COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..618087 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(706..1434) product lantibiotic protection ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261887.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS 1597..1731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 1948..2223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(3179..4378) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812770.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene aroA CDS complement(4667..4852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(5046..7220) product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389826.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 tRNA 5317..5411 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA complement(7372..7447) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(7575..8738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052026.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(8798..8968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(9260..11380) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055470.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene glgX CDS complement(11570..12238) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052016.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(12268..13242) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582492.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(13372..16320) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068236.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene polA CDS complement(16343..17104) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812733.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 tRNA 17452..17527 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 17750..18364 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051922.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(18570..20015) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812729.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene pyk CDS complement(20400..20579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(20563..21546) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051920.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(21638..23749) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389776.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene uvrB CDS complement(23771..24385) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815565.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene coaE CDS complement(24632..26104) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812721.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene rpsA CDS complement(26282..27169) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389775.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 27330..28421 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389774.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 28623..29474 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053564.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 29560..30396 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068242.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(30424..30852) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389773.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene ispF CDS complement(31092..31685) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068244.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 31826..34090 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812706.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene glgB CDS 34119..34847 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051909.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 34869..35939 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053568.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 36567..36713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(36887..38455) product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068360.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(38569..38802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 38811..38960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(39258..40712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068362.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 41118..41540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(41739..42455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(42552..43043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(43036..43542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 44024..44515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(44741..45475) product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994243.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(45547..46590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(46485..47738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 48254..49618 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890213.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 49768..51165 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986687.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 51585..51959 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033512961.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(51991..52128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 52127..52840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 note possible pseudo, internal stop codon CDS complement(53120..53434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(53498..54706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(54734..56185) product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771251.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(56189..56983) product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767582.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(57079..58233) product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202469.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(58230..58643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(59553..60536) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383750.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(60533..61687) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142191.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(61760..63286) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217063484.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 63801..65438 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582382.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(65633..65851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 66207..66470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(66481..67272) product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051905.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 67417..67779 product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023658181.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(67883..69388) product DUF5719 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053571.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(69385..72516) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053572.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(72513..72812) product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051901.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 73232..74551 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947073.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(74686..75171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 75278..76162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 76430..78238 product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389764.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 78339..78617 product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003835265.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(78854..80368) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051898.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 80464..81390 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053578.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(81534..82016) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112265.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(82097..82504) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051894.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(82610..83179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817844.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 tRNA complement(83368..83448) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(83557..84555) product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068252.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(84594..85175) product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068253.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(85256..85600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 85575..85823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(85952..87250) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051126.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene eno CDS complement(87338..90934) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068255.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene mfd CDS complement(90924..91523) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053586.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene pth CDS complement(91719..92228) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068257.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(92416..95658) product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068258.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 95880..97139 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389746.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(97245..97955) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390005.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene nadD CDS complement(97952..98584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(98581..99870) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035137421.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 100046..101533 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390008.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene thrC CDS 101661..102947 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041161656.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 102959..103231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 103355..103885 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067975.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(104014..104796) product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171842511.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene tenA CDS complement(104974..105690) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056362.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(105786..107549) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068268.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene recN CDS complement(107549..108523) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818094.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 108735..110195 product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051148.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 110311..110970 product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051149.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(111172..111900) product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051151.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 note possible pseudo, frameshifted CDS complement(111897..112943) product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053603.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(112940..114724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068271.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(114817..116139) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068272.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene tyrS CDS 116341..118173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(118258..119040) product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818363.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(119055..119546) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390016.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(119855..121333) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051162.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene argH CDS complement(121486..122724) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068275.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(122995..123498) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817270.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene argR CDS complement(123495..124463) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782770.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene argF CDS complement(124570..125850) product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056889.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(125840..126793) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813526.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene argB CDS complement(126975..128147) product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068278.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene argJ CDS complement(128144..129238) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068279.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene argC CDS complement(129462..130109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782767.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(130203..132806) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053616.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene pheT CDS complement(132819..133886) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051172.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene pheS CDS complement(134099..134971) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053618.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(135042..137519) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116779.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(137616..138983) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389742.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 139196..139825 product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582465.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 140020..141516 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051179.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 141693..142481 product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051180.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 142833..144419 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068284.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene glnA CDS complement(144648..145484) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053619.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(145477..147045) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053620.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(147145..147777) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782764.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 148039..149112 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355191.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 149281..150426 product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054010.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 150644..151453 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389830.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(151622..153124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(153926..154669) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(154681..155406) product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033170.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(155406..158516) product type 2 lanthipeptide synthetase LanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875575.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene lanM CDS complement(159225..159905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(159979..160185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(160532..161344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 161313..161537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(161673..162338) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816947.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(162584..165277) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067935.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene ligA CDS complement(165289..168483) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389737.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(168757..170844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410302.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 171074..171877 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582851.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(171919..173091) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812582.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(173243..174013) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053237.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 174393..175082 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053234.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 175132..177519 product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054001.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 177645..177950 product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053232.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(178066..179556) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067926.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(179973..181349) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067922.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 181565..182560 product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055606.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(182756..185326) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067921.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(185398..185859) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056380.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene nrdR CDS complement(185925..186278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 186501..187238 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052535.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene lexA CDS 187361..188284 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067981.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(188601..189563) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052533.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(189705..191225) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067980.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene hflX CDS 191494..192129 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389654.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 192214..196254 product DUF3418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056518.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 196420..197715 product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053649.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene purT CDS 197917..198603 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051209.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 198717..202451 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068298.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(202558..203007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(203086..203334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(203444..203629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 203715..205112 product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389327.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 205103..206050 product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389328.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(206520..207380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 207553..207738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(207862..209670) product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 209870..211375 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051228.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene purF CDS 211440..212474 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813914.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene purM CDS 212596..213864 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813917.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene purD CDS complement(214046..215026) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068827.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(215165..216607) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112416.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(216640..217596) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112414.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(217825..218865) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498680.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(219078..221114) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068304.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 tRNA 221421..221512 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(221689..222831) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051237.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene purK CDS complement(222860..223357) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813948.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene purE CDS 223562..225430 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390119.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 225465..225950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(226033..226521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 tRNA complement(226845..226919) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(227034..228212) product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053675.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(228708..230771) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068315.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene dnaG CDS complement(230880..232238) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068317.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene alr CDS 232539..233966 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817916.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(234174..234641) product histone acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068319.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(234871..235356) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390122.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(235492..237516) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058493.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene recQ CDS complement(237513..238466) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014098.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(238957..241689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(242342..243097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 note possible pseudo, frameshifted CDS complement(243108..243563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 243886..244134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 note possible pseudo, frameshifted CDS 244305..244556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 note possible pseudo, frameshifted repeat_region 244602..255079 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gggatcatccccgcgtgtgcggggaacac CDS complement(255141..255419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(255494..256537) product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674075.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene cas1e CDS complement(256534..257235) product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229112.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene cas6e CDS complement(257246..257992) product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229113.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene cas5e CDS complement(258011..259174) product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene cas7e CDS complement(259232..259867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(259848..261569) product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994024.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(261634..264738) product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674070.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 265022..265756 product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052787970.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(266172..269486) product mupirocin-resistant isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390135.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene ileS tRNA 269943..270015 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 270060..270133 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 270166..270241 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 270459..271496 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581611.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(271801..273834) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389613.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(273849..275678) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052496.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(275678..276253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(276507..278753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 278951..279529 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053909.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(279811..280629) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860631.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 280803..281978 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150382938.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(282113..282562) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813451.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(282735..283685) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056552.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(283992..285437) product lincomycin efflux MFS transporter Lmr(B) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886396.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene lmr(B) CDS 285732..288059 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052488.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(288167..288886) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053909.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(289252..290529) product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015713811.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(290717..291043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(291390..296288) product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068820.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(296568..296936) product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052767.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 297163..298149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(298310..299038) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052483.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene nrdG CDS complement(299188..299352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 note possible pseudo, frameshifted CDS complement(299375..301573) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812105.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene nrdD note possible pseudo, frameshifted CDS 301742..301891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 301891..303171 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389606.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene xseA CDS 303247..303531 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812098.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(304017..305105) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389605.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 tRNA 305337..305410 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(305501..306544) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390364.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 306801..308588 product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390152.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 308745..310109 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(310344..310760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(310980..312164) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783085.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 312443..313495 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053899.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(313610..317476) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068346.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(317473..321639) product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068347.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 321809..322939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 323352..329222 product tandem-95 repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051312.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(329184..329381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 329395..330588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(330768..331082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 331347..331901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 note possible pseudo, frameshifted CDS complement(331914..332225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 332256..332435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 332482..334632 product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068348.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(334811..338857) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051319.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(338884..342450) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053735.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(342648..343280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057770.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(343298..344200) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053737.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 344263..344862 product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389580.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(345081..346574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(346586..346729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 347080..347310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 347548..348036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 348038..349006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(349374..350738) product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(350796..351068) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(351442..353355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(353424..354512) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817320.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(354548..355216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(355233..356171) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(356184..357158) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(357264..358871) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(359489..360829) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674808.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 361257..362240 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050760732.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(362271..362981) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023658105.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(363171..364319) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057648.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(364367..365653) product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055215.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(365785..368070) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399464.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(368257..368973) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811992.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(369112..370089) product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051334.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 370000..370299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(370296..370592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 370485..370841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(371106..372146) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051335.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(372212..374755) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051336.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(374895..376112) product DUF2183 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811988.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(376109..376513) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051338.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene gcvH CDS complement(376570..378204) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389574.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(378342..379457) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389573.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene nudC CDS complement(379459..380304) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051340.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(380423..381040) product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068356.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 381181..381519 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068357.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene trxA CDS 381669..382673 product G5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068358.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(382851..384002) product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052368.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene fucO CDS 384216..384737 product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052477.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene mscL CDS 384768..385328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 tRNA complement(385489..385562) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(385722..386582) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068780.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene trmB tRNA 386761..386835 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 386879..386954 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(387279..387800) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052361.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(387890..388552) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052360.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(388627..389517) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390190.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 389655..390068 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052358.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(390149..391183) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052357.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(391398..392117) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053845.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(392313..393230) product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390193.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 393424..394830 product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052351.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene serC CDS complement(394917..396182) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055303.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 396405..397085 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068776.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene phoU CDS 397328..399208 product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363217.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(399461..400015) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(400136..400876) product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052347.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(401029..401913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(402480..404201) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053839.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene lysS tRNA 404415..404489 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 404747..405934 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390199.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 406123..408192 product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390200.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 408201..408917 product DUF4125 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814656.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 409062..410663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(410652..411188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(411185..413074) product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156628927.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 413188..414678 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143562.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 414675..415355 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068769.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 tRNA complement(415636..415721) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(416019..417305) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052327.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene serS CDS 417457..418524 product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143567.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(418593..419447) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363838.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(419479..421575) product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390207.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 421900..423576 product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068756.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene pgm CDS 423770..424786 product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081966502.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 424895..425593 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052314.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene rpiA CDS complement(425955..426521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052313.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 426693..428057 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390212.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene radA CDS complement(428073..429245) product riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055364.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(429330..430430) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068748.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(430450..430953) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814603.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene rbfA CDS complement(431191..433950) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390214.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene infB CDS complement(434110..435150) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782965.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene nusA CDS 435226..436056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03280 tRNA complement(436173..436261) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(436239..436691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(436866..437756) product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022173241.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(437962..438429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(438514..439512) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053048.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(439591..439989) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829907.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene rpsK CDS complement(440072..440449) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808138.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene rpsM CDS complement(440730..440948) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808114.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene infA CDS complement(441126..441692) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815675.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(441796..443133) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053045.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene secY CDS complement(443318..443770) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783622.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene rplO CDS complement(443773..443967) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053043.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene rpmD CDS complement(443964..444692) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815670.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene rpsE CDS complement(444689..445060) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053041.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene rplR CDS complement(445062..445601) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814536.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene rplF CDS complement(445619..446017) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829896.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene rpsH CDS complement(446101..446286) product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114370.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(446288..446863) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053039.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene rplE CDS complement(446860..447195) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814523.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene rplX CDS complement(447197..447565) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814521.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene rplN CDS complement(447705..447965) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055338.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene rpsQ CDS complement(447968..448219) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105502.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene rpmC CDS complement(448221..448640) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053037.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene rplP CDS complement(448647..449450) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053036.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene rpsC CDS complement(449453..449812) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814510.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene rplV CDS complement(449828..450106) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114357.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene rpsS CDS complement(450121..450951) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114355.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene rplB CDS complement(450988..451284) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053033.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene rplW CDS complement(451290..451949) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815665.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene rplD CDS complement(451956..452606) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053031.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene rplC CDS complement(452623..452931) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003827292.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene rpsJ CDS complement(453581..456307) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068742.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene adhE CDS 456823..457956 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068741.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(458239..458637) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289210.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(458746..459306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(459518..460522) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583055.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(460537..460731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 460746..463340 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068740.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene glgX CDS complement(463497..464057) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814481.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene rpsI CDS complement(464078..464527) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053026.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene rplM CDS complement(464818..466989) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053798.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene malQ CDS complement(467028..467651) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390230.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(467761..468402) product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053023.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(468454..469521) product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053022.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(469518..470840) product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053796.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 tRNA 471099..471186 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 471458..472711 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053794.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene dinB CDS 472830..474005 product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068697.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene glf CDS 474150..476507 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390331.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(476754..478661) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814147.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene leuA CDS complement(478742..479143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(479635..480276) product DUF5701 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816090.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 480554..481648 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051614.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene asd CDS complement(481946..482509) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819192.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(482552..483316) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051616.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(483460..484062) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814133.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene recR CDS complement(484066..486786) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390335.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene dnaX CDS 486999..487583 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051623.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(487641..488762) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814128.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(488753..489169) product flp pilus-assembly TadE/G-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410434.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(489166..489582) product TadE family type IV pilus minor pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814125.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(489590..489880) product DUF4244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051627.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 490851..491657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 491794..492918 product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051629.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 493194..494540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 494790..497027 product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814112.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 497162..498199 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507753.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 498189..498989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013364002.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(499190..501187) product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051558.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(501184..501450) product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054731.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(501578..502327) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051560.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(502324..503709) product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068484.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(503716..505113) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054729.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene dnaB CDS complement(505496..507322) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390296.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(507493..507831) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814240.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(507833..509119) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054727.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(509329..510591) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056312.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene ftsY CDS complement(510737..510910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004110365.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(510907..511200) product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116156.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 511389..512114 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054725.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 512174..513208 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056302.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(513624..515132) product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054723.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 tRNA 515394..515468 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 516046..517218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 517665..517874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 517917..519107 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052235.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(519273..520505) product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051574.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 520845..523382 product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068489.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 523379..525565 product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068490.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 525614..526300 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054715.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(526543..527097) product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054714.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(527149..527949) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068491.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(528014..529243) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068492.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(529272..530606) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051582.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(530620..531891) product Fe-S-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054710.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(532132..532788) product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051584.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(532851..534602) product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068493.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(534938..535114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(535294..536274) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642346.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(536523..536654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(536862..537410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(537749..539320) product SpaA isopeptide-forming pilin-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814213.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(539467..543024) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143219.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(543331..544347) product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068518.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(544344..544835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(544852..545091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 545094..546572 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803746.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 546952..548433 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068639.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 548745..549758 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389491.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(550224..552065) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068648.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(552079..553866) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068647.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(554207..554713) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068645.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(554799..555833) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143196.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(555748..556032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 556185..556379 product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814099.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene thiS CDS 556471..557184 product sulfur carrier protein ThiS adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966206.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene thiF CDS 557216..558130 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390344.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(558290..559804) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068642.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 559903..560994 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143615.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 561093..561719 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811535.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene upp CDS 561998..562477 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811533.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene rlmH CDS complement(562676..563749) product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057441.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(563803..564948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(564960..565148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(565451..568183) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057489.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene clpB CDS complement(568476..569300) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582957.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(569424..569726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(569820..570662) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582354.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(571406..574051) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067907.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 574370..575365 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053195.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 575567..575764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(575826..577004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(577980..578258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(578285..579406) product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837256.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(579406..580374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(580819..582384) product isopeptide-forming domain-containing fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837259.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(582502..586494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(587280..587516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(587513..588949) product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389721.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(588964..589353) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053193.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(589558..591714) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055645.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(591810..592541) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389720.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(592801..594210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 594332..594622 product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053189.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(595033..596658) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053188.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene groL CDS complement(597012..597689) product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055622.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 597904..598602 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053184.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 598730..599803 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053183.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 599800..600786 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053182.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 600783..601358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021975282.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 601358..602422 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053180.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 602419..603510 product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782716.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 603507..604181 product DUF6466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389711.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 604496..604828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 604828..606453 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782718.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 606702..608090 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722165.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene coaBC CDS 608203..608970 product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814936.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(609019..610302) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032682473.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 610330..610488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 610703..612610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 612685..613707 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003836804.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene rfbB CDS 613817..614260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 614264..614671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 614647..614913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 615019..617649 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225431655.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 sequence2 source 1..280831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(652..1236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(1641..2075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(2242..2877) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068395.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(2890..4113) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363812.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(4110..5477) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818237.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(5581..5925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 rRNA complement(5989..9019) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 rRNA complement(9455..10983) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 CDS complement(11551..13104) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052449.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene guaB CDS complement(13167..14294) product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113078.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(14291..14950) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814862.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 15189..15845 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052445.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(15932..16636) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(16636..18495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(18500..19426) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052441.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(19500..20585) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055677.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(20784..21665) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055663.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene prmC CDS complement(21766..22854) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814857.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene prfA CDS complement(23013..23225) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814855.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene rpmE tRNA complement(23569..23643) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 24205..26970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 27480..27767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(27874..29106) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052436.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 29274..30794 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782901.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(30921..31118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 31145..31372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(31477..33441) product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203328.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(33528..35159) product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906008.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(35236..36129) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226353.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(36129..37172) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226352.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(37273..38547) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226351.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 38904..39923 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(40055..41752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(42087..43433) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053874.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene xylA CDS 43697..44980 product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390162.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(45462..46913) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582302.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(47886..49007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(49015..49239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 49707..51044 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812813.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 51071..51496 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056959.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(51554..52048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(52283..52696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(52850..53392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(53423..53749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(53877..54536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(54549..55010) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836783.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(55053..55913) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990025.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 56056..56238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 56153..56599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(56606..56854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 57569..59248 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068794.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene ettA CDS 59579..60481 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363792.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(60585..61166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(61200..62765) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068791.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene folK CDS complement(62841..63713) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068790.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene folP CDS complement(63826..64425) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052379.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene folE CDS complement(64430..66508) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068789.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene ftsH CDS complement(66505..67068) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816281.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene hpt CDS complement(67146..68531) product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390179.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(68606..68842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(69007..70371) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068784.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(70371..71942) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068783.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 72023..72904 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814755.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(73021..74148) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051442.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(74473..75807) product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055726.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(76076..77494) product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068425.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(77640..78296) product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051445.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(78326..79012) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068426.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 note possible pseudo, frameshifted CDS complement(79225..80223) product polyphenol oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390256.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(80301..81869) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582363.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(82072..82935) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051430.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(83065..85239) product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068420.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(85426..85995) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814370.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(86263..88944) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081538.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(89191..89460) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052997.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene rpsO CDS complement(89875..91008) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068709.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(91331..92020) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053083.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene leuD CDS complement(92066..93469) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053084.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene leuC CDS 93654..94463 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081262.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(94594..95892) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068707.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 tRNA complement(95995..96069) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA complement(96107..96180) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(96445..97965) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051591.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene gltX CDS 98179..99231 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068502.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 99173..99370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(99536..100372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068504.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(100406..101065) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389452.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 101318..102742 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054697.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(102894..103463) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051598.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 103609..103956 product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886618.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(104272..105789) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068506.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(105838..106509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 note possible pseudo, internal stop codon CDS complement(106579..107427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 note possible pseudo, internal stop codon CDS complement(107479..108081) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817572.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(108163..109812) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814167.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene ptsP CDS 110094..110354 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814166.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 110568..111575 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814163.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(111600..112748) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068508.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(112785..113432) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051604.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene tmk CDS complement(113711..116701) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582338.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene topA CDS complement(116798..117901) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055559.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(118164..119348) product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068736.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene dapC CDS complement(119416..119733) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053016.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(119767..121278) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053015.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(121409..122605) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390234.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(122651..122824) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100510685.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene rpmG tRNA complement(122873..122947) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA complement(122951..123023) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA complement(123024..123106) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(123301..123594) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053011.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene groES CDS complement(123762..124688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814448.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(124918..125505) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053783.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 125706..126299 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012472143.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 126379..126558 product evolved beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815625.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(126537..126737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 126818..127378 product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057269.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(128035..131895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053004.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(131892..133406) product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053003.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(133585..133965) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053002.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene rplL CDS complement(134073..134594) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053001.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene rplJ CDS complement(134902..135543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816512.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 135757..136662 product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390109.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(136786..138180) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390244.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(138563..139174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(140723..141502) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051433.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene pstB CDS complement(141542..142534) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782854.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene pstA CDS complement(142531..143484) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068423.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene pstC CDS complement(143604..144725) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051436.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene pstS CDS complement(144923..145624) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051437.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(145686..146951) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055698.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(147073..147783) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814409.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene mtnN CDS complement(147811..149040) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051440.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(149125..150441) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068385.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(150565..151302) product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410358.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(151353..152222) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068388.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(152335..153390) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068391.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(153459..155576) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389427.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(155789..159397) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068393.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(159536..160156) product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056414.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene pdxT CDS complement(160241..161116) product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053677.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene pdxS CDS 161405..163228 product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068394.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(163350..164867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(165079..166557) product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068360.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(166643..167074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068361.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(167166..167408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 167696..172534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(172656..173831) product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143696.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(173890..174936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(174939..175964) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064504886.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(175971..177023) product beta-1,6-galactofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001407542.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene wbbI CDS complement(177034..178548) product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771251.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(178545..179951) product O-antigen polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254557.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(179967..180962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(181307..185878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(186416..187234) product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476440.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(187273..188799) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217063484.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(188993..190027) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389605.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(190296..190838) product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068381.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(191285..192799) product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051388.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene araA CDS complement(192896..193588) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051389.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(193621..195258) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051390.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(195306..196685) product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964648.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(197256..198371) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057860.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(198575..199294) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414600.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(199291..200034) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389561.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene lepB CDS complement(200148..200510) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811942.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene rplS CDS complement(200976..202673) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389549.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene pgi CDS complement(202718..202939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(203034..204266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 tRNA 204613..204687 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA 204751..204833 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 205074..206084 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068404.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(206253..206912) product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051401.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(206996..207742) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058292.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene rph CDS 207943..209265 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055715.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 209391..209729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(209816..210100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 210222..210722 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051410.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene coaD CDS 210715..211608 product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057854.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 211615..212211 product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054816.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 212334..212528 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811892.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene rpmF CDS 212642..213382 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055729.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene rnc CDS 213570..215474 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054814.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 215487..216041 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054813.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene ilvN CDS complement(216131..217303) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814403.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(217471..218082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 218265..218807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(218892..221054) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068412.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(221207..221722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(221812..222537) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811881.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 222639..224285 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068414.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene cysS CDS 224494..226143 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022527326.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene ffh CDS 226413..226673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 226738..227445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 227622..228089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 228132..228365 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811858.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 228416..229030 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054805.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene rimM CDS complement(229107..230018) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730689.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 230142..231617 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051460.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 231663..232580 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054789.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene trmD CDS complement(232584..233222) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582362.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene rsmD CDS complement(233308..235761) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068431.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(235944..236138) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811837.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene rpmB CDS 236409..237443 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811834.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 237507..238718 product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051458.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 238788..239426 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051459.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(239556..240689) product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055652.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(240706..241704) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811732.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(241818..242699) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389488.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(242862..244187) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056295.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene murA CDS complement(244370..245065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143587.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 tRNA complement(245208..245281) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(245326..246267) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143590.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(246340..246858) product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390268.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(247062..256379) product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390269.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(256483..258069) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052982.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(258066..259913) product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053766.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 260081..260677 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052980.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(260856..261809) product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389505.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(261822..263075) product SpaA isopeptide-forming pilin-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582935.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(263115..266840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(267377..268828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(268825..270432) product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992104.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(270429..271568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(271570..273612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(273906..274082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(274100..274312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(274912..276087) product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256266.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(276099..276977) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229020.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(276979..277896) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229019.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(277901..279199) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733127.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(279325..280455) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973786.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 sequence3 source 1..141614 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 863..2875 product DUF6020 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390273.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 2887..3750 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053763.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(3934..4623) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829786.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene rplA CDS complement(4639..5070) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053055.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene rplK CDS complement(5420..6265) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389487.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene nusG CDS complement(6306..6533) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053057.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene secE tRNA complement(6570..6645) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(6778..7992) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055070.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(8157..9290) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055074.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene proB CDS complement(9295..10971) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053060.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene obgE CDS complement(11122..11373) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811713.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene rpmA CDS complement(11414..11722) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053062.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene rplU CDS complement(11882..14536) product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582944.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(14879..16075) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811704.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene dapE CDS 16224..17168 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811702.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(17288..18784) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811699.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(18781..19632) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143208.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(19804..21246) product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068714.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(21443..22432) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811687.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene thrB CDS complement(22432..23748) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068712.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(23935..25524) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389477.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(25531..27321) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820794.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene argS CDS complement(27475..28971) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080642.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(29210..29599) product Rid family detoxifying hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054771.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 tRNA complement(29823..29897) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 30024..30653 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081633.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(30830..31762) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740584.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(31941..32951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051473.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(32951..34558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 34773..35591 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389466.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(35816..36598) product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363923.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene nucS CDS complement(36785..37081) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054766.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(37081..38556) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814333.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene atpD CDS complement(38565..39473) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051479.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(39477..41105) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051480.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene atpA CDS complement(41159..41986) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054765.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(42017..42541) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819064.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(42588..42818) product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003831420.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene atpE CDS complement(42879..43682) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814317.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene atpB CDS complement(44214..45251) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054763.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene metA tRNA 45370..45446 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(45500..47425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 47716..49956 product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814307.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(50100..50510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 50743..51237 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054759.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 51813..52382 product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390280.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(52470..53216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818411.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 53392..54141 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814301.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 54149..54841 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051520.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene nth CDS 54940..56478 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057703.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 56530..59343 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054756.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene valS CDS complement(59598..59990) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051524.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(60175..62076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(62458..64077) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051527.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(64282..64596) product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105898.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(64704..65756) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820016.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(66028..67524) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105892.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene gatB CDS complement(67558..69096) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054751.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene gatA CDS complement(69099..69371) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068473.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene gatC CDS 70050..71003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032736338.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(71521..72348) product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051535.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(72348..72989) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051536.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(73024..74403) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054746.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(74649..77411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 note possible pseudo, frameshifted CDS complement(77596..78327) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389498.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 tRNA complement(78557..78631) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(78937..80046) product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389495.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 80344..83322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(83546..83992) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051544.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene rplI CDS complement(84012..84260) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051545.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene rpsR CDS complement(84305..84946) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068475.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(84999..85295) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003828111.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene rpsF CDS complement(85492..86535) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972694.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(86740..86859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(86958..88007) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051650.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene ilvC CDS complement(88360..89412) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051651.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene ilvC CDS complement(89777..91129) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389418.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(91535..93151) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068531.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(93442..94164) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054235.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(94413..95900) product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068532.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene gtfA CDS complement(96171..98243) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390132.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 98506..99492 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814924.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(99656..100744) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051663.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 101330..101452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(101707..103248) product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068231.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(103614..104630) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068829.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(104951..106462) product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643065.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(106657..107601) product beta-galactosidase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102183.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(107582..109525) product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102182.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(109654..110655) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476382.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene galE CDS complement(110659..112149) product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836862.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene galT CDS complement(112306..113481) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921936.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 113903..114937 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289652.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 115125..116453 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814091.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 116450..117493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(117616..118392) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390348.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(118448..119317) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058535.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(119401..121629) product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816051.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(121717..122685) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068671.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(122832..123533) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051631.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(123788..124459) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051632.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(124558..125124) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054672.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(125210..126211) product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051638.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(126357..126989) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055523.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene grpE CDS complement(126992..128863) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051640.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene dnaK CDS 129281..131458 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068527.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene malQ CDS 131570..132616 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051648.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(132764..133378) product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068637.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(133855..134697) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068636.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(134697..135551) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052964.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 135915..136934 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054086.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(137208..138536) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(138817..139344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 139629..140006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 140043..140846 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390367.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(140931..141182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390368.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 sequence4 source 1..763959 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 340..774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 1716..2261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 2393..3046 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052450.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene orn CDS 3084..4499 product PIF1 family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068808.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 4686..6110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(6363..7472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(7465..8142) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816947.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 8585..10378 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055676.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 10748..11458 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138146.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(11471..13552) product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582898.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 13722..14327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 14352..15128 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052460.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene map CDS 15286..16578 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053894.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(16731..17720) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815280.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene dapD CDS complement(17871..18605) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053270.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 18782..19438 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058318.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 19425..20099 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053272.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 20092..20913 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056908.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 20928..21824 product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056925.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 22064..23074 product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994499.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 23125..24000 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524312.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 24135..25223 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722904.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 25220..25888 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434110.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 25972..27147 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390044.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 27335..27526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 27679..28566 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053281.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(29135..30367) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056294.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(30596..31528) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053078.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(31629..32459) product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389614.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(32647..33426) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053283.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene murI CDS 33587..34477 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054039.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene dapF CDS complement(34597..35250) product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389616.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 35336..36217 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054041.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(36350..36574) product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821409.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(36644..38107) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067952.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 38253..39761 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067953.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(39923..41503) product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054045.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 41774..42625 product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389621.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 42671..43096 product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053292.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 tRNA complement(43350..43424) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 43582..45207 product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053293.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 45204..46391 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389635.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene dxr CDS 46464..47666 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054049.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene ispG CDS 47852..49531 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067955.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 49543..50265 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815260.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene recO CDS 50326..51117 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055433.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(51218..51622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 51671..52621 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143212.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(52708..54009) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067956.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(54146..55219) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067957.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(55480..56154) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056912.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 56081..56359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(56587..58143) product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782652.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(58296..59615) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067958.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(60053..61108) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067959.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(61273..63108) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389701.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene ilvD CDS 63243..63377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 63557..64678 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051295.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene prfB CDS 64732..65892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 65889..66812 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812215.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene ftsX CDS 66871..68298 product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113498.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 68428..68907 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812219.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene smpB CDS 69249..71006 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051287.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene glmS CDS 71156..71923 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410317.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(72030..73457) product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053980.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 73518..74933 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812547.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene hisS CDS 74963..76762 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067913.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene aspS CDS 77166..77963 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162094060.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 77979..78806 product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363315.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 78806..79483 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819283.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 79490..80593 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067917.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 80827..82470 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390129.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 82472..83449 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814940.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 83449..84306 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143524.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 84303..85169 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068323.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 85162..85941 product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783136.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(86017..87498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 88179..89189 product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363729.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 89273..90454 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390124.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 91488..92516 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973334.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 92724..94028 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803805.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 94164..95102 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803806.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 95119..95997 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803807.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 96113..97228 product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 97429..97629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 97839..99356 product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389981.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 99440..100387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 100387..103884 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582773.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 104032..105249 product DUF2220 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224063203.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 105492..105704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 105823..106107 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053158.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene rpoZ CDS 106379..107596 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389702.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene metK CDS 107731..108444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 note possible pseudo, frameshifted CDS 108444..110105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 note possible pseudo, frameshifted CDS 110220..110924 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812477.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 110954..111922 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053160.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene fmt CDS complement(112057..112665) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057164.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene serB CDS 112874..114445 product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389705.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene arc CDS 114490..116133 product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011742989.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene dop CDS 116145..116999 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582864.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 117005..117199 product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812488.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 117199..118677 product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068846.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene pafA CDS complement(118799..119083) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812492.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(119272..121671) product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068847.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(121793..123229) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816427.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene purB CDS 123265..123849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 124119..124823 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389591.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 124823..126172 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053725.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 126260..127015 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068345.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene dapB CDS 127411..128301 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389595.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene dapA CDS 128402..130282 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057778.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 130520..133126 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068343.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene pepN CDS complement(133214..133849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 134163..135176 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581611.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 135220..136548 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 136685..137440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(137501..138112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 138229..138468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 138426..140219 product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994410.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene pulA CDS 140203..140943 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922420.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 141004..141774 product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993522.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(141900..143243) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225750.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(143663..145099) product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230584.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 145428..146813 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812074.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene glmM CDS 146856..147509 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816189.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 147506..148903 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068339.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 148912..150078 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051205.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(150062..151087) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056348.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 tRNA complement(151149..151224) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 152449..152820 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813881.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene rpsL CDS 152826..153296 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813834.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene rpsG CDS 153330..155456 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003832662.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene fusA CDS 155594..156793 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051202.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene tuf CDS 157026..157412 product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812258.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 157707..159089 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812265.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene hisD CDS 159086..160246 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067977.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 160394..160993 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052519.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene hisB CDS 160993..161757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815225.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 161779..162423 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067978.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene hisH CDS 162479..163204 product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389648.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene priA CDS complement(163317..164648) product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812277.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 164979..166316 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052524.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene glnA CDS 166469..167404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067979.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(167501..168700) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054393.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene serA CDS complement(168711..170990) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052539.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 171332..171838 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812311.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene mraZ CDS 171838..172902 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052542.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene rsmH CDS 173000..173359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389658.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 173359..175173 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389659.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 175228..176094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067982.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 176191..177462 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389661.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 note possible pseudo, frameshifted CDS 177413..177649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 note possible pseudo, frameshifted CDS 177685..178791 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052547.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene mraY CDS 178845..180299 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067983.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene murD CDS 180373..181575 product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067984.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene ftsW CDS 181599..182771 product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812327.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 182866..184383 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054402.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene murC CDS 184383..185714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 tmRNA 185834..186228 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 186247..186429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(186417..188012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 188011..188187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 188648..189205 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056944.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene efp CDS 189260..189673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 189890..191086 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782674.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene carA CDS 191088..194471 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056239.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene carB CDS 194473..195402 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053266.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene pyrF CDS 195406..195990 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053267.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene gmk CDS complement(196258..196632) product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053312.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(196723..197523) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055440.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene thiD CDS complement(197574..200144) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067965.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene thiC CDS complement(200352..201260) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067966.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(201448..202596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(203092..204966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(205177..206922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 207226..208035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 208251..208817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 209578..210024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 210140..211417 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142659.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 211440..213851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 213856..214692 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226289.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 214716..215762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 215759..216763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 216805..217416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 217591..219066 product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067967.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 219179..220420 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812184.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene dusB CDS 220599..221834 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053319.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene ftsZ CDS 221870..222349 product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053320.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 222536..222817 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812190.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 222958..224349 product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067968.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 224346..224951 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053323.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene lspA CDS 224948..225892 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054072.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 226148..229702 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582833.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene dnaE CDS complement(230121..231017) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067996.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(231058..232272) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067997.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 232599..234218 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068000.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 234422..235516 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052566.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 235518..236702 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052567.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 236708..238444 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052568.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(238607..239128) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057255.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(239270..240871) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068002.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 241095..242603 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068005.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(242741..243466) product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812371.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(243463..244707) product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389675.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(244769..246325) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389678.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(246384..247934) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389678.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 248006..248680 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057260.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 248692..249009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054435.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(249454..250404) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112999.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 250626..251660 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014483607.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(251899..252417) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812394.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene ybaK CDS complement(252649..253707) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052589.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene gap CDS complement(253915..254646) product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 254819..256705 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906399.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene asnB CDS 256720..257049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 257313..258050 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032682519.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene infC CDS 258097..258225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 258268..258651 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812406.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene rplT CDS 258785..259744 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068014.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene xerD CDS 259900..260739 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389684.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 260943..261722 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389687.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 261835..263115 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080872.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene nadA CDS 263112..264839 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389689.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene nadB CDS 264833..265717 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068020.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene nadC CDS 265717..267018 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068021.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(267123..267737) product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052787970.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 267972..269903 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052606.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene typA CDS 270102..270578 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052607.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 270687..271667 product prephenate dehydratase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783121.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 271661..272647 product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068024.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(272746..273006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812433.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(273018..275879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(275876..276877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 276964..277926 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389693.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 278169..279812 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068025.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 280056..280982 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052614.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 281007..281957 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052615.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 281974..283980 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783117.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 284054..284947 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389696.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 285090..285959 product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068026.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 285962..286720 product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783114.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 286724..288001 product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055251.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 288068..288595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 288733..291195 product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068028.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 291409..294108 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068029.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene acnA CDS 294494..294880 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813420.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(294894..296249) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(296246..296896) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101939.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 297062..298102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(298104..300209) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390093.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(300293..300634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 300711..301574 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052631.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 301862..302812 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052632.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(302858..303532) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815463.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 303686..305125 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021648605.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene miaB CDS 305109..306152 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052636.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene miaA CDS 306276..309104 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052638.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 309141..309803 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058588.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene pgsA CDS 309814..310440 product nicotinamide-nucleotide amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813803.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 310511..311023 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052641.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 311207..312145 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025221252.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 312324..313253 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025221252.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 313289..314272 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053710.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 314284..315084 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051288.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 315259..315492 product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113620.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 315843..317030 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052644.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene recA CDS 317037..317675 product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390086.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 318349..319011 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052648.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene raiA CDS 319227..322076 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068038.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene secA CDS complement(322170..322403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 322757..323839 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068039.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene trpD CDS complement(323986..324543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390083.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 324591..325304 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068041.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(325415..327538) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390081.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(327597..328676) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055156.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 328821..329636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 329804..331252 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055162.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 331331..333625 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068045.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(333757..335016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389598.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 335661..336566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(336590..339757) product DUF3427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389398.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(339764..340189) product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811442.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 340596..341804 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582790.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 341921..346570 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068048.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 346620..348026 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776705.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 348023..351337 product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776704.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 351514..352527 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582789.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(352615..355308) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068049.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 355570..356934 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740565.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 356931..359549 product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068555.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 359682..360932 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054496.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(361038..362189) product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813754.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene sepH CDS 362337..362627 product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052669.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 362627..363112 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055963.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene dut CDS 363212..365536 product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012471819.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(365621..366160) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 366251..367120 product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390054.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 367337..367681 product DUF979 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390167.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 367760..368410 product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390168.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene pcp CDS complement(368595..369398) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390072.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(369686..370363) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112597.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(370360..371163) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115441.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(371246..372085) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 372341..373489 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052048.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 373552..375249 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052049.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 375249..375452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 375711..378086 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582507.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene pflB CDS 378214..379095 product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068217.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene pflA CDS 379265..379906 product DUF3000 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068216.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 379887..381191 product HRDC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390066.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 381246..382613 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068214.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene tig CDS 382978..383457 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928208.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene dtd CDS 383470..384174 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390042.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(384171..384932) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897033.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(385145..385879) product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068138.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 386158..386835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 387121..387618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 387628..388020 product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888442.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(388238..389704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776735.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(389807..390253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(390395..390559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 390776..391471 product DUF1819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228220.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 391478..392197 product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038867.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 392289..395945 product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228200.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene brxC CDS 395942..397825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 397818..399161 product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038871.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 399225..401324 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038872.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 402124..403056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 403129..404661 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022342.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 404654..407299 product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038873.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene pglZ CDS 407342..409549 product BREX system Lon protease-like protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038874.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene brxL CDS 409564..410721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(410894..411871) product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041807480.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 412103..412300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389845.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(412563..412850) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813907.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(413201..413668) product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068139.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(413799..415703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(415798..417864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(418203..418682) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928208.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene dtd CDS complement(418687..419445) product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054642.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(419635..420609) product DUF1524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390253.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 420740..421495 product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053362.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 421488..422942 product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068657.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 422954..423502 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813311.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 423721..425400 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068162.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 425595..427868 product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836501.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 428094..429407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(429494..430531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 430807..431211 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052678.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(431308..432510) product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582782.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 432577..433761 product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054224.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 433939..434880 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054371.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 434966..435775 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389977.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 435779..436813 product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389848.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 436884..437441 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068133.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 437577..439883 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389888.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene metE CDS 440068..440913 product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111779.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene metF CDS 440963..444067 product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068132.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 444209..445207 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054218.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene pyrB CDS 445207..445626 product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816669.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 445630..447054 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068131.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 447079..448026 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052226.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene pyrF CDS 448043..448867 product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052227.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 448864..449823 product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052228.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 449930..450625 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389897.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene pyrE CDS complement(450731..451654) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813143.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(451734..452369) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068130.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 452539..453774 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185067440.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(453825..454859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(454978..455955) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813131.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(456131..457912) product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052234.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(458236..459357) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812397.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 459537..459971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 460039..460749 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222252.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 460881..461306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 461373..462422 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053640.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 462674..463423 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816623.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 463548..465149 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052765.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 465335..467149 product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389514.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 467382..470315 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068107.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene uvrA CDS 470420..472618 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582770.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene uvrC CDS 472689..473636 product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056051.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 473636..474592 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363500.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene rapZ CDS 474773..475720 product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813277.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene whiA CDS 475846..477051 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032737730.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 477140..477940 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052784.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene tpiA CDS 478039..478287 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813271.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene secG CDS 478375..479325 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056108.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 479325..480179 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054292.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 480391..481884 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812931.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(482135..483238) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111694.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene tal CDS complement(483327..485435) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068109.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene tkt CDS 485693..486862 product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068110.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene hrcA CDS 486922..488064 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813250.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene dnaJ CDS complement(488177..489091) product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052850.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene uppP CDS 489264..490055 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054285.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(490150..490953) product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068111.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 tRNA 491135..491208 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA 491237..491308 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA 491348..491420 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA 491459..491532 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA 491553..491626 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS 491848..492534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(492650..494683) product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582533.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 494953..496101 product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052160.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 496105..496410 product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816822.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 496407..497837 product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055089.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 498070..499422 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 499838..500266 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389907.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 500399..501025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 501262..501693 product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051196.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 501690..502061 product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053642.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 502102..502656 product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(502678..503841) product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964735.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 504141..505358 product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 505405..505995 product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435157.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 506083..508755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 508945..509622 product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262713.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 509705..510649 product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389832.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene bsh CDS 510775..511143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 note possible pseudo, frameshifted CDS complement(511252..512250) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053364.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 512477..513091 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052163.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 513294..514421 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068176.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 514566..515279 product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389822.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(515377..515637) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052167.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene rpsT CDS 515804..517684 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053360.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene lepA CDS 517693..518895 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080545203.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene hemW CDS complement(519048..519845) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051633.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(519862..521364) product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057589.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(521361..522485) product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068525.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(522537..523817) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054673.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 524367..528854 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068166.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene gltB CDS 528856..530403 product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812939.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 530497..530958 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068160.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 531088..534777 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058870.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 534922..536166 product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068159.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene glgA CDS 536335..537183 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053343.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 537313..540249 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068058.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene leuS CDS 540476..541777 product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819596.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene sstT CDS 542298..542780 product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054369.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 542783..544840 product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507697.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(544940..545146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 545072..545236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 note possible pseudo, internal stop codon CDS complement(545353..545802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(545988..546650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 546829..546948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 547142..548089 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057620.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene holA CDS 548092..548679 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047289290.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene tsaE CDS 548686..549480 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389971.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene tsaB CDS 549477..549989 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783284.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene rimI CDS 549986..551029 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054363.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene tsaD tRNA 551148..551221 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 551266..551343 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS 551551..553584 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054284.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene thrS CDS 553679..554434 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813232.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 554441..555022 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052856.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene ruvC CDS 555091..555708 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052857.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene ruvA CDS 555710..555964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 note possible pseudo, frameshifted CDS 555961..556770 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054282.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene ruvB note possible pseudo, frameshifted CDS 556812..557231 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052859.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 557231..557827 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068112.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 557893..559086 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052861.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene sucC CDS 559086..560006 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052862.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene sucD CDS 560035..561354 product DUF6350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052863.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 561332..562957 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389934.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene purH CDS 563105..563377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813210.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(563306..564274) product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052865.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 564413..565186 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052866.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 565183..567312 product bifunctional cytidylate kinase/GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055764.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene der tRNA 567419..567494 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS 567973..569400 product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055741.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 569677..571422 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817902.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 571435..571782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389921.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 571910..574366 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068114.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 574442..574786 product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052872.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 574877..575590 product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813164.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(575985..576386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(576352..576987) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052293.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(577081..577524) product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052292.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(577530..578369) product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389926.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(578372..578704) product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052290.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(578705..579682) product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052289.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(579679..580170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 580133..580288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(580316..581167) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055763.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene hisG CDS complement(581228..581491) product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054261.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(581500..582171) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813194.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene rpe CDS complement(582193..583107) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389930.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene lgt CDS complement(583104..583904) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582574.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene trpA CDS complement(584007..586094) product bifunctional indole-3-glycerol phosphate synthase/tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068116.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(586150..587706) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052763.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene trpE CDS complement(587706..588095) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052762.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene hisI CDS complement(588132..588902) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068099.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene hisF CDS complement(589133..590296) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068098.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene rlmN CDS complement(590412..591398) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052757.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(591424..591978) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052756.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene frr CDS complement(592024..592773) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052755.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene pyrH CDS complement(593062..593937) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052754.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene tsf CDS complement(594044..594853) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056702.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene rpsB CDS complement(595091..595573) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052751.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene def CDS complement(595577..597613) product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068097.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(597870..598172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(598550..599674) product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052748.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 599801..601021 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783318.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 601242..602771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115246.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(602901..603878) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053368.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene era CDS complement(603880..605298) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052157.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(605347..605892) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052156.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene ybeY CDS complement(605882..607003) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052155.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(607017..607355) product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055091.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(607435..608232) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052153.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 tRNA 608348..608436 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 608492..609364 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812896.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 609533..610780 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812894.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene glgC CDS complement(610945..611526) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052150.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(611587..612144) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052149.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(612183..613454) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389815.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(613577..614356) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053376.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene sufC CDS complement(614376..615476) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052146.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene sufD CDS complement(615605..617122) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055081.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene sufB CDS complement(617245..618906) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052143.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(619084..624351) product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947102.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene pulA CDS complement(624647..625093) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052141.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene aroQ CDS complement(625131..626765) product bifunctional shikimate kinase/3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052140.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(626762..627952) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816938.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene aroC CDS 627996..628463 product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143357.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(628525..629703) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003823435.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene mltG CDS complement(629703..630167) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812865.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene ruvX CDS complement(630178..632856) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053385.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene alaS CDS complement(632937..633173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812861.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(633173..633553) product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812859.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(633648..634322) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055085.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(634465..635091) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812853.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene rpsD CDS complement(635285..636061) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052129.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(636063..637280) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068184.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(637283..637678) product DUF4418 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052126.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(637889..639679) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052919.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(639689..641542) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582988.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(641716..644328) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052125.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 644494..645075 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057285.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 645169..646524 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052123.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(646597..647859) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389794.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(647846..649060) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389793.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(649072..650034) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057287.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 650570..651406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 651508..652185 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052109.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(652192..652395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(652485..654896) product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055496.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(655004..655231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 655326..655841 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068818.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 656002..656913 product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101955.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 656924..658108 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101954.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(658130..659023) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740577.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 659162..659998 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(659952..661742) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107752.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 662296..663855 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817686.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene zwf CDS 663852..664799 product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818892.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 664856..665647 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143563.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene pgl CDS complement(665752..665928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(666092..668461) product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033493356.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(668520..668990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(669109..670002) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(670005..670919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(670919..672193) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970436.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(672420..673436) product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068667.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(673651..674724) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068665.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(674781..676892) product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068664.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(676919..677602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(677771..679219) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814647.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene gndA CDS complement(679306..679923) product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723214.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 680316..681110 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054022.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 681107..681895 product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817259.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene fetB CDS 681967..682677 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389903.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(682735..683115) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104332.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(683311..684600) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052100.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(684732..685544) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813549.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(685722..686468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(686614..686820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(687527..688366) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143544.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(688486..688899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(688913..689290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 689405..690745 product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053653.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(690825..691841) product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051199.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 692030..693016 product transcriptional regulator PtxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113738.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene ptxS CDS 693189..694514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329694.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 694637..695386 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102224.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 695436..696407 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963717.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 696460..697080 product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963718.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 697077..697628 product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963719.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene hxlB CDS 697743..698609 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709302.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(698742..700793) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068191.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(701051..702019) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816259.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(702177..702500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(702502..703017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 702953..703162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(703492..705543) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389378.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 706148..706513 product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813590.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(706760..707854) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081438.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene ychF CDS complement(708072..708872) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783010.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene proC CDS complement(708960..710297) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068205.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 710475..713084 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047379863.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 713160..713906 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052073.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(713977..716502) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068207.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(716499..716618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 note possible pseudo, frameshifted CDS complement(716660..717451) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068208.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(717831..718118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(718337..720403) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390363.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene phoA CDS complement(720636..723200) product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582331.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(723443..723652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(723798..725111) product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052070.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 725460..726335 product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052069.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 726559..727014 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813644.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 727014..728552 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052067.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 728586..730028 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390056.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(730025..730372) product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813638.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 730528..732351 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053431.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 732452..733399 product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052064.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 733436..734107 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052063.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(734276..735025) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068210.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(735022..736455) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068211.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 tRNA complement(736646..736720) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA complement(736758..736832) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS complement(737026..738360) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021975717.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene clpX CDS complement(738495..739148) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052059.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(739145..739759) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052058.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(740085..740693) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068849.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 tRNA complement(741424..741497) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(741573..741646) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS complement(741872..742570) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057554.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(742713..743129) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052031.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene rsfS CDS complement(743233..744567) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782812.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene glmU CDS complement(744767..745270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 745532..745903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 745969..746412 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673332.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 746668..747681 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051408.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(747704..748309) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389798.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 tRNA 748565..748636 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(749048..750070) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052033.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(750246..752225) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068225.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(752606..753832) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068227.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(754073..755746) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582495.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene pta CDS complement(755956..758433) product phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068223.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(758696..758929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 759069..760631 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389788.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene guaA CDS 761050..762318 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033503612.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 762630..763265 product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548076.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 763274..763645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 sequence5 source 1..197386 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(582..2612) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055427524.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 2808..3713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(3784..4140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(5170..6933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(7190..10075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(10331..11620) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068683.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(11620..12456) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068684.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(12618..14489) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068688.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(14681..15913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(15910..17694) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068688.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(18011..19807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(19959..23438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 23926..27057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(27151..27999) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643284.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 28039..28275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(28280..29950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(29947..31629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(31691..32770) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994687.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 32873..34312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(34375..36165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 36570..37964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(38113..40191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(40318..41382) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053235.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 tRNA 41594..41681 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS complement(42133..43806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 44100..45209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 45399..46049 product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927004.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(46128..47882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(48203..49792) product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003833659.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(50258..51544) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783481.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(51756..52823) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068538.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene fbaA CDS complement(52951..54768) product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060618734.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 55016..57634 product YhgE/Pip family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143686.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 57631..59907 product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068631.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(60268..61224) product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068560.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene yddG CDS complement(62375..62635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 62619..62888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 tRNA complement(62914..62987) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS complement(63294..64169) product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055925.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene htpX CDS complement(64635..66080) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811466.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(66329..67987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994508.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(68056..68217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 68407..69885 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224035.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 70088..71098 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170143.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene ansA CDS complement(71213..73393) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068542.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(73754..75631) product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068543.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 75970..77271 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051676.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene tgt tRNA 77558..77641 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS 78175..78636 product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055906.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(79082..80011) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143687.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(80270..82867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(83073..84134) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068564.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(84252..86894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 87149..87850 product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068566.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 87875..88405 product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051708.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 88413..90065 product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051709.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 90062..91489 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056849.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 91486..92952 product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389388.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 92949..93908 product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068567.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 93905..95959 product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389386.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene pknB CDS complement(96085..96729) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811402.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(96792..97898) product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068569.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(97895..98656) product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816156.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 98824..99267 product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389385.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene crgA CDS complement(99618..100409) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051719.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 100492..100722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(101012..103468) product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051721.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 103727..104125 product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022527180.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(104319..104690) product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815101.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 104837..105937 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815099.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene trpS CDS complement(106232..107860) product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(108001..109857) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068576.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 110130..112877 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068577.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 114557..114874 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 114868..115161 product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994045.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(115337..115564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(115681..116646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058018.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 116621..117016 product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476020.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 117120..117815 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389340.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(118070..118765) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053629.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 tRNA 118961..119035 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA 119073..119146 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS complement(119213..120535) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815077.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 120655..121215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15320 note possible pseudo, frameshifted tRNA 121397..121470 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS complement(121558..121803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 122037..123125 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973334.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 123376..124692 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803805.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 124910..125881 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803806.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 125887..126747 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803807.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 126864..129278 product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027547.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene yicI CDS 129464..130483 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783206.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene rsmI CDS complement(130508..130936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(130933..131613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 131890..133740 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068654.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene metG CDS 134103..134993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(134974..135156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(135302..135472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 135610..136956 product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815054.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene gdhA CDS 137135..137353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 137432..139444 product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783044.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 139530..140510 product protein disulfide-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390383.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 tRNA 140571..140645 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 CDS 140983..142518 product ubiquitin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390384.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 142534..143424 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068602.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene rsmA CDS 143421..144332 product 4-diphosphocytidyl-2C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051793.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 144361..144993 product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815003.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(145127..146503) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051791.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 146426..146620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 146631..147335 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815006.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 147332..149524 product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173361541.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 149521..153204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 154174..155820 product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058493.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene recQ CDS complement(155927..157309) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068597.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(157311..158276) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013364057.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 158781..159719 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114045.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene trxB CDS complement(160233..160901) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056575.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene rsmG CDS complement(160995..161510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390392.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(161627..162670) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051771.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene yidC CDS complement(162990..163352) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051769.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene rnpA CDS complement(163378..163512) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051768.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene rpmH CDS 163819..165375 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051767.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene dnaA CDS 165612..165944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 165934..167058 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815931.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene dnaN CDS 167091..168245 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054593.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 168242..168712 product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783054.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 168858..170960 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173361534.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene gyrB CDS 171114..173792 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068593.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene gyrA CDS 173848..174459 product DUF3566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051760.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 174980..176107 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051809.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene ugpC CDS 176337..177746 product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390376.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(178147..179139) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814978.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene rlmB CDS complement(179301..180830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(180899..181480) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051821.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene dcd CDS complement(181800..183872) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068624.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 184021..184464 product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056534.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(184507..185349) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507544.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 185531..187825 product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390374.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(187911..189113) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054616.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 189232..189402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 189637..190929 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068626.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 190944..191870 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051829.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 191901..192773 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051830.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 192974..194794 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068628.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 194935..196200 product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051833.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene ilvA CDS complement(196302..197063) product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051834.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(197068..197316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 sequence6 source 1..1929 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(486..797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 note possible pseudo, frameshifted CDS complement(987..1592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950