 209784..210305 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288258.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 210324..211619 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378953.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 211644..214043 product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817010.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 214048..215457 product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245001.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene uxaC CDS 215463..216545 product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391968.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene uxuA CDS 216523..217368 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964640.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(217433..217888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(218485..218913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 219158..220129 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 220145..221044 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357901.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 221096..222736 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357899.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 222834..224702 product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene yesM CDS 224677..226173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 226210..227223 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289537.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 227223..227786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 227887..228192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(228199..228516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(228631..228813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 229018..229830 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245334.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 230670..231755 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244794.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene proB CDS 231771..233018 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245312.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene proA CDS 233073..233498 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(233537..233878) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098871.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(233981..234340) product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229458.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 234515..235723 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229456.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 235820..236170 product DUF4181 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163262524.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(236237..236794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 236877..237206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 237391..237762 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886460.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene cueR CDS 237950..239251 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246022.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 239481..240227 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817566.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 240331..241398 product trifunctional transcriptional activator/DNA repair protein Ada/methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989338.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 241622..241825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 note possible pseudo, internal stop codon CDS 241853..242044 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229515.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 242155..242619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(242628..243221) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231827.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 243306..243857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245720.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 243959..244150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 244224..244391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 244647..245015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 245031..245312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 245320..247335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 247362..247832 product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403325.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(248163..248330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 249051..249782 product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167470.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene gntR CDS 249841..251187 product gluconate permease GntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131724.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene gntP CDS 251520..251867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 252224..253759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 253756..255147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 255305..256960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 257017..257982 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 258001..258885 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 258908..260614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 260772..261206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(261266..262201) product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917148.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 262319..262642 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277353.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(262761..263537) product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964207.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(263534..264664) product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437110.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(264866..265423) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245116.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 265532..266515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(266579..266932) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086910.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(267038..267628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 267785..269107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 269210..269926 product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965862.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 269939..270712 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278967.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 270734..271123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350140.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 271566..272054 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927090.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 272074..272583 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442621.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 272614..273030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(273076..274101) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697701.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 274250..274750 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168663.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(274813..274941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 275054..275851 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214342.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 275875..276873 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587042.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 276870..277535 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278485.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(277661..280831) product bifunctional P-450/NADPH--P450 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359058.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene cypD CDS complement(280910..281485) product transcriptional regulator FatR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967878.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene fatR CDS 281974..282825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 282855..283391 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584342.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 283435..283914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 283920..284315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 284317..285033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144124.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 285076..285450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 285474..285752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(285875..286582) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175234.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 286668..287414 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477868.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(287446..287652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 287780..288157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(288260..288502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 288614..289237 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963888.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(289323..289931) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181746.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 290130..292553 product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209617549.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 292710..293339 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402586.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 293376..293660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(294351..295673) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209630.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(295670..297082) product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398865.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene glcD CDS complement(297182..298297) product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898619.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(298415..318712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 319090..322152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(322182..322340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 322491..323723 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003270289.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(324235..324648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(324663..326024) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246486.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 326076..326900 product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144264.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(326930..327778) product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245320.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(327793..328041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(328107..328736) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510847.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(328848..328994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(329077..329643) product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938438.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 329849..330532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 330554..331135 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092372.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene clpP CDS 331236..331703 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965852.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 331705..332265 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767065.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 332362..332895 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706006.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 333053..334735 product choice-of-anchor I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385247.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(334785..336326) product glycine betaine transporter OpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229220.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene opuD CDS 336848..337126 product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656239.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 337123..338553 product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104834.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene panF CDS 338690..339088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 339295..339849 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771200.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene ssuE CDS 339862..340020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 340117..341301 product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422278.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene ssuD CDS 341298..342068 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886450.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 342082..342927 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432128.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 342939..344273 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727463.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 344300..345310 product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276931.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 345373..345660 product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948127.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(346068..346976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(346977..347489) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966541.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 347801..348637 product RsbT co-antagonist RsbRC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231216.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene rsbRC CDS complement(348664..349062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 349214..350218 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594067.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 350215..350838 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966054.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(350872..351162) product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843022.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(351387..351836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(351889..352095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 352241..352561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 352589..352816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 352833..353402 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399156.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(353409..354455) product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782251.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 354664..355431 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889459.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(355726..356556) product RsbT co-antagonist protein RsbRD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398754.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene rsbRD CDS complement(356661..357728) product DUF3900 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233793.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 358081..359298 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258522.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(359368..360252) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948696.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 360387..361469 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385769.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 361634..361954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 361944..363641 product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225134.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 363751..364293 product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228315.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 364431..364958 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355429.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 364939..366273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 367190..368338 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887567.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 368357..369622 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027008.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 369635..371254 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228698.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 371241..372113 product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030215.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 372115..372933 product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 372946..374100 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887567.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 374114..375295 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459846.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 375296..375685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 375691..376473 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 376489..376908 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061570.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 377340..378164 product D-aminopeptidase DppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245814.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene dppA CDS 378178..379110 product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245446.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene dppB CDS 379110..380063 product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245702.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene dppC CDS 380068..381063 product dipeptide ABC transporter ATP-binding subunit DppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232615.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene dppD CDS 381096..382712 product dipeptide ABC transporter substrate-binding protein DppE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886494.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene dppE CDS 382771..383700 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967072.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 383703..384809 product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244980.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene ykfB CDS 384806..385726 product gamma-D-glutamyl-L-lysine dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245577.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene eepC CDS 385729..386736 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967074.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 386733..387518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(388018..389268) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937253.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 389453..390310 product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245320.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 390441..390899 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242940.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 390965..391927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 391987..393747 product alpha-glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910456.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 393863..394897 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966936.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 395051..398128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 398281..399675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 400038..401468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(401532..402176) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156575269.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 402330..403283 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614096.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 403280..404800 product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129141.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 404920..405849 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686827.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 405949..407457 product multidrug efflux MFS transporter Bmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246377.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene bmr3 CDS 407742..409358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(409406..410677) product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668841.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(410925..411542) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246558.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(411720..412463) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616938.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(412478..413143) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461612.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(413176..413967) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823741.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(414126..414629) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399390.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(414771..415004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(415084..415506) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234396.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(415587..416015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 416231..417415 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243413.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene nagA CDS 417412..418167 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228092.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene nagB CDS 418164..418892 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014894892.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 418889..419797 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642887.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene murQ CDS 419810..421183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(421211..422026) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932922.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 422372..422569 product cold shock-like protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224086.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene cspB CDS complement(423129..424664) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199961.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 425081..426949 product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150916.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene abc-f CDS complement(427012..427368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435818.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(427433..428236) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856990.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(428220..429197) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811777.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(429210..430184) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439336.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 430369..431778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 431905..432285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 432421..433665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(433738..434679) product serine protease Isp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232562.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene isp CDS 434869..435609 product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888398.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(436193..436660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(436745..438193) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588856.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene aldA CDS 438371..438949 product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241242.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 438965..439630 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246379.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 439969..440877 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246253.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene murQ CDS 440890..441747 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234966.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 441772..443142 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234968.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 443139..444149 product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580599.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 444178..445530 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234970.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene amiE CDS 445551..447470 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234975.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene nagZ CDS 447494..448735 product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 449281..449478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 449471..449989 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966472.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 450048..450185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(450230..450859) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261421.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 451093..451953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(451984..452805) product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244958.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 452934..453626 product two-component system response regulator YkoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232551.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene ykoG CDS 453623..454981 product two-component system sensor histidine kinase YkoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245526.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene ykoH CDS 455033..455722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 455868..456413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(456908..458428) product flotillin lipid rafts scaffold protein FloT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228960.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene floT CDS complement(458439..458978) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243808.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 459115..460197 product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704606.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 460320..461588 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704607.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 461601..462734 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242551.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 462936..463661 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(463695..465020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(465013..465534) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948534.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(465655..465804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 465918..467006 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 467064..468086 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 468106..468864 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 468879..469847 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989909.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 470005..471000 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210384.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 471079..471402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 471443..471835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(471919..472593) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243990.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(472823..472981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(473037..473486) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133920.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 473604..474017 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359781.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(474058..475185) product subtilisin AprE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233171.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene aprE CDS 475468..476721 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187945.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 476741..476896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 477780..479498 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228375.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(479523..479852) product MerR family transcriptional regulator TnrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232541.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene tnrA CDS 480044..480199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(480191..480451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 480603..480794 product stress response protein YkoL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245766.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene ykoL CDS 481014..481604 product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232376.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 481692..482150 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232536.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(482179..483009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(483103..484950) product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886495.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 485025..485552 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259582.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene gmhB CDS complement(485572..486429) product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886496.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 486571..488070 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(488103..488876) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104281.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 489067..489687 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967095.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 489817..490620 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967096.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 490982..491728 product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245855.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene sigI CDS 491725..492912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(493011..493217) product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124489.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(493337..494011) product transcriptional regulator HtpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245220.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene htpK CDS 494179..495057 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245353.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene htpX CDS 495250..496596 product Ktr system potassium transporter KtrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244672.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene ktrD CDS 496718..498733 product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246590.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene pbpC CDS 498897..500459 product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265568.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(500510..500845) product DUF3905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726024.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 500921..501058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 501146..501322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 501319..501474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(501514..503280) product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860933.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(503397..504443) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245573.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 504739..506928 product sporulation two-component system sensor histidine kinase KinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232504.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene kinE CDS 506941..507435 product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232502.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene ogt CDS 507697..508527 product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661957.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene kynA CDS 509061..509606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 509617..510090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(510115..511164) product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232498.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene mtnA CDS complement(511177..512361) product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244973.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene mtnK CDS complement(512747..513535) product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204714.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 513637..514827 product methionine-glutamine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244774.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene mtnE CDS 515069..516307 product 2,3-diketo-5-methylthiopentyl-1-phosphate enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245108.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene mtnW CDS 516304..516966 product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245748.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene mtnX CDS 516963..517595 product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244782.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 517621..518154 product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244952.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene mtnD CDS 518281..518934 product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264206.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene cbpA CDS 519188..519436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(519486..520220) product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082259.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 520465..521412 product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224067.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(521486..522994) product sporulation kinase KinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886497.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene kinD CDS 523303..523755 product MarR family transcriptional regulator MhqR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232475.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene mhqR CDS complement(524446..525204) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232473.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene motB CDS complement(525197..525988) product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244739.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene motA CDS complement(525981..526178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 526157..527851 product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008568.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 528038..528679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(528699..530768) product ATP-dependent protease ATP-binding subunit ClpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967104.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene clpE CDS 531031..532077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244712.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 532335..533678 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966903.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 533768..533890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(533932..535227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 535504..536166 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711596.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene queC CDS 536163..536600 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245665.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene queD CDS 536615..537325 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232460.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene queE CDS 537345..537842 product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218613.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene queF CDS 538015..538215 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719639.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(538326..538625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(538870..539544) product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399300.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 539649..540449 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596582.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 540583..541380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(541407..541925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(542192..542380) product YkvS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232446.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 542566..543432 product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892675.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 543506..544156 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902568.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 544227..544421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356683.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(544454..544972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 545317..545904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 546016..547500 product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802302.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 547526..548632 product GerAB/ArcD/ProY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809697.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 548619..549692 product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832881.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 549756..551084 product sporulation protein YkvU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245552.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene ykvU CDS 551410..552603 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096609.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 552683..553045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328788.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(553286..553840) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181848.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 554164..556068 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083788.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(556110..556307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(556410..557732) product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 557984..560128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(560173..560508) product DUF3243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242951.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(560603..561718) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404177.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(561801..563321) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160471.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 563489..564574 product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582734.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 564571..565107 product glycosyl-4,4'-diaponeurosporenoate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001805835.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene crtO CDS 565144..566247 product di/tri-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244662.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene papB CDS 566329..567144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(567179..568204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 568360..570072 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228375.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 570253..571485 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940045.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 571463..573118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 573124..574110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 574107..574760 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229468.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 574770..575351 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022395.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 575363..576784 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938336.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(576796..577872) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941964.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(578140..578595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 578783..579001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 579038..579253 product DUF2922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197602.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 579387..579527 product YvrJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393335.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 579566..580429 product manganese transporter MneS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233995.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene mneS CDS 580558..580809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(581309..581440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 581673..584069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(584100..584897) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594228.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(585009..585434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 585572..585955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 586039..586881 product ptsGHI operon transcription antiterminator GlcT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967114.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene glcT CDS 587105..589204 product PTS glucose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244661.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene ptsG CDS 589304..589570 product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154654.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 589570..591285 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218638.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene ptsP CDS 591403..592941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 592979..593221 product splAB operon transcriptional regulator SplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218644.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene splA CDS 593367..594392 product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245173.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene splB CDS 594501..595286 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067764.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 595346..595819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 595816..596316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 596350..597225 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245029.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 597246..597662 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103516.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(597708..598463) product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244693.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 598850..600976 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245075.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 601096..601767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 601811..601984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 602276..604087 product sporulation kinase KinA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245779.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene kinA CDS complement(604131..605279) product aminotransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232415.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 605435..606406 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002003436.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene corA CDS 606510..607064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(607110..607502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(607635..607832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(607964..608428) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905064.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(608418..608975) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062063.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 609195..610454 product sporulation sensor histidine kinase KinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002002352.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene kinB CDS complement(610935..612218) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986298.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 612473..613792 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943876.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 613891..614793 product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967126.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene cheV CDS complement(614854..615315) product YkyB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232406.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(615398..616432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 616522..616656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(617046..618335) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245267.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(618425..618919) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886500.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 619109..620635 product Ppx/GppA family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002198132.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 620792..622903 product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421678.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 623072..625171 product GGDEF domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664304.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(625173..625985) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232400.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 626184..626948 product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001987267.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene fadH CDS 627076..628296 product EAL-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232391.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 628353..628592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 628778..629437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 629535..630431 product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227725.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(630478..630714) product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717875.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(630734..631696) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754999.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 631874..632110 product DUF1797 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218671.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 632125..632274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 632579..633097 product ribonuclease H-like YkuK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232389.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 633171..633365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 633563..634006 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218674.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 634077..635600 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(635621..635983) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800776.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(635995..636726) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531213.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 636853..637725 product transcriptional regulator CcpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232387.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene ccpC CDS 637913..638623 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218680.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene dapD CDS 638694..639833 product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301163.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 639877..640119 product YkuS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101022.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(640164..641006) product small-conductance mechanosensitive channel protein MscT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244994.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene mscT CDS 641338..641880 product biofilm-specific peroxidase AhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245371.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene ahpA CDS 641948..642403 product thiol-disulfide oxidoreductase YkuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245810.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene ykuV CDS 642864..643064 product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193054.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene cspD CDS 643610..644227 product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070938.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(644272..644562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 644817..645707 product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972565.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 645724..647085 product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082125.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene gltA CDS 647238..648518 product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene preA CDS 648534..649952 product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228420.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene hydA CDS 650003..651478 product NCS1 family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339102.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 651492..651701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 651829..653445 product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027970.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 sequence02 source 1..1753275 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 159..2054 product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353280.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 2175..2336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 2681..3853 product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503517.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene yhbH CDS 3984..4481 product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338938.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 4619..6007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(6488..7051) product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138383.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(7172..8932) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010470.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(8929..9645) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283871.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(9708..9923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 10042..11448 product spore germination protein GerKA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246515.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene gerKA CDS 11445..12626 product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392972.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 12639..13760 product spore germination protein GerKB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234509.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene gerKB CDS 13753..13965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 14031..14456 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282829.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(14570..15307) product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722864.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 15564..16127 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002054718.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 16146..16490 product multidrug efflux SMR transporter subunit YkkC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232583.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene ykkC CDS 16490..16804 product multidrug efflux SMR transporter subunit YkkD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245695.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene ykkD CDS 16821..17654 product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424696.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene speE CDS complement(18145..18594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 18754..19581 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722772.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 19706..20716 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356351.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 20819..22051 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776454.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 22094..22960 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051829.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 22957..23778 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051830.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 23861..24583 product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 25073..25588 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989708.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 25769..26215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 26305..26595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 26662..26931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 27035..27451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(27541..27702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 27881..28285 product DUF4279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323212.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 28454..29038 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009879470.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 29124..29612 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057909.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 29715..29912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(30076..30243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 30426..30869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 31135..31500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 31684..32196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 32388..32732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 32729..33187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(33289..33975) product two-component system response regulator DctR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234347.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene dctR CDS complement(33976..35553) product two-component system sensor histidine kinase DctS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234348.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene dctS CDS 35635..36687 product C4-dicarboxylate TRAP transporter substrate-binding protein DctB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234350.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene dctB CDS complement(37139..37312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 37547..38809 product C4-dicarboxylate transporter DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246626.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene dctP CDS 39013..39633 product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231449.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 39645..40643 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232642.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(40718..41497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(41497..42735) product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809015.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 42857..44365 product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460908.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 44425..45015 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683439.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(45053..45232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 45365..47287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(47939..49705) product glycoside hydrolase family 66 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108626.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(49766..52300) product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 52773..53171 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968618.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(53192..54031) product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246628.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 54175..55005 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604155.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 55150..55737 product sortase SrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244666.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene srtA CDS 55758..56177 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021908.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(56220..57131) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448370.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 57288..57689 product YhcU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233401.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(57738..58202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(58204..58641) product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532258.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 58823..59485 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245030.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 59548..61092 product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245514.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 61501..62061 product glycerol uptake operon antiterminator GlpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233388.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene glpP CDS 62225..63040 product glycerol uptake facilitator protein GlpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233386.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene glpF CDS 63065..64555 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759995.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene glpK CDS 64703..66373 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233382.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene glpD CDS 66605..68335 product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244986.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene pgcA CDS 69025..70146 product two-component system sensor histidine kinase CasK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170871709.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene casK CDS 70160..70801 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694643.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 70816..71343 product FMN-dependent NADPH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244703.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene yhdA CDS complement(71752..72003) product YhdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233373.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 72185..72889 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550961.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 72996..74348 product acyclic terpene utilization AtuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124270.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 74345..74656 product DUF4387 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817378.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 74668..75564 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132865.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene rbsK CDS 75557..76456 product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene rmgP CDS 76459..77337 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286008.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 77363..78820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 79251..80714 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218124.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 80733..82097 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850962.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 82210..82770 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242928.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(82843..83241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(83254..83697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(83722..83964) product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234151.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(83977..84345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(84449..84793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 84987..85580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 85577..86125 product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497633.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 86349..88103 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967136.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 88112..89932 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232362.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 90060..90608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 90746..91453 product toxin SDP protection protein YknW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232360.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene yknW CDS 91450..92574 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244902.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 92571..93257 product ABC transporter ATP-binding protein YknY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232356.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene yknY CDS 93254..94447 product sporulation-delaying-protein transporter subunit SkiZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232354.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene skiZ CDS 94729..95352 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662215.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(95367..96005) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181585.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 96209..96760 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232348.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene lepB CDS 96830..97753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 97810..98172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(98199..98459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232345.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 98622..100241 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232344.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(100298..101212) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044939.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(101332..102561) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232341.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 102724..103890 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218394.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 103890..104762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 105044..106804 product ABC-F type ribosomal protection protein VmlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234144.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene vmlR CDS complement(106846..107685) product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488993.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(107965..108972) product cell shape-determining protein MreBH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245743.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene mreBH CDS 109225..109638 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244690.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 109809..110264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253253.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 110350..111204 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245146.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 111314..111976 product Ktr system potassium transporter KtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222311.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene ktrC CDS 112609..114330 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245362.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene ade CDS complement(114534..114749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(114756..116423) product ribonuclease J1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245660.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene rnjA CDS complement(116428..116637) product RNA polymerase subunit omega 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222303.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene rnpZA CDS 116851..117045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 117069..117839 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998273.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(117885..118439) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245474.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene def CDS complement(118585..118713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 118943..119620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 120084..121199 product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222294.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene pdhA CDS 121203..122180 product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232313.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene pdhB CDS 122337..123707 product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232311.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene pdhC CDS 123712..125124 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232309.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene lpdA CDS complement(125194..125580) product peptidoglycan-associated lipoprotein Slp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245672.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene slp CDS 126234..126782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 127087..128166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 128163..130307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 130279..130752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(131906..133444) product glycine betaine transporter OpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230127.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene opuD CDS 133562..134395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(134429..134827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 134983..135282 product DUF3055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181837.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 135654..135803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(136235..137707) product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244780.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene speA CDS 137954..139180 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089998.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 139192..139968 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889459.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 139981..141156 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 141156..141908 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 141945..143549 product long-chain-fatty-acid--CoA ligase LcfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399166.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene lcfA CDS 143622..144185 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040397.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 144264..145148 product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460375.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 145145..145921 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445567.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 145933..146340 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 146364..147419 product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762579.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 147422..148165 product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 148182..148946 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene fabG CDS 148964..149737 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 149742..150728 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229986.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 150903..151769 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886926.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 151766..152746 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886927.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 152746..153525 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886928.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 153503..154210 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022994065.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 154296..155471 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480285.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 155766..157439 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879007.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 157446..158447 product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887575.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 158831..159787 product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925404.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene fabK CDS 159814..160083 product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456560.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(160154..160795) product YktB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232300.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 161050..161238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250168.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 161412..162203 product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232297.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene suhB CDS 162203..162658 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232296.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(162720..162905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 163045..164889 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232278.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene typA CDS 164926..165252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 165249..165530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258151.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(165540..165962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(165962..166162) product YlaI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001995040.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 166339..166794 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024581.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(166822..167436) product YhcN/YlaJ family sporulation lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232269.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 167607..168935 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358083.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(168994..169482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289792.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 169617..170546 product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245206.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene glsA CDS 170659..170940 product YlaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245286.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 171204..172412 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967159.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene ftsW CDS 172482..175925 product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244778.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene pyc CDS 176056..177480 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989524.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(177508..178449) product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188730.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene ctaA CDS 178913..179830 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232250.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene cyoE CDS 179930..181009 product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232248.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene coxB CDS 181044..182915 product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232245.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene ctaD CDS 182915..183538 product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232244.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene ctaE CDS 183543..183872 product cytochrome c oxidase subunit IVB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232242.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene ctaF CDS 184031..184936 product cytochrome c oxidase assembly factor CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244967.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene ctaG CDS 184995..185456 product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830117.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 185602..186111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(187203..188261) product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081388.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene ytvI CDS complement(188433..188789) product YugN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232238.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 188986..189414 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199022.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 189649..190656 product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245434.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(190849..191331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 191503..191898 product YlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232233.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 191914..192153 product YlbE-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232231.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 192257..192673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 192744..193193 product regulatory iron-sulfur-containing complex subunit RicF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221370.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene ricF CDS complement(193203..193538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 193634..193906 product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967171.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(193960..194340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616010.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 194722..195291 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266972.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene rsmD CDS 195293..195775 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245283.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene coaD CDS complement(195822..197036) product dipicolinic acid transporter SpoVV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245492.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene spoVV CDS 197211..198017 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662590.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 198001..199023 product protease DdcP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245451.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene ddcP CDS complement(199106..200335) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244707.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 200631..200867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 200921..201442 product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872145.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 201515..201688 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984764.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene rpmF CDS 201812..202594 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231526.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 202682..203290 product sporulation specific transcriptional regulator GerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232210.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene gerR CDS complement(203326..203805) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244940.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 204001..205335 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231523.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 205412..205627 product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001987345.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 205645..207186 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886744.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 207328..208206 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232206.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 208203..208592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 208682..210307 product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245571.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene bshC CDS 210386..210862 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221402.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene mraZ CDS 210947..211879 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245724.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene rsmH CDS 211909..212274 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232200.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene ftsL CDS 212277..214478 product penicillin-binding protein 2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968930.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene pbpB CDS 214601..216544 product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245048.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 216808..218277 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245326.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 218368..219342 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene mraY CDS 219344..220693 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232189.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene murD CDS 220741..221841 product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244810.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene spoVE CDS 222076..222984 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene murB CDS 223130..223969 product cell division protein DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232178.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene divIB CDS 223947..224657 product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245024.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 224670..225389 product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967184.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 225389..225751 product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238683.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 225969..227264 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967186.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene ftsA CDS 227309..228466 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232167.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene ftsZ CDS complement(228645..228827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 228978..233279 product bacillopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245629.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 233652..234581 product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232163.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene spoIIGA CDS 234816..235535 product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene sigE CDS 235677..236456 product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967190.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene sigG CDS 236547..236810 product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232153.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 236898..237737 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967191.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene pgeF CDS 237734..238402 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245324.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 238424..238864 product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244791.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene sepF CDS 238871..239134 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450918.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 239220..239990 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029719.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 240087..240599 product septum site-determining protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221468.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene divIVA CDS 240943..243714 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455951.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene ileS2 CDS 244255..244626 product sporulation-related RNA polymerase-binding protein YlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245479.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene ylyA CDS 244707..245189 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245047.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene lspA CDS 245170..246084 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245307.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 246239..246817 product bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232127.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene pyrR CDS 246957..248264 product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435928.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene uraA CDS 248411..249328 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245123.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 249312..250598 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245035.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 250595..251695 product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232115.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 251680..254892 product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232113.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene carB CDS 254889..255674 product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983358.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene pyrK CDS 255668..256603 product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245610.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 256572..257291 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083500.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene pyrF CDS 257288..257920 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711440.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene pyrE CDS complement(257956..258216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 258534..258701 product YezD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116158.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 258807..259508 product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232103.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 259521..260585 product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232101.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene cysP CDS 260628..261767 product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108789.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene sat CDS 261781..262377 product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380502.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene cysC CDS 262491..263264 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521268.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene cobA CDS 263266..264051 product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232093.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene sirB CDS 264032..264595 product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456704.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 264819..265094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 265467..265820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(265865..267568) product tRNA modification protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886504.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene rqcH CDS 267777..270398 product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232087.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 270496..271371 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564118.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 271445..271708 product extracellular matrix/biofilm regulator RemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154355.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene remA CDS 271723..272334 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232083.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene gmk CDS 272340..272537 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221520.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene rpoZ CDS 272639..273841 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911730.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene coaBC CDS 273845..276262 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene priA CDS 276332..276814 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279455.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene def CDS 276811..277776 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232070.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene fmt CDS 277763..279106 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249665.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene rsmB CDS 279109..280200 product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232066.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene rlmN CDS 280205..280966 product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene prpC CDS 280960..282936 product serine/threonine protein kinase PrkC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232062.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene prkC CDS 282963..283847 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113935.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene rsgA CDS 283850..284497 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene rpe CDS 284570..285208 product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245470.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(285493..285681) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221548.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene rpmB CDS 285961..286323 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232054.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 286341..288008 product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245033.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 288174..288836 product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232050.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene sdaAB CDS 288862..289749 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232049.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene sdaAA CDS 289736..291790 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006884.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene recG CDS 291898..292497 product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232044.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene fapR CDS 292481..293473 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684110.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene plsX CDS 293494..294441 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245314.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene fabD CDS 294438..295178 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene fabG CDS 295271..295504 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154310.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene acpP CDS 295594..296325 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232030.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene rncS CDS 296472..300038 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232028.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene smc CDS 300054..301043 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232026.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene ftsY CDS 301718..302050 product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238590.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 302063..303406 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863460.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene ffh CDS 303501..303773 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220815.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene rpsP CDS 303785..304015 product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728421.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 304099..304479 product YlqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232015.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 304490..305014 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232013.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene rimM CDS 305011..305739 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967234.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene trmD CDS 305896..306240 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220825.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene rplS CDS 306385..306918 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711857.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene lepB CDS 306941..307813 product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene ylqF CDS 308068..308853 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174721.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene rnhB CDS 309069..310229 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020785.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene sucC CDS 310248..311150 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238566.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene sucD CDS 311290..312183 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245871.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene dprA CDS 312402..314477 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245599.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene topA CDS 314531..315835 product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244725.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene trmFO CDS 315902..316810 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231988.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene xerC CDS 316862..317404 product ATP-dependent protease proteolytic subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526272.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene hslV CDS 317423..318823 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245556.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene hslU CDS 318851..319630 product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220850.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene codY CDS 319915..320307 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245656.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene flgB CDS 320307..320756 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245521.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene flgC CDS 320765..321058 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238544.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene fliE CDS 321126..322718 product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886506.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene fliF CDS 322733..323746 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231981.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene fliG CDS 323739..324467 product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870077.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 324473..325795 product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244825.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene fliI CDS 325792..326235 product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231977.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene fliJ CDS 326249..326818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 326846..328954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 328968..329402 product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231970.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene flgD CDS 329482..330408 product flagellar basal body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231968.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene flgG CDS 330495..330662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 330655..331086 product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231964.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene fliL CDS 331122..332120 product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220879.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene fliM CDS 332113..333213 product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231962.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene fliY CDS 333233..333595 product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244957.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene cheY CDS 333613..334236 product flagella biosynthesis regulatory protein FliZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231958.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene fliZ CDS 334233..334898 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245692.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene fliP CDS 334913..335182 product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene fliQ CDS 335187..335960 product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245510.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene fliR CDS 335962..337044 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene flhB CDS 337087..339117 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene flhA CDS 339114..340184 product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231945.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene flhF CDS 340187..341050 product flagellum location/number ATPase FlhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886507.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene flhG CDS 341051..342097 product protein-glutamate O-methylesterase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245823.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene cheB CDS 342135..344099 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245734.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene cheA CDS 344120..344593 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231938.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene cheW CDS 344615..345109 product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244852.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene cheD CDS 345146..345913 product RNA polymerase sigma-28 factor SigD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220911.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene sigD CDS 345965..346408 product swarming motility protein SwrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967248.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene swrB CDS 346559..347257 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene rpsB CDS 347419..348300 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018578.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene tsf CDS 348474..349196 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220923.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene pyrH CDS 349196..349756 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene frr CDS 349650..349874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 349887..350660 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231925.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 350774..351922 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245155.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene dxr CDS 351938..353200 product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886508.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene rseP CDS 353260..354963 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814310.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene proS CDS 355093..359400 product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245843.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 359713..360186 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231915.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene rimP CDS 360256..361389 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene nusA CDS 361403..361678 product glucose-induced regulator RulR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967250.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene rulR CDS 361678..361980 product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220946.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 361999..364152 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231906.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene infB CDS 364149..364427 product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220950.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 364447..364803 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776437.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene rbfA CDS 364870..365781 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244678.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene truB CDS 365818..366768 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766706.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene ribF CDS 366893..367162 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229392.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene rpsO CDS 367337..369454 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231897.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene pnp CDS 369589..370548 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244721.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 370603..371841 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245717.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 371919..372176 product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231890.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 372332..373234 product dipicolinic acid synthetase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954724.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene dpaA CDS 373231..373830 product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244650.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene dpaB CDS 373969..375012 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244674.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene asd CDS 375084..376298 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245524.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene dapG CDS 376336..377211 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245816.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene dapA CDS 377367..379031 product ribonuclease J2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231875.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene rnjB CDS 379351..379524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 379800..380543 product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245712.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene tepA CDS 380540..380767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 380878..383232 product DNA translocase SpoIIIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245350.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene spoIIIE CDS 383563..384288 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245732.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 384385..385431 product guanosine ABC transporter substrate-binding protein NupN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228831.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene nupN CDS 385658..387187 product guanosine ABC transporter ATP-binding protein NupO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228830.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene nupO CDS 387184..388230 product guanosine ABC transporter permease NupP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243735.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene nupP CDS 388231..389190 product guanosine ABC transporter permease NupQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228827.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene nupQ CDS 389388..390668 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886510.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 390669..391955 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244823.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 392011..392724 product EF-P-5 aminopentanone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244676.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene efpI CDS 392805..393062 product DUF3243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245199.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 393225..394016 product DUF3388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574107.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 394038..394913 product cell shape determination protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886511.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene rodZ CDS 394989..395567 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244753.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene pgsA CDS 395589..396845 product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231847.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 397100..398137 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245789.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene recA CDS 398517..400079 product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221010.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene rny CDS 400199..400993 product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene ymdB CDS 401191..401451 product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154135.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene spoVS CDS 401540..402457 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688057.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 402648..404384 product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625418.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 404385..405251 product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190155.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 405469..406509 product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244880.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene tdh CDS 406531..407709 product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231837.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 407912..409441 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244831.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene miaB CDS 409452..409880 product regulatory iron-sulfur-containing complex subunit RicA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231834.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene ricA CDS 410357..410902 product outer spore coat protein CotE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231833.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene cotE CDS 411041..413635 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244841.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene mutS CDS 413652..415517 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245099.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene mutL CDS complement(415728..416702) product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206335.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene phaC CDS complement(416721..417053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 417346..417534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 417536..418003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 418060..418278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(418316..418795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244390.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 418930..419313 product YmaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231769.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 419428..420369 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene miaA CDS 420406..420630 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813896.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene hfq CDS 420857..421807 product stage V sporulation protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231746.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene spoVK CDS complement(421845..422447) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219999.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 422672..423955 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245432.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene hflX CDS 423948..425216 product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460286.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 425315..425719 product transcriptional repressor GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238341.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene glnR CDS 425787..427121 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231737.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene glnA CDS complement(427179..428621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387299.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(428717..429337) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene lexA CDS 429497..429808 product cell division suppressor protein YneA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231598.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene yneA CDS 429813..430469 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991469.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 430541..430771 product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231595.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 430943..432949 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245397.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene tkt CDS 433087..433533 product sporulation inhibitor of replication protein SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231591.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene sirA CDS 433619..433837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(433911..434087) product aspartyl-phosphate phosphatase YnzD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886518.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene ynzD CDS 434354..435061 product cytochrome c-type biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152676.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene ccdA CDS 435177..435536 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359271.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 435634..436113 product CcdC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231582.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(436147..436572) product DUF2621 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889373.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(436644..436838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(437025..437168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 437292..437438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(437415..437600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(437728..438129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(438914..439060) product small acid-soluble spore protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221237.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 439189..439452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146296.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(439486..439635) product small acid-soluble spore protein O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000518056.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene sspO CDS 439879..442605 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245728.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene acnA CDS 442752..443258 product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244797.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 443361..443492 product FbpB family small basic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244964.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 443559..443702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 443775..444005 product small acid-soluble spore protein Tlp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231568.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene tlp CDS 444105..444527 product YbgC/FadM family acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231566.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 444530..444850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231564.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(444844..445146) product HesB/YadR/YfhF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231562.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(445206..446333) product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887601.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(446433..447017) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231560.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene plsY CDS 447123..447536 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151390.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 448019..449983 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231552.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene parE CDS 449987..452410 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231550.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene parC CDS complement(452455..452574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(452601..452909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 453093..454502 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231542.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 454864..456195 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485341.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 456207..457220 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485881.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 457386..459113 product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933481.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene cydD CDS 459110..460822 product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485888.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene cydC CDS complement(460865..461854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 462063..462884 product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244958.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(463554..464507) product LAGLIDADG family homing endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165409.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(464864..465496) product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193598.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(465571..465918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(466313..466534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 note possible pseudo, frameshifted CDS complement(466665..467453) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246492.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(467547..468071) product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799620.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(468195..469472) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106376.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(469678..470082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(470034..470357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(470603..471361) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437766.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene cobS CDS complement(471358..471915) product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546718.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene cobU CDS complement(471909..472973) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016795.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(472975..473892) product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461545.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene cbiB CDS complement(473921..475231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(475248..476210) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968147.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(476272..477246) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243040.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(477273..478322) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258437.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene cobT CDS complement(478328..479797) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836536.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(479829..480377) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229235.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene cobO CDS complement(480361..480543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(480729..481415) product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217589597.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(481501..482751) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461637.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 482952..483224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 483335..483784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(484326..485279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 485377..486498 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228615.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(486561..487346) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732813.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(487508..488707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(488708..489847) product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379387.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(490314..490589) product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026117.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(490663..491916) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867334.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(492039..492413) product nucleotide excision repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048941.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(492492..492809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(492857..493438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 493544..493846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242704.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(493861..494022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(494141..495115) product PRK06851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147460.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(495305..496684) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839485.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(496681..497361) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781961.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(497512..498198) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723280.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(498200..499234) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722397.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(499382..499981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(500077..500445) product replication termination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220337.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene rtp CDS complement(500783..500929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(501107..501646) product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232799.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(501630..504596) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245240.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene fdhF CDS complement(504722..504955) product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232366.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene moaD CDS complement(504952..505422) product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531881.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene moaE CDS complement(505403..505933) product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513649.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene mobB CDS complement(505903..507183) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442200.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(507186..508187) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844143.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene moaA CDS complement(508203..508991) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802695.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene fdhD CDS complement(509094..509903) product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965890.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene speD CDS 510175..510372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 510441..511004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 511116..511301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(511547..513466) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948356.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 513946..514650 product 5-oxoprolinase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234420.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene pxpB CDS 514647..515651 product 5-oxoprolinase subunit PxpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234419.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene pxpC CDS 515656..516426 product 5-oxoprolinase subunit PpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234423.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene pxpA CDS 516445..517632 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234422.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(517670..518743) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807837.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(518862..520376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(520512..521099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11970 note possible pseudo, frameshifted CDS complement(521984..523192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(523229..524467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(524433..525419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 525565..526818 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022166.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(526871..527563) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080944.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(527576..528598) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022166.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(528612..529595) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022166.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 529730..530725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(530794..531777) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022166.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(531781..532719) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(532721..533797) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(533794..534906) product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 535140..536426 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(536472..537185) product lactate utilization protein LutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228309.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene lutC CDS complement(537166..538605) product lactate utilization iron-sulfur protein LutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228307.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene lutB CDS complement(538607..539329) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869148.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(539440..541218) product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811125.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(541450..542217) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(542263..543039) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393001.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(543094..545274) product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269180.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(545419..546882) product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143062.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(546886..548244) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085032097.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(548246..549547) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929187.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(549618..550316) product L-lactate utilization/bacilysin biosynthesis transcriptional regulator LutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968191.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene lutR CDS complement(550441..551460) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643768.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(552232..553317) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(553304..554221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(554249..555076) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(555089..556033) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(556090..557373) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286788.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(557573..558715) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730052.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(558792..559940) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(560095..561087) product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene mgrA CDS complement(561218..562465) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039560.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(562633..563301) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245627.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(563314..564198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 564359..564871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(564893..566002) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002157242.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(566242..566727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(566815..567519) product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245002.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(567537..567902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(567957..568394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(568391..569149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 569403..569606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 569662..570441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 570438..570701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 570775..571131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 571124..572914 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966836.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(573922..576261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(576387..578186) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528118.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(578205..579386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(579391..579711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(579866..580162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(580131..581090) product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389035.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(581176..581316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(581332..583080) product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(583449..584483) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene galE CDS complement(584558..585715) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968194.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(585669..586370) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228268.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(586363..586968) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243002.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(586973..588526) product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(588558..589760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(589766..590965) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107241.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(590974..592137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(592140..593174) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228264.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(593193..594386) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107241.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(594397..595020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(595033..595788) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203389.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(595825..596826) product biofilm exopolysaccharide biosynthesis protein EpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228259.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene epsG CDS complement(596906..597817) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905213.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(597819..598940) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(598951..600018) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908873.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(599981..601147) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242735.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(601208..603034) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071743885.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(603031..603204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(603424..604083) product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467944.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(604064..604804) product protein-tyrosine kinase activator TkmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227811.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene tkmA CDS 605190..605558 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578878.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(605598..605996) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034360.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(606001..606441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(606455..607630) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230129.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(607730..608125) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(608106..609308) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158673.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(609305..609796) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639884.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(609848..612061) product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195651.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(612265..613626) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966541.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 613839..615065 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243467.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 615195..616448 product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105815.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(616517..617122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 617287..617937 product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819982.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 618101..619594 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246610.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(619639..621903) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989783.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene metE CDS complement(622312..623091) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984753.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 623205..624458 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012262.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(624522..625388) product phosphatase YwpJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242946.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene ywpJ CDS complement(625385..626155) product transcriptional regulator GlcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244075.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene glcR CDS complement(626371..628155) product IucA/IucC family siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904090.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(628169..629476) product lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904089.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(629466..630017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(630014..631798) product petrobactin biosynthesis protein AsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679665.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene asbA CDS complement(631795..633291) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928963.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(633303..634655) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011319592.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(634642..634917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 635118..636764 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074555177.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(636806..637447) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090962.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene thiE CDS complement(637428..638255) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867389.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene thiD CDS complement(638252..639061) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056115.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene thiM CDS complement(639264..640382) product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890707.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(640409..641578) product spore germination protein GerKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246578.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene gerKC CDS complement(641589..643067) product spore germination protein GerKA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246515.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene gerKA CDS complement(643174..644526) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399312.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(644881..645147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(645349..646014) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975411.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(646147..646977) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722505.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(646920..647282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(647416..647874) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245144.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(647897..649183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(649325..650098) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530480.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(650258..650824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 650996..652813 product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800003.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene pepF CDS complement(652855..654963) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494262.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene recQ CDS complement(655083..655280) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286203.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(655527..655736) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234008.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(655862..656971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(656946..657638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 657863..659053 product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964224.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(659050..659787) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612370.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(659951..660961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(660958..662283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 662466..662711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(663200..664060) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615409.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(664158..665597) product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207627.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(665710..666201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(666323..667120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(667265..668050) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246720.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene gdh CDS complement(668066..668920) product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353544.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 669099..669305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 669511..670998 product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080288.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene dhaS CDS complement(671117..671320) product DUF6501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231245.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 671439..673313 product sporulenol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399534.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene sqhC CDS complement(673397..673690) product RNA polymerase alpha subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718625.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(673741..674913) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100954.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(674910..675680) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182367.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(675695..677482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(677613..678368) product RsbT co-antagonist protein RsbRA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966610.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene rsbRA CDS complement(678445..679488) product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188043.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 679623..680759 product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398691.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(680850..682115) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399364.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene odhB CDS complement(682118..684958) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399330.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene sucA CDS complement(685067..685273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(685413..687338) product nitric oxide reductase activation protein NorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399326.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(687351..688241) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886530.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 688412..689011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140265.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(689045..690043) product MsnO8 family LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228318.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(690165..691172) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246351.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(691317..691889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(691986..692858) product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231400.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 693098..695032 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808767.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(695075..695629) product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880650.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(696128..697156) product peptidoglycan endopeptidase LytE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244816.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene lytE CDS complement(697567..698763) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269258.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(698895..700229) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792073.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(700356..700958) product cyclic di-AMP synthase CdaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886531.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene cdaS CDS 701073..701192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 701258..702619 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231218.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(702697..703104) product transcriptional regulator LrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246601.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene lrpA CDS 703221..703979 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026122.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(704025..704690) product bacillithiol biosynthesis deacetylase BshB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231215.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene bshB2 CDS complement(704707..705057) product YojF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231213.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(705070..705342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231211.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(705429..706361) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535539.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene rarD CDS 706498..706965 product spore germination protein GerT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231207.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene gerT CDS complement(707038..707277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(707367..707747) product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246574.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(707868..708596) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(708593..708916) product transcriptional regulator YodB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399427.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene yodB CDS 709064..709687 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231196.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 709790..711076 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090686.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 711098..711874 product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258428.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(711915..712520) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975477.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(712582..713193) product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889473.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene wrbA CDS complement(713835..715238) product carboxy-terminal processing protease CtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231186.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene ctpA CDS 715420..716115 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399589.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 716195..716461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231182.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(716490..716744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(716829..717020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(717020..717835) product LD-carboxypeptidase LdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399387.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene ldcB CDS complement(717992..718696) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110707.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene deoD CDS 718877..719020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231174.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(719054..719362) product shape determination protein YodL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399431.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene yodL CDS complement(719415..719672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(720063..720209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(720364..721233) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337312.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(721322..722356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(723137..723358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(723396..723686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(723864..724634) product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486596.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(724621..725436) product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872063.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(725436..725600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 725712..726803 product DUF2515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376159.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(726828..727004) product YozD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231166.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 727144..727314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(727311..727985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231162.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 728148..728270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(728671..729384) product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242863.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(729479..730273) product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775488.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(730288..731076) product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888221.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(731090..732085) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843645.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 732378..735440 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 735521..736090 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494663.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(736115..737317) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503266.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(737505..739016) product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227742.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(739163..739456) product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246602.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(739625..741253) product multidrug efflux MFS transporter MdtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228559.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene mdtP CDS complement(741264..741689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(741839..742072) product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231160.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(742157..742438) product YokU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995764.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(742431..743843) product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902136.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene ablA CDS complement(744517..745917) product arginine utilization transcriptional regulator RocR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002002706.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene rocR CDS complement(745958..746812) product putative beta-lysine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878594.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene ablB CDS complement(746887..748317) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716485.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(748383..749651) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436698.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(749674..750312) product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525293.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(750291..750992) product acetate CoA-transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208097.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene atoD CDS complement(750989..752356) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205893.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 752576..752770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(752808..753251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(753269..753979) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802424.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 754176..754835 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271956.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 754825..754962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 754952..755362 product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868894.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene speD CDS 755359..756345 product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123965.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(756942..757370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(757392..758126) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014177.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(758143..758550) product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720569.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene spxA CDS complement(758887..759102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(759219..759476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(759639..761132) product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136108.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(761164..761607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(761778..762455) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234624.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(762471..763319) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966510.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(763397..763648) product DUF2164 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981066.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(763727..764077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 764192..765157 product multidrug resistance efflux transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232772.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(765584..766627) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769754.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(766772..768214) product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181201.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(768334..768555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 768717..768995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(769186..770904) product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243849.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene cysI CDS complement(770930..772753) product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243259.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 772949..773857 product cysJI operon transcriptional regulator CysL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243173.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene cysL CDS complement(773931..774215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(774235..775104) product manganese transporter MneS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233995.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene mneS CDS 775425..776609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(777056..778054) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398967.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene bioB CDS 778236..778727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(778755..779657) product posttranslocation chaperone PrsA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989927.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene prsA2 CDS 779828..781039 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128805580.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene cls CDS complement(781036..782355) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771670.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene brnQ CDS complement(782555..783229) product membrane lipoprotein lipid attachment site-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244238.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(783316..784716) product alkaline phosphatase PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234119.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene phoB CDS complement(784873..786063) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164690873.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(786060..787106) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454564.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 787334..787681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(788254..788382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(788813..790072) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034616.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(790077..790484) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390166.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(790485..791021) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343928.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(791196..791441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798786.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(791502..792563) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724779.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene murG CDS complement(792581..793459) product transcriptional regulator CitR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233357.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene citR CDS 793568..794674 product citrate synthase CitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244745.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene citA CDS complement(794686..795081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 795252..795416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(795352..795957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(795954..797147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(797746..798801) product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085410.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(798928..800154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(800151..800831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 801115..803865 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140417.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene ppc CDS complement(803884..804450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 804702..805091 product SET domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573649.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(805120..805494) product glyoxalase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529405.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(805914..806642) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773447.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(806626..807495) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000452052.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(807520..807864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(807854..808093) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381292.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(808340..810022) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370456.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene argS CDS complement(810403..810855) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107259.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(811097..811645) product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963719.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene hxlB CDS complement(811642..812259) product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963718.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(812311..813324) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(813380..814045) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene eda CDS complement(814064..815344) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113740.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(815358..816305) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703773.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(816312..817061) product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113739.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 817321..817539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(817666..817980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(818144..818440) product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583804.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(818461..819096) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185385.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(819118..819552) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204165.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(819718..820251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(820377..821213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(821188..821337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(821806..822063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(822224..823090) product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928954.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(823231..824190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(824187..824891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(824891..825742) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170849.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 825859..826455 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722193.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(826501..828261) product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544318.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(828367..829032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(829044..829280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 829556..829840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(829989..831155) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179093.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(831216..832637) product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358103.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene gabD CDS complement(832809..833660) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362557.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 833806..834471 product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970400.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(834587..835597) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003019.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(835609..836814) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256286.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(836811..837410) product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948663.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(837571..838002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 838095..838649 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920716.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(838701..839780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(839777..840484) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356233.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(840438..841037) product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176066.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(841242..842270) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928745.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(842341..842793) product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246544.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene mutT CDS complement(842801..843487) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588494.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(843510..843980) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540457.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(844086..844580) product lactoylglutathione lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119583.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 844710..845036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 845050..845202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(845287..845730) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327433.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(845862..846431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(846442..846918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 847118..847900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(847877..849103) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793325.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 849287..850078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 850262..850726 product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925810.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(850941..852668) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000663074.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene thrS CDS complement(853533..854153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(854221..855030) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948538.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(855048..855731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079416402.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(855762..856559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 note possible pseudo, internal stop codon CDS 856855..857409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(857748..858530) product spore maturation N-acetyltransferase CgeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230830.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene cgeE CDS complement(858523..858909) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145269.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 859125..859931 product DUF4397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257289.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 859900..860541 product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078653258.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(861041..861883) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383655.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 861988..862821 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435002.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(862923..863870) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261262.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene msrB CDS 864106..864534 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398634.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 864593..864841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433610.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(864912..865709) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099991.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 865854..866621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 866784..867002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(867048..867257) product protein YpmT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230808.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene ypmT CDS complement(867254..868375) product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392037.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(868389..869561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(869830..870414) product YpmS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288396.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(870430..871224) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245956.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(871347..871919) product cytochrome c oxidase assembly accessory protein ScuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245947.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene scuA CDS complement(871989..872945) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125044.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 873066..873572 product PCYCGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761026.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(873651..873818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(873924..874766) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169470.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(875433..875684) product DUF2535 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745806.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(875775..877043) product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230803.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene ilvA CDS 877158..877382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 877486..878556 product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399025.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 878540..879181 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398522.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(879201..879926) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616588.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(879992..880474) product dihydrofolate reductase DfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230799.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene dfrA CDS complement(880471..881265) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398587.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(881292..882038) product zinc metalloprotease Zmp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861706.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene zmp1 CDS 882187..882336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(882386..883162) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025696.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(883342..883866) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230797.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(883883..884473) product YpjP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967559.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(884756..884881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(884909..885688) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637459.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(885815..886249) product bacilliredoxin BrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230794.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene brxA CDS complement(886323..888035) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002937428.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene ilvD CDS 888201..888890 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564871.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(888932..889681) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628423.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(889713..890417) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655263.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(890565..891689) product conserved virulence factor C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398677.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(891769..892419) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180008.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(892433..893278) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684725.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(893341..894204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(894262..894744) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219440.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene bsaA CDS complement(894747..895247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460219.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(895247..896932) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110057.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 897063..897971 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398721.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene metA CDS 898135..899280 product diglucosyl diacylglycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246153.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 899323..900330 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244136.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(900375..901073) product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121737.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(901070..901768) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160042.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 901907..902134 product DUF3892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965887.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 902147..902302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(902786..902968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(903043..903309) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154654.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(903379..903630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 903868..904068 product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230776.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene cspD CDS complement(904126..904332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 904525..904791 product DUF2564 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534392.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(904830..905015) product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399003.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(905008..905673) product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875548.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 905832..906509 product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230767.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 906522..906923 product reverse transcriptase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573873.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 906920..907816 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195333.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(907844..908122) product DUF6123 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195212.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(908145..908801) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042729.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(908902..909801) product 5'-3' exonuclease ExnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230763.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene exnP CDS complement(909920..910045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(910114..910389) product YpbS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230757.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(910567..914142) product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182111.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 914371..914763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(914969..915595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(915703..916224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(916228..916563) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948327.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(916703..917338) product FMN-dependent NADH-azoreductase AzoRB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243587.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene azoRB CDS 917548..917835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(918109..918672) product alkylpyrone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398552.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene bpsB CDS complement(918669..919769) product type III polyketide synthase BpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230750.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene bpsA CDS complement(919956..920492) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048158.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(920569..921222) product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964933.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 921328..922086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(922154..923464) product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230748.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene pbuX CDS complement(923461..924051) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866483.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(924390..925907) product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215104.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene ypwA CDS complement(926405..928342) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230718.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(928486..928683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(928739..929890) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521224.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(930707..931012) product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225629.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene gpsB CDS complement(931089..931655) product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862908.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(931719..932141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(932486..933730) product metal-dependent exonucleaseMrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398813.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene mrfB CDS complement(933721..936006) product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene mrfA CDS complement(936110..936613) product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967573.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 936814..937218 product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485814.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 937280..937435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 937435..937686 product sigma-G-dependent sporulation-specific acid-soluble spore protein CsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234887.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene csgA CDS 937686..937820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(937843..938145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(938178..938627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 938800..938979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 939091..939267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(939359..939730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(939789..940025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(940727..941698) product DUF2515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495658.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 941842..942438 product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399067.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene recU CDS 942483..945164 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398589.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(945239..945772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(945765..946427) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933025.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene nth CDS complement(946450..947154) product DNA replication protein DnaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398499.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene dnaD CDS complement(947334..948626) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398777.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene asnS CDS complement(948735..949922) product aspartate transaminase AspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398489.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene aspB CDS complement(949936..950427) product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758739.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(950440..950610) product YpmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225588.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(950793..953597) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398920.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene dinG CDS complement(953730..954113) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225586.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene panD CDS complement(954138..954980) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230656.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene panC CDS complement(954977..955819) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000851109.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene panB CDS complement(956071..957054) product bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230650.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(957039..958238) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439321.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(958231..959376) product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768305.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene bshA CDS complement(959373..960113) product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230642.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene bshB1 CDS complement(960076..960504) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684761.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene mgsA CDS complement(960518..961315) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246190.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene dapB CDS complement(961328..961657) product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398996.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 961806..962678 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202121.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(962985..963797) product sporulation protein YpjB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230633.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene ypjB CDS complement(963878..964474) product DUF1405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886552.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(964546..965313) product menaquinol-cytochrome c reductase cytochrome b/c subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225562.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(965373..966047) product menaquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225560.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene qcrB CDS complement(966051..966560) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230627.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(966704..967159) product YpiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246201.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(967535..971230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(971444..971983) product ReoY family proteolytic degradation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399171.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(972065..973330) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230620.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(973354..974250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(974509..975819) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246068.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene aroA CDS complement(975831..976943) product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230615.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(977002..978084) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399129.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene hisC CDS complement(978136..978957) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230608.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene trpA CDS complement(978920..980149) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230605.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene trpB CDS complement(980130..980786) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398742.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(980783..981541) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886553.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 gene trpC CDS complement(981534..982550) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245959.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene trpD CDS complement(982522..984066) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246124.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene trpE CDS complement(984401..984766) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967606.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene aroH CDS complement(984763..985848) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230592.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene aroB CDS complement(985848..987020) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398727.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene aroC CDS complement(987097..987870) product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230589.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene cheR CDS complement(988610..989056) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886554.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene ndk CDS complement(989158..990120) product heptaprenyl diphosphate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886555.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene hepT CDS complement(990228..990923) product 2-heptaprenyl-1,4-naphthoquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187667.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene menG CDS complement(990925..991731) product heptaprenyl diphosphate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398550.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene hepS CDS complement(991843..992070) product trp RNA-binding attenuation protein MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230576.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene mtrB CDS complement(992101..992667) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225516.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene folE CDS complement(992873..993151) product non-specific DNA-binding protein Hbs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153447.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene hbs CDS 993348..993494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(993678..995156) product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230572.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene spoIVA CDS complement(995358..996077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755475.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(996106..996306) product DUF2768 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399143.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(996735..997769) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230566.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene gpsA CDS complement(997785..999095) product ribosome-associated GTPase EngA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230565.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene engA CDS complement(999319..999510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230563.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(999507..1000403) product YIEGIA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230562.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(1000405..1000998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230560.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 1001127..1001258 product YpzI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513900.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(1001310..1002371) product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399098.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene fni CDS complement(1002384..1003532) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230556.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene rpsA CDS complement(1003662..1004252) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(1004252..1004923) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230555.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene cmk CDS complement(1005007..1005201) product YpfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230553.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(1005253..1005915) product cyclic di-GMP receptor DgrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230551.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene dgrA CDS complement(1005993..1007336) product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230547.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene ypeB CDS complement(1007349..1008308) product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249045.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene sleB CDS complement(1008523..1009197) product glutamic-type intramembrane protease PrsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230542.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene prsW CDS 1009303..1010271 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822018.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene ansA CDS complement(1010299..1011315) product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399008.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(1011372..1012643) product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886557.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene gudB CDS complement(1012874..1013476) product genetic competence negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230533.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(1013599..1014519) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142718.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(1015080..1015715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(1015785..1016249) product YpbF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230531.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(1016353..1017018) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398603.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(1017023..1017607) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886558.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(1017612..1019090) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230528.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(1019100..1020149) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398594.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 1020440..1020688 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151996.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(1020732..1021313) product riboflavin transporter FmnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399159.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene fmnP CDS complement(1021400..1021678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 1021786..1023360 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398713.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene serA CDS complement(1023405..1024658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(1024801..1025613) product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582599.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(1025684..1026532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(1027045..1027332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(1027488..1027736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(1027813..1028001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(1028053..1028538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(1028619..1029047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(1029119..1029532) product DUF5412 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944004.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(1029584..1030309) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237656.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(1030746..1031240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(1031430..1032041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(1032213..1033349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(1033346..1033882) product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230521.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene sigX CDS complement(1034000..1034578) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781269.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(1034659..1035174) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567165.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(1035187..1035600) product DUF4430 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894007.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(1036013..1037818) product sensor histidine kinase ResE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230520.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene resE CDS complement(1037815..1038537) product DNA-binding response regulator ResD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246107.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene resD CDS complement(1038768..1039943) product cytochrome c biogenesis protein ResC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398799.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene resC CDS complement(1039964..1041589) product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230515.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene resB CDS complement(1041606..1042130) product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230513.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene resA CDS complement(1042231..1042956) product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398815.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene rluB CDS complement(1043131..1043658) product spore maturation protein SpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230509.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene spmB CDS complement(1043661..1044254) product spore maturation protein SpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398980.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene spmA CDS complement(1044247..1045317) product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230505.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene dacB CDS complement(1045907..1046398) product YpuI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064519.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(1046423..1046830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139849141.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(1046930..1047514) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223904.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene scpB CDS complement(1047519..1048268) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246108.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene scpA CDS 1048768..1049217 product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230498.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(1049292..1049648) product GNAT family N-acetyltransferase RibT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223910.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene ribT CDS complement(1049837..1050301) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230892.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene ribH CDS complement(1050319..1051515) product bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468974.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene ribBA CDS complement(1051531..1052172) product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493929.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene ribE CDS complement(1052179..1053246) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131986.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene ribD CDS complement(1054231..1055148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(1055261..1055695) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853782.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 1055868..1056749 product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967658.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(1056789..1058213) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550944.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(1058376..1059167) product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244042.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(1059192..1059845) product succinyl-CoA--3-ketoacid CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243049.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(1059861..1060562) product succinyl-CoA--3-ketoacid CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244373.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(1060593..1062035) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243205.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(1062791..1064113) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398851.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene lysA CDS complement(1064250..1065728) product spore germination protein SpoVAF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230471.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene spoVAF CDS complement(1065685..1066293) product stage V sporulation protein SpoVABEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230469.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene spoVAEA CDS complement(1066303..1066653) product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230467.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene spoVAE CDS complement(1066641..1067675) product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230465.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene spoVAD CDS complement(1067698..1068147) product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223947.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene spoVAC CDS complement(1068165..1068587) product stage V sporulation protein SpoVAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230463.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene spoVAB CDS complement(1068577..1069197) product stage V sporulation protein SpoVAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246053.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene spoVAA CDS complement(1069490..1070248) product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene sigF CDS complement(1070260..1070700) product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230452.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene spoIIAB CDS complement(1070697..1071050) product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398633.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene spoIIAA CDS complement(1071161..1072321) product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene dacF CDS complement(1072439..1073743) product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243061.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(1073740..1074573) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(1074588..1075775) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046067.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene deoB CDS complement(1075987..1076880) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398985.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene xerD CDS complement(1076887..1077111) product YqzK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230440.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(1077218..1077682) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223972.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene fur CDS complement(1077796..1078446) product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398593.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene spoIIM CDS 1078573..1079136 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068762.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(1079169..1080338) product TIGR00375 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246128.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(1080340..1080891) product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398600.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene nudF CDS 1081031..1081153 product Z-ring formation inhibitor MciZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870302.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 1081225..1082130 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747210.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(1082188..1083006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(1083003..1083854) product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 1084051..1084929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(1084966..1085223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(1085290..1085958) product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889326.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(1085973..1086668) product succinyl-CoA--3-ketoacid CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244373.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(1086672..1087865) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459196.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 1088786..1089697 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522997.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 1089835..1089963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 1090061..1090981 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819234.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 1091064..1092020 product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(1092101..1092343) product YqkC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230411.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(1092357..1092680) product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226552.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 1092809..1093006 product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070876731.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(1093413..1093745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(1093760..1095022) product UV damage repair protein UvrX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168747920.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 1095310..1095579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 1095900..1096091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(1096137..1096931) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147802.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(1096945..1097898) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398688.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 1098397..1099236 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398788.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene proC CDS 1099318..1099623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 1099620..1099988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 1100009..1100704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(1100729..1101166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(1101184..1101948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(1101929..1103581) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398867.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 1103977..1104993 product NADPH dehydrogenase NamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230377.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene namA CDS complement(1105129..1105293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(1105363..1106151) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454677.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(1106187..1106426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(1106469..1106654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18350 note possible pseudo, internal stop codon CDS complement(1106688..1107113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(1107148..1107675) product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681855.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(1107744..1108157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(1108266..1108757) product biofilm phosphatase Bph inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355538.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene bph CDS complement(1108818..1109324) product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901178.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(1109647..1110003) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760481.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 1110148..1110942 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242985.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(1111068..1111655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(1111908..1112555) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836334.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(1112585..1112731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(1112784..1113254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(1113262..1114002) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885971.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 1114197..1114745 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929865.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 1114748..1115542 product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255000.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(1115623..1116330) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346313.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(1116430..1117227) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073799.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(1117291..1118112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(1118158..1118325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(1118469..1118681) product DUF4017 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789485.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(1118911..1119726) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066520.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(1119741..1120151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(1120304..1121125) product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114002.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene nei CDS complement(1121245..1121793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(1121952..1122101) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719608.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene rpmG CDS complement(1122177..1122722) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721031.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(1122712..1123641) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397446.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene rnz CDS 1123814..1124203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(1124259..1124678) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759735.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 1124819..1125604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 1125821..1126168 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380304.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 1126155..1127153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052351.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(1127246..1127635) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800661.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(1127919..1128464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(1128582..1128959) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581467.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(1129108..1129797) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(1129775..1130890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(1130993..1131496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(1131604..1131840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(1131875..1132543) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028048.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(1132574..1132759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 1132853..1133356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(1133490..1134056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(1134175..1134639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(1134629..1135138) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707124.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(1135260..1135439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(1135430..1135579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(1135694..1136032) product immunity 53 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672474.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(1136052..1136201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(1136318..1136518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(1136623..1136766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(1136815..1137186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(1137417..1138049) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875269.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(1138192..1138938) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858645.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(1139165..1140037) product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945412.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(1140408..1140839) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965897.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(1140912..1141319) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361287.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(1141363..1141608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(1141712..1142107) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398989.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(1142148..1142699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182396.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(1142704..1142970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(1143105..1143476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 1143747..1144046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(1144119..1144580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(1144608..1145009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 note possible pseudo, internal stop codon CDS complement(1145190..1145639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 note possible pseudo, internal stop codon CDS complement(1145668..1146444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(1146419..1146955) product RNA polymerase sigma factor YlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245485.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene ylaC CDS complement(1147091..1147243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(1147291..1147659) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002022511.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(1147711..1148316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(1148486..1148812) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(1148813..1149232) product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437765.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(1149440..1151692) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964842.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(1151689..1152390) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582779.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 1152645..1154135 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246151.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene zwf CDS complement(1154196..1154759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(1154759..1154968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(1155086..1155511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(1155714..1155839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(1156131..1156922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 1157149..1158180 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190236313.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(1158232..1159476) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245231.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(1159579..1160223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(1160493..1161860) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227543.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(1162003..1162431) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600350.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(1162598..1162780) product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990233.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(1162879..1164291) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene gndA CDS complement(1164396..1165637) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398755.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 1166056..1167318 product glutamate/proton symporter GltT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245579.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene gltT CDS complement(1167356..1167586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(1168263..1168505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(1168548..1169075) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291883.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene msrA CDS complement(1169140..1170264) product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609803.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(1170283..1171836) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(1171833..1172249) product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867372.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene mce CDS complement(1172203..1172358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(1172550..1173065) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398604.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(1173087..1174070) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246146.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(1174197..1174919) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590206.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(1174912..1175571) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046916.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(1175651..1176427) product arginine ABC transporter substrate-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398706.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene artP CDS complement(1176672..1177109) product bacilliredoxin BrxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226477.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene brxB CDS complement(1177186..1178208) product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099360647.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene meaB CDS complement(1178205..1180358) product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258367.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene scpA CDS complement(1180359..1182218) product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390233.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 1182419..1182595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 1182624..1183526 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230330.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(1184072..1185379) product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257658.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(1185409..1186392) product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290076.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene bfmBAB CDS complement(1186405..1187397) product 3-methyl-2-oxobutanoate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398565.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene bfmBAA CDS complement(1187442..1188863) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051291.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene lpdA CDS complement(1188911..1190023) product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230311.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene buk CDS complement(1190088..1191182) product branched-chain amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230309.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene bcd CDS complement(1191225..1192115) product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764677.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene yqiS CDS complement(1192262..1194322) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398669.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 1194518..1194748 product DUF2627 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190187.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(1194788..1195522) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172583.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 1195564..1195701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(1195769..1196557) product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226427.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene spo0A CDS complement(1196861..1198150) product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398697.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene spoIVB CDS complement(1198335..1200059) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene recN CDS complement(1200089..1200538) product arginine repressor ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230265.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene argR CDS complement(1200720..1201559) product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230264.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(1201563..1203455) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245985.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene dxs CDS complement(1203814..1204692) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230262.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(1204692..1204925) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226409.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(1204918..1206270) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246103.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene xseA CDS complement(1206290..1207156) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230259.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene folD CDS complement(1207191..1207583) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230256.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene nusB CDS 1207855..1208145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(1208205..1208612) product fatty acid biosynthesis protein YqhY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230254.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene yqhY CDS complement(1208635..1209987) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230253.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene accC CDS complement(1209999..1210499) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472859.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene accB CDS complement(1211113..1211691) product stage III sporulation ratchet engulfment protein SpoIIIAH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230250.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene spoIIIAH CDS complement(1211706..1212359) product stage III sporulation protein AG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230248.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene spoIIIAG CDS complement(1212352..1212981) product stage III sporulation protein AF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230233.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene spoIIIAF CDS complement(1212994..1214073) product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230230.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene spoIIIAE CDS complement(1214183..1214521) product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230228.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene spoIIIAD CDS complement(1214585..1214791) product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153142.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene spoIIIAC CDS complement(1214813..1215328) product stage III sporulation protein SpoIIIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238702.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene spoIIIAB CDS complement(1215322..1216245) product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230226.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene spoIIIAA CDS complement(1216318..1216599) product YqhV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398639.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 1216788..1216964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(1216990..1217547) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226377.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene efp CDS complement(1217596..1218660) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411056.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene pepQ CDS complement(1218647..1219102) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230223.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene aroQ CDS complement(1219262..1219792) product YqhR family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230222.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 1220043..1220990 product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967716.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 1221034..1221408 product SA1362 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226367.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(1221427..1222299) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230220.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(1222412..1222843) product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143076.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene mntR CDS complement(1222974..1224092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(1224322..1225788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(1226106..1226942) product octanoyltransferase LipM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398586.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene lipM CDS 1227150..1227533 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108653.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(1227572..1229032) product aminomethyl-transferring glycine dehydrogenase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795698.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene gcvPB CDS complement(1229025..1230371) product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230207.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene gcvPA CDS complement(1230397..1231500) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene gcvT CDS 1232274..1233740 product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398544.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 1233744..1234538 product YqhG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183959.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 1234953..1235078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 1235182..1235517 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578878.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(1235574..1235771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(1235786..1236085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(1236339..1236551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 1236633..1236941 product YqzG/YhdC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246051.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(1236999..1237178) product YqzE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230176.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(1237204..1237722) product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836631.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene aroK CDS complement(1237796..1238170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(1238167..1238706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(1238591..1238899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(1238886..1239335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(1239313..1239624) product comG operon protein ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230162.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene comGC CDS complement(1239643..1240677) product comG operon protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246116.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene comGB CDS complement(1240667..1241734) product competence protein ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399124.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene comGA tRNA 1241931..1242002 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(1242372..1242620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(1242803..1243183) product transcriptional regulator MgsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230147.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 gene mgsR CDS 1243452..1243697 product DUF2626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226300.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(1243752..1244840) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181859.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(1244849..1245481) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871236.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 1245563..1246009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 1246093..1246266 product DUF2759 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230141.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(1246330..1246638) product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230139.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(1246661..1247758) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230137.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(1247810..1248952) product M14 family metallocarboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886566.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(1249086..1250969) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399146.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(1251319..1252287) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391706.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene glcK CDS complement(1252355..1252555) product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253699.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(1252703..1253872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(1254060..1254236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230126.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(1254304..1255074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(1255067..1255633) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230122.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(1255697..1255846) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153056.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene rpmG CDS complement(1255956..1257005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(1257012..1258697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 1258894..1259241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245993.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 1259238..1259714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(1259815..1260474) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251240.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene phoU CDS complement(1260574..1261398) product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226686.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene pstB CDS complement(1261434..1262312) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831209.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene pstA CDS complement(1262314..1263255) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204619.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene pstC CDS complement(1263329..1264303) product phosphate ABC transporter substrate-binding protein PhoX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871265.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene phoX CDS complement(1264533..1266695) product penicillin-binding protein 2A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398702.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene pbpA CDS complement(1266836..1268131) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230095.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(1268769..1269377) product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052031.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene sodA CDS complement(1269494..1269976) product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398518.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(1270072..1271703) product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456248.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 1271918..1272691 product DUF1189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230089.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(1272753..1274492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 1274716..1275048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825409.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 1275180..1276292 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886567.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene ispG CDS complement(1276339..1276728) product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886568.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 1276914..1277498 product nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246215.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(1277535..1277957) product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398578.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene zur CDS complement(1277959..1278795) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613815.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(1278798..1279571) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059649.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS complement(1279695..1280576) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435963.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 1280703..1280957 product DUF2624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230076.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(1280992..1281888) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967756.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(1281900..1283216) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121678890.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 1283460..1284191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 1284317..1285258 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246170.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(1285302..1286423) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399125.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(1286420..1287133) product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006551.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(1287269..1287631) product cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230068.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene cccA CDS complement(1287811..1288950) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245114.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(1289318..1290430) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226225.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene rpoD CDS complement(1290525..1292336) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230066.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene dnaG CDS complement(1292369..1292842) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230065.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(1293135..1293947) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230064.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(1293967..1294626) product transcriptional regulator CcpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237058.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene ccpN CDS complement(1294786..1296846) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230059.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene glyS CDS complement(1296839..1297729) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226213.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene glyQ CDS complement(1298042..1298800) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230055.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene recO CDS complement(1298833..1298976) product YqzL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883924.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(1299094..1300002) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230051.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene era CDS complement(1299995..1300393) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086294.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(1300506..1300805) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398824.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(1300855..1301337) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054684.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene ybeY CDS complement(1301334..1303511) product cyclic-di-AMP phosphodiesterase PgpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886570.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene pgpH CDS complement(1303574..1304533) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230035.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(1304537..1305721) product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230033.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene yqfD CDS complement(1305738..1306025) product sporulation protein YqfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732266.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene yqfC CDS complement(1306086..1306574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230029.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(1306605..1307594) product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230026.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene floA CDS complement(1307611..1308861) product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230024.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(1309068..1309514) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230022.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(1309528..1309701) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719762.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene rpsU CDS 1309908..1310855 product Na/Pi symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230019.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(1310895..1311566) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933101.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 gene deoC CDS complement(1312087..1313445) product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230017.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene mtaB CDS complement(1313451..1314206) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230015.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(1314220..1315158) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398884.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene prmA CDS complement(1315179..1316294) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230010.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene dnaJ CDS complement(1316862..1318691) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398786.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene dnaK CDS complement(1318717..1319313) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230005.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene grpE CDS complement(1319399..1320427) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246126.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene hrcA CDS complement(1320571..1321728) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181861.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene hemW CDS complement(1321825..1323651) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229999.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene lepA CDS 1323794..1323997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(1324519..1324860) product YqxA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399162.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(1324885..1326084) product spore autolysin SpoIIP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229993.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene spoIIP CDS complement(1326153..1327271) product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662627.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene gpr CDS 1327476..1327742 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229989.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene rpsT CDS complement(1327778..1328806) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229987.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene holA CDS 1329101..1329235 product YqzM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229983.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(1329272..1331620) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967776.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(1331626..1332174) product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439774.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(1332243..1332872) product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398514.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene comEA CDS 1332958..1333782 product late competence protein ComER inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398597.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene comER CDS complement(1333866..1334621) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229973.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(1334618..1334974) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229971.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene rsfS CDS complement(1334971..1335549) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399059.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene yqeK CDS complement(1335539..1336108) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398676.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(1336124..1336417) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955224.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene yhbY CDS complement(1336411..1337253) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812091.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene aroE CDS complement(1337269..1338375) product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229966.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene yqeH CDS complement(1338378..1338893) product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226126.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 1339274..1339414 product sporulation histidine kinase inhibitor Sda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886571.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene sda CDS 1339838..1340377 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459914.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene pssA CDS complement(1340409..1340576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 1341145..1341285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 1341329..1341469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(1341644..1342384) product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene sigK CDS 1342622..1343368 product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229964.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(1343587..1344720) product bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229810.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(1344722..1345645) product O-acetylserine dependent cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103859.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(1345728..1346426) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967881.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene mtnN CDS complement(1346489..1347130) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229807.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 1347493..1347693 product YrzA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010984.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(1347723..1348406) product YrrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246156.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(1348467..1350209) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398903.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(1350267..1350740) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399078.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene greA CDS complement(1351018..1351653) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225916.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene udk CDS complement(1351658..1352926) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229802.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(1352961..1353890) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399094.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(1353883..1354545) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229800.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(1354727..1355854) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229799.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene mltG CDS complement(1356066..1356353) product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246199.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(1356385..1356801) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229795.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene ruvX CDS complement(1356803..1357069) product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225903.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(1357181..1359814) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246158.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene alaS CDS complement(1360137..1361198) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967889.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(1361321..1361515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(1361925..1362116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225893.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(1362131..1362631) product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886583.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(1362634..1365009) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398511.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(1365025..1365678) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886584.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(1365748..1366863) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038010.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene mnmA CDS complement(1366887..1368026) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439881.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(1368041..1368457) product cysteine metabolism transcriptional regulator CymR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225879.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene cymR CDS complement(1368476..1369141) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246558.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 1369285..1370571 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398500.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(1370619..1371383) product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967893.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(1372371..1374149) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229758.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene aspS CDS complement(1374169..1375431) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229755.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene hisS CDS complement(1375778..1375951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 1376087..1377817 product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399040.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(1377892..1378335) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071581519.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene dtd CDS complement(1378352..1380544) product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229747.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene relA CDS complement(1380709..1381221) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229745.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(1381238..1383589) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941257.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene recJ CDS complement(1383966..1384310) product DUF1049 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229740.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(1384500..1384934) product cell wall hydrolase CwlJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538153.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene cwlJ CDS complement(1385047..1387296) product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245970.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene secDF CDS complement(1387334..1387630) product post-transcriptional regulator ComN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398498.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene comN CDS 1387773..1389335 product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398529.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene spoVB CDS complement(1389339..1389989) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398801.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS 1390141..1390518 product TIGR04086 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229729.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(1390570..1390854) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398708.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene yajC CDS complement(1390938..1392083) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125365.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene tgt CDS complement(1392111..1393139) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229723.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene queA CDS complement(1393170..1394171) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229718.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene ruvB CDS complement(1394183..1394791) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229717.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene ruvA CDS complement(1394925..1395473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(1395633..1396364) product spore germination protein SgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245996.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene sgpA CDS complement(1396572..1398212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(1398395..1399504) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025295.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene nadA CDS complement(1399520..1400350) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092232.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene nadC CDS complement(1400337..1401908) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138531.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene nadB CDS 1402002..1403144 product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973777.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 1403151..1403687 product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812272.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(1403723..1404580) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398512.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene pheA CDS complement(1404598..1405041) product transcriptional regulator ThrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222630.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 gene thrR CDS complement(1405117..1406403) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246161.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene obgE CDS complement(1406426..1406974) product sporulation initiation phosphotransferase Sop0B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399131.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene spo0B CDS complement(1407203..1407496) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222623.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene rpmA CDS complement(1407498..1407851) product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973720.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(1407863..1408171) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726868.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene rplU CDS complement(1408323..1409753) product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855451.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(1409813..1410679) product stage IV sporulation intramembrane metalloprotease SpoIVFB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398649.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene spoIVFB CDS complement(1410672..1411448) product stage IV sporulation protein SpoIVFA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398684.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene spoIVFA CDS complement(1411734..1412540) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398624.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene minD CDS complement(1412543..1413226) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398901.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene minC CDS complement(1413402..1413923) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975766.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene mreD CDS complement(1413920..1414816) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135499.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene mreC CDS complement(1414911..1415933) product cell shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229650.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene mreB CDS complement(1416047..1416730) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246034.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene radC CDS complement(1416767..1417336) product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226290.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(1417496..1418518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(1418636..1419463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(1419444..1420061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(1420062..1421033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(1421050..1421532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(1421805..1422209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(1422316..1423521) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(1423521..1424561) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(1424567..1426222) product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(1426227..1427534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 1427713..1428150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 1428147..1428656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 1428667..1430340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(1430375..1432087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(1432171..1433475) product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582053.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 gene folC CDS complement(1433548..1436190) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398606.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene valS CDS 1436657..1436848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222590.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(1436876..1437913) product spore coat protein CotN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399056.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene cotN CDS complement(1438007..1439014) product stage VI sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002024850.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene spoVID CDS 1439170..1439358 product stress response protein CsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227718.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene csbD CDS 1439442..1439609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(1439649..1440935) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398699.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene hemL CDS complement(1440955..1441935) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087065.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene hemB CDS complement(1441939..1442721) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229629.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene hemD CDS complement(1442721..1443653) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886587.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene hemC CDS complement(1443686..1444519) product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222575.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(1444538..1445893) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399038.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene hemA CDS 1446162..1446647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 1446785..1447027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 1447028..1447279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 1447395..1447604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(1447601..1447849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 1447932..1448567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(1448606..1449193) product ribosome biogenesis GTP-binding protein YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869113.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene ysxC CDS complement(1449190..1451514) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229618.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene lon CDS complement(1451719..1453377) product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398923.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene lonB CDS complement(1453650..1454915) product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene clpX CDS complement(1455363..1456649) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene tig CDS complement(1456892..1457899) product DNA damage checkpoint antagonist DdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229609.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene ddcA CDS complement(1457971..1458558) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229606.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene leuD CDS complement(1458530..1459969) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229604.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene leuC CDS complement(1460047..1461159) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399139.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene leuB CDS complement(1461203..1462747) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967929.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS complement(1462734..1463756) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222549.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene ilvC CDS complement(1463868..1464383) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399096.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene ilvN CDS complement(1464380..1466098) product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398643.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene ilvB CDS complement(1466510..1467415) product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005486.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene ilvE tRNA complement(1468243..1468318) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(1468443..1468955) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229585.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(1468975..1469571) product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886588.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(1469568..1470326) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246039.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(1470496..1471581) product spore germination protein GerM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229578.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene gerM CDS complement(1472309..1473106) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774002.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene racE CDS complement(1473116..1473568) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229573.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(1473757..1473981) product spore germination transcription factor GerE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003184172.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene gerE CDS complement(1474116..1474583) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822735.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(1474656..1475420) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229569.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene sdhB CDS complement(1475424..1477184) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229567.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 gene sdhA CDS complement(1477215..1477823) product succinate dehydrogenase cytochrome B558 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222512.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 gene sdhC CDS 1478126..1478587 product YslB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222508.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(1478637..1479878) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229564.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(1480265..1482049) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246045.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene uvrC CDS complement(1482331..1482645) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222500.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene trxA CDS complement(1482810..1483787) product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101963.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene etfA CDS complement(1483845..1484618) product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029033.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene etfB CDS complement(1484691..1485464) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229549.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(1485507..1486091) product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229547.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene fadR CDS complement(1486561..1488249) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414744.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(1488578..1488982) product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237674.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(1489000..1491357) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229541.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(1491402..1493126) product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867515.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene polX CDS complement(1493242..1493784) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229537.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(1493793..1494050) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229534.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene zapA CDS 1494169..1495107 product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245949.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene rnhC CDS complement(1495162..1497576) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398979.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene pheT CDS complement(1497591..1498625) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398818.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 gene pheS CDS complement(1498996..1499748) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003158483.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 1500103..1500315 product small acid-soluble spore protein SspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229525.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 gene sspI CDS complement(1500363..1501448) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163568.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(1501511..1501999) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365050.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 1502128..1502523 product sigma W pathway protein YsdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229493.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene ysdB CDS complement(1502546..1503130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(1503192..1503461) product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229490.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(1503527..1503886) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222420.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene rplT CDS complement(1503914..1504114) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125945.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 gene rpmI CDS complement(1504136..1504639) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886591.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 gene infC CDS complement(1504965..1506893) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229473.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 gene thrS CDS complement(1507268..1508092) product putative sporulation protein YtxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229471.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 gene ytxC CDS complement(1508209..1509144) product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400104.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene dnaI CDS complement(1509166..1510563) product replication initiation membrane attachment protein DnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229464.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene dnaB CDS complement(1510648..1511106) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223586.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene nrdR CDS complement(1511221..1511619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(1511736..1512116) product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223584.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene speD CDS complement(1512821..1513843) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229459.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(1513969..1514574) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219305.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene coaE CDS complement(1514592..1515227) product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229449.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene ytaF CDS complement(1515289..1516113) product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246122.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 gene mutM CDS complement(1516126..1518756) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398870.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene polA CDS complement(1518858..1519793) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937986.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(1519783..1520760) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409358.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene hflK CDS complement(1520961..1522721) product sensory box histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032129.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene phoR CDS complement(1522714..1523433) product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229442.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene phoP CDS complement(1523650..1524126) product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914180.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(1524211..1525149) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229437.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene mdh CDS complement(1525229..1526497) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene icd CDS complement(1526597..1527715) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene citZ CDS complement(1528107..1528565) product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398695.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS 1528618..1529730 product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081398.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene ytvI CDS complement(1529820..1530206) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246085.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 gene fxsA CDS complement(1530319..1532079) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398560.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 gene pyk CDS complement(1532134..1533093) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229420.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene pfkA CDS complement(1533432..1534409) product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229417.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene accA CDS complement(1534403..1535266) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223544.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 gene accD CDS complement(1535394..1536020) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204441.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(1536031..1537266) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229415.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 gene maeB CDS complement(1537387..1540749) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229412.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 gene dnaE CDS 1540882..1541220 product sporulation membrane protein YtrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229410.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene ytrH CDS 1541217..1541720 product sporulation membrane protein YtrI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229408.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene ytrI CDS 1541856..1542038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229407.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(1542055..1542996) product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398971.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene nrnA CDS 1543143..1543439 product YtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229401.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS complement(1543506..1544825) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201587.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(1544891..1545124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(1545213..1545893) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868927.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(1546616..1547734) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219405.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene ald CDS complement(1547952..1548710) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398521.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 1548852..1550147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(1550163..1550330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(1550413..1551786) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246018.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 gene argH CDS complement(1551783..1552994) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229357.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 1553183..1553494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417218.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(1553554..1554066) product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398479.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(1554053..1554907) product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256850.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(1554979..1556388) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460243.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(1556496..1557683) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223511.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(1557927..1558916) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181883.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(1559048..1559548) product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024529.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene tpx CDS complement(1559682..1560149) product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398631.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene ytfJ CDS complement(1560165..1560866) product DUF2953 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399127.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(1560945..1561466) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229340.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS complement(1561482..1562486) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229337.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene sppA CDS 1562648..1563451 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399091.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(1564410..1566008) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229333.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(1566103..1567680) product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817748.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS complement(1567808..1567939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS complement(1568044..1568244) product alpha type acid-soluble spore protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223491.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene sspA CDS complement(1568327..1569526) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229326.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene thiI CDS complement(1569531..1570670) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398687.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS 1570913..1572262 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229322.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 gene brnQ CDS complement(1572309..1574006) product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229320.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene ezrA CDS 1574237..1575040 product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229318.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene hisJ CDS complement(1575054..1575698) product transcriptional regulator RefZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229313.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene refZ CDS 1575828..1576307 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494335.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(1576370..1577554) product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726562.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene megL CDS complement(1577646..1579439) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229309.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 1579784..1580386 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229304.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 gene rpsD CDS complement(1580723..1581217) product DUF2716 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886642.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(1581421..1581906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(1582046..1582531) product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276532.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(1582686..1583054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(1583190..1583525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(1583565..1584032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(1584217..1584993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS complement(1585036..1585278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(1585280..1585537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(1585618..1585851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(1585844..1585996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(1585989..1586282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(1586292..1589993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(1589984..1591438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(1591435..1594557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(1594572..1594730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905722.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(1594775..1594969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(1594950..1595234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(1595237..1595566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(1595563..1595919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS complement(1595912..1596253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(1596240..1596533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(1596545..1596784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(1596798..1598063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(1598054..1598635) product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905713.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(1598628..1599824) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905712.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(1599828..1601555) product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031366181.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(1601552..1601899) product P27 family phage terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905710.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS complement(1602047..1602358) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023349146.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(1602385..1602924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS 1603013..1603246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS 1603334..1604023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(1604001..1604174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(1604254..1604703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(1605061..1606509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 1606810..1608759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(1608828..1609337) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012145.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(1609370..1609825) product ArpU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166128.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(1609866..1610045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(1610049..1610825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(1610776..1611540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(1611807..1612517) product ORF6C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905684.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(1612565..1612837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(1612858..1613070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 1613257..1613715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 1613726..1614154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 1614247..1615392 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387264.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(1615540..1615758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(1615886..1617151) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229300.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 gene tyrS CDS 1617553..1620477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(1620992..1622710) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399030.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 gene acsA CDS 1622873..1623505 product acetoin utilization protein acetyltransferase AcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229296.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene acuA CDS 1623545..1624189 product acetoin utilization AcuB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634583.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 1624186..1625358 product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092793.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 gene acuC CDS complement(1625401..1626405) product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229285.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 gene ccpA CDS complement(1626706..1627782) product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223454.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 1628107..1630227 product cell division FtsA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392752.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(1630262..1630594) product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229280.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene ytxJ CDS complement(1630698..1631195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(1631243..1631686) product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229276.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS 1631903..1633018 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(1633231..1634529) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229274.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene murC CDS complement(1634940..1637783) product DNA translocase SftA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229272.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene sftA CDS complement(1638001..1638816) product DUF1444 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967991.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(1638838..1639152) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838193.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(1639292..1639798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 1639959..1640276 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234476.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 1640394..1641326 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877935.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(1641408..1641926) product DUF84 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869966.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(1642007..1643080) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031503.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 1643923..1644234 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229259.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(1644275..1645123) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246020.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(1645201..1645842) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene trmB CDS 1646470..1646748 product YtzH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237926.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(1646745..1647536) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001986674.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(1647736..1649868) product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921725.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 gene pulA CDS complement(1649943..1650860) product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229243.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(1650987..1651907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229241.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS complement(1651939..1652625) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227015.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS complement(1652625..1653008) product CidA/LrgA family holin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673222.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(1653055..1653603) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418986.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene thpR CDS 1653803..1654735 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229237.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene cysK CDS complement(1654762..1655940) product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242781.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(1656055..1657449) product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399126.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 gene pepV CDS 1657787..1659088 product hypoxanthine/guanine permease PbuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229234.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene pbuO CDS 1659403..1659627 product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003152337.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(1659715..1660440) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234935.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(1660592..1662214) product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229224.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene murJ CDS 1662552..1663829 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229222.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(1663841..1664023) product sporulation protein Cse60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223398.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(1664024..1664263) product DUF2553 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533800.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS complement(1664375..1664689) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398993.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(1664797..1667211) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 gene leuS CDS complement(1667159..1667365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(1667687..1668010) product DUF4257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246114.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(1668352..1669539) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398741.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(1669695..1670099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(1670151..1671419) product ABC transporter permease YtrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398682.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 gene ytrF CDS complement(1671475..1672173) product ABC transporter ATP-binding protein YtrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229129.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene ytrE CDS complement(1672185..1673174) product ABC transporter permease YtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246175.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 gene ytrC CDS complement(1673168..1674046) product ABC transporter ATP-binding protein YtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398506.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene ytrB CDS complement(1674039..1674428) product GntR family transcriptional regulator YtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229121.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene ytrA CDS complement(1675133..1675294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(1675310..1675573) product YtzC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229117.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS 1675829..1676728 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968016.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS 1676725..1677303 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764471.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(1677363..1678442) product tetraprenyl-beta-curcumene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399076.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene tbcS CDS complement(1678456..1679250) product phospholipase YtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398545.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene ytpA CDS 1679358..1679879 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640212.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 1680098..1680664 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868576.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 1680712..1681854 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261636.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(1681938..1683218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 note possible pseudo, internal stop codon CDS 1683194..1683388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(1683435..1683821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24630 note possible pseudo, internal stop codon CDS complement(1684525..1685727) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene metK CDS 1686369..1687958 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229100.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene pckA CDS 1688308..1689501 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870329.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS 1689786..1690070 product CD3324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229850.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 1690196..1690840 product elongation factor G-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387072.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 1690853..1691635 product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129191.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(1691680..1691922) product DUF2584 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727325.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(1691976..1692758) product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246204.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS 1692893..1693879 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733143.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS 1693892..1694665 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009050.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS 1694652..1695458 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229090.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS 1695793..1696755 product serine protease Isp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232562.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene isp CDS complement(1696789..1697340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(1697444..1697914) product nucleoside triphosphatase YtkD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229087.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene ytkD CDS complement(1697980..1698312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435818.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(1698381..1698785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(1698912..1699352) product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229083.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS 1699459..1699623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS 1699874..1701223 product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027994.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(1701259..1702236) product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409939.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(1702249..1703256) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211478001.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS 1703412..1704569 product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258647.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS 1704654..1705556 product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246378.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene folE2 CDS complement(1705649..1707430) product peptidoglycan O-acetyltransferase OatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398729.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene oatA CDS complement(1707746..1708615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(1708602..1708952) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419063.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(1709097..1709936) product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399435.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(1709926..1710144) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231396.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS complement(1710155..1710637) product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809105.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(1710825..1711094) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831302.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 gene rpsN CDS complement(1711160..1711507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS complement(1711651..1712952) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948760.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(1713170..1714021) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228594.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 gene purU CDS complement(1714115..1714873) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385607.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(1714830..1715855) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531262.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS complement(1715876..1716736) product nickel ABC transporter permease subunit NikC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023381.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene nikC CDS complement(1716733..1717677) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024132.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS complement(1717679..1719238) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469196.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(1719320..1720207) product pseudopaline transport inner membrane protein CntI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104336.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene cntI CDS complement(1720201..1721463) product pseudopaline biosynthesis dehydrogenase CntM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112333.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 gene cntM CDS complement(1721460..1722281) product pseudopaline biosynthesis protein CntL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112332.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene cntL CDS complement(1722406..1722879) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219361.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 1723019..1723249 product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809333.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 gene yidD CDS complement(1723237..1723800) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838169.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS 1723949..1725124 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757677.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 1725246..1726331 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126148.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(1726359..1727279) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830339.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(1727354..1727596) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643433.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 1727767..1729113 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399130.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS 1729141..1730184 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229071.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 1730307..1730465 product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229069.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(1730532..1731416) product manganese ABC transporter permease MntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229067.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene mntD CDS complement(1731413..1732729) product manganese ABC transporter permease MntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229064.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene mntC CDS complement(1732736..1733494) product manganese ABC transporter ATP-binding protein MntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398644.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene mntB CDS complement(1733509..1734435) product manganese ABC transporter substrate-binding protein/adhesin MntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229060.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 gene mntA CDS complement(1734825..1735946) product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398737.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 gene menC CDS complement(1735927..1737387) product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229056.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS complement(1737458..1738276) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229054.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 gene menB CDS complement(1738303..1739106) product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398592.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 gene menH CDS complement(1739103..1740854) product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229050.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 gene menD CDS complement(1740841..1742262) product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398674.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 1742561..1743496 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425747.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 1743642..1744391 product yteA family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229046.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(1744461..1746866) product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494109.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene glgP CDS complement(1746856..1748307) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246015.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene glgA CDS complement(1748304..1749332) product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398841.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene glgD CDS complement(1749415..1750563) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968049.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS complement(1750514..1752445) product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398803.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 gene glgB tRNA complement(1753099..1753170) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(1753184..1753274) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 sequence03 source 1..55126 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 17..127 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 CDS 765..968 product anti-sigma-G factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243294.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene csfB CDS 1166..2590 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243352.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS 2596..3222 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243137.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene tmk CDS 3307..3639 product cyclic di-AMP receptor DarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242755.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene darA CDS 3649..4086 product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966249.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 4099..5094 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244417.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene holB CDS 5097..5924 product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272429.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS 5938..6306 product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412063.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 gene yabA CDS 6419..7135 product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244526.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 7122..7445 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242983.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS 7417..8295 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243457.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene rsmI CDS complement(8338..8616) product transition state genes transcriptional regulator AbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226760.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 gene abrB CDS 9210..11168 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134147.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 gene metG CDS 11260..12030 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS 12264..13478 product ubiquitin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226754.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 13630..14193 product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692835.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 gene rnmV CDS 14186..15067 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226751.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene rsmA CDS 15299..16189 product sporulation-specific protease PrtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243478.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene prtG CDS 16420..16689 product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218330.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS 16872..17057 product small, acid-soluble spore protein, alpha/beta type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218333.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 17227..18096 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226742.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 gene ispE CDS 18152..18985 product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078543208.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 gene purR CDS 19002..19376 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226738.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS 19568..19858 product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454041.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 gene spoVG CDS 20076..21431 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226732.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene glmU CDS 21523..22476 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107420.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 22717..23367 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243443.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 23560..24117 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226727.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene pth CDS 24181..24411 product anti-sigma-F factor Fin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243417.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 gene fin CDS 24550..28086 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 gene mfd CDS 28275..28811 product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218365.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 gene spoVT CDS 28963..30558 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243709.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS 30579..32042 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226718.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 gene mazG CDS 32061..32324 product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226716.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS 32407..32712 product sporulation protein YabP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226714.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 gene yabP CDS 32709..33338 product spore cortex biosynthesis protein YabQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243260.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 gene yabQ CDS 33351..33731 product cell division protein DivIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243211.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene divIC CDS 33813..34265 product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218379.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 tRNA 34437..34513 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 34522..34596 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 34862..37342 product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243026.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene spoIIE CDS 37446..38183 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243782.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 38149..39231 product serine/threonine protein kinase PrkT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966278.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene prkT CDS 39340..40728 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243704.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 gene tilS CDS 40750..41292 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226700.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene hpt CDS 41396..43327 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243881.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 gene ftsH CDS 43542..44309 product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578367.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 44328..45203 product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226695.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 gene hslO CDS 45227..46135 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243824.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 46255..47178 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261709.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene cysK CDS 47291..48709 product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189724.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 gene pabB CDS 48721..49305 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602293.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 gene pabA CDS 49305..50165 product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909893.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 gene pabC CDS 50180..51037 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002164656.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene folP CDS 51030..51392 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242949.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 gene folB CDS 51389..51916 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059445.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 gene folK CDS 51865..52074 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387031.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 52097..53098 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243741.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene dusB CDS 53208..54707 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242743.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene lysS sequence04 source 1..50453 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(419..1744) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833093.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(2077..3618) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244399.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 gene guaA CDS complement(3870..6053) product DUF4129 domain-containing transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242683.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(6050..7270) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831659.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(7270..8232) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242543.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(8668..9588) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966621.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(10143..10346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(10439..11488) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078275.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 11770..12558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 12555..13415 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801276.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 13388..14563 product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(14736..15443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(15662..16546) product beta-glucoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931557.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 gene bglK CDS complement(16646..17974) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261349.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(17987..19393) product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963707.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS complement(19409..19717) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963706.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(19719..20060) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966248.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(20196..20909) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226988.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 21111..21596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964816.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(21721..22047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(22470..22823) product DUF1048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891986.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(22859..23200) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429484.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(23379..24104) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246495.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 gene tatC CDS complement(24173..24379) product sec-independent protein translocase protein TatAD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223835.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 gene tatAD CDS complement(24399..26285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(26690..27322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(27322..27819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS complement(27896..29185) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067531.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(29296..30879) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304851.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(30854..32623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS complement(32712..33548) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532486.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(33548..34507) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067530.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS complement(34543..35631) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(35645..36802) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(37009..37305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(37593..38633) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974028.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(38963..40591) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243151.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 gene groL CDS complement(40634..40918) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003155970.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 gene groES CDS 41198..41932 product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234069.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS 41935..42135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS complement(42148..42909) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886426.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene tatC CDS complement(42916..43095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(43113..43754) product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234073.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(43751..44266) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243499.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene moaC CDS 44420..46336 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244150.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS complement(46566..47585) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414585.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene tsaD CDS complement(47582..48037) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243019.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 gene rimI CDS complement(48051..48740) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865740.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 gene tsaB CDS complement(48737..49198) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049642.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene tsaE CDS complement(49208..50188) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234080.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 gene thiL tRNA complement(50374..50449) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 sequence05 source 1..335445 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(388..600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 723..1487 product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235130.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 gene pdaB CDS complement(1523..2128) product KinB signaling pathway activation protein KbaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088527.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene kbaA CDS 2271..2906 product spore germination lipoprotein GerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235126.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene gerD CDS complement(3073..4131) product iron-sulfur carrier protein/transcriptional regulator SalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235124.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene salA CDS complement(4243..4956) product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399672.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene cwlD CDS complement(5029..5469) product DUF2521 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101005.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(5590..5982) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399691.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene rpsI CDS complement(6003..6440) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241966.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 gene rplM CDS complement(6594..7334) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001995175.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene truA CDS complement(7344..8141) product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399656.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS complement(8138..9004) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406513.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(8980..9822) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399689.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(10002..10364) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225836.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene rplQ CDS complement(10444..11388) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569643.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 gene rpoA CDS complement(11579..11968) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966385.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 gene rpsK CDS complement(11990..12355) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235095.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 gene rpsM CDS complement(12524..12742) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 gene infA CDS complement(12746..13054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(13073..13819) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225828.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 gene map CDS complement(13816..14469) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399686.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(14526..15821) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399662.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 gene secY CDS complement(15821..16261) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene rplO CDS complement(16294..16476) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156497.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 gene rpmD CDS complement(16490..16990) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003328273.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 gene rpsE CDS complement(17014..17376) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628816.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene rplR CDS complement(17410..17946) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399690.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene rplF CDS complement(17978..18376) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241998.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene rpsH CDS complement(18409..18594) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085700.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene rpsN CDS complement(18616..19155) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080831.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 gene rplE CDS complement(19180..19491) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156486.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene rplX CDS complement(19531..19899) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723686.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 gene rplN CDS complement(19938..20204) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225804.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene rpsQ CDS complement(20225..20428) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene rpmC CDS complement(20418..20852) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225801.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 gene rplP CDS complement(20855..21511) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235068.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 gene rpsC CDS complement(21515..21856) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148024.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene rplV CDS complement(21874..22152) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124453.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene rpsS CDS complement(22210..23040) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225795.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene rplB CDS complement(23070..23357) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156467.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 gene rplW CDS complement(23357..23980) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399658.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene rplD CDS complement(24008..24634) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399671.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene rplC CDS complement(24677..24985) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 gene rpsJ CDS complement(25327..26517) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235058.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene tuf CDS complement(26629..28707) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090364.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene fusA CDS complement(28767..29237) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137493.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene rpsG CDS complement(29289..29711) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225781.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene rpsL CDS complement(29820..30068) product 50S ribosomal protein L7ae-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225778.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS complement(30195..33794) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399688.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene rpoC CDS complement(33841..37422) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966326.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene rpoB CDS complement(37682..38287) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763279.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(38415..38780) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159736.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 gene rplL CDS complement(38838..39338) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235042.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 gene rplJ CDS complement(39584..40282) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235040.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 gene rplA CDS complement(40377..40802) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085872.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene rplK CDS complement(40974..41507) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225764.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 gene nusG CDS complement(41717..41896) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399676.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene secE CDS complement(41960..42109) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156421.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene rpmG CDS complement(42193..42912) product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966312.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 gene sigH CDS complement(42917..43426) product ribosome-dependent mRNA decay endonuclease Rae1/YacP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235032.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 gene rae1 CDS complement(43430..44173) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399684.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 gene rlmB CDS complement(44176..44592) product mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399685.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(44595..45992) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399682.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene cysS CDS complement(45943..46638) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476500.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene cysE CDS complement(46996..48453) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399675.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene gltX CDS complement(48532..49008) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225745.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 gene ispF CDS complement(49012..49689) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235019.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene ispD CDS complement(49702..50802) product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235014.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS complement(50998..52080) product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225736.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene disA CDS complement(52085..53467) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 gene radA CDS complement(53598..56048) product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 gene clpC CDS complement(56045..57136) product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235007.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(57138..57683) product protein-arginine kinase activator protein McsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966297.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 gene mcsA CDS complement(57699..58160) product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225724.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene ctsR rRNA complement(58790..58900) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA complement(58995..61921) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 rRNA complement(62127..63661) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 CDS complement(63929..64978) product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460119.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(65084..67603) product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244540.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 gene gyrA CDS complement(67889..69262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(69389..69637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS complement(69774..71702) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 gene gyrB CDS complement(71753..72007) product extracellular matrix regulator RemB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219266.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene remB CDS complement(72027..73136) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243515.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 gene recF CDS complement(73182..73400) product ribosome maturation protein RlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226810.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 gene rlbA CDS complement(73606..74742) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212886.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene dnaN CDS complement(74998..76344) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 gene dnaA CDS 77175..77309 product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240855.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene rpmH CDS 77476..77850 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242628.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene rnpA CDS 77979..78734 product YidC family membrane integrase SpoIIIJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886648.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene spoIIIJ CDS 78731..79351 product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243764.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS 79611..80996 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244507.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene mnmE CDS 81062..82951 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000541039.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 gene mnmG CDS 82985..83701 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243029.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 gene rsmG CDS 83831..84697 product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226829.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 gene noc CDS 84873..85634 product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 gene soj CDS 85627..86481 product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226832.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene spo0J CDS 86554..87255 product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236030.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS complement(87258..87881) product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243890.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 gene yyaC CDS 88059..88949 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364812.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 88949..89143 product DUF951 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226838.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS 89380..90480 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242727.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene ychF CDS 90594..90881 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233778.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene rpsF CDS 90923..91447 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721668.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene ssb CDS 91494..91733 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219224.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene rpsR CDS 91861..92790 product YybS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243969.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS 92875..94854 product cyclic-di-AMP phosphodiesterase GdpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242517.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 gene gdpP CDS 94851..95297 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226915.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 gene rplI CDS 95401..96765 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 gene dnaB CDS complement(96856..97017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 97233..98519 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243325.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene purA tRNA 98647..98720 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 99035..100483 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813688.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS 100704..101408 product cell wall metabolism DNA-binding response regulator WalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244363.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 gene walR CDS 101414..103258 product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968432.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 gene walK CDS 103248..104588 product WalRK two-component regulatory system regulator WalH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242498.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 gene walH CDS 104575..105381 product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383740.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS 105387..106181 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242676.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS 106299..107516 product serine protease HtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969578.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 gene htrC CDS 107716..107871 product CxxH/CxxC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219122.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS 107954..108433 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243164.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 gene rlmH CDS 108546..109262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS 109267..109653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS 109610..109933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS 110128..111000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS complement(111339..111860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS 112306..113214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS 113180..114637 product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392971.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 114637..115797 product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890704.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(115987..116703) product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399223.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS complement(116845..116997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(117109..118074) product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399225.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 118313..119047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS complement(119340..120551) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089891.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 120861..122078 product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028040.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(122116..123351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS complement(123365..123841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS complement(123857..124330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS complement(124516..125811) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157713.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS 125933..127150 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212348.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(127212..128378) product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014749.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS 128631..128810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS complement(129067..129885) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814111.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS complement(129885..130916) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814109.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS complement(130913..131908) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459473.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS complement(131949..133004) product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198708.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 133444..134790 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234143.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS complement(134835..135326) product DUF4188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141249.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS complement(135329..135883) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144143.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 136236..137735 product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078186907.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS 137880..138395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(138533..139954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS 140060..140749 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886529.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS 140832..141743 product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242581.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS 141803..142783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS 143118..144014 product Mph(B) family macrolide 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031017.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS 144146..145018 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234236.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS 145101..146033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(146064..148007) product bacitracin ABC transporter permease BceB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229139.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene bceB CDS complement(147997..148758) product bacitracin ABC transporter ATP-binding protein BceA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229137.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 gene bceA CDS complement(148860..149864) product two-component sensor histidine kinase BceS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398652.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 gene bceS CDS complement(149861..150550) product two-component response regulator BceR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399109.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 gene bceR CDS complement(150652..151848) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723548.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS complement(151860..152288) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343680.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 152474..154354 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243561.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene htpG CDS 154690..154935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 154936..155265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS complement(155394..156467) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721374.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(156464..157267) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721373.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(157269..158072) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721372.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(158062..159168) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014601365.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 159456..160211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(160253..161482) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244314.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 gene pepT CDS complement(161488..162432) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259330.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS 162557..163165 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227303.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 163629..164321 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949146.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 164299..166515 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986267.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS complement(166726..168192) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836876.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS 168399..169937 product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS 169952..171235 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014902978.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 171247..172407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 172559..173161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 173316..173813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 173857..174522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS 174553..175203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 175305..175889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS 175923..176579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS 176681..177268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 177344..177961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 178065..178649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 178721..179371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 179535..180119 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244157.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS 180147..182102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242583.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS 182118..182444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS 182729..183022 product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220661.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS 183115..183354 product ESX secretion system protein YukD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228763.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene yukD CDS 183369..184694 product type VII secretion protein EssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243575.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 gene essB CDS 184718..189199 product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243866.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 gene essC CDS 189196..192090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS 192074..192583 product type VII secretion protein EssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886603.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene essA CDS 192657..193622 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645284.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 193728..194042 product CHY zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127269.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS 193969..194199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(194289..194543) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181712.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS 194733..195920 product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235507.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS 196012..197001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS complement(197015..197575) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506639.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS 197989..199179 product ParM/StbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025624.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 199193..199753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(199879..200076) product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS complement(200076..200246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 200398..201708 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 201806..203017 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983287.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 203020..203925 product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972041.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS 204107..204715 product YhbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102258.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 204735..205517 product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890721.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS complement(205749..207305) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178940855.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS complement(207446..207805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS 207907..208821 product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849692.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 208859..211036 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047293.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 gene topB CDS 211813..212865 product cytochrome aa3 quinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886637.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 gene qoxA CDS 212886..214832 product cytochrome aa3 quinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227407.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 gene qoxB CDS 214847..215488 product cytochrome aa3 quinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227409.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 gene qoxC CDS 215478..215789 product cytochrome aa3 quinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227410.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 gene qoxD CDS complement(215829..216113) product spore morphogenesis/germination protein YwcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227411.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 gene ywcE CDS 216429..217376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184231.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(217434..218774) product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986374.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS 218740..218940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS 218979..219728 product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244098.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 gene nfsA CDS 219776..220438 product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830963.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS 220647..222257 product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272455.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS 222251..222835 product chromate resistance efflux protein ChrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227840.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 gene chrA CDS 222832..223362 product chromate resistance efflux protein ChrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227840.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 gene chrA CDS 223727..224548 product sac operon transcriptional antiterminator SacT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243088.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 gene sacT CDS 224734..226113 product PTS system sucrose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227426.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 gene scrA CDS 226213..227163 product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS 227178..228611 product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886636.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 gene sacA CDS complement(229024..229839) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242645.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS complement(229971..230711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS complement(230948..231265) product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233729.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS 231964..232767 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242519.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS 232875..233639 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966274.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS 233656..233958 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689616.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS 233974..234645 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242965.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS complement(234727..235074) product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233729.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 235211..235381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS 235398..235688 product YwdI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243806.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS 235754..236158 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227446.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 236300..236710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS complement(236749..237195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(237375..238118) product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287595.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS 238370..239341 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243393.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 gene pta CDS 239432..240274 product octanoyl-[GcvH]:protein N-octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227511.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene ywfL CDS complement(240767..241522) product prespore-specific transcription regulator RsfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243464.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 gene rsfA CDS 241808..242032 product DUF1450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222050.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS 242158..243459 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243873.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS 243536..244042 product YwgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227524.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(244076..244261) product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147171.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS 244348..245010 product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372445.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS 245023..245538 product YwhD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136678.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS complement(245679..247745) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227540.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS 247993..248823 product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424696.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene speE CDS 248840..249721 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227545.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 gene speB CDS 249885..250316 product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243604.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS 250313..251983 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene argS CDS 252152..252547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(252559..253515) product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227599.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 gene uvsE CDS complement(253537..254739) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966421.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 gene cls CDS 254946..257057 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086758.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS 257206..258384 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047982.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS 258402..259256 product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538874.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS 259281..260420 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074554312.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 260665..261804 product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 gene acdA CDS 261832..262470 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238599.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS 262496..265759 product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS 266385..267401 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388651.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS 267604..268209 product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246350.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS 268283..268861 product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234723.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS 269163..270380 product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028308.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS 270319..271692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29140 note possible pseudo, frameshifted CDS 271685..272803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29150 note possible pseudo, frameshifted CDS 272815..273627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028306.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS 273718..273933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 273967..275568 product YceG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246317.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS 275642..276727 product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234715.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 277160..277708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 277991..279598 product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227612.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 gene pyrG CDS complement(279661..280194) product DUF2529 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912402.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS 280487..280858 product sporulation initiation phosphotransferase Spo0F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227621.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 gene spo0F CDS 281048..281905 product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243339.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS 282024..282668 product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227626.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 gene fsa CDS 283147..284436 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227628.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS 284485..285447 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242962.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 gene glpX CDS 285738..287021 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221939.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 gene rho CDS 287145..287345 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 gene rpmE CDS 287558..288181 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243018.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS 288261..288671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS complement(288708..289229) product chromosome-anchoring protein RacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227642.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 gene racA CDS complement(289384..289806) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017671.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS 289989..291059 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227645.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 gene prfA CDS 291062..291934 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267042.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 gene prmC CDS 292171..292902 product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227654.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 gene spoIIR CDS 293020..293460 product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758435.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS 293624..294664 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557353.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS 294755..295315 product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227661.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS 295455..295904 product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832356.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 295925..296368 product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221910.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 gene rpiB CDS 296382..296957 product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136366.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS 297151..298386 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001981400.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 gene glyA CDS complement(298435..299262) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243397.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS complement(299592..299996) product YfmQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243426.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 300193..300822 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227670.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 gene upp CDS 300895..303141 product serine protease Vpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227419.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 gene vpr CDS 303326..303547 product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171223.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS 303555..303923 product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243159.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 gene atpI CDS 303944..304654 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242621.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 gene atpB CDS 304714..304926 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052064.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 gene atpE CDS 305103..305627 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244051.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 gene atpF CDS 305624..306169 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243176.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 306185..307693 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243657.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 gene atpA CDS 307781..308641 product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244388.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 gene atpG CDS 308691..310112 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227686.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 gene atpD CDS 310139..310543 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227688.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS 311040..311849 product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583991.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS 311846..313276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 313282..314847 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 314933..315598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS 315595..315744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS 315790..316833 product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936757.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 gene xylF CDS 316932..318455 product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393517.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS 318452..319630 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208974840.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene gguB CDS 319721..321190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS 321271..321543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234883.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS complement(321608..322807) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365630.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS 322966..323952 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803848.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(324124..324627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS 324844..325218 product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179273.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene nuoA CDS 325209..325730 product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236331.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 gene nuoB CDS 325720..326952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS 326956..328056 product NADH-quinone oxidoreductase subunit NuoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621434.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 gene nuoD CDS 328056..329060 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573431.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 gene nuoH CDS 329099..329518 product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677191.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 gene nuoI CDS 329515..330033 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012801.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS 330030..330344 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100078.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene nuoK CDS 330374..332239 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568230.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 gene nuoL CDS 332239..333750 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998926.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS 333757..335247 product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367506.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 gene nuoN sequence06 source 1..604649 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(504..1262) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086102.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS complement(1264..2265) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715551.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS complement(2280..3065) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057157.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(3040..3330) product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082906.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS 3886..4458 product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228966.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 gene thiT CDS 4551..4739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(5187..5984) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976957.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS complement(6083..6604) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228963.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS 6723..7787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS complement(7832..8734) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841809.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS 8871..10520 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244755.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS 10577..11065 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242867.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(11147..11518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS 11694..12194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29950 tRNA 12303..12375 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(12489..14192) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461506.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS complement(14522..15604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(15796..17157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS complement(17341..19737) product M6 family metalloprotease immune inhibitor InhA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035926.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 gene inhA1 CDS 20021..20338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(20400..21239) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368275.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS complement(21296..22249) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059329.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS 22385..22576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS complement(22732..24174) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039351.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(24320..25090) product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231267.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS complement(25574..26458) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246070.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS complement(26632..27744) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395264.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS 28088..28996 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063174092.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS 29175..30593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS complement(30725..30943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 31194..31598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245685.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(31714..32184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS complement(32177..32674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS 32872..33699 product RsbT co-antagonist protein RsbRD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398754.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 gene rsbRD CDS 33806..34696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS complement(34773..35138) product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229458.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS complement(35161..36147) product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228926.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 gene iolU CDS complement(36223..36918) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886431.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS complement(37081..40293) product surfactin resistance protein SrfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242663.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 gene srfP CDS 40509..41351 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659627.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(41399..42013) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246159.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS complement(42078..42524) product DUF6376 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695200.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS complement(42798..43100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS complement(43200..45068) product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232350.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS complement(45090..46001) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244923.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 gene pfkB CDS complement(45998..46750) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957281.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS complement(46897..48657) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453879.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS 48810..49589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30280 note possible pseudo, internal stop codon, frameshifted CDS 49603..50067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30290 note possible pseudo, internal stop codon, frameshifted CDS complement(50134..51525) product L-cystine transporter TcyP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244685.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 gene tcyP CDS 51722..52549 product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635337.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(52574..52834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244393.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(52884..53513) product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858074.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 gene kynB CDS complement(53510..54778) product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276276.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 gene kynU CDS complement(54765..55853) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229861.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS 56020..56424 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674794.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS 56481..56813 product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967371.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(57539..58456) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074553996.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(58437..58853) product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243483.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS complement(58938..60599) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044735.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(60856..62091) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649370.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(62201..63514) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402274.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(63627..64934) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393641.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS 65073..65315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS 65330..66322 product potassium channel protein KbfO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242502.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 gene kbfO CDS complement(66319..66723) product YugN-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612334.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(67044..67193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS complement(67314..68663) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103658.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS complement(68807..69970) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228869.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS 70130..70363 product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220771.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS complement(70446..70844) product S1 domain-containing post-transcriptional regulator GSP13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228864.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 gene yugI CDS complement(71048..72685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(72678..73235) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256305.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(73431..74600) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968069.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS complement(74597..75097) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968070.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS 75366..76160 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228858.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS complement(76199..76459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 76566..77732 product cystathionine beta-lyase PatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228854.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene patB CDS 78025..79323 product sporulation sensor histidine kinase KinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228853.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 gene kinB CDS 79334..79732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS complement(79842..80042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 80198..80587 product kinase-associated lipoprotein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209332.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS complement(80615..81238) product 3'-5' exonuclease KapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344361.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 gene kapD CDS 81464..82642 product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228842.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS 83447..85309 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886602.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS 85368..85766 product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS complement(85818..86375) product YufK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228837.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(86793..87020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS 87237..89627 product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228821.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS 89624..90058 product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228819.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 90058..90399 product Na(+)/H(+) antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220730.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS 90392..91873 product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244432.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS 91879..92355 product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244015.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS 92355..92645 product Na(+)/H(+) antiporter subunit F1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228814.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS 92623..92988 product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244302.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 gene mnhG CDS 93088..93681 product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553324.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(93728..94297) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231441.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS complement(94322..94714) product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140612.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS complement(94728..95663) product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967290.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(96050..96748) product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161449.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS complement(97019..97660) product two-component system response regulator ComA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220716.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 gene comA CDS complement(97741..100053) product two-component system sensor histidine kinase ComP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242894.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 gene comP CDS complement(100086..100247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS complement(100251..101177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(101324..101464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(101693..101920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS complement(102034..102636) product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868563.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS complement(102737..103639) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442783.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS complement(103701..104933) product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243525.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 gene pdeH CDS complement(105034..106305) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212371.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS 106442..106582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS complement(106780..108027) product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790938.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(108489..108878) product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247558.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS 109356..110816 product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231423.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 gene hpaB CDS complement(110813..112861) product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399552.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS complement(112967..113935) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398480.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS complement(114024..114245) product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242933.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS complement(114352..115458) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243652.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS complement(115949..117286) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966903.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(117371..117784) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285639.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS 118137..118691 product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852222.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS complement(118765..118986) product YuzF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220677.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS 119170..120675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238727.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS complement(120745..121278) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244444.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS 121465..121938 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810530.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(122050..122592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS complement(122742..123494) product (S)-benzoin forming benzil reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244421.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS complement(123566..128101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS complement(128449..129852) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451037.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS 130133..131362 product sporulation transcriptional activator AdeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886604.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene adeR CDS 131503..132633 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243280.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 gene ald CDS complement(132995..133717) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687920.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS 133865..134794 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986545.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS complement(134791..136557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(136673..137269) product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228739.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS 137374..137958 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252167.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(138107..138640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS 138826..138984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS complement(139023..140351) product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228736.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS complement(140552..142042) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228733.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS complement(142073..142456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS 142615..143094 product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244337.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS 143107..143922 product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888014.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(144539..145213) product stationary phase survival protein SpsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969090.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 gene spsC CDS complement(145360..145677) product YuiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243877.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS complement(145742..145870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS complement(146035..146517) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415298.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS complement(146623..147837) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886605.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS 148229..149224 product ferredoxin--NADP reductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220618.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 gene yumC CDS complement(149480..150310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS complement(150454..150816) product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244166.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS complement(150900..151760) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243745.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 gene dapF CDS complement(151896..153119) product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243750.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS complement(153763..153999) product YuzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595027.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 154285..155352 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242518.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(155434..155760) product YuzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242597.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS 155959..156198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31370 note possible pseudo, frameshifted CDS complement(156245..158218) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243690.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS complement(158343..159281) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228699.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 gene thrB CDS complement(159275..160336) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228697.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene thrC CDS complement(160333..161631) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228694.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS complement(161864..162037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS complement(162091..163056) product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468866.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS complement(163121..164131) product spore coat-associated protein CotNH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242649.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 gene cotNH CDS 164283..164783 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243814.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS complement(164834..165604) product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276467.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS complement(165870..166307) product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274012.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS 166429..166695 product DUF3055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392606.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS 166747..167034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS complement(167066..167341) product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228682.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 167451..168125 product YhcN/YlaJ family sporulation lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243821.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS complement(168171..169067) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222888.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 gene lipA CDS 169282..170271 product L-Ala--D-Glu endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243462.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 gene lytH CDS complement(170414..171919) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450066.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS complement(172136..173692) product tetracycline efflux Na+/H+ antiporter family transporter Tet(35) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480402.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 gene tet(35) CDS complement(174124..174891) product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968113.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 gene yunB CDS complement(174994..175296) product YunC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242587.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS complement(175358..176758) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242525.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS complement(176792..177616) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455757.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS complement(177636..178493) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243895.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS complement(179003..180400) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228608.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 gene sufB CDS complement(180488..180916) product iron-sulfur cluster assembly scaffold protein SufU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009523.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 gene sufU CDS complement(180906..182126) product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228604.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene sufS CDS complement(182126..183430) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228602.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 gene sufD CDS complement(183448..184233) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151872.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 gene sufC CDS complement(184403..184573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS complement(184770..185138) product carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162837647.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS complement(185908..186735) product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735103.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 gene metQ CDS complement(186750..187406) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359401.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS complement(187399..188460) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242531.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 gene metN CDS complement(188880..190196) product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272631.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS complement(190451..190771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(190914..191222) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002008881.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS complement(191243..191590) product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640869.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(191722..191964) product YusG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228581.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS complement(192018..192401) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222781.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 gene gcvH CDS complement(192463..192825) product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222779.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(192995..194779) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416279.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS complement(194814..195989) product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228574.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS complement(196004..198388) product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486377.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS 198636..198785 product YuzL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228571.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(198834..199748) product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS 199850..200119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228567.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS 200132..200470 product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228564.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS complement(200523..201071) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843675.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS 201176..201394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(201433..201696) product YusU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228549.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(201711..202454) product IucA/IucC family C-terminal-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267803.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS complement(202451..203263) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886609.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(203298..204353) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760047.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(204350..205351) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242478.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS 205530..206528 product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106346642.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS complement(206611..208239) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229182.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS 208383..209108 product ZIP family zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225190.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS complement(209138..210472) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383526.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS complement(210473..211129) product potassium uptake protein KtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243377.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 gene ktrA CDS complement(212100..214517) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003185.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS complement(214867..215073) product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244260.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 gene copZ CDS complement(215094..215420) product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS complement(215484..216161) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238949.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS complement(216158..217516) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822542.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS complement(217632..218879) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814826.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS 219301..220035 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758837.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS complement(220093..221886) product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990142.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS complement(222021..222197) product sec-independent protein translocase protein TatAY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234072.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 gene tatAY CDS 222454..222702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 222716..224128 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244227.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS complement(224160..224576) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460168.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS complement(224593..225744) product KdpD-like non-kinase potassium sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181481.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 gene kdpDN CDS complement(226036..226620) product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412605.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 gene kdpC CDS complement(226641..228764) product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248019.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 gene kdpB CDS complement(228785..230461) product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638330.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 gene kdpA CDS complement(230680..231063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424073.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS complement(231206..231406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(231370..231765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS 232619..232996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS 233502..234839 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393265.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 gene glnA CDS 235027..236409 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809373.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS complement(236457..237635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS 237850..238431 product efflux pump transcriptional regulator FepR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722345.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 gene fepR CDS 238533..238871 product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706751.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS 238871..239185 product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312623.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS 239199..240098 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947043.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS complement(240543..241067) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246192.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS complement(241089..241748) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 gene fabG CDS complement(241840..242208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS complement(242366..242914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS complement(242904..243395) product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230521.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 gene sigX CDS complement(243506..244402) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398525.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS 244535..245380 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034812.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS complement(245383..246339) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836485.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS complement(246957..248162) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501370.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS complement(248182..249015) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721578.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(249025..249675) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467994.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS complement(249665..250696) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622979.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS complement(250689..250856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(251146..251568) product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130472.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS 251648..251866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 251894..252664 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS 252694..253428 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184045.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS complement(253534..253908) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS 254300..254449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS 254446..258975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS complement(259232..259807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246043.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS complement(260188..260346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(260354..260542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS 261023..269431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS 269433..269858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS complement(270223..270495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS complement(271511..272140) product DUF2185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089860.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS complement(272175..272753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS 272880..273080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS 273271..273744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(273854..274285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093107.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS 274845..276461 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021571.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 gene metG CDS complement(276480..277835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS complement(277832..278512) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044826408.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS complement(278524..278961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS complement(278976..280148) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931069.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS complement(280145..280831) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002993627.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS complement(280832..281737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS complement(282295..282924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(282985..283929) product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399848.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 gene hutG CDS complement(283901..285184) product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244327.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 gene hutI CDS complement(285196..286848) product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243634.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 gene hutU CDS complement(286845..288377) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631841.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 gene hutH CDS complement(288496..288942) product hut operon transcriptional regulator HutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243875.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 gene hutP CDS complement(289028..289348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS complement(289348..289554) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250290.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS complement(289685..293416) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028358.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS complement(293740..295218) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS 295423..295665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS complement(295619..296872) product serine protease Do-like protein HtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228534.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 gene htrB CDS 297386..298054 product secretion stress-responsive two-component system response regulator CssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228529.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 gene cssR CDS 298054..299397 product secretion stress-responsive two-component system sensor histidine kinase CssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228527.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 gene cssS CDS 299544..300095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS complement(300235..300693) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021653.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS complement(300763..302322) product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064214.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS complement(302319..303977) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879007.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS 304129..304437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS 304431..305321 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932683.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS 305322..306320 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269958.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS complement(306388..306543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS complement(306616..306795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS complement(306884..308269) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228523.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 gene fumC CDS 308467..308754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS complement(308782..309471) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS complement(309481..309858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS 310030..311151 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290155.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 gene msrB CDS complement(311198..313033) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994077.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS complement(313440..313616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS complement(313777..314892) product spore germination protein GerKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000474043.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 gene gerKC CDS complement(314873..315988) product GerAB/ArcD/ProY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185786.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS complement(315967..317508) product spore germination protein GerKA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208313.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene gerKA CDS complement(317652..318986) product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289543.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS 319217..320149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS 320146..321030 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965671.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS complement(321077..322279) product oxalate decarboxylase family bicupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747527.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS complement(322438..323205) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886409.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS complement(323198..324103) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246573.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS complement(324212..324763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS complement(325062..325763) product lysozyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231283.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS 325919..326356 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633757.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS complement(326353..326538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS complement(326759..327559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(327584..329122) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254941.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 gene gntK CDS complement(329233..330132) product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195924.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 gene gnd CDS 330278..331123 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119646.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS 331369..331932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505543.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS complement(331960..332277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS 332412..332843 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343680.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS 332848..334065 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190318.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS complement(334119..334607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS 334718..335050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS complement(335808..336635) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS complement(336648..337544) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257890.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(337684..338934) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989565.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS complement(338995..341109) product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085539.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS complement(341202..342206) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS 342402..342887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS complement(342946..343257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS complement(343257..344150) product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989568.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS complement(344285..345016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS complement(345013..345993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS complement(346018..347283) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920960.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS 347546..348511 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234685.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS complement(349040..351175) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485759.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS complement(351165..351536) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592531.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS 351682..351996 product Zn(II)-responsive metalloregulatory transcriptional repressor CzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231284.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 gene czrA CDS complement(352046..352963) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723624.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS complement(353139..354119) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206490.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS complement(354112..355029) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989559.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS complement(355019..355831) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931622.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS 356010..356675 product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204015.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS complement(357023..358462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219770990.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS complement(358526..359443) product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706367.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS complement(359470..360222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS complement(360164..360337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(360297..361061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS complement(361058..362533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS complement(362520..363161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS 363249..363437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(363430..364437) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545846.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS complement(364463..365659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS complement(365834..366448) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243118.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS complement(366550..367959) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123146.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS 368139..368516 product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980551.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS complement(368569..369345) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229890.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS complement(369400..369627) product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229888.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS complement(369663..370790) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967833.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS complement(370834..371400) product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023951.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS complement(371443..371730) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661705.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS complement(371745..372104) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092318.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS complement(372125..372604) product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229885.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS complement(372719..372979) product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456206.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS complement(372997..373335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS 373513..373674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS complement(373831..376443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33580 tmRNA complement(376874..377238) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(377395..377865) product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 gene smpB CDS complement(377960..380350) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391084.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 gene rnr CDS complement(380369..381112) product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242610.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS complement(381467..381700) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220028.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 gene secG CDS 381874..382797 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733747.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS 382976..383899 product nuclease-related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635759.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS complement(384452..385744) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228333.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 gene eno CDS complement(385770..387305) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228330.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 gene gpmI CDS complement(387298..388059) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243394.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 gene tpiA CDS complement(388088..389272) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243051.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS complement(389397..390404) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219957.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 gene gap CDS complement(390458..391531) product gapA transcriptional regulator CggR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968188.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 gene cggR CDS complement(391685..391942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS complement(391954..393270) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242595.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 gene rpoN CDS 393349..393567 product protein YvfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219905.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 gene yvfG CDS complement(393737..394762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33740 tRNA complement(394961..395039) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 395253..396272 product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052948656.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS 396461..397060 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049162.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 gene clpP CDS complement(397692..397949) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS complement(397974..398924) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243775.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 gene whiA CDS complement(399030..399989) product gluconeogenesis morphogenetic factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244450.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 gene mgfK CDS complement(399989..400876) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243903.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 gene rapZ CDS complement(400934..401314) product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886622.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS complement(401739..402689) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243021.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 gene trxB CDS complement(402791..404260) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242799.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS complement(404487..405116) product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243045.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 gene hisIE CDS complement(405113..405871) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244585.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 gene hisF CDS complement(405868..406605) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242559.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 gene hisA CDS complement(406602..407237) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244267.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 gene hisH CDS complement(407238..407825) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243389.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 gene hisB CDS complement(407838..409106) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243286.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 gene hisD CDS complement(409103..409744) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968235.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 gene hisG CDS complement(409737..410912) product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244441.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS complement(411436..411966) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255064.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS complement(411970..412611) product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222403.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 gene ppaX CDS complement(412601..413551) product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243723.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS complement(413556..414374) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242661.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 gene lgt CDS complement(414397..415332) product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228097.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 gene hprK CDS 415616..416311 product sporulation-specific N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244862.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 gene cwlC CDS complement(416345..417250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS 417364..417747 product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242893.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 gene mscL CDS complement(417774..418142) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228066.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS complement(418145..418345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS complement(418352..419470) product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228061.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS complement(419522..419842) product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678055.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS complement(420445..423321) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228057.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 gene uvrA CDS complement(423328..425310) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 gene uvrB CDS complement(425556..425795) product CsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722623.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS complement(425811..427400) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722853.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS complement(427652..429052) product two-component system sensor histidine kinase YclK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969263.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 gene yclK CDS complement(429049..429747) product two-component system response regulator YclJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246532.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 gene yclJ CDS 429938..431401 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234506.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS 431414..432109 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234507.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS 432254..433231 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066670.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS 433604..434518 product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015052.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 gene ctaB CDS complement(434549..434869) product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671654.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS 435011..435169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS 435247..435579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS complement(435667..436395) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240990.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS complement(436692..437870) product cell division topological determinant MinJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242631.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 gene minJ CDS complement(437959..438333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS complement(438689..440158) product carboxy-terminal processing protease CtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228041.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 gene ctpB CDS complement(440314..441666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS complement(441757..442647) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968247.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 gene ftsX CDS complement(442640..443326) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228039.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 gene ftsE CDS complement(443737..444066) product cytochrome c-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727964.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 gene cccB CDS complement(444120..444986) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242677.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS complement(445177..445797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS complement(446322..447308) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 gene prfB CDS complement(447479..449995) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228033.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 gene secA CDS complement(450252..450554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS complement(450682..451254) product ribosome hibernation promotion factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228031.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 gene hpf CDS complement(451645..452034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS complement(452018..452368) product flagella biosynthesis regulatory protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242603.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 gene fliT CDS complement(452368..452769) product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243747.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 gene fliS CDS complement(452786..454564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS complement(454579..454911) product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968250.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 gene flaG CDS 454991..455146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS complement(455901..457109) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272513.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS complement(457287..457505) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219727.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 gene csrA CDS complement(457505..457933) product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228007.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 gene fliW CDS complement(457952..458506) product DUF6470 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243053.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS complement(458550..459431) product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228004.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 gene flgL CDS complement(459442..460962) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228001.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 gene flgK CDS complement(460981..461463) product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227999.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 gene flgN CDS complement(461481..461738) product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227997.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 gene flgM CDS complement(461804..462217) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227995.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS complement(462276..462965) product comF operon protein ComFC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227991.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 gene comFC CDS complement(462962..463237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS complement(463318..464298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS complement(464769..464954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS complement(465169..466011) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844766.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS complement(466195..466878) product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219701.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 gene degU CDS complement(466951..468108) product two-component sensor histidine kinase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227983.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 gene degS CDS 468257..468892 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227979.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS 468907..469890 product polyisoprenyl-teichoic acid--peptidoglycan teichoic acid transferase TagV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244117.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 gene tagV CDS complement(469912..470898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS complement(470895..472274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(472296..472655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS complement(472801..474219) product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048103.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS complement(474318..474989) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891044.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS complement(475209..475961) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242619.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS complement(476168..477082) product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986973.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS complement(477079..478398) product UDP-glucose 6-dehydrogenase TuaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242596.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 gene tuaD CDS complement(478424..479305) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002097988.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 gene galU CDS 479629..481050 product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085030.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS complement(481101..481904) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897935.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS complement(481924..482856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS complement(482813..483964) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524118.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS complement(484072..486294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS complement(486346..487110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS complement(487187..489277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS complement(489462..494096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS complement(494513..496372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS complement(496481..497263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34730 CDS complement(497412..498728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS 499095..500039 product transcription antiterminator LytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227949.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 gene lytR CDS 500230..503544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS complement(503716..505515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS complement(505631..505894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS complement(505947..506699) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245342.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS complement(506838..507359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS complement(507510..507833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS complement(508755..510314) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027258.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS complement(510370..512667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS complement(512740..514233) product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256992.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS complement(514282..515172) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057222.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS complement(515177..516052) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056604.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS complement(516049..516939) product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805026.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS complement(516967..517818) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289254.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS complement(517772..518506) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430452.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS complement(518578..519879) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920974.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS complement(519884..520534) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084007.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS complement(520810..522060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS complement(522326..522490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS 522636..522860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS complement(523069..523458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS complement(523436..525232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS complement(525229..527130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS complement(527134..530346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS 530733..531497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733102.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS complement(531494..531718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS 531639..532616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS complement(532706..533737) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 gene galE CDS 534029..535846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS complement(536039..536875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35040 repeat_region 537260..537441 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aatcctctaaacgaggctattagtatttctac CDS 538106..538852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS complement(538889..539218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS 539571..539975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS 540186..540398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS complement(540623..540790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS complement(540787..541023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS complement(541242..541376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS 541696..541875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35120 repeat_region 543299..543484 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgttaatcctctaaacgaggctattggtatttctac CDS complement(544874..545608) product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068143.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 repeat_region 545894..546315 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttaatcctctaaacgaggctattagtatttctac CDS complement(546690..546998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS complement(546988..548121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS 548274..548504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS complement(548630..549523) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949138.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS complement(549721..550671) product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244253.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 gene manA CDS complement(550704..551774) product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989598.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS complement(551799..552746) product DUF1861 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213840.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS 552979..554238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS 554295..555230 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114399.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS 555330..556175 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS 556189..556884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS 556881..557894 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721423.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS complement(558035..559039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS complement(559177..560127) product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244253.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 gene manA CDS complement(560166..561902) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104191.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS complement(562013..563080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS complement(563084..564463) product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046233294.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS complement(565027..566601) product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103238290.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS complement(566609..567484) product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006843524.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS complement(567506..568435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS complement(568432..569691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS complement(569681..570643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS complement(570640..571752) product lipid galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557046.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS complement(571766..572299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS complement(572322..573143) product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288211.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS complement(573935..575014) product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107662.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 gene gmd CDS complement(575038..575976) product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS complement(575994..576674) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060578.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS complement(576690..577577) product UTP--glucose-1-phosphate uridylyltransferase BpsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757832.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 gene bpsC CDS complement(577596..578924) product UDP-glucose 6-dehydrogenase UglF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243223.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 gene uglF CDS complement(579144..579908) product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099684015.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS complement(580004..580702) product tyrosine-protein kinase PtkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244182.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 gene ptkA CDS complement(580692..581441) product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393128.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS complement(581671..581802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS complement(581958..582101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS 582361..583971 product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227806.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS 583961..586717 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227803.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS 586935..588920 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104325.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS complement(589057..589434) product single-stranded DNA-binding protein SsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227798.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 gene ssbB CDS complement(589592..589990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS 590284..590694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS 590792..591247 product YwpF-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227794.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS complement(591266..591541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS complement(591602..592420) product nuclease-related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635759.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS complement(593459..593893) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221796.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 gene fabZ CDS complement(593961..594224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS complement(594237..595028) product flagellar hook-basal body complex protein FlhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244381.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 gene flhP CDS complement(595039..595827) product flagellar hook-basal body complex protein FlhO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244097.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 gene flhO CDS complement(596020..597021) product cell shape-determining protein Mbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227776.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 gene mbl CDS complement(597171..597446) product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221804.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 gene spoIIID CDS complement(597799..598737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS 598913..599341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS 599348..599842 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193331.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS complement(599938..600963) product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243408.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 gene spoIID CDS complement(601070..601504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS complement(601671..602975) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227695.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 gene murA CDS complement(603008..603748) product YwmB family TATA-box binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244344.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS complement(603991..604221) product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227691.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 sequence07 source 1..303319 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(322..1194) product nucleotidyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243727.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS 1398..1751 product YgzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025063.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS complement(1845..2282) product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223285.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 gene perR CDS complement(2399..3352) product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989785.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 CDS complement(3507..3974) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233532.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 gene bcp CDS complement(4038..4442) product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964343.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 CDS complement(4523..5182) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906541.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 gene modB CDS complement(5172..5942) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031846.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 gene modA CDS 6059..7354 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233535.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 CDS 7668..12140 product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932983.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS 12386..13468 product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765785.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS complement(13508..14065) product YdhK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242997.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS complement(14445..15341) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS complement(15359..16360) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110329.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS complement(16553..18160) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS complement(18211..19179) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS complement(19160..20170) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861634.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS complement(20484..22226) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966836.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS complement(22358..22888) product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223272.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS complement(23028..23285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS 23490..24041 product phosphatidylethanolamine N-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509340.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS 24063..25571 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160471.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS complement(25809..26789) product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531471.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS complement(26967..27176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS complement(27157..27324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS complement(28549..28734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS complement(28818..29570) product enoyl-[acyl-carrier-protein] reductase FabL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223262.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 gene fabL CDS 29660..29884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233542.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS complement(29913..31007) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243838.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 gene mutY CDS 31242..32222 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244136.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS complement(32257..32526) product YfhJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243789.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS 32626..32787 product small, acid-soluble spore protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223241.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS 32820..32978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS complement(33016..33357) product YfhH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244592.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS 33430..34086 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403642.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS complement(34092..34904) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243354.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 gene recX CDS 35068..35964 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244332.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS 35994..37124 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698319.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS 37276..37473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS 37582..38139 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914736.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS 38924..39106 product YfhD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233561.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS complement(39544..40680) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233750.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS 40888..42594 product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268782.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS 42591..44057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS 44075..44716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS complement(44771..45154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS 45428..47170 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129119821.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS complement(47217..48092) product enantioselective carboxylesterase CesB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246261.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 gene cesB CDS 48387..48884 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951608.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS complement(49036..49776) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457092.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 gene map CDS complement(49875..50378) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406573.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS complement(50863..51300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS complement(51710..53101) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233644.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 gene rlmD CDS complement(53118..53981) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233646.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS complement(54065..54865) product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244439.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 gene pdaA CDS complement(54982..56514) product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413503.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 gene fumA CDS complement(56807..61036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS complement(61595..61786) product SE1561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223132.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS 61928..63052 product radical SAM/CxCxxxxC motif protein YfkAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233655.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 gene yfkAB CDS complement(63138..63923) product YfkD famly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233657.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS complement(63992..64600) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244154.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS complement(64764..65816) product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482137.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 gene cax CDS 65945..66361 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550210.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS complement(66389..66772) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778826.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS 66898..68064 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966795.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS 68197..68343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS complement(68734..69549) product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242564.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS complement(69569..69895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242981.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS complement(69888..70382) product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243480.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 gene yfkJ CDS 70566..70793 product DUF1128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366196.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS 70864..71064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS complement(71097..71612) product general stress protein 18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243504.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 gene yfkM CDS 71929..76131 product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886443.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS complement(76180..77454) product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072933.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS complement(78088..79023) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948290.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS 79192..80679 product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056087.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 gene crtD CDS complement(80717..81436) product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233679.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 gene treR CDS complement(81470..83152) product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244272.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 gene treC CDS complement(83216..84631) product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233682.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 gene treP CDS complement(84898..85548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS complement(85563..86906) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256609.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS complement(86922..87293) product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382363.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS 87461..87862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS 88024..89838 product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077417416.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS complement(89873..90667) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943353.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS 90811..92076 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930645.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS complement(92092..92721) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262990.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS 92846..94300 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015295.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS complement(94293..94457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS complement(94904..96124) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257534.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS complement(96124..97668) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259175.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS complement(97689..98579) product R2-like ligand-binding oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259170.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS complement(98667..99020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS complement(99030..99218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS complement(99423..99845) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071234.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS 99896..100204 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243829.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS complement(100194..100331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS complement(100328..101209) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246240.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS complement(101312..101767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS complement(101784..102494) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600647.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS complement(103109..104197) product nitric oxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243309.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 gene nosA CDS 104612..106252 product PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705542.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS 106256..107047 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771997.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS 107170..107982 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226530.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS 108064..108669 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880691.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS complement(108700..110052) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228313.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS complement(110141..110857) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978111.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS complement(110841..111305) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142237840.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS 111447..112457 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242607.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS complement(112917..114224) product globin-coupled sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003471527.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS complement(114389..115021) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722886.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS complement(115014..116054) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722885.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 CDS complement(116051..116782) product cell wall-active antibiotics response protein LiaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003734006.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 gene liaF CDS complement(117287..117931) product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814146.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS complement(117950..118300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36860 CDS complement(118325..118618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36870 CDS 118855..119055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36880 CDS 119055..120542 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399269.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 CDS 120640..121419 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972950.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 CDS 121483..121608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS complement(122054..123952) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244423.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS complement(124070..125494) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS complement(125604..126002) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143896.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS complement(126016..126630) product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225375.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS complement(126763..127950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS complement(128139..130418) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139603260.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS complement(130837..131040) product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914500.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS complement(131033..133108) product carbon starvation protein CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259563.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 gene cstA CDS complement(133217..134470) product sporulation sensor histidine kinase KinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228853.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 gene kinB CDS 134672..134860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37010 CDS complement(134982..136019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS complement(136009..136539) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864729.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS complement(136760..138286) product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098249.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS complement(138302..138634) product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817360.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS 138850..140055 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521075.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS complement(140112..140633) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723656.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS complement(140699..142522) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244082.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS complement(142503..144245) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243936.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS complement(144461..145960) product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398698.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS complement(146169..146900) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172583.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS complement(146988..148340) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060609.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS complement(148355..149167) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635946.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS complement(149164..150096) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573797.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS complement(150093..151205) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181467.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 gene ugpC CDS complement(151192..151803) product glycerol uptake operon antiterminator GlpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233388.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 gene glpP CDS complement(152058..152507) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808679.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS complement(152519..153280) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459298.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS complement(153909..156605) product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235309.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS complement(156927..157313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS complement(157310..157714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS complement(157707..159029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS complement(159072..159398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS 159728..161398 product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945515.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS complement(162044..162865) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246440.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 gene nadE CDS complement(162878..163492) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416411.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 gene nadD CDS complement(163520..164992) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228788.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS complement(165012..165560) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816782.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 CDS complement(165615..166388) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989490.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS complement(166965..167195) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025240.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS complement(167241..168584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS complement(168713..169015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS 169167..170129 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 CDS 170218..171732 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS 171836..172225 product inner spore coat protein CotNE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227093.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 gene cotNE CDS 172442..174187 product two-component system sensor histidine kinase LytS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229477.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 gene lytS CDS 174180..174911 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393659.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS 175067..176518 product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627647.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS complement(176573..177586) product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226779.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS complement(177586..178242) product 5-bromo-4-chloroindolyl phosphate hydrolysis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242630.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS complement(178564..178977) product gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267097.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS complement(179005..179763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS complement(179779..180111) product gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972473.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS complement(180133..180417) product gas vesicle protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730759.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS complement(180389..180658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS complement(180680..181483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS complement(181487..181750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS complement(181752..182516) product gas vesicle protein GvpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890522.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 gene gvpF CDS complement(182539..183450) product gas vesicle protein GvpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890517.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 gene gvpN CDS complement(183473..183736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS complement(183813..184073) product gas vesicle structural protein GvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724507.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS complement(184077..184565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS complement(184591..185082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS complement(185124..185390) product gas vesicle structural protein GvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724507.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 CDS complement(185827..186399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS complement(186424..186972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS complement(187029..187589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS complement(187604..188371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243767.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS complement(188393..189622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243998.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS complement(189660..189797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS complement(189815..189976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS complement(189995..190162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS complement(190180..190500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS complement(190867..193269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS complement(193407..194654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS complement(194848..196560) product neutral protease NprB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745123.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 gene nprB CDS 196795..197367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS 197342..197881 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767813.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS 197954..198568 product CalY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172852.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS complement(198788..200053) product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006634.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 gene proA CDS complement(200073..201194) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231456.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 gene proB CDS complement(201224..202066) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886524.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 gene proC CDS complement(202324..203481) product sodium ABC transporter permease NatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246346.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 gene natB CDS complement(203471..204220) product sodium ABC transporter ATP-binding protein NatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234757.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 gene natA CDS 204409..205107 product two-component system response regulator NatR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234759.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 gene natR CDS 205120..206109 product two-component system sensor histidine kinase NatK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246454.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 gene natK CDS complement(206124..206960) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244033.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS complement(206974..207762) product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063502.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS complement(207765..208205) product DUF2243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234949.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS complement(208343..209161) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921011.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS complement(209354..209896) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711853.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 gene lepB CDS complement(209952..210098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS complement(210333..210758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS complement(210774..211196) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706722.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS complement(211359..212420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS complement(212655..213743) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877096.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 CDS complement(213740..214669) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS complement(214812..217130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS complement(217207..218850) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357899.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 CDS complement(218939..219862) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357901.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS complement(219872..220807) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382199.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS complement(220892..221827) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224436.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS 222119..222781 product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229218.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS complement(222857..223444) product DUF2441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005956.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS complement(223475..223651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS complement(223681..224103) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566583.1 transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS complement(224535..225215) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183248.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS complement(225228..225665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37980 CDS complement(225680..227116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS 227231..227491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38000 CDS 227691..228002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS 228239..228547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38020 CDS 228835..229149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS 229295..230176 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS complement(230234..230836) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS 230929..231450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS complement(231595..232239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS complement(232244..233008) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477868.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS complement(233039..233182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38090 CDS 233424..234392 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707232.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS complement(234446..234898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS 235034..235999 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644043.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 CDS complement(236123..236830) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233742.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 CDS complement(236833..237309) product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251721.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS complement(237431..239323) product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195117.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 gene abc-f CDS 240066..242399 product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035473.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 gene helD CDS complement(242451..242846) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227906.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS complement(242961..243980) product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566684.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS complement(245016..245258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38190 CDS complement(245714..247543) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851428.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS complement(248060..249394) product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478813.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS complement(249394..251382) product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202084.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS complement(251399..252211) product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263020.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS complement(252460..253845) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233892.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 gene rlmD CDS complement(253928..254839) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS complement(255011..256441) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219444.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 gene gatB CDS complement(256454..257911) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242878.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 gene gatA CDS complement(257928..258218) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219442.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 gene gatC CDS complement(258316..259239) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888715.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS complement(259584..260597) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475724.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 CDS complement(260613..263153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS complement(263150..264148) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293897.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 gene galE CDS complement(264145..265326) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704250.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS complement(265323..267275) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575935.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS complement(267279..269504) product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836501.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS complement(269519..271243) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775502.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS complement(271256..272137) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582884.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS complement(272137..272988) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582885.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS complement(273059..274330) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582886.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS complement(274605..274964) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288087.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS 275315..276796 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687602.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 gene putP CDS complement(276824..277009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS complement(277325..278512) product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242795.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 CDS complement(278541..280571) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 gene ligA CDS complement(280571..282784) product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233919.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 gene pcrA CDS complement(282851..283537) product heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272088.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS 283705..284679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS complement(284745..285053) product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS complement(285077..286102) product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS complement(286136..287869) product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233929.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 CDS 287961..288203 product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233931.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS complement(288469..289737) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242993.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 gene purD CDS complement(289790..291328) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244516.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 gene purH CDS complement(291331..291912) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088592.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 gene purN CDS complement(291909..292949) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242485.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 gene purM CDS complement(292968..294395) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233947.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 gene purF CDS complement(294371..296599) product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244429.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 gene purL CDS complement(296583..297266) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243954.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 gene purQ CDS complement(297263..297517) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219409.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 gene purS CDS complement(297505..298236) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170544.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 gene purC CDS complement(298620..299912) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233955.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 gene purB CDS complement(299929..301053) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966735.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 gene purK CDS complement(301046..301534) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244134.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 gene purE CDS complement(301881..302081) product NETI motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219403.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 CDS complement(302078..302620) product DUF5698 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966729.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 rRNA complement(303185..303295) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 sequence08 source 1..35245 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 3..77 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 83..155 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 340..1239 product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711572.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 gene rocF CDS 1452..2015 product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 gene sigW CDS 2032..2643 product anti-sigma-W factor RsiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234951.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 gene rsiW CDS 2817..3638 product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223651.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 gene cdaA CDS 3631..4899 product CdaA regulatory protein CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234947.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 gene cdaR CDS 4932..6278 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234946.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 gene glmM CDS 6822..8624 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234943.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 gene glmS CDS 8737..9156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678524.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS complement(9222..10205) product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432447.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 gene guaC CDS 10990..11499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38750 CDS 11662..12807 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244365.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS 12923..13348 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232574.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 CDS 13542..14465 product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234172.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS complement(14513..15010) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620342.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 CDS complement(15064..15510) product DUF4385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985648.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS complement(15551..16510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS complement(16510..17457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS 17705..18682 product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245086.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS 18874..19602 product YqcI/YcgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043753.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS complement(19661..20902) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282740.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS 21108..21719 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966584.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 CDS 21720..22217 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043111304.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS 22473..23843 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028370.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS 23972..24697 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812699.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS 24694..25707 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266746.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 CDS 25762..26418 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711168.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS complement(27019..27480) product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886417.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS complement(27754..29043) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665496.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS 29452..30078 product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229547.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 gene fadR CDS 30075..30947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS 30997..31314 product YqzG/YhdC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793376.1 transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS 31468..31845 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948844.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS 31835..32704 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560935.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS 32701..33399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38990 CDS 33530..34129 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231529.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 CDS 34217..34975 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490911.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 sequence09 source 1..27426 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 69..143 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 153..226 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 248..333 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 368..451 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 571..1497 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964483.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS 1652..2515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS 2550..2906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS 3064..3198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39050 CDS complement(3237..4070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39060 CDS complement(4083..4922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39070 CDS 5069..6019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS 6349..6759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39090 CDS 6803..7054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS 7292..8065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39110 CDS 8014..8796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39120 CDS 8879..9103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39130 CDS complement(9298..9486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39140 CDS complement(9464..10048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39150 CDS 10257..12968 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 CDS 13054..13236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39170 CDS 13323..13811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS 13873..14502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39190 CDS 14665..15063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39200 CDS 15418..16233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39210 CDS 16518..17459 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582924.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 CDS 17459..18286 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 CDS 18367..19647 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582923.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS 19804..21588 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS 21593..23134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39260 tRNA 23255..23328 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(23418..24083) product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245517.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS 24162..25295 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345218.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 gene queG CDS 25361..26257 product amidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886452.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS 26304..26786 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886453.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 gene trmL sequence10 source 1..24099 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(149..1210) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405049.1 transl_table 11 codon_start 1 locus_tag LOCUS_39310 CDS complement(1455..1775) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234326.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS 1843..2010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS 2051..3136 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234325.1 transl_table 11 codon_start 1 locus_tag LOCUS_39340 CDS 3236..4603 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246696.1 transl_table 11 codon_start 1 locus_tag LOCUS_39350 CDS 4907..5614 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721422.1 transl_table 11 codon_start 1 locus_tag LOCUS_39360 CDS 5768..7270 product ATP-dependent RNA helicase CshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246685.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 gene cshA CDS 7383..8351 product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961155.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 gene uvsE CDS 8473..8952 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234318.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS 8942..10384 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966602.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS complement(10419..11015) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246687.1 transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS 11125..11490 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234281.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 gene acpS CDS 11632..12642 product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234282.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS 12771..13940 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234284.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 gene alr CDS 14094..14381 product antitoxin EndoAI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004570.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 CDS 14386..14736 product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156187.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 gene ndoA CDS 14875..15711 product RsbT co-antagonist protein RsbRA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966610.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 gene rsbRA CDS 15708..16073 product RsbT antagonist protein RsbS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225190.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 gene rsbS CDS 16076..16477 product serine/threonine-protein kinase RsbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246640.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 gene rsbT CDS 16489..17496 product phosphoserine phosphatase RsbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234295.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 gene rsbU CDS 17560..17889 product anti-sigma factor antagonist RsbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234298.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 gene rsbV CDS 17886..18368 product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234299.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 gene rsbW CDS 18334..19122 product RNA polymerase sigma factor SigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246715.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 gene sigB CDS 19122..19721 product phosphoserine phosphatase RsbX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246608.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 gene rsbX CDS 19865..22027 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246556.1 transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS 22193..22705 product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246525.1 transl_table 11 codon_start 1 locus_tag LOCUS_39560 tRNA 22853..22927 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 22954..23038 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 23153..23227 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 23255..23330 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 23341..23424 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 23440..23525 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA 23612..23688 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA 23694..23770 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA 23793..23866 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 sequence11 source 1..21210 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(335..601) product sigma-K factor-processing regulator BofA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225421.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 gene bofA CDS complement(666..887) product YaaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242387.1 transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS complement(912..1508) product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225425.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 gene recR CDS complement(1519..1845) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225427.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 CDS complement(1863..3569) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247135.1 transl_table 11 codon_start 1 locus_tag LOCUS_39610 gene dnaX CDS complement(4094..4585) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439010.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 gene tadA CDS 4650..5195 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247139.1 transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS 5263..6549 product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247133.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS complement(6586..7731) product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS complement(7736..8647) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000674020.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 CDS complement(8652..9260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS complement(9280..10395) product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810913.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 gene hppD CDS 10652..11293 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148218.1 transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS 11290..11958 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053585.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS 12100..13119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39710 tRNA complement(13245..13337) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(13459..14736) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247131.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 gene serS CDS complement(15061..15651) product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238787.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 gene pdxT CDS complement(15673..16557) product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247145.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 gene pdxS CDS complement(16746..18101) product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966224.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 gene dacA CDS complement(18273..19739) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226803.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 gene guaB CDS 19854..20822 product YaaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247147.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 rRNA complement(21056..21166) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 sequence12 source 1..968 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(3..78) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA complement(82..158) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA complement(221..313) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA complement(329..405) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA complement(412..488) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(520..595) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(611..687) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(693..769) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 rRNA complement(803..913) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 sequence13 source 1..1515 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 284..394 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 tRNA 414..488 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA 492..580 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA 594..670 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 674..749 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 760..835 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA 881..956 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA 974..1047 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA 1053..1129 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA 1157..1231 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA 1238..1328 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA 1346..1420 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA 1439..1514 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 sequence14 source 1..984 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(45..119) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA complement(147..220) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA complement(239..323) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(333..408) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA complement(436..511) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA complement(551..625) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA complement(644..716) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA complement(718..792) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 rRNA complement(819..929) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 sequence15 source 1..490 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence16 source 1..465 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 126..202 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA 215..289 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 sequence17 source 1..460 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence18 source 1..614 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 75..185 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00100 tRNA 368..444 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 tRNA 449..524 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 sequence19 source 1..405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(243..353) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00110 sequence20 source 1..449 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(1..73) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 tRNA complement(80..162) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 tRNA complement(176..251) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 tRNA complement(269..344) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 tRNA complement(374..449) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 sequence21 source 1..367 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence22 source 1..258166 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 488..2590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39780 CDS 2606..3742 product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028107.1 transl_table 11 codon_start 1 locus_tag LOCUS_39790 CDS 3862..4320 product thioredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398596.1 transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS complement(4506..6389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS complement(6505..6939) product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 gene nsrR CDS 7126..8337 product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947707.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 gene hmpA CDS 8550..9752 product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742949.1 transl_table 11 codon_start 1 locus_tag LOCUS_39840 CDS 10284..11693 product stage V sporulation protein SpoVR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202693.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 gene spoVR CDS 11806..12255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS 12318..13655 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259423.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS 13678..13878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS 13891..15138 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112960.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 CDS 15271..15618 product metal-responsive transcriptional regulator AseR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243257.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 gene aseR CDS 15748..16929 product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243030.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 CDS 16969..17388 product thioredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398596.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 CDS 17480..17839 product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948467.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 gene arsD CDS 17856..19640 product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272721.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 gene arsA CDS 19677..20105 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016117863.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 CDS 20129..20410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39960 CDS 20499..20987 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205378591.1 transl_table 11 codon_start 1 locus_tag LOCUS_39970 CDS complement(21012..22097) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163568.1 transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS complement(22136..22489) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568601.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 gene crcB CDS complement(22486..22881) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639315.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 gene crcB CDS 23351..24025 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049879.1 transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS 24029..25426 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494832.1 transl_table 11 codon_start 1 locus_tag LOCUS_40020 CDS 25500..25655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS 25969..27615 product ribonuclease J1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245660.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 gene rnjA CDS complement(27637..28944) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968439.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 CDS complement(29060..30532) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234986.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 CDS 30895..31812 product proline dehydrogenase PutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246421.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 gene putB CDS 31841..33382 product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259555.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 gene pruA CDS 33550..35019 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886399.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 gene putP CDS 35148..36368 product proline utilization transcriptional regulator PutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234651.1 transl_table 11 codon_start 1 locus_tag LOCUS_40100 gene putR CDS complement(36625..37032) product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435507.1 transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS 37166..37846 product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228889.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 CDS complement(37896..39902) product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439994.1 transl_table 11 codon_start 1 locus_tag LOCUS_40130 CDS 40180..41607 product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440000.1 transl_table 11 codon_start 1 locus_tag LOCUS_40140 CDS 41644..42819 product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048339.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 gene iadA CDS 42876..45401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40160 CDS 45803..46468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40170 CDS 46607..47590 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066670.1 transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS 47611..47901 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113690.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 CDS 48021..48878 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962922.1 transl_table 11 codon_start 1 locus_tag LOCUS_40200 CDS 49232..50266 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948870.1 transl_table 11 codon_start 1 locus_tag LOCUS_40210 CDS complement(50342..51268) product class A beta-lactamase Bla1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013141957.1 transl_table 11 codon_start 1 locus_tag LOCUS_40220 gene bla CDS 52246..53331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40230 CDS 53312..53692 product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184510.1 transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS complement(53840..55231) product arginine utilization regulatory protein RocR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244510.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 gene rocR CDS 55425..56627 product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242970.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 gene rocD CDS 56659..57939 product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227482.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 gene rocG CDS 58069..58635 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775371.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS complement(58684..59334) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001987352.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 CDS 59452..60264 product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242564.1 transl_table 11 codon_start 1 locus_tag LOCUS_40300 CDS 61026..62501 product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802296.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS 62528..63622 product GerAB/ArcD/ProY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095034.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 CDS 63619..64752 product spore germination protein GerHC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411389.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 gene gerHC CDS complement(65101..66372) product uracil/xanthine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484506.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 CDS 66572..67465 product transcriptional regulator BsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246552.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 gene bsdA CDS 67468..68685 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219567.1 transl_table 11 codon_start 1 locus_tag LOCUS_40360 CDS 68767..69207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40370 CDS 69336..69638 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389622.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 CDS 69638..70810 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017008.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 CDS complement(70899..71753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40400 CDS complement(71799..71942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40410 CDS complement(72019..72984) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733112.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 CDS complement(73045..74169) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243652.1 transl_table 11 codon_start 1 locus_tag LOCUS_40430 CDS complement(74269..74640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40440 CDS complement(74729..75472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40450 CDS complement(75465..76106) product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 transl_table 11 codon_start 1 locus_tag LOCUS_40460 CDS 76422..77891 product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123069.1 transl_table 11 codon_start 1 locus_tag LOCUS_40470 CDS 77988..78578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40480 CDS 78582..79058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40490 CDS 79233..79805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40500 CDS 79812..80882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40510 CDS 80963..81415 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245175.1 transl_table 11 codon_start 1 locus_tag LOCUS_40520 CDS complement(81448..82017) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009878789.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 CDS 82239..83327 product small-conductance mechanosensitive channel protein MscY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245529.1 transl_table 11 codon_start 1 locus_tag LOCUS_40540 gene mscY CDS 83395..84204 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956251.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 gene proC CDS 84540..85427 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459554.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 CDS 85905..86090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40570 CDS complement(86145..92165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40580 CDS complement(92377..93141) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257732.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS complement(93134..93697) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 CDS complement(93877..94920) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729560.1 transl_table 11 codon_start 1 locus_tag LOCUS_40610 CDS complement(94938..97208) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722279.1 transl_table 11 codon_start 1 locus_tag LOCUS_40620 CDS 97784..98641 product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233305.1 transl_table 11 codon_start 1 locus_tag LOCUS_40630 gene dat CDS complement(98679..100055) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233301.1 transl_table 11 codon_start 1 locus_tag LOCUS_40640 gene nhaC CDS complement(100273..100794) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233299.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 CDS 100976..103303 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769254.1 transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS complement(103854..104009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40670 CDS complement(104181..104495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS 105004..106761 product multidrug ABC transporter ATP-binding protein BmrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245157.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 gene bmrC CDS 106758..108776 product multidrug resistance ABC transporter ATP-binding protein/permease BmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233292.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 gene bmrD CDS complement(108822..109433) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861619.1 transl_table 11 codon_start 1 locus_tag LOCUS_40710 CDS 109616..110428 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732840.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 CDS 110508..111116 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281501.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 CDS 111132..111869 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623610.1 transl_table 11 codon_start 1 locus_tag LOCUS_40740 CDS complement(111888..112031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40750 CDS complement(112650..112856) product alpha type acid-soluble spore protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223491.1 transl_table 11 codon_start 1 locus_tag LOCUS_40760 gene sspA CDS 113115..113363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510476.1 transl_table 11 codon_start 1 locus_tag LOCUS_40770 CDS complement(113573..114685) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818931.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 gene ugpC CDS complement(114810..115694) product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242549.1 transl_table 11 codon_start 1 locus_tag LOCUS_40790 CDS complement(115769..115948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS complement(115993..116205) product YheE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886462.1 transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS complement(116228..117277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS complement(117274..118629) product spore coat associated protein YheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245015.1 transl_table 11 codon_start 1 locus_tag LOCUS_40830 gene yheD CDS complement(118626..120011) product YheC/YheD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658112.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS 120131..121267 product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245756.1 transl_table 11 codon_start 1 locus_tag LOCUS_40850 CDS 121358..121711 product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224239.1 transl_table 11 codon_start 1 locus_tag LOCUS_40860 CDS 122516..123382 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233277.1 transl_table 11 codon_start 1 locus_tag LOCUS_40870 CDS 123524..124447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40880 CDS 124601..125080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40890 CDS 125155..125883 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234424.1 transl_table 11 codon_start 1 locus_tag LOCUS_40900 CDS 126031..127527 product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245132.1 transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS complement(127654..128184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40920 CDS 128410..128898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40930 CDS 129508..129993 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 CDS 129990..130895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40950 CDS 131272..131898 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963768.1 transl_table 11 codon_start 1 locus_tag LOCUS_40960 CDS 132081..132203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40970 CDS 132200..132406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40980 CDS 132467..133033 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016125602.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 CDS 133204..133977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41000 CDS 134205..134678 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398668.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 CDS complement(134928..136199) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034616.1 transl_table 11 codon_start 1 locus_tag LOCUS_41020 CDS complement(136190..136534) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 transl_table 11 codon_start 1 locus_tag LOCUS_41030 CDS 137034..138593 product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281991.1 transl_table 11 codon_start 1 locus_tag LOCUS_41040 CDS 138612..139760 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS 139782..140645 product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS 140642..141793 product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228126.1 transl_table 11 codon_start 1 locus_tag LOCUS_41070 CDS 141877..142647 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003269647.1 transl_table 11 codon_start 1 locus_tag LOCUS_41080 CDS complement(142711..142896) product YhzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000539551.1 transl_table 11 codon_start 1 locus_tag LOCUS_41090 CDS 143026..143925 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233262.1 transl_table 11 codon_start 1 locus_tag LOCUS_41100 CDS 143918..145177 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244912.1 transl_table 11 codon_start 1 locus_tag LOCUS_41110 CDS 145707..146936 product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815696.1 transl_table 11 codon_start 1 locus_tag LOCUS_41120 CDS 146950..149964 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217618.1 transl_table 11 codon_start 1 locus_tag LOCUS_41130 CDS 150042..150989 product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245698.1 transl_table 11 codon_start 1 locus_tag LOCUS_41140 gene yhaM CDS 151112..151303 product sporulation protein YhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233252.1 transl_table 11 codon_start 1 locus_tag LOCUS_41150 gene yhaL CDS complement(151733..152593) product peptidylprolyl isomerase PrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245079.1 transl_table 11 codon_start 1 locus_tag LOCUS_41160 gene prsA CDS 152572..152754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41170 CDS complement(153376..153555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172690.1 transl_table 11 codon_start 1 locus_tag LOCUS_41180 CDS complement(153723..154262) product DUF3267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245590.1 transl_table 11 codon_start 1 locus_tag LOCUS_41190 CDS 154495..154830 product YhaI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966921.1 transl_table 11 codon_start 1 locus_tag LOCUS_41200 CDS complement(154817..155413) product HTH-type transcriptional regulator Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003239501.1 transl_table 11 codon_start 1 locus_tag LOCUS_41210 CDS complement(155616..155972) product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245875.1 transl_table 11 codon_start 1 locus_tag LOCUS_41220 CDS 156131..156319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41230 CDS complement(156359..156880) product tryptophan transporter TrpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233236.1 transl_table 11 codon_start 1 locus_tag LOCUS_41240 gene trpP CDS complement(156997..158073) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233234.1 transl_table 11 codon_start 1 locus_tag LOCUS_41250 gene serC CDS complement(158212..158634) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233231.1 transl_table 11 codon_start 1 locus_tag LOCUS_41260 CDS 159603..160340 product ABC transporter ATP-binding protein EcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233230.1 transl_table 11 codon_start 1 locus_tag LOCUS_41270 gene ecsA CDS 160337..161566 product ABC transporter permease EcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245169.1 transl_table 11 codon_start 1 locus_tag LOCUS_41280 gene ecsB CDS 161587..162297 product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233225.1 transl_table 11 codon_start 1 locus_tag LOCUS_41290 CDS complement(162400..163599) product N-acetyl amino acid acetylase SndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245681.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 gene sndC CDS 163695..164384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS 164543..165031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41320 CDS complement(165254..165760) product heme-degrading oxygenase HmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244748.1 transl_table 11 codon_start 1 locus_tag LOCUS_41330 gene hmoB CDS 165895..168036 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233213.1 transl_table 11 codon_start 1 locus_tag LOCUS_41340 CDS 168224..169282 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966929.1 transl_table 11 codon_start 1 locus_tag LOCUS_41350 gene hemE CDS 169349..170287 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244736.1 transl_table 11 codon_start 1 locus_tag LOCUS_41360 gene hemH CDS 170369..171790 product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245394.1 transl_table 11 codon_start 1 locus_tag LOCUS_41370 gene hemY CDS 171848..172363 product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372695.1 transl_table 11 codon_start 1 locus_tag LOCUS_41380 CDS 172651..173223 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233204.1 transl_table 11 codon_start 1 locus_tag LOCUS_41390 CDS 173299..175650 product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245424.1 transl_table 11 codon_start 1 locus_tag LOCUS_41400 CDS 175808..176821 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103718.1 transl_table 11 codon_start 1 locus_tag LOCUS_41410 CDS 176875..178998 product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243331.1 transl_table 11 codon_start 1 locus_tag LOCUS_41420 CDS 178946..179095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41430 CDS complement(179488..179622) product protein YhfH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886464.1 transl_table 11 codon_start 1 locus_tag LOCUS_41440 gene yhfH CDS 179815..180555 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233185.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 CDS 180568..181557 product lipoate--protein ligase LplJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244914.1 transl_table 11 codon_start 1 locus_tag LOCUS_41460 gene lplJ CDS 182223..183779 product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055172.1 transl_table 11 codon_start 1 locus_tag LOCUS_41470 CDS 183797..184567 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231526.1 transl_table 11 codon_start 1 locus_tag LOCUS_41480 CDS 184853..185404 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071745902.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 CDS 185422..186141 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943112.1 transl_table 11 codon_start 1 locus_tag LOCUS_41500 CDS 186131..186436 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807927.1 transl_table 11 codon_start 1 locus_tag LOCUS_41510 CDS 186514..187779 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233175.1 transl_table 11 codon_start 1 locus_tag LOCUS_41520 CDS 188073..189356 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787351.1 transl_table 11 codon_start 1 locus_tag LOCUS_41530 gene aceA CDS 189479..192667 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011074.1 transl_table 11 codon_start 1 locus_tag LOCUS_41540 CDS 192809..193693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41550 CDS complement(193768..194604) product bromoperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074319.1 transl_table 11 codon_start 1 locus_tag LOCUS_41560 CDS complement(194889..195122) product IDEAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233142.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 CDS 195384..195947 product competence transcription factor ComK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245329.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 gene comK CDS complement(195948..196310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233132.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 CDS 196491..197108 product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886465.1 transl_table 11 codon_start 1 locus_tag LOCUS_41600 CDS 197130..197636 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751900.1 transl_table 11 codon_start 1 locus_tag LOCUS_41610 gene lepB CDS complement(197714..198949) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809990.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 CDS 199049..199942 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257188.1 transl_table 11 codon_start 1 locus_tag LOCUS_41630 CDS complement(199969..201093) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384195.1 transl_table 11 codon_start 1 locus_tag LOCUS_41640 CDS 201029..201217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41650 CDS 201293..204790 product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244988.1 transl_table 11 codon_start 1 locus_tag LOCUS_41660 gene addB CDS 204790..208494 product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233100.1 transl_table 11 codon_start 1 locus_tag LOCUS_41670 gene addA CDS 208567..209748 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233099.1 transl_table 11 codon_start 1 locus_tag LOCUS_41680 CDS 209745..213089 product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245201.1 transl_table 11 codon_start 1 locus_tag LOCUS_41690 gene sbcC CDS 213106..213408 product HNH nuclease-like protein HlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245113.1 transl_table 11 codon_start 1 locus_tag LOCUS_41700 gene hlpB CDS complement(213443..213661) product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233096.1 transl_table 11 codon_start 1 locus_tag LOCUS_41710 CDS complement(213706..214095) product spore germination protein GerPE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886467.1 transl_table 11 codon_start 1 locus_tag LOCUS_41720 CDS complement(214092..214268) product spore germination protein GerPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233093.1 transl_table 11 codon_start 1 locus_tag LOCUS_41730 gene gerPD CDS complement(214265..214888) product spore germination protein GerPC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245548.1 transl_table 11 codon_start 1 locus_tag LOCUS_41740 CDS complement(214977..215189) product spore germination protein GerPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233090.1 transl_table 11 codon_start 1 locus_tag LOCUS_41750 gene gerPB CDS complement(215203..215424) product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233088.1 transl_table 11 codon_start 1 locus_tag LOCUS_41760 CDS 215686..217809 product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211478206.1 transl_table 11 codon_start 1 locus_tag LOCUS_41770 CDS 218556..219710 product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244185.1 transl_table 11 codon_start 1 locus_tag LOCUS_41780 CDS complement(219707..219874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41790 CDS 220186..221091 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245441.1 transl_table 11 codon_start 1 locus_tag LOCUS_41800 CDS complement(221139..222329) product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242970.1 transl_table 11 codon_start 1 locus_tag LOCUS_41810 gene rocD CDS 222512..222868 product YisL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244937.1 transl_table 11 codon_start 1 locus_tag LOCUS_41820 CDS complement(222904..223470) product DUF2777 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616046.1 transl_table 11 codon_start 1 locus_tag LOCUS_41830 CDS 223665..225515 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333979.1 transl_table 11 codon_start 1 locus_tag LOCUS_41840 gene asnB CDS 225596..226477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41850 CDS 226635..228158 product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334293.1 transl_table 11 codon_start 1 locus_tag LOCUS_41860 CDS 228155..229630 product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102097.1 transl_table 11 codon_start 1 locus_tag LOCUS_41870 gene crtI CDS 229623..230456 product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642485.1 transl_table 11 codon_start 1 locus_tag LOCUS_41880 CDS complement(230487..230717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41890 CDS 230777..231592 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524312.1 transl_table 11 codon_start 1 locus_tag LOCUS_41900 CDS 231885..233339 product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164930.1 transl_table 11 codon_start 1 locus_tag LOCUS_41910 CDS complement(233400..234878) product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134752840.1 transl_table 11 codon_start 1 locus_tag LOCUS_41920 gene crtI CDS complement(234897..235556) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660405.1 transl_table 11 codon_start 1 locus_tag LOCUS_41930 CDS complement(235549..236310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41940 CDS complement(236453..237736) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920960.1 transl_table 11 codon_start 1 locus_tag LOCUS_41950 CDS complement(237968..239329) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233074.1 transl_table 11 codon_start 1 locus_tag LOCUS_41960 CDS 239452..240315 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966961.1 transl_table 11 codon_start 1 locus_tag LOCUS_41970 CDS 240654..240974 product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125378.1 transl_table 11 codon_start 1 locus_tag LOCUS_41980 CDS complement(241485..243254) product alpha-glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910456.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 CDS 243646..244950 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709916.1 transl_table 11 codon_start 1 locus_tag LOCUS_42000 CDS 245161..246462 product maltosaccharide ABC transporter permease MalC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194988.1 transl_table 11 codon_start 1 locus_tag LOCUS_42010 gene malC CDS 246459..247298 product maltosaccharide ABC transporter permease MalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022608.1 transl_table 11 codon_start 1 locus_tag LOCUS_42020 gene malD CDS 247403..248938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42030 CDS 249057..250100 product maltose operon transcriptional repressor MalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219053.1 transl_table 11 codon_start 1 locus_tag LOCUS_42040 gene malR CDS complement(250144..252528) product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078404016.1 transl_table 11 codon_start 1 locus_tag LOCUS_42050 CDS 252662..253597 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009879443.1 transl_table 11 codon_start 1 locus_tag LOCUS_42060 CDS 253723..257952 product bacteriocin-processing peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211478051.1 transl_table 11 codon_start 1 locus_tag LOCUS_42070