>Feature sequence01 1805 534 gene locus_tag LOCUS_00010 gene tyrS 1805 534 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408375.1 protein_id gnl|my_center|LOCUS_00010 2500 1802 gene locus_tag LOCUS_00020 2500 1802 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408373.1 protein_id gnl|my_center|LOCUS_00020 2731 2510 gene locus_tag LOCUS_00030 2731 2510 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408362.1 protein_id gnl|my_center|LOCUS_00030 5827 2834 gene locus_tag LOCUS_00040 5827 2834 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729310.1 protein_id gnl|my_center|LOCUS_00040 7318 5870 gene locus_tag LOCUS_00050 gene argH 7318 5870 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110848.1 protein_id gnl|my_center|LOCUS_00050 8544 7327 gene locus_tag LOCUS_00060 8544 7327 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079277.1 protein_id gnl|my_center|LOCUS_00060 9112 8615 gene locus_tag LOCUS_00070 9112 8615 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408178.1 protein_id gnl|my_center|LOCUS_00070 10032 9109 gene locus_tag LOCUS_00080 gene argF 10032 9109 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408165.1 protein_id gnl|my_center|LOCUS_00080 11234 10032 gene locus_tag LOCUS_00090 11234 10032 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110845.1 protein_id gnl|my_center|LOCUS_00090 12178 11231 gene locus_tag LOCUS_00100 gene argB 12178 11231 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895218.1 protein_id gnl|my_center|LOCUS_00100 13434 12175 gene locus_tag LOCUS_00110 gene argJ 13434 12175 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079269.1 protein_id gnl|my_center|LOCUS_00110 14477 13431 gene locus_tag LOCUS_00120 gene argC 14477 13431 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729317.1 protein_id gnl|my_center|LOCUS_00120 17040 14542 gene locus_tag LOCUS_00130 gene pheT 17040 14542 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729318.1 protein_id gnl|my_center|LOCUS_00130 18136 17093 gene locus_tag LOCUS_00140 gene pheS 18136 17093 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895223.1 protein_id gnl|my_center|LOCUS_00140 19084 18278 gene locus_tag LOCUS_00150 19084 18278 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408112.1 protein_id gnl|my_center|LOCUS_00150 19515 19135 gene locus_tag LOCUS_00160 gene rplT 19515 19135 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058700.1 protein_id gnl|my_center|LOCUS_00160 19778 19584 gene locus_tag LOCUS_00170 gene rpmI 19778 19584 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058702.1 protein_id gnl|my_center|LOCUS_00170 20486 19833 gene locus_tag LOCUS_00180 gene infC 20486 19833 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729330.1 protein_id gnl|my_center|LOCUS_00180 20759 21142 gene locus_tag LOCUS_00190 20759 21142 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729332.1 protein_id gnl|my_center|LOCUS_00190 24151 21158 gene locus_tag LOCUS_00200 gene uvrA 24151 21158 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895254.1 protein_id gnl|my_center|LOCUS_00200 24363 25046 gene locus_tag LOCUS_00210 24363 25046 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895255.1 protein_id gnl|my_center|LOCUS_00210 25162 26337 gene locus_tag LOCUS_00220 25162 26337 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728928.1 protein_id gnl|my_center|LOCUS_00220 26464 28773 gene locus_tag LOCUS_00230 26464 28773 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449606.1 protein_id gnl|my_center|LOCUS_00230 29258 28806 gene locus_tag LOCUS_00240 29258 28806 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075327.1 protein_id gnl|my_center|LOCUS_00240 31632 29479 gene locus_tag LOCUS_00250 gene uvrB 31632 29479 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911575.1 protein_id gnl|my_center|LOCUS_00250 31702 32280 gene locus_tag LOCUS_00260 31702 32280 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110813.1 protein_id gnl|my_center|LOCUS_00260 33419 32241 gene locus_tag LOCUS_00270 gene coaE 33419 32241 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088698.1 protein_id gnl|my_center|LOCUS_00270 34716 33469 gene locus_tag LOCUS_00280 34716 33469 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224306.1 protein_id gnl|my_center|LOCUS_00280 36512 35031 gene locus_tag LOCUS_00290 gene rpsA 36512 35031 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895279.1 protein_id gnl|my_center|LOCUS_00290 36712 37515 gene locus_tag LOCUS_00300 36712 37515 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 protein_id gnl|my_center|LOCUS_00300 38317 37523 gene locus_tag LOCUS_00310 38317 37523 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226808.1 protein_id gnl|my_center|LOCUS_00310 38436 38819 gene locus_tag LOCUS_00320 38436 38819 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226809.1 protein_id gnl|my_center|LOCUS_00320 39586 38825 gene locus_tag LOCUS_00330 39586 38825 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894626.1 protein_id gnl|my_center|LOCUS_00330 40515 39583 gene locus_tag LOCUS_00340 40515 39583 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894625.1 protein_id gnl|my_center|LOCUS_00340 41443 40541 gene locus_tag LOCUS_00350 41443 40541 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894624.1 protein_id gnl|my_center|LOCUS_00350 41559 42062 gene locus_tag LOCUS_00360 41559 42062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 42385 42083 gene locus_tag LOCUS_00370 42385 42083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409512.1 protein_id gnl|my_center|LOCUS_00370 45317 42534 gene locus_tag LOCUS_00380 gene polA 45317 42534 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111138.1 protein_id gnl|my_center|LOCUS_00380 45530 46780 gene locus_tag LOCUS_00390 45530 46780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 46785 47777 gene locus_tag LOCUS_00400 46785 47777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 47767 48843 gene locus_tag LOCUS_00410 47767 48843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 48840 49667 gene locus_tag LOCUS_00420 48840 49667 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_00420 51137 49767 gene locus_tag LOCUS_00430 51137 49767 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_00430 51915 51262 gene locus_tag LOCUS_00440 51915 51262 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057960.1 protein_id gnl|my_center|LOCUS_00440 52076 52151 gene locus_tag LOCUS_t00010 52076 52151 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 53277 52126 gene locus_tag LOCUS_00450 53277 52126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00450 53674 53378 gene locus_tag LOCUS_00460 53674 53378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 54352 53771 gene locus_tag LOCUS_00470 54352 53771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 54643 55314 gene locus_tag LOCUS_00480 54643 55314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 55406 56617 gene locus_tag LOCUS_00490 gene aroB 55406 56617 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894414.1 protein_id gnl|my_center|LOCUS_00490 56610 57485 gene locus_tag LOCUS_00500 56610 57485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 57482 58804 gene locus_tag LOCUS_00510 57482 58804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 58809 59867 gene locus_tag LOCUS_00520 58809 59867 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_00520 59864 60628 gene locus_tag LOCUS_00530 59864 60628 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813616.1 protein_id gnl|my_center|LOCUS_00530 60817 61587 gene locus_tag LOCUS_00540 60817 61587 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727889.1 protein_id gnl|my_center|LOCUS_00540 61584 61778 gene locus_tag LOCUS_00550 61584 61778 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727890.1 protein_id gnl|my_center|LOCUS_00550 62867 61836 gene locus_tag LOCUS_00560 62867 61836 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727891.1 protein_id gnl|my_center|LOCUS_00560 63385 62939 gene locus_tag LOCUS_00570 63385 62939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 63562 65064 gene locus_tag LOCUS_00580 63562 65064 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104247.1 protein_id gnl|my_center|LOCUS_00580 65949 65080 gene locus_tag LOCUS_00590 gene sigF 65949 65080 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417158.1 protein_id gnl|my_center|LOCUS_00590 66414 67325 gene locus_tag LOCUS_00600 66414 67325 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224926.1 protein_id gnl|my_center|LOCUS_00600 68202 67336 gene locus_tag LOCUS_00610 68202 67336 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894617.1 protein_id gnl|my_center|LOCUS_00610 69735 68317 gene locus_tag LOCUS_00620 gene pyk 69735 68317 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728910.1 protein_id gnl|my_center|LOCUS_00620 71305 69788 gene locus_tag LOCUS_00630 71305 69788 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728909.1 protein_id gnl|my_center|LOCUS_00630 75884 71298 gene locus_tag LOCUS_00640 gene gltB 75884 71298 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728908.1 protein_id gnl|my_center|LOCUS_00640 77177 76041 gene locus_tag LOCUS_00650 77177 76041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 77971 77174 gene locus_tag LOCUS_00660 gene trpA 77971 77174 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075867.1 protein_id gnl|my_center|LOCUS_00660 79347 77968 gene locus_tag LOCUS_00670 gene trpB 79347 77968 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728904.1 protein_id gnl|my_center|LOCUS_00670 80169 79351 gene locus_tag LOCUS_00680 gene trpC 80169 79351 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057938.1 protein_id gnl|my_center|LOCUS_00680 81135 80299 gene locus_tag LOCUS_00690 81135 80299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 82766 81132 gene locus_tag LOCUS_00700 82766 81132 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407977.1 protein_id gnl|my_center|LOCUS_00700 82952 82770 gene locus_tag LOCUS_00710 82952 82770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 83305 82952 gene locus_tag LOCUS_00720 gene hisI 83305 82952 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224158.1 protein_id gnl|my_center|LOCUS_00720 84075 83302 gene locus_tag LOCUS_00730 gene hisF 84075 83302 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898942.1 protein_id gnl|my_center|LOCUS_00730 84911 84072 gene locus_tag LOCUS_00740 84911 84072 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894599.1 protein_id gnl|my_center|LOCUS_00740 85654 84911 gene locus_tag LOCUS_00750 gene priA 85654 84911 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114402.1 protein_id gnl|my_center|LOCUS_00750 86003 85698 gene locus_tag LOCUS_00760 86003 85698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 86635 86000 gene locus_tag LOCUS_00770 gene hisH 86635 86000 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057924.1 protein_id gnl|my_center|LOCUS_00770 87291 86650 gene locus_tag LOCUS_00780 gene hisB 87291 86650 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407950.1 protein_id gnl|my_center|LOCUS_00780 88436 87288 gene locus_tag LOCUS_00790 88436 87288 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728896.1 protein_id gnl|my_center|LOCUS_00790 89791 88433 gene locus_tag LOCUS_00800 gene hisD 89791 88433 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877610.1 protein_id gnl|my_center|LOCUS_00800 91069 90017 gene locus_tag LOCUS_00810 91069 90017 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056643.1 protein_id gnl|my_center|LOCUS_00810 92095 91211 gene locus_tag LOCUS_00820 gene nadC 92095 91211 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894590.1 protein_id gnl|my_center|LOCUS_00820 93105 92092 gene locus_tag LOCUS_00830 gene nadA 93105 92092 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407931.1 protein_id gnl|my_center|LOCUS_00830 93253 93948 gene locus_tag LOCUS_00840 93253 93948 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111216.1 protein_id gnl|my_center|LOCUS_00840 94560 93904 gene locus_tag LOCUS_00850 94560 93904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 94817 94557 gene locus_tag LOCUS_00860 94817 94557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075895.1 protein_id gnl|my_center|LOCUS_00860 95900 94833 gene locus_tag LOCUS_00870 gene bioB 95900 94833 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057907.1 protein_id gnl|my_center|LOCUS_00870 96641 95952 gene locus_tag LOCUS_00880 gene bioD 96641 95952 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027666.1 protein_id gnl|my_center|LOCUS_00880 97828 96638 gene locus_tag LOCUS_00890 97828 96638 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407805.1 protein_id gnl|my_center|LOCUS_00890 99188 97848 gene locus_tag LOCUS_00900 99188 97848 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728880.1 protein_id gnl|my_center|LOCUS_00900 99330 101570 gene locus_tag LOCUS_00910 99330 101570 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104325.1 protein_id gnl|my_center|LOCUS_00910 101692 104124 gene locus_tag LOCUS_00920 101692 104124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 104128 106497 gene locus_tag LOCUS_00930 gene treY 104128 106497 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407790.1 protein_id gnl|my_center|LOCUS_00930 106509 107903 gene locus_tag LOCUS_00940 gene xylB 106509 107903 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877620.1 protein_id gnl|my_center|LOCUS_00940 109437 107926 gene locus_tag LOCUS_00950 109437 107926 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730628.1 protein_id gnl|my_center|LOCUS_00950 110552 109434 gene locus_tag LOCUS_00960 110552 109434 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729197.1 protein_id gnl|my_center|LOCUS_00960 110677 111696 gene locus_tag LOCUS_00970 110677 111696 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896980.1 protein_id gnl|my_center|LOCUS_00970 111747 113081 gene locus_tag LOCUS_00980 111747 113081 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896979.1 protein_id gnl|my_center|LOCUS_00980 113085 114038 gene locus_tag LOCUS_00990 113085 114038 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896978.1 protein_id gnl|my_center|LOCUS_00990 114038 114916 gene locus_tag LOCUS_01000 114038 114916 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896977.1 protein_id gnl|my_center|LOCUS_01000 114991 116100 gene locus_tag LOCUS_01010 gene ugpC 114991 116100 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730626.1 protein_id gnl|my_center|LOCUS_01010 116139 117896 gene locus_tag LOCUS_01020 gene treZ 116139 117896 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728877.1 protein_id gnl|my_center|LOCUS_01020 117932 118975 gene locus_tag LOCUS_01030 117932 118975 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028601.1 protein_id gnl|my_center|LOCUS_01030 120468 119113 gene locus_tag LOCUS_01040 gene ilvA 120468 119113 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908197.1 protein_id gnl|my_center|LOCUS_01040 120949 120506 gene locus_tag LOCUS_01050 120949 120506 CDS product F420H(2)-dependent quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407780.1 protein_id gnl|my_center|LOCUS_01050 121176 121424 gene locus_tag LOCUS_01060 121176 121424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 124968 121414 gene locus_tag LOCUS_01070 gene dnaE 124968 121414 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082233.1 protein_id gnl|my_center|LOCUS_01070 125857 125180 gene locus_tag LOCUS_01080 125857 125180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 126773 125847 gene locus_tag LOCUS_01090 126773 125847 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728869.1 protein_id gnl|my_center|LOCUS_01090 127284 126766 gene locus_tag LOCUS_01100 gene lspA 127284 126766 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495573.1 protein_id gnl|my_center|LOCUS_01100 127435 128412 gene locus_tag LOCUS_01110 127435 128412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014909.1 protein_id gnl|my_center|LOCUS_01110 129007 128477 gene locus_tag LOCUS_01120 129007 128477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 129269 130237 gene locus_tag LOCUS_01130 129269 130237 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973324.1 protein_id gnl|my_center|LOCUS_01130 131682 130246 gene locus_tag LOCUS_01140 131682 130246 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728865.1 protein_id gnl|my_center|LOCUS_01140 132143 131769 gene locus_tag LOCUS_01150 132143 131769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 132607 132140 gene locus_tag LOCUS_01160 132607 132140 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230647.1 protein_id gnl|my_center|LOCUS_01160 132718 133407 gene locus_tag LOCUS_01170 132718 133407 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729239.1 protein_id gnl|my_center|LOCUS_01170 136611 133396 gene locus_tag LOCUS_01180 gene ileS 136611 133396 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728863.1 protein_id gnl|my_center|LOCUS_01180 137521 136889 gene locus_tag LOCUS_01190 137521 136889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 138451 137603 gene locus_tag LOCUS_01200 138451 137603 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080209.1 protein_id gnl|my_center|LOCUS_01200 139053 138769 gene locus_tag LOCUS_01210 139053 138769 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900476.1 protein_id gnl|my_center|LOCUS_01210 139851 139111 gene locus_tag LOCUS_01220 gene sepF 139851 139111 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411133.1 protein_id gnl|my_center|LOCUS_01220 140725 139940 gene locus_tag LOCUS_01230 140725 139940 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224822.1 protein_id gnl|my_center|LOCUS_01230 141402 140722 gene locus_tag LOCUS_01240 gene pgeF 141402 140722 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729652.1 protein_id gnl|my_center|LOCUS_01240 142627 141467 gene locus_tag LOCUS_01250 gene ftsZ 142627 141467 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080214.1 protein_id gnl|my_center|LOCUS_01250 143663 142851 gene locus_tag LOCUS_01260 143663 142851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 145216 143660 gene locus_tag LOCUS_01270 gene murC 145216 143660 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411159.1 protein_id gnl|my_center|LOCUS_01270 146346 145213 gene locus_tag LOCUS_01280 gene murG 146346 145213 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729656.1 protein_id gnl|my_center|LOCUS_01280 148022 146343 gene locus_tag LOCUS_01290 gene ftsW 148022 146343 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049746059.1 protein_id gnl|my_center|LOCUS_01290 149638 148019 gene locus_tag LOCUS_01300 gene murD 149638 148019 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729658.1 protein_id gnl|my_center|LOCUS_01300 150737 149640 gene locus_tag LOCUS_01310 gene mraY 150737 149640 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060906.1 protein_id gnl|my_center|LOCUS_01310 151302 150790 gene locus_tag LOCUS_01320 151302 150790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 152924 151299 gene locus_tag LOCUS_01330 152924 151299 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729660.1 protein_id gnl|my_center|LOCUS_01330 154996 153062 gene locus_tag LOCUS_01340 gene pbpB 154996 153062 CDS product D,D-transpeptidase PbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411214.1 protein_id gnl|my_center|LOCUS_01340 156094 155135 gene locus_tag LOCUS_01350 156094 155135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 157157 156180 gene locus_tag LOCUS_01360 gene rsmH 157157 156180 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729663.1 protein_id gnl|my_center|LOCUS_01360 157834 157403 gene locus_tag LOCUS_01370 gene mraZ 157834 157403 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856549.1 protein_id gnl|my_center|LOCUS_01370 158648 158241 gene locus_tag LOCUS_01380 158648 158241 CDS product DUF3040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110487.1 protein_id gnl|my_center|LOCUS_01380 159271 158786 gene locus_tag LOCUS_01390 159271 158786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 159577 160185 gene locus_tag LOCUS_01400 159577 160185 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060891.1 protein_id gnl|my_center|LOCUS_01400 160169 161848 gene locus_tag LOCUS_01410 160169 161848 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 protein_id gnl|my_center|LOCUS_01410 161845 162708 gene locus_tag LOCUS_01420 161845 162708 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225926.1 protein_id gnl|my_center|LOCUS_01420 162801 163451 gene locus_tag LOCUS_01430 162801 163451 CDS product DUF3153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296496.1 protein_id gnl|my_center|LOCUS_01430 163507 164658 gene locus_tag LOCUS_01440 163507 164658 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225927.1 protein_id gnl|my_center|LOCUS_01440 165609 164674 gene locus_tag LOCUS_01450 165609 164674 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234353719.1 protein_id gnl|my_center|LOCUS_01450 165715 166848 gene locus_tag LOCUS_01460 165715 166848 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729667.1 protein_id gnl|my_center|LOCUS_01460 166863 168383 gene locus_tag LOCUS_01470 gene crtI 166863 168383 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224197.1 protein_id gnl|my_center|LOCUS_01470 168446 169978 gene locus_tag LOCUS_01480 168446 169978 CDS product alpha-(1->6)-mannopyranosyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903784.1 protein_id gnl|my_center|LOCUS_01480 169975 170877 gene locus_tag LOCUS_01490 169975 170877 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224196.1 protein_id gnl|my_center|LOCUS_01490 171828 170884 gene locus_tag LOCUS_01500 171828 170884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 171991 173766 gene locus_tag LOCUS_01510 171991 173766 CDS product S53 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230264.1 protein_id gnl|my_center|LOCUS_01510 174144 173779 gene locus_tag LOCUS_01520 174144 173779 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729669.1 protein_id gnl|my_center|LOCUS_01520 174255 175493 gene locus_tag LOCUS_01530 174255 175493 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877981.1 protein_id gnl|my_center|LOCUS_01530 176923 175523 gene locus_tag LOCUS_01540 176923 175523 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110483.1 protein_id gnl|my_center|LOCUS_01540 177458 176976 gene locus_tag LOCUS_01550 177458 176976 CDS product polyadenylate-specific 3'-exoribonuclease AS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060872.1 protein_id gnl|my_center|LOCUS_01550 177501 178733 gene locus_tag LOCUS_01560 177501 178733 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877982.1 protein_id gnl|my_center|LOCUS_01560 179377 178655 gene locus_tag LOCUS_01570 179377 178655 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895641.1 protein_id gnl|my_center|LOCUS_01570 180424 179447 gene locus_tag LOCUS_01580 180424 179447 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224324.1 protein_id gnl|my_center|LOCUS_01580 180801 180421 gene locus_tag LOCUS_01590 180801 180421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 182046 180901 gene locus_tag LOCUS_01600 182046 180901 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296493.1 protein_id gnl|my_center|LOCUS_01600 182507 182070 gene locus_tag LOCUS_01610 182507 182070 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224321.1 protein_id gnl|my_center|LOCUS_01610 182925 182512 gene locus_tag LOCUS_01620 182925 182512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729677.1 protein_id gnl|my_center|LOCUS_01620 184154 183036 gene locus_tag LOCUS_01630 gene pimB 184154 183036 CDS product GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877983.1 protein_id gnl|my_center|LOCUS_01630 185503 184169 gene locus_tag LOCUS_01640 185503 184169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110481.1 protein_id gnl|my_center|LOCUS_01640 186564 185506 gene locus_tag LOCUS_01650 gene ripC 186564 185506 CDS product peptidoglycan hydrolase RipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907994.1 protein_id gnl|my_center|LOCUS_01650 187333 186740 gene locus_tag LOCUS_01660 187333 186740 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014945.1 protein_id gnl|my_center|LOCUS_01660 187940 187659 gene locus_tag LOCUS_01670 187940 187659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 188172 189932 gene locus_tag LOCUS_01680 188172 189932 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_01680 189982 190257 gene locus_tag LOCUS_01690 189982 190257 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224084.1 protein_id gnl|my_center|LOCUS_01690 191388 190279 gene locus_tag LOCUS_01700 gene trpD 191388 190279 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224077.1 protein_id gnl|my_center|LOCUS_01700 191925 191446 gene locus_tag LOCUS_01710 191925 191446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224079.1 protein_id gnl|my_center|LOCUS_01710 192218 191991 gene locus_tag LOCUS_01720 192218 191991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 192109 192609 gene locus_tag LOCUS_01730 192109 192609 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296491.1 protein_id gnl|my_center|LOCUS_01730 192677 193606 gene locus_tag LOCUS_01740 192677 193606 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086661.1 protein_id gnl|my_center|LOCUS_01740 193603 194832 gene locus_tag LOCUS_01750 193603 194832 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093315.1 protein_id gnl|my_center|LOCUS_01750 194829 196457 gene locus_tag LOCUS_01760 194829 196457 CDS product ubiquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005096648.1 protein_id gnl|my_center|LOCUS_01760 197201 196608 gene locus_tag LOCUS_01770 gene aac(2')-Ic 197201 196608 CDS product aminoglycoside N-acetyltransferase AAC(2')-Ic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899880.1 protein_id gnl|my_center|LOCUS_01770 197633 197217 gene locus_tag LOCUS_01780 197633 197217 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060801.1 protein_id gnl|my_center|LOCUS_01780 198712 197630 gene locus_tag LOCUS_01790 198712 197630 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085336.1 protein_id gnl|my_center|LOCUS_01790 199043 200971 gene locus_tag LOCUS_01800 gene asnB 199043 200971 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729689.1 protein_id gnl|my_center|LOCUS_01800 202021 201047 gene locus_tag LOCUS_01810 202021 201047 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074905.1 protein_id gnl|my_center|LOCUS_01810 202578 202210 gene locus_tag LOCUS_01820 202578 202210 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895666.1 protein_id gnl|my_center|LOCUS_01820 203831 202719 gene locus_tag LOCUS_01830 203831 202719 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085331.1 protein_id gnl|my_center|LOCUS_01830 203886 204647 gene locus_tag LOCUS_01840 203886 204647 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085330.1 protein_id gnl|my_center|LOCUS_01840 204653 206410 gene locus_tag LOCUS_01850 204653 206410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 206407 207165 gene locus_tag LOCUS_01860 206407 207165 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110464.1 protein_id gnl|my_center|LOCUS_01860 208287 207184 gene locus_tag LOCUS_01870 208287 207184 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110461.1 protein_id gnl|my_center|LOCUS_01870 209465 208353 gene locus_tag LOCUS_01880 gene gcvT 209465 208353 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729697.1 protein_id gnl|my_center|LOCUS_01880 209579 211114 gene locus_tag LOCUS_01890 209579 211114 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296489.1 protein_id gnl|my_center|LOCUS_01890 211328 213196 gene locus_tag LOCUS_01900 211328 213196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 213196 214125 gene locus_tag LOCUS_01910 213196 214125 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729703.1 protein_id gnl|my_center|LOCUS_01910 214118 214903 gene locus_tag LOCUS_01920 gene lipB 214118 214903 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895681.1 protein_id gnl|my_center|LOCUS_01920 214900 215967 gene locus_tag LOCUS_01930 gene lipA 214900 215967 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223711.1 protein_id gnl|my_center|LOCUS_01930 216013 216777 gene locus_tag LOCUS_01940 216013 216777 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895683.1 protein_id gnl|my_center|LOCUS_01940 217608 216784 gene locus_tag LOCUS_01950 217608 216784 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484454.1 protein_id gnl|my_center|LOCUS_01950 219119 217707 gene locus_tag LOCUS_01960 219119 217707 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090641.1 protein_id gnl|my_center|LOCUS_01960 219367 219128 gene locus_tag LOCUS_01970 219367 219128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 219994 219533 gene locus_tag LOCUS_01980 219994 219533 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085293.1 protein_id gnl|my_center|LOCUS_01980 220114 221547 gene locus_tag LOCUS_01990 gene glnA 220114 221547 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895686.1 protein_id gnl|my_center|LOCUS_01990 221717 222313 gene locus_tag LOCUS_02000 221717 222313 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223383.1 protein_id gnl|my_center|LOCUS_02000 222326 223087 gene locus_tag LOCUS_02010 222326 223087 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729808.1 protein_id gnl|my_center|LOCUS_02010 223204 223368 gene locus_tag LOCUS_02020 223204 223368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 224353 223376 gene locus_tag LOCUS_02030 224353 223376 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085283.1 protein_id gnl|my_center|LOCUS_02030 227419 224372 gene locus_tag LOCUS_02040 227419 224372 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110447.1 protein_id gnl|my_center|LOCUS_02040 228821 227481 gene locus_tag LOCUS_02050 gene glnA 228821 227481 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729709.1 protein_id gnl|my_center|LOCUS_02050 230465 228906 gene locus_tag LOCUS_02060 230465 228906 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110445.1 protein_id gnl|my_center|LOCUS_02060 230721 231566 gene locus_tag LOCUS_02070 gene panB 230721 231566 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085258.1 protein_id gnl|my_center|LOCUS_02070 231663 232652 gene locus_tag LOCUS_02080 gene pip 231663 232652 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204007.1 protein_id gnl|my_center|LOCUS_02080 232649 234166 gene locus_tag LOCUS_02090 232649 234166 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110443.1 protein_id gnl|my_center|LOCUS_02090 234661 235809 gene locus_tag LOCUS_02100 234661 235809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 235881 236402 gene locus_tag LOCUS_02110 235881 236402 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088529.1 protein_id gnl|my_center|LOCUS_02110 236425 237648 gene locus_tag LOCUS_02120 236425 237648 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104175.1 protein_id gnl|my_center|LOCUS_02120 239199 237685 gene locus_tag LOCUS_02130 239199 237685 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110870.1 protein_id gnl|my_center|LOCUS_02130 240687 239581 gene locus_tag LOCUS_02140 240687 239581 CDS product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085246.1 protein_id gnl|my_center|LOCUS_02140 241426 240689 gene locus_tag LOCUS_02150 241426 240689 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223078.1 protein_id gnl|my_center|LOCUS_02150 242626 241466 gene locus_tag LOCUS_02160 242626 241466 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729722.1 protein_id gnl|my_center|LOCUS_02160 243758 242628 gene locus_tag LOCUS_02170 gene cobC 243758 242628 CDS product Rv2231c family pyridoxal phosphate-dependent protein CobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411503.1 protein_id gnl|my_center|LOCUS_02170 243824 244510 gene locus_tag LOCUS_02180 243824 244510 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729723.1 protein_id gnl|my_center|LOCUS_02180 244503 244973 gene locus_tag LOCUS_02190 gene ptpA 244503 244973 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411510.1 protein_id gnl|my_center|LOCUS_02190 246028 245015 gene locus_tag LOCUS_02200 246028 245015 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894400.1 protein_id gnl|my_center|LOCUS_02200 246238 247230 gene locus_tag LOCUS_02210 246238 247230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 248132 247227 gene locus_tag LOCUS_02220 248132 247227 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729726.1 protein_id gnl|my_center|LOCUS_02220 248232 249164 gene locus_tag LOCUS_02230 248232 249164 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014223.1 protein_id gnl|my_center|LOCUS_02230 250596 249133 gene locus_tag LOCUS_02240 250596 249133 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730326.1 protein_id gnl|my_center|LOCUS_02240 250693 251793 gene locus_tag LOCUS_02250 250693 251793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 251819 252553 gene locus_tag LOCUS_02260 251819 252553 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776271.1 protein_id gnl|my_center|LOCUS_02260 253576 252572 gene locus_tag LOCUS_02270 253576 252572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 253685 254689 gene locus_tag LOCUS_02280 253685 254689 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043788179.1 protein_id gnl|my_center|LOCUS_02280 254830 254693 gene locus_tag LOCUS_02290 254830 254693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 255156 255082 gene locus_tag LOCUS_t00020 255156 255082 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 255773 255237 gene locus_tag LOCUS_02300 255773 255237 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729732.1 protein_id gnl|my_center|LOCUS_02300 256192 255770 gene locus_tag LOCUS_02310 256192 255770 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060606.1 protein_id gnl|my_center|LOCUS_02310 256888 256373 gene locus_tag LOCUS_02320 256888 256373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 257233 260013 gene locus_tag LOCUS_02330 gene aceE 257233 260013 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911788.1 protein_id gnl|my_center|LOCUS_02330 260054 261316 gene locus_tag LOCUS_02340 260054 261316 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085223.1 protein_id gnl|my_center|LOCUS_02340 261504 262427 gene locus_tag LOCUS_02350 261504 262427 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878004.1 protein_id gnl|my_center|LOCUS_02350 262544 262849 gene locus_tag LOCUS_02360 gene acpM 262544 262849 CDS product meromycolate extension acyl carrier protein AcpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060591.1 protein_id gnl|my_center|LOCUS_02360 262855 264120 gene locus_tag LOCUS_02370 gene kasA 262855 264120 CDS product 3-oxoacyl-ACP synthase KasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729736.1 protein_id gnl|my_center|LOCUS_02370 264192 265634 gene locus_tag LOCUS_02380 264192 265634 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900487.1 protein_id gnl|my_center|LOCUS_02380 266236 265718 gene locus_tag LOCUS_02390 266236 265718 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908531.1 protein_id gnl|my_center|LOCUS_02390 267189 266359 gene locus_tag LOCUS_02400 267189 266359 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224592.1 protein_id gnl|my_center|LOCUS_02400 268368 267238 gene locus_tag LOCUS_02410 268368 267238 CDS product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403885.1 protein_id gnl|my_center|LOCUS_02410 268268 268507 gene locus_tag LOCUS_02420 268268 268507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 268570 268749 gene locus_tag LOCUS_02430 268570 268749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 269032 270192 gene locus_tag LOCUS_02440 269032 270192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 270973 270197 gene locus_tag LOCUS_02450 270973 270197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893573.1 protein_id gnl|my_center|LOCUS_02450 271251 273332 gene locus_tag LOCUS_02460 271251 273332 CDS product Rv1355c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728218.1 protein_id gnl|my_center|LOCUS_02460 274871 273369 gene locus_tag LOCUS_02470 274871 273369 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049744721.1 protein_id gnl|my_center|LOCUS_02470 275683 275081 gene locus_tag LOCUS_02480 275683 275081 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112478.1 protein_id gnl|my_center|LOCUS_02480 276886 275690 gene locus_tag LOCUS_02490 276886 275690 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005122091.1 protein_id gnl|my_center|LOCUS_02490 278412 276883 gene locus_tag LOCUS_02500 278412 276883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 279812 278493 gene locus_tag LOCUS_02510 279812 278493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 281412 280123 gene locus_tag LOCUS_02520 281412 280123 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005122091.1 protein_id gnl|my_center|LOCUS_02520 282104 281409 gene locus_tag LOCUS_02530 282104 281409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 283330 282101 gene locus_tag LOCUS_02540 283330 282101 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005122091.1 protein_id gnl|my_center|LOCUS_02540 284792 283440 gene locus_tag LOCUS_02550 284792 283440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 285049 286494 gene locus_tag LOCUS_02560 285049 286494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 286554 288080 gene locus_tag LOCUS_02570 286554 288080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 289216 288110 gene locus_tag LOCUS_02580 289216 288110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 290484 289213 gene locus_tag LOCUS_02590 290484 289213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 291611 290481 gene locus_tag LOCUS_02600 291611 290481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 292288 291632 gene locus_tag LOCUS_02610 292288 291632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 293371 292367 gene locus_tag LOCUS_02620 gene gmd 293371 292367 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_02620 294377 293361 gene locus_tag LOCUS_02630 gene gmd 294377 293361 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284917.1 protein_id gnl|my_center|LOCUS_02630 295582 294374 gene locus_tag LOCUS_02640 295582 294374 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_02640 296046 295971 gene locus_tag LOCUS_t00030 296046 295971 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 296138 296064 gene locus_tag LOCUS_t00040 296138 296064 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 296503 296709 gene locus_tag LOCUS_02650 296503 296709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060436.1 protein_id gnl|my_center|LOCUS_02650 298630 296711 gene locus_tag LOCUS_02660 gene dnaG 298630 296711 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085036.1 protein_id gnl|my_center|LOCUS_02660 299951 298608 gene locus_tag LOCUS_02670 299951 298608 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486041.1 protein_id gnl|my_center|LOCUS_02670 301221 299944 gene locus_tag LOCUS_02680 301221 299944 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085034.1 protein_id gnl|my_center|LOCUS_02680 301728 301225 gene locus_tag LOCUS_02690 301728 301225 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030920.1 protein_id gnl|my_center|LOCUS_02690 303244 301859 gene locus_tag LOCUS_02700 303244 301859 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060419.1 protein_id gnl|my_center|LOCUS_02700 303404 303736 gene locus_tag LOCUS_02710 303404 303736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 303733 304164 gene locus_tag LOCUS_02720 gene zur 303733 304164 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903860.1 protein_id gnl|my_center|LOCUS_02720 304599 304180 gene locus_tag LOCUS_02730 304599 304180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906807.1 protein_id gnl|my_center|LOCUS_02730 305423 304596 gene locus_tag LOCUS_02740 305423 304596 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228389.1 protein_id gnl|my_center|LOCUS_02740 306183 305389 gene locus_tag LOCUS_02750 gene recO 306183 305389 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060357.1 protein_id gnl|my_center|LOCUS_02750 307651 306188 gene locus_tag LOCUS_02760 307651 306188 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899846.1 protein_id gnl|my_center|LOCUS_02760 308597 307656 gene locus_tag LOCUS_02770 gene era 308597 307656 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895864.1 protein_id gnl|my_center|LOCUS_02770 309946 308594 gene locus_tag LOCUS_02780 309946 308594 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895866.1 protein_id gnl|my_center|LOCUS_02780 310524 309952 gene locus_tag LOCUS_02790 gene ybeY 310524 309952 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895867.1 protein_id gnl|my_center|LOCUS_02790 311524 310529 gene locus_tag LOCUS_02800 311524 310529 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412235.1 protein_id gnl|my_center|LOCUS_02800 312555 311749 gene locus_tag LOCUS_02810 312555 311749 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975294.1 protein_id gnl|my_center|LOCUS_02810 313307 312552 gene locus_tag LOCUS_02820 313307 312552 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729879.1 protein_id gnl|my_center|LOCUS_02820 314486 313335 gene locus_tag LOCUS_02830 gene dnaJ 314486 313335 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074629.1 protein_id gnl|my_center|LOCUS_02830 315604 314555 gene locus_tag LOCUS_02840 gene hrcA 315604 314555 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060339.1 protein_id gnl|my_center|LOCUS_02840 315748 316287 gene locus_tag LOCUS_02850 315748 316287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 317422 316181 gene locus_tag LOCUS_02860 gene hemW 317422 316181 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087641.1 protein_id gnl|my_center|LOCUS_02860 317815 319521 gene locus_tag LOCUS_02870 317815 319521 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729896.1 protein_id gnl|my_center|LOCUS_02870 319518 320249 gene locus_tag LOCUS_02880 319518 320249 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729897.1 protein_id gnl|my_center|LOCUS_02880 320228 321214 gene locus_tag LOCUS_02890 320228 321214 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060324.1 protein_id gnl|my_center|LOCUS_02890 321214 322548 gene locus_tag LOCUS_02900 321214 322548 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110195.1 protein_id gnl|my_center|LOCUS_02900 322545 323288 gene locus_tag LOCUS_02910 322545 323288 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412306.1 protein_id gnl|my_center|LOCUS_02910 323341 324774 gene locus_tag LOCUS_02920 323341 324774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 325784 324789 gene locus_tag LOCUS_02930 325784 324789 CDS product TOBE-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060315.1 protein_id gnl|my_center|LOCUS_02930 326698 325781 gene locus_tag LOCUS_02940 gene cysW 326698 325781 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911860.1 protein_id gnl|my_center|LOCUS_02940 327552 326695 gene locus_tag LOCUS_02950 gene cysT 327552 326695 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895898.1 protein_id gnl|my_center|LOCUS_02950 328616 327549 gene locus_tag LOCUS_02960 328616 327549 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895899.1 protein_id gnl|my_center|LOCUS_02960 329257 329051 gene locus_tag LOCUS_02970 329257 329051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 329390 331414 gene locus_tag LOCUS_02980 329390 331414 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729900.1 protein_id gnl|my_center|LOCUS_02980 332342 331437 gene locus_tag LOCUS_02990 332342 331437 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167917.1 protein_id gnl|my_center|LOCUS_02990 334445 332400 gene locus_tag LOCUS_03000 334445 332400 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226475.1 protein_id gnl|my_center|LOCUS_03000 336356 334491 gene locus_tag LOCUS_03010 gene lepA 336356 334491 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084973.1 protein_id gnl|my_center|LOCUS_03010 336536 337162 gene locus_tag LOCUS_03020 336536 337162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402145.1 protein_id gnl|my_center|LOCUS_03020 337172 337723 gene locus_tag LOCUS_03030 337172 337723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 338820 337756 gene locus_tag LOCUS_03040 338820 337756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 340072 338855 gene locus_tag LOCUS_03050 340072 338855 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095590.1 protein_id gnl|my_center|LOCUS_03050 341553 340072 gene locus_tag LOCUS_03060 341553 340072 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966249.1 protein_id gnl|my_center|LOCUS_03060 342932 341550 gene locus_tag LOCUS_03070 gene hmgA 342932 341550 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977111.1 protein_id gnl|my_center|LOCUS_03070 344308 342980 gene locus_tag LOCUS_03080 344308 342980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 345501 344305 gene locus_tag LOCUS_03090 345501 344305 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728131.1 protein_id gnl|my_center|LOCUS_03090 345606 346211 gene locus_tag LOCUS_03100 345606 346211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726872.1 protein_id gnl|my_center|LOCUS_03100 346208 346843 gene locus_tag LOCUS_03110 346208 346843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 348246 346864 gene locus_tag LOCUS_03120 348246 346864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 349406 348243 gene locus_tag LOCUS_03130 gene lprM 349406 348243 CDS product Mce family lipoprotein LprM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899107.1 protein_id gnl|my_center|LOCUS_03130 350635 349406 gene locus_tag LOCUS_03140 350635 349406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 351660 350632 gene locus_tag LOCUS_03150 351660 350632 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876746.1 protein_id gnl|my_center|LOCUS_03150 352679 351657 gene locus_tag LOCUS_03160 352679 351657 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899104.1 protein_id gnl|my_center|LOCUS_03160 353878 352676 gene locus_tag LOCUS_03170 353878 352676 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085898.1 protein_id gnl|my_center|LOCUS_03170 354734 353886 gene locus_tag LOCUS_03180 354734 353886 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071299.1 protein_id gnl|my_center|LOCUS_03180 355522 354731 gene locus_tag LOCUS_03190 355522 354731 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418986.1 protein_id gnl|my_center|LOCUS_03190 355653 355522 gene locus_tag LOCUS_03200 355653 355522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 357470 355674 gene locus_tag LOCUS_03210 357470 355674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 357594 358382 gene locus_tag LOCUS_03220 357594 358382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 358417 358983 gene locus_tag LOCUS_03230 358417 358983 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731182.1 protein_id gnl|my_center|LOCUS_03230 359916 359068 gene locus_tag LOCUS_03240 359916 359068 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729930.1 protein_id gnl|my_center|LOCUS_03240 360899 359913 gene locus_tag LOCUS_03250 360899 359913 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060265.1 protein_id gnl|my_center|LOCUS_03250 362740 360896 gene locus_tag LOCUS_03260 362740 360896 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084969.1 protein_id gnl|my_center|LOCUS_03260 363970 362834 gene locus_tag LOCUS_03270 363970 362834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 364278 364538 gene locus_tag LOCUS_03280 gene rpsT 364278 364538 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895949.1 protein_id gnl|my_center|LOCUS_03280 365500 364643 gene locus_tag LOCUS_03290 gene holA 365500 364643 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110184.1 protein_id gnl|my_center|LOCUS_03290 367220 365478 gene locus_tag LOCUS_03300 367220 365478 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087550.1 protein_id gnl|my_center|LOCUS_03300 368221 367217 gene locus_tag LOCUS_03310 368221 367217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 369268 368408 gene locus_tag LOCUS_03320 369268 368408 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412381.1 protein_id gnl|my_center|LOCUS_03320 370060 369293 gene locus_tag LOCUS_03330 370060 369293 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729938.1 protein_id gnl|my_center|LOCUS_03330 370763 370101 gene locus_tag LOCUS_03340 370763 370101 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895958.1 protein_id gnl|my_center|LOCUS_03340 371161 370799 gene locus_tag LOCUS_03350 gene rsfS 371161 370799 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067112.1 protein_id gnl|my_center|LOCUS_03350 372018 371158 gene locus_tag LOCUS_03360 372018 371158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 373511 372063 gene locus_tag LOCUS_03370 373511 372063 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729941.1 protein_id gnl|my_center|LOCUS_03370 374437 373508 gene locus_tag LOCUS_03380 374437 373508 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084944.1 protein_id gnl|my_center|LOCUS_03380 375747 374434 gene locus_tag LOCUS_03390 375747 374434 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110175.1 protein_id gnl|my_center|LOCUS_03390 376479 375781 gene locus_tag LOCUS_03400 376479 375781 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728321.1 protein_id gnl|my_center|LOCUS_03400 378786 376525 gene locus_tag LOCUS_03410 gene recG 378786 376525 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093937.1 protein_id gnl|my_center|LOCUS_03410 380537 378783 gene locus_tag LOCUS_03420 380537 378783 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728319.1 protein_id gnl|my_center|LOCUS_03420 380632 380823 gene locus_tag LOCUS_03430 gene rpmB 380632 380823 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091970.1 protein_id gnl|my_center|LOCUS_03430 380837 381646 gene locus_tag LOCUS_03440 380837 381646 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081472.1 protein_id gnl|my_center|LOCUS_03440 382357 381665 gene locus_tag LOCUS_03450 382357 381665 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056911.1 protein_id gnl|my_center|LOCUS_03450 382878 382357 gene locus_tag LOCUS_03460 382878 382357 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223643.1 protein_id gnl|my_center|LOCUS_03460 383962 382913 gene locus_tag LOCUS_03470 383962 382913 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415034.1 protein_id gnl|my_center|LOCUS_03470 384102 384347 gene locus_tag LOCUS_03480 384102 384347 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973433.1 protein_id gnl|my_center|LOCUS_03480 384344 384874 gene locus_tag LOCUS_03490 384344 384874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 385918 384923 gene locus_tag LOCUS_03500 385918 384923 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858849.1 protein_id gnl|my_center|LOCUS_03500 386020 386796 gene locus_tag LOCUS_03510 gene cofC 386020 386796 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081461.1 protein_id gnl|my_center|LOCUS_03510 386822 389080 gene locus_tag LOCUS_03520 386822 389080 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893757.1 protein_id gnl|my_center|LOCUS_03520 389121 390047 gene locus_tag LOCUS_03530 389121 390047 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093939.1 protein_id gnl|my_center|LOCUS_03530 390750 390133 gene locus_tag LOCUS_03540 390750 390133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 391496 390909 gene locus_tag LOCUS_03550 gene leuD 391496 390909 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893754.1 protein_id gnl|my_center|LOCUS_03550 392991 391546 gene locus_tag LOCUS_03560 gene leuC 392991 391546 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728310.1 protein_id gnl|my_center|LOCUS_03560 393110 393817 gene locus_tag LOCUS_03570 393110 393817 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728309.1 protein_id gnl|my_center|LOCUS_03570 393909 394406 gene locus_tag LOCUS_03580 393909 394406 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726631.1 protein_id gnl|my_center|LOCUS_03580 395408 394449 gene locus_tag LOCUS_03590 395408 394449 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205364.1 protein_id gnl|my_center|LOCUS_03590 395420 396574 gene locus_tag LOCUS_03600 395420 396574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 398488 397208 gene locus_tag LOCUS_03610 398488 397208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 398699 398481 gene locus_tag LOCUS_03620 398699 398481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 399050 398751 gene locus_tag LOCUS_03630 399050 398751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 399825 399052 gene locus_tag LOCUS_03640 399825 399052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 400075 400002 gene locus_tag LOCUS_t00050 400075 400002 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 400255 400183 gene locus_tag LOCUS_t00060 400255 400183 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 401841 400357 gene locus_tag LOCUS_03650 gene gltX 401841 400357 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728308.1 protein_id gnl|my_center|LOCUS_03650 402647 401847 gene locus_tag LOCUS_03660 402647 401847 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975579.1 protein_id gnl|my_center|LOCUS_03660 403459 402680 gene locus_tag LOCUS_03670 403459 402680 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728307.1 protein_id gnl|my_center|LOCUS_03670 403591 404814 gene locus_tag LOCUS_03680 403591 404814 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893748.1 protein_id gnl|my_center|LOCUS_03680 405646 404795 gene locus_tag LOCUS_03690 405646 404795 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729056.1 protein_id gnl|my_center|LOCUS_03690 406692 405682 gene locus_tag LOCUS_03700 406692 405682 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893747.1 protein_id gnl|my_center|LOCUS_03700 408284 406689 gene locus_tag LOCUS_03710 gene serA 408284 406689 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081440.1 protein_id gnl|my_center|LOCUS_03710 408524 409186 gene locus_tag LOCUS_03720 408524 409186 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072578.1 protein_id gnl|my_center|LOCUS_03720 410510 409497 gene locus_tag LOCUS_03730 gene ilvC 410510 409497 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893742.1 protein_id gnl|my_center|LOCUS_03730 411100 410597 gene locus_tag LOCUS_03740 gene ilvN 411100 410597 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056841.1 protein_id gnl|my_center|LOCUS_03740 413064 411097 gene locus_tag LOCUS_03750 413064 411097 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296656.1 protein_id gnl|my_center|LOCUS_03750 413300 413821 gene locus_tag LOCUS_03760 413300 413821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 413895 415742 gene locus_tag LOCUS_03770 gene ilvD 413895 415742 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223580.1 protein_id gnl|my_center|LOCUS_03770 417077 415746 gene locus_tag LOCUS_03780 417077 415746 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115973.1 protein_id gnl|my_center|LOCUS_03780 417338 418999 gene locus_tag LOCUS_03790 417338 418999 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142818.1 protein_id gnl|my_center|LOCUS_03790 420414 419056 gene locus_tag LOCUS_03800 420414 419056 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283890.1 protein_id gnl|my_center|LOCUS_03800 420518 421528 gene locus_tag LOCUS_03810 420518 421528 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730353.1 protein_id gnl|my_center|LOCUS_03810 421551 422384 gene locus_tag LOCUS_03820 421551 422384 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111769.1 protein_id gnl|my_center|LOCUS_03820 423102 422410 gene locus_tag LOCUS_03830 423102 422410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 424257 423112 gene locus_tag LOCUS_03840 424257 423112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 424378 425469 gene locus_tag LOCUS_03850 424378 425469 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877369.1 protein_id gnl|my_center|LOCUS_03850 425848 425498 gene locus_tag LOCUS_03860 425848 425498 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836253.1 protein_id gnl|my_center|LOCUS_03860 425951 426739 gene locus_tag LOCUS_03870 425951 426739 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532942.1 protein_id gnl|my_center|LOCUS_03870 426736 427944 gene locus_tag LOCUS_03880 426736 427944 CDS product Rv0191 family MFS efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401149.1 protein_id gnl|my_center|LOCUS_03880 >Feature sequence02 939 127 gene locus_tag LOCUS_03890 939 127 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727651.1 protein_id gnl|my_center|LOCUS_03890 2191 971 gene locus_tag LOCUS_03900 gene mftD 2191 971 CDS product mycofactocin biosynthesis FMN-dependent deaminase MftD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877068.1 protein_id gnl|my_center|LOCUS_03900 3463 2222 gene locus_tag LOCUS_03910 gene mftC 3463 2222 CDS product mycofactocin radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112050.1 protein_id gnl|my_center|LOCUS_03910 3768 3460 gene locus_tag LOCUS_03920 gene mftB 3768 3460 CDS product mycofactocin biosynthesis chaperone MftB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077617.1 protein_id gnl|my_center|LOCUS_03920 3892 3770 gene locus_tag LOCUS_03930 3892 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 4000 4593 gene locus_tag LOCUS_03940 gene mftR 4000 4593 CDS product mycofactocin system transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112053.1 protein_id gnl|my_center|LOCUS_03940 4723 5775 gene locus_tag LOCUS_03950 4723 5775 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728662.1 protein_id gnl|my_center|LOCUS_03950 6497 5835 gene locus_tag LOCUS_03960 6497 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 7299 6571 gene locus_tag LOCUS_03970 7299 6571 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113309.1 protein_id gnl|my_center|LOCUS_03970 8505 7312 gene locus_tag LOCUS_03980 8505 7312 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055608.1 protein_id gnl|my_center|LOCUS_03980 9284 8556 gene locus_tag LOCUS_03990 9284 8556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 9886 9281 gene locus_tag LOCUS_04000 9886 9281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 10536 9883 gene locus_tag LOCUS_04010 10536 9883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 11096 10533 gene locus_tag LOCUS_04020 11096 10533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 11292 12752 gene locus_tag LOCUS_04030 11292 12752 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411955.1 protein_id gnl|my_center|LOCUS_04030 12749 13630 gene locus_tag LOCUS_04040 12749 13630 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727652.1 protein_id gnl|my_center|LOCUS_04040 17528 13647 gene locus_tag LOCUS_04050 17528 13647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223680.1 protein_id gnl|my_center|LOCUS_04050 17689 18000 gene locus_tag LOCUS_04060 17689 18000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 18941 18084 gene locus_tag LOCUS_04070 18941 18084 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090402.1 protein_id gnl|my_center|LOCUS_04070 19647 19039 gene locus_tag LOCUS_04080 19647 19039 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079706.1 protein_id gnl|my_center|LOCUS_04080 20981 19644 gene locus_tag LOCUS_04090 20981 19644 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224741.1 protein_id gnl|my_center|LOCUS_04090 22031 21054 gene locus_tag LOCUS_04100 22031 21054 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727412.1 protein_id gnl|my_center|LOCUS_04100 22066 23010 gene locus_tag LOCUS_04110 22066 23010 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079707.1 protein_id gnl|my_center|LOCUS_04110 24608 23103 gene locus_tag LOCUS_04120 24608 23103 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030671.1 protein_id gnl|my_center|LOCUS_04120 24658 24954 gene locus_tag LOCUS_04130 24658 24954 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706250.1 protein_id gnl|my_center|LOCUS_04130 26069 24927 gene locus_tag LOCUS_04140 26069 24927 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414559.1 protein_id gnl|my_center|LOCUS_04140 27450 26260 gene locus_tag LOCUS_04150 gene tuf 27450 26260 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055596.1 protein_id gnl|my_center|LOCUS_04150 29674 27569 gene locus_tag LOCUS_04160 gene fusA 29674 27569 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055595.1 protein_id gnl|my_center|LOCUS_04160 30189 29719 gene locus_tag LOCUS_04170 gene rpsG 30189 29719 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892787.1 protein_id gnl|my_center|LOCUS_04170 30563 30189 gene locus_tag LOCUS_04180 gene rpsL 30563 30189 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003929602.1 protein_id gnl|my_center|LOCUS_04180 30938 31930 gene locus_tag LOCUS_04190 30938 31930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 32039 33151 gene locus_tag LOCUS_04200 32039 33151 CDS product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416075.1 protein_id gnl|my_center|LOCUS_04200 33280 35067 gene locus_tag LOCUS_04210 33280 35067 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111122.1 protein_id gnl|my_center|LOCUS_04210 35057 35506 gene locus_tag LOCUS_04220 35057 35506 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082139.1 protein_id gnl|my_center|LOCUS_04220 35516 35887 gene locus_tag LOCUS_04230 35516 35887 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897880.1 protein_id gnl|my_center|LOCUS_04230 36002 36964 gene locus_tag LOCUS_04240 36002 36964 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272579.1 protein_id gnl|my_center|LOCUS_04240 38348 36966 gene locus_tag LOCUS_04250 38348 36966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 38415 39191 gene locus_tag LOCUS_04260 38415 39191 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892805.1 protein_id gnl|my_center|LOCUS_04260 39317 40615 gene locus_tag LOCUS_04270 39317 40615 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936020.1 protein_id gnl|my_center|LOCUS_04270 40623 41798 gene locus_tag LOCUS_04280 40623 41798 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222819.1 protein_id gnl|my_center|LOCUS_04280 42348 41755 gene locus_tag LOCUS_04290 42348 41755 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224757.1 protein_id gnl|my_center|LOCUS_04290 43175 42345 gene locus_tag LOCUS_04300 43175 42345 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404949.1 protein_id gnl|my_center|LOCUS_04300 44380 43181 gene locus_tag LOCUS_04310 44380 43181 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898667.1 protein_id gnl|my_center|LOCUS_04310 46425 44377 gene locus_tag LOCUS_04320 46425 44377 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224754.1 protein_id gnl|my_center|LOCUS_04320 48032 46434 gene locus_tag LOCUS_04330 48032 46434 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896889.1 protein_id gnl|my_center|LOCUS_04330 49189 48029 gene locus_tag LOCUS_04340 49189 48029 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092833.1 protein_id gnl|my_center|LOCUS_04340 50908 49190 gene locus_tag LOCUS_04350 50908 49190 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730568.1 protein_id gnl|my_center|LOCUS_04350 51714 50905 gene locus_tag LOCUS_04360 51714 50905 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731630.1 protein_id gnl|my_center|LOCUS_04360 52708 51785 gene locus_tag LOCUS_04370 52708 51785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 52761 53150 gene locus_tag LOCUS_04380 52761 53150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 53214 53840 gene locus_tag LOCUS_04390 53214 53840 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230956.1 protein_id gnl|my_center|LOCUS_04390 53837 55006 gene locus_tag LOCUS_04400 53837 55006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 55900 55055 gene locus_tag LOCUS_04410 55900 55055 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897269.1 protein_id gnl|my_center|LOCUS_04410 57527 55914 gene locus_tag LOCUS_04420 57527 55914 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742163.1 protein_id gnl|my_center|LOCUS_04420 58799 57540 gene locus_tag LOCUS_04430 58799 57540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730849.1 protein_id gnl|my_center|LOCUS_04430 59363 58812 gene locus_tag LOCUS_04440 59363 58812 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084274.1 protein_id gnl|my_center|LOCUS_04440 59569 59369 gene locus_tag LOCUS_04450 59569 59369 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897265.1 protein_id gnl|my_center|LOCUS_04450 60930 59584 gene locus_tag LOCUS_04460 60930 59584 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897264.1 protein_id gnl|my_center|LOCUS_04460 61742 60930 gene locus_tag LOCUS_04470 61742 60930 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059332.1 protein_id gnl|my_center|LOCUS_04470 62990 61743 gene locus_tag LOCUS_04480 62990 61743 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730851.1 protein_id gnl|my_center|LOCUS_04480 63595 62987 gene locus_tag LOCUS_04490 63595 62987 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897891.1 protein_id gnl|my_center|LOCUS_04490 63660 65150 gene locus_tag LOCUS_04500 63660 65150 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084280.1 protein_id gnl|my_center|LOCUS_04500 65193 65921 gene locus_tag LOCUS_04510 65193 65921 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897259.1 protein_id gnl|my_center|LOCUS_04510 65918 66820 gene locus_tag LOCUS_04520 65918 66820 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084282.1 protein_id gnl|my_center|LOCUS_04520 66817 67185 gene locus_tag LOCUS_04530 66817 67185 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084283.1 protein_id gnl|my_center|LOCUS_04530 67182 67805 gene locus_tag LOCUS_04540 67182 67805 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729168.1 protein_id gnl|my_center|LOCUS_04540 67802 69049 gene locus_tag LOCUS_04550 67802 69049 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878473.1 protein_id gnl|my_center|LOCUS_04550 69321 69037 gene locus_tag LOCUS_04560 69321 69037 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057105.1 protein_id gnl|my_center|LOCUS_04560 70322 69351 gene locus_tag LOCUS_04570 70322 69351 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063804.1 protein_id gnl|my_center|LOCUS_04570 70363 71028 gene locus_tag LOCUS_04580 70363 71028 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731308.1 protein_id gnl|my_center|LOCUS_04580 71950 71102 gene locus_tag LOCUS_04590 71950 71102 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404873.1 protein_id gnl|my_center|LOCUS_04590 73114 72002 gene locus_tag LOCUS_04600 73114 72002 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_04600 73831 73118 gene locus_tag LOCUS_04610 73831 73118 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731310.1 protein_id gnl|my_center|LOCUS_04610 75083 73818 gene locus_tag LOCUS_04620 75083 73818 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731311.1 protein_id gnl|my_center|LOCUS_04620 76843 75134 gene locus_tag LOCUS_04630 76843 75134 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404631.1 protein_id gnl|my_center|LOCUS_04630 77062 77892 gene locus_tag LOCUS_04640 77062 77892 CDS product acyl-[acyl-carrier-protein] thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900448.1 protein_id gnl|my_center|LOCUS_04640 78464 77907 gene locus_tag LOCUS_04650 78464 77907 CDS product DUF3558 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900308.1 protein_id gnl|my_center|LOCUS_04650 79057 78461 gene locus_tag LOCUS_04660 79057 78461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 79440 79054 gene locus_tag LOCUS_04670 79440 79054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04670 79454 80167 gene locus_tag LOCUS_04680 79454 80167 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920959.1 protein_id gnl|my_center|LOCUS_04680 80164 81426 gene locus_tag LOCUS_04690 80164 81426 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222038.1 protein_id gnl|my_center|LOCUS_04690 81423 82646 gene locus_tag LOCUS_04700 81423 82646 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804927.1 protein_id gnl|my_center|LOCUS_04700 82658 83953 gene locus_tag LOCUS_04710 82658 83953 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222034.1 protein_id gnl|my_center|LOCUS_04710 83950 85974 gene locus_tag LOCUS_04720 gene cerN 83950 85974 CDS product ceramidase CerN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114226.1 protein_id gnl|my_center|LOCUS_04720 85971 87200 gene locus_tag LOCUS_04730 85971 87200 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929866.1 protein_id gnl|my_center|LOCUS_04730 87248 87775 gene locus_tag LOCUS_04740 87248 87775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 88357 87791 gene locus_tag LOCUS_04750 88357 87791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 89415 88354 gene locus_tag LOCUS_04760 89415 88354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04760 90965 89772 gene locus_tag LOCUS_04770 90965 89772 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973190.1 protein_id gnl|my_center|LOCUS_04770 91109 92254 gene locus_tag LOCUS_04780 91109 92254 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973189.1 protein_id gnl|my_center|LOCUS_04780 92470 92730 gene locus_tag LOCUS_04790 92470 92730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 92865 95057 gene locus_tag LOCUS_04800 92865 95057 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973559.1 protein_id gnl|my_center|LOCUS_04800 95088 95795 gene locus_tag LOCUS_04810 95088 95795 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_04810 95792 96331 gene locus_tag LOCUS_04820 95792 96331 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892879.1 protein_id gnl|my_center|LOCUS_04820 96962 97726 gene locus_tag LOCUS_04830 96962 97726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 98692 97823 gene locus_tag LOCUS_04840 gene mmsB 98692 97823 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727701.1 protein_id gnl|my_center|LOCUS_04840 99852 98689 gene locus_tag LOCUS_04850 99852 98689 CDS product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727702.1 protein_id gnl|my_center|LOCUS_04850 101369 99849 gene locus_tag LOCUS_04860 101369 99849 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727703.1 protein_id gnl|my_center|LOCUS_04860 101497 103224 gene locus_tag LOCUS_04870 gene ibuL 101497 103224 CDS product isobutyrate:CoA ligase IbuL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030731.1 protein_id gnl|my_center|LOCUS_04870 103221 104591 gene locus_tag LOCUS_04880 103221 104591 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110109.1 protein_id gnl|my_center|LOCUS_04880 106027 104615 gene locus_tag LOCUS_04890 106027 104615 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027415.1 protein_id gnl|my_center|LOCUS_04890 106936 106040 gene locus_tag LOCUS_04900 106936 106040 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731346.1 protein_id gnl|my_center|LOCUS_04900 107804 106911 gene locus_tag LOCUS_04910 107804 106911 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728549.1 protein_id gnl|my_center|LOCUS_04910 108846 107911 gene locus_tag LOCUS_04920 108846 107911 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222909.1 protein_id gnl|my_center|LOCUS_04920 109047 109301 gene locus_tag LOCUS_04930 109047 109301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 109229 109786 gene locus_tag LOCUS_04940 109229 109786 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730252.1 protein_id gnl|my_center|LOCUS_04940 110740 109793 gene locus_tag LOCUS_04950 110740 109793 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036475.1 protein_id gnl|my_center|LOCUS_04950 111638 110745 gene locus_tag LOCUS_04960 111638 110745 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193251.1 protein_id gnl|my_center|LOCUS_04960 111729 112169 gene locus_tag LOCUS_04970 111729 112169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 112208 112888 gene locus_tag LOCUS_04980 112208 112888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 113812 112898 gene locus_tag LOCUS_04990 113812 112898 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070939922.1 protein_id gnl|my_center|LOCUS_04990 114883 113873 gene locus_tag LOCUS_05000 114883 113873 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727354.1 protein_id gnl|my_center|LOCUS_05000 115122 116093 gene locus_tag LOCUS_05010 115122 116093 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015457.1 protein_id gnl|my_center|LOCUS_05010 116480 116638 gene locus_tag LOCUS_05020 116480 116638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 116657 118003 gene locus_tag LOCUS_05030 116657 118003 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877747.1 protein_id gnl|my_center|LOCUS_05030 118003 119124 gene locus_tag LOCUS_05040 118003 119124 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899061.1 protein_id gnl|my_center|LOCUS_05040 123300 119344 gene locus_tag LOCUS_05050 123300 119344 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077661.1 protein_id gnl|my_center|LOCUS_05050 126822 123334 gene locus_tag LOCUS_05060 126822 123334 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727628.1 protein_id gnl|my_center|LOCUS_05060 128214 127195 gene locus_tag LOCUS_05070 128214 127195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 128921 128214 gene locus_tag LOCUS_05080 128921 128214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 130231 128990 gene locus_tag LOCUS_05090 130231 128990 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224306.1 protein_id gnl|my_center|LOCUS_05090 131535 130228 gene locus_tag LOCUS_05100 131535 130228 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222538.1 protein_id gnl|my_center|LOCUS_05100 132814 131540 gene locus_tag LOCUS_05110 132814 131540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 133854 132811 gene locus_tag LOCUS_05120 133854 132811 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229369.1 protein_id gnl|my_center|LOCUS_05120 134941 133868 gene locus_tag LOCUS_05130 134941 133868 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223672.1 protein_id gnl|my_center|LOCUS_05130 136269 134938 gene locus_tag LOCUS_05140 136269 134938 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224301.1 protein_id gnl|my_center|LOCUS_05140 137133 136273 gene locus_tag LOCUS_05150 137133 136273 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223674.1 protein_id gnl|my_center|LOCUS_05150 137952 137146 gene locus_tag LOCUS_05160 137952 137146 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976385.1 protein_id gnl|my_center|LOCUS_05160 139118 137997 gene locus_tag LOCUS_05170 gene mceG 139118 137997 CDS product ABC transporter ATP-binding protein MceG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727627.1 protein_id gnl|my_center|LOCUS_05170 139704 139315 gene locus_tag LOCUS_05180 gene rplL 139704 139315 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222530.1 protein_id gnl|my_center|LOCUS_05180 140331 139807 gene locus_tag LOCUS_05190 gene rplJ 140331 139807 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055400.1 protein_id gnl|my_center|LOCUS_05190 >Feature sequence03 2032 122 gene locus_tag LOCUS_05200 gene typA 2032 122 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730337.1 protein_id gnl|my_center|LOCUS_05200 2174 2362 gene locus_tag LOCUS_05210 2174 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 2438 3694 gene locus_tag LOCUS_05220 2438 3694 CDS product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729765.1 protein_id gnl|my_center|LOCUS_05220 3873 5171 gene locus_tag LOCUS_05230 3873 5171 CDS product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729765.1 protein_id gnl|my_center|LOCUS_05230 5734 5204 gene locus_tag LOCUS_05240 5734 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 6157 5747 gene locus_tag LOCUS_05250 6157 5747 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896546.1 protein_id gnl|my_center|LOCUS_05250 7212 6154 gene locus_tag LOCUS_05260 7212 6154 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229774.1 protein_id gnl|my_center|LOCUS_05260 8921 7209 gene locus_tag LOCUS_05270 8921 7209 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229775.1 protein_id gnl|my_center|LOCUS_05270 9969 8944 gene locus_tag LOCUS_05280 9969 8944 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878186.1 protein_id gnl|my_center|LOCUS_05280 10082 10402 gene locus_tag LOCUS_05290 10082 10402 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730347.1 protein_id gnl|my_center|LOCUS_05290 10610 11461 gene locus_tag LOCUS_05300 10610 11461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 11817 11485 gene locus_tag LOCUS_05310 11817 11485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 11708 12511 gene locus_tag LOCUS_05320 11708 12511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 14039 12591 gene locus_tag LOCUS_05330 14039 12591 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775787.1 protein_id gnl|my_center|LOCUS_05330 14211 14780 gene locus_tag LOCUS_05340 14211 14780 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059527.1 protein_id gnl|my_center|LOCUS_05340 14860 15714 gene locus_tag LOCUS_05350 14860 15714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403862.1 protein_id gnl|my_center|LOCUS_05350 15766 16452 gene locus_tag LOCUS_05360 15766 16452 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030391327.1 protein_id gnl|my_center|LOCUS_05360 16449 17387 gene locus_tag LOCUS_05370 16449 17387 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224138.1 protein_id gnl|my_center|LOCUS_05370 18937 17621 gene locus_tag LOCUS_05380 18937 17621 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059466.1 protein_id gnl|my_center|LOCUS_05380 20329 18977 gene locus_tag LOCUS_05390 20329 18977 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115478.1 protein_id gnl|my_center|LOCUS_05390 20310 21173 gene locus_tag LOCUS_05400 20310 21173 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222172.1 protein_id gnl|my_center|LOCUS_05400 21405 21608 gene locus_tag LOCUS_05410 21405 21608 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222289.1 protein_id gnl|my_center|LOCUS_05410 22642 21689 gene locus_tag LOCUS_05420 22642 21689 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403330.1 protein_id gnl|my_center|LOCUS_05420 22745 24847 gene locus_tag LOCUS_05430 22745 24847 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228470.1 protein_id gnl|my_center|LOCUS_05430 25962 24874 gene locus_tag LOCUS_05440 25962 24874 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804875.1 protein_id gnl|my_center|LOCUS_05440 26427 26050 gene locus_tag LOCUS_05450 26427 26050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083117.1 protein_id gnl|my_center|LOCUS_05450 27592 26465 gene locus_tag LOCUS_05460 27592 26465 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727834.1 protein_id gnl|my_center|LOCUS_05460 27654 28226 gene locus_tag LOCUS_05470 27654 28226 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727835.1 protein_id gnl|my_center|LOCUS_05470 28773 28228 gene locus_tag LOCUS_05480 gene abmR 28773 28228 CDS product transcriptional regulator AbmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406375.1 protein_id gnl|my_center|LOCUS_05480 29124 29600 gene locus_tag LOCUS_05490 29124 29600 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084746.1 protein_id gnl|my_center|LOCUS_05490 31047 29611 gene locus_tag LOCUS_05500 31047 29611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 31208 32116 gene locus_tag LOCUS_05510 31208 32116 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918355.1 protein_id gnl|my_center|LOCUS_05510 32120 32665 gene locus_tag LOCUS_05520 32120 32665 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897761.1 protein_id gnl|my_center|LOCUS_05520 33393 32662 gene locus_tag LOCUS_05530 33393 32662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 33528 34529 gene locus_tag LOCUS_05540 33528 34529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 34953 34543 gene locus_tag LOCUS_05550 34953 34543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256633.1 protein_id gnl|my_center|LOCUS_05550 36253 34961 gene locus_tag LOCUS_05560 36253 34961 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207514.1 protein_id gnl|my_center|LOCUS_05560 36537 36238 gene locus_tag LOCUS_05570 36537 36238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 37058 36534 gene locus_tag LOCUS_05580 37058 36534 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027861.1 protein_id gnl|my_center|LOCUS_05580 37656 37114 gene locus_tag LOCUS_05590 37656 37114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 37718 38224 gene locus_tag LOCUS_05600 37718 38224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 38848 38189 gene locus_tag LOCUS_05610 38848 38189 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285566.1 protein_id gnl|my_center|LOCUS_05610 39093 38923 gene locus_tag LOCUS_05620 39093 38923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 40189 39110 gene locus_tag LOCUS_05630 gene ychF 40189 39110 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014061.1 protein_id gnl|my_center|LOCUS_05630 41445 40246 gene locus_tag LOCUS_05640 41445 40246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 42500 41532 gene locus_tag LOCUS_05650 42500 41532 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031568.1 protein_id gnl|my_center|LOCUS_05650 43063 42506 gene locus_tag LOCUS_05660 43063 42506 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030978.1 protein_id gnl|my_center|LOCUS_05660 43354 43076 gene locus_tag LOCUS_05670 43354 43076 CDS product Rho termination factor N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 protein_id gnl|my_center|LOCUS_05670 43702 44733 gene locus_tag LOCUS_05680 43702 44733 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229955.1 protein_id gnl|my_center|LOCUS_05680 45002 44739 gene locus_tag LOCUS_05690 45002 44739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 45171 47453 gene locus_tag LOCUS_05700 45171 47453 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728262.1 protein_id gnl|my_center|LOCUS_05700 47450 47677 gene locus_tag LOCUS_05710 47450 47677 CDS product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728261.1 protein_id gnl|my_center|LOCUS_05710 47757 49310 gene locus_tag LOCUS_05720 47757 49310 CDS product Ada metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091823.1 protein_id gnl|my_center|LOCUS_05720 49307 49825 gene locus_tag LOCUS_05730 49307 49825 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058688.1 protein_id gnl|my_center|LOCUS_05730 49867 50982 gene locus_tag LOCUS_05740 49867 50982 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_05740 51070 52125 gene locus_tag LOCUS_05750 51070 52125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05750 52881 52132 gene locus_tag LOCUS_05760 52881 52132 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015195.1 protein_id gnl|my_center|LOCUS_05760 52946 53776 gene locus_tag LOCUS_05770 gene nadE 52946 53776 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081185.1 protein_id gnl|my_center|LOCUS_05770 54679 53762 gene locus_tag LOCUS_05780 54679 53762 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415986.1 protein_id gnl|my_center|LOCUS_05780 55760 54708 gene locus_tag LOCUS_05790 55760 54708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 55642 55938 gene locus_tag LOCUS_05800 55642 55938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 56313 56053 gene locus_tag LOCUS_05810 56313 56053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 57320 56310 gene locus_tag LOCUS_05820 57320 56310 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226002.1 protein_id gnl|my_center|LOCUS_05820 57431 57973 gene locus_tag LOCUS_05830 57431 57973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 59475 58084 gene locus_tag LOCUS_05840 59475 58084 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080124.1 protein_id gnl|my_center|LOCUS_05840 59951 60292 gene locus_tag LOCUS_05850 59951 60292 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229055.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05850 60645 60572 gene locus_tag LOCUS_t00070 60645 60572 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 61508 60756 gene locus_tag LOCUS_05860 61508 60756 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223189.1 protein_id gnl|my_center|LOCUS_05860 63234 61594 gene locus_tag LOCUS_05870 gene pgm 63234 61594 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728182.1 protein_id gnl|my_center|LOCUS_05870 63404 63982 gene locus_tag LOCUS_05880 63404 63982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 64177 65556 gene locus_tag LOCUS_05890 64177 65556 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093306.1 protein_id gnl|my_center|LOCUS_05890 66474 65626 gene locus_tag LOCUS_05900 66474 65626 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228550.1 protein_id gnl|my_center|LOCUS_05900 66992 66625 gene locus_tag LOCUS_tm00010 66992 66625 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 67208 67729 gene locus_tag LOCUS_05910 67208 67729 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229692.1 protein_id gnl|my_center|LOCUS_05910 68215 67736 gene locus_tag LOCUS_05920 gene smpB 68215 67736 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056461.1 protein_id gnl|my_center|LOCUS_05920 68322 68849 gene locus_tag LOCUS_05930 68322 68849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 69751 68846 gene locus_tag LOCUS_05940 gene ftsX 69751 68846 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907867.1 protein_id gnl|my_center|LOCUS_05940 70455 69751 gene locus_tag LOCUS_05950 gene ftsE 70455 69751 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728142.1 protein_id gnl|my_center|LOCUS_05950 70994 70518 gene locus_tag LOCUS_05960 70994 70518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 71920 70991 gene locus_tag LOCUS_05970 71920 70991 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081063.1 protein_id gnl|my_center|LOCUS_05970 73041 71926 gene locus_tag LOCUS_05980 gene prfB 73041 71926 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416129.1 protein_id gnl|my_center|LOCUS_05980 73496 73116 gene locus_tag LOCUS_05990 73496 73116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 73593 74393 gene locus_tag LOCUS_06000 gene hisN 73593 74393 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618313.1 protein_id gnl|my_center|LOCUS_06000 74859 74386 gene locus_tag LOCUS_06010 74859 74386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 75253 74921 gene locus_tag LOCUS_06020 75253 74921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 75495 76862 gene locus_tag LOCUS_06030 75495 76862 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094221.1 protein_id gnl|my_center|LOCUS_06030 76908 78125 gene locus_tag LOCUS_06040 76908 78125 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728136.1 protein_id gnl|my_center|LOCUS_06040 79682 78240 gene locus_tag LOCUS_06050 79682 78240 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030470.1 protein_id gnl|my_center|LOCUS_06050 79852 80421 gene locus_tag LOCUS_06060 79852 80421 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978343.1 protein_id gnl|my_center|LOCUS_06060 80833 81162 gene locus_tag LOCUS_06070 80833 81162 CDS product transglycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084899.1 protein_id gnl|my_center|LOCUS_06070 81358 81954 gene locus_tag LOCUS_06080 81358 81954 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222346.1 protein_id gnl|my_center|LOCUS_06080 82443 81985 gene locus_tag LOCUS_06090 gene htdZ 82443 81985 CDS product 3-hydroxyacyl-thioester dehydratase HtdZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400912.1 protein_id gnl|my_center|LOCUS_06090 83145 82483 gene locus_tag LOCUS_06100 83145 82483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 83287 83922 gene locus_tag LOCUS_06110 83287 83922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 84799 83936 gene locus_tag LOCUS_06120 84799 83936 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400979.1 protein_id gnl|my_center|LOCUS_06120 85598 84891 gene locus_tag LOCUS_06130 85598 84891 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084715.1 protein_id gnl|my_center|LOCUS_06130 86110 85595 gene locus_tag LOCUS_06140 86110 85595 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726812.1 protein_id gnl|my_center|LOCUS_06140 86207 87334 gene locus_tag LOCUS_06150 86207 87334 CDS product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084716.1 protein_id gnl|my_center|LOCUS_06150 87370 88062 gene locus_tag LOCUS_06160 87370 88062 CDS product phosphonatase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084718.1 protein_id gnl|my_center|LOCUS_06160 88095 89150 gene locus_tag LOCUS_06170 88095 89150 CDS product 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089938.1 protein_id gnl|my_center|LOCUS_06170 89150 90337 gene locus_tag LOCUS_06180 89150 90337 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110147.1 protein_id gnl|my_center|LOCUS_06180 90334 91254 gene locus_tag LOCUS_06190 90334 91254 CDS product 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089933.1 protein_id gnl|my_center|LOCUS_06190 91232 92029 gene locus_tag LOCUS_06200 91232 92029 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084727.1 protein_id gnl|my_center|LOCUS_06200 92050 92664 gene locus_tag LOCUS_06210 92050 92664 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854162.1 protein_id gnl|my_center|LOCUS_06210 94061 92673 gene locus_tag LOCUS_06220 94061 92673 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975714.1 protein_id gnl|my_center|LOCUS_06220 95062 94220 gene locus_tag LOCUS_06230 95062 94220 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484721.1 protein_id gnl|my_center|LOCUS_06230 96614 95064 gene locus_tag LOCUS_06240 96614 95064 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906341.1 protein_id gnl|my_center|LOCUS_06240 96932 97117 gene locus_tag LOCUS_06250 96932 97117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 97933 97808 gene locus_tag LOCUS_06260 97933 97808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 98066 98521 gene locus_tag LOCUS_06270 gene ephG 98066 98521 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414015.1 protein_id gnl|my_center|LOCUS_06270 98561 98962 gene locus_tag LOCUS_06280 98561 98962 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106807.1 protein_id gnl|my_center|LOCUS_06280 99100 99026 gene locus_tag LOCUS_t00080 99100 99026 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 100130 99165 gene locus_tag LOCUS_06290 100130 99165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775834.1 protein_id gnl|my_center|LOCUS_06290 103223 100185 gene locus_tag LOCUS_06300 103223 100185 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728043.1 protein_id gnl|my_center|LOCUS_06300 103394 103996 gene locus_tag LOCUS_06310 103394 103996 CDS product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223149.1 protein_id gnl|my_center|LOCUS_06310 105054 104017 gene locus_tag LOCUS_06320 105054 104017 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893338.1 protein_id gnl|my_center|LOCUS_06320 106052 105117 gene locus_tag LOCUS_06330 106052 105117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 106966 106106 gene locus_tag LOCUS_06340 106966 106106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092677.1 protein_id gnl|my_center|LOCUS_06340 108009 106963 gene locus_tag LOCUS_06350 108009 106963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115764.1 protein_id gnl|my_center|LOCUS_06350 109084 108053 gene locus_tag LOCUS_06360 109084 108053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 109301 110773 gene locus_tag LOCUS_06370 109301 110773 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081023.1 protein_id gnl|my_center|LOCUS_06370 110864 111769 gene locus_tag LOCUS_06380 110864 111769 CDS product cyclodehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728040.1 protein_id gnl|my_center|LOCUS_06380 111804 113120 gene locus_tag LOCUS_06390 111804 113120 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111848.1 protein_id gnl|my_center|LOCUS_06390 113509 113183 gene locus_tag LOCUS_06400 113509 113183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 116100 114025 gene locus_tag LOCUS_06410 116100 114025 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111856.1 protein_id gnl|my_center|LOCUS_06410 114534 114610 gene locus_tag LOCUS_t00090 114534 114610 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 116184 116435 gene locus_tag LOCUS_06420 gene mrx1 116184 116435 CDS product mycoredoxin Mrx1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728032.1 protein_id gnl|my_center|LOCUS_06420 117414 116467 gene locus_tag LOCUS_06430 gene nudC 117414 116467 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056376.1 protein_id gnl|my_center|LOCUS_06430 117978 117424 gene locus_tag LOCUS_06440 117978 117424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 118105 118686 gene locus_tag LOCUS_06450 118105 118686 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230001.1 protein_id gnl|my_center|LOCUS_06450 119738 118662 gene locus_tag LOCUS_06460 119738 118662 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081006.1 protein_id gnl|my_center|LOCUS_06460 119835 120236 gene locus_tag LOCUS_06470 119835 120236 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728030.1 protein_id gnl|my_center|LOCUS_06470 121293 120259 gene locus_tag LOCUS_06480 121293 120259 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896593.1 protein_id gnl|my_center|LOCUS_06480 121380 121979 gene locus_tag LOCUS_06490 121380 121979 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730371.1 protein_id gnl|my_center|LOCUS_06490 125448 121969 gene locus_tag LOCUS_06500 gene adnB 125448 121969 CDS product ATP-dependent DNA helicase AdnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416833.1 protein_id gnl|my_center|LOCUS_06500 128860 125441 gene locus_tag LOCUS_06510 128860 125441 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223038.1 protein_id gnl|my_center|LOCUS_06510 128863 129792 gene locus_tag LOCUS_06520 128863 129792 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877251.1 protein_id gnl|my_center|LOCUS_06520 130575 129856 gene locus_tag LOCUS_06530 130575 129856 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080998.1 protein_id gnl|my_center|LOCUS_06530 131798 130572 gene locus_tag LOCUS_06540 131798 130572 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080996.1 protein_id gnl|my_center|LOCUS_06540 132151 131786 gene locus_tag LOCUS_06550 132151 131786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 134804 132282 gene locus_tag LOCUS_06560 gene nirB 134804 132282 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111865.1 protein_id gnl|my_center|LOCUS_06560 136295 134856 gene locus_tag LOCUS_06570 136295 134856 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447243.1 protein_id gnl|my_center|LOCUS_06570 136604 137413 gene locus_tag LOCUS_06580 136604 137413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 138121 137447 gene locus_tag LOCUS_06590 138121 137447 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228133.1 protein_id gnl|my_center|LOCUS_06590 139456 138173 gene locus_tag LOCUS_06600 139456 138173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 139602 140282 gene locus_tag LOCUS_06610 139602 140282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 >Feature sequence04 728 336 gene locus_tag LOCUS_06620 728 336 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731395.1 protein_id gnl|my_center|LOCUS_06620 818 1873 gene locus_tag LOCUS_06630 818 1873 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389904.1 protein_id gnl|my_center|LOCUS_06630 3383 1860 gene locus_tag LOCUS_06640 gene crtI 3383 1860 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225928.1 protein_id gnl|my_center|LOCUS_06640 3995 3426 gene locus_tag LOCUS_06650 3995 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 4628 4023 gene locus_tag LOCUS_06660 4628 4023 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224757.1 protein_id gnl|my_center|LOCUS_06660 5877 4642 gene locus_tag LOCUS_06670 5877 4642 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 protein_id gnl|my_center|LOCUS_06670 6132 6059 gene locus_tag LOCUS_t00100 6132 6059 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6521 6186 gene locus_tag LOCUS_06680 6521 6186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 7498 6518 gene locus_tag LOCUS_06690 7498 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858464.1 protein_id gnl|my_center|LOCUS_06690 8323 7658 gene locus_tag LOCUS_06700 8323 7658 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092841.1 protein_id gnl|my_center|LOCUS_06700 9605 8337 gene locus_tag LOCUS_06710 9605 8337 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063361.1 protein_id gnl|my_center|LOCUS_06710 10627 9695 gene locus_tag LOCUS_06720 10627 9695 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082898.1 protein_id gnl|my_center|LOCUS_06720 10803 11471 gene locus_tag LOCUS_06730 10803 11471 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230040.1 protein_id gnl|my_center|LOCUS_06730 11546 11917 gene locus_tag LOCUS_06740 11546 11917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 11999 12685 gene locus_tag LOCUS_06750 11999 12685 CDS product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066393.1 protein_id gnl|my_center|LOCUS_06750 12794 13219 gene locus_tag LOCUS_06760 gene mscL 12794 13219 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230043.1 protein_id gnl|my_center|LOCUS_06760 14857 13250 gene locus_tag LOCUS_06770 14857 13250 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730355.1 protein_id gnl|my_center|LOCUS_06770 15228 14854 gene locus_tag LOCUS_06780 15228 14854 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049745379.1 protein_id gnl|my_center|LOCUS_06780 17129 15342 gene locus_tag LOCUS_06790 17129 15342 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730352.1 protein_id gnl|my_center|LOCUS_06790 17418 17134 gene locus_tag LOCUS_06800 17418 17134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104514.1 protein_id gnl|my_center|LOCUS_06800 18332 17508 gene locus_tag LOCUS_06810 18332 17508 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896559.1 protein_id gnl|my_center|LOCUS_06810 19527 18340 gene locus_tag LOCUS_06820 19527 18340 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896558.1 protein_id gnl|my_center|LOCUS_06820 19857 19597 gene locus_tag LOCUS_06830 19857 19597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 20825 20112 gene locus_tag LOCUS_06840 20825 20112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 21516 20875 gene locus_tag LOCUS_06850 21516 20875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 22062 21889 gene locus_tag LOCUS_06860 22062 21889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 22758 22072 gene locus_tag LOCUS_06870 22758 22072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 24317 22758 gene locus_tag LOCUS_06880 24317 22758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 25894 24485 gene locus_tag LOCUS_06890 25894 24485 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082904.1 protein_id gnl|my_center|LOCUS_06890 26621 25929 gene locus_tag LOCUS_06900 gene mprA 26621 25929 CDS product two-component system response regulator MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014588181.1 protein_id gnl|my_center|LOCUS_06900 26866 28086 gene locus_tag LOCUS_06910 26866 28086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 28083 28298 gene locus_tag LOCUS_06920 28083 28298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 28298 29089 gene locus_tag LOCUS_06930 28298 29089 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940238.1 protein_id gnl|my_center|LOCUS_06930 29140 30243 gene locus_tag LOCUS_06940 29140 30243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919038.1 protein_id gnl|my_center|LOCUS_06940 30296 32524 gene locus_tag LOCUS_06950 30296 32524 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031731.1 protein_id gnl|my_center|LOCUS_06950 33069 32806 gene locus_tag LOCUS_06960 33069 32806 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858446.1 protein_id gnl|my_center|LOCUS_06960 34379 33066 gene locus_tag LOCUS_06970 34379 33066 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072487.1 protein_id gnl|my_center|LOCUS_06970 34471 34707 gene locus_tag LOCUS_06980 gene rpmB 34471 34707 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858441.1 protein_id gnl|my_center|LOCUS_06980 34707 34877 gene locus_tag LOCUS_06990 gene rpmG 34707 34877 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410628.1 protein_id gnl|my_center|LOCUS_06990 34879 35184 gene locus_tag LOCUS_07000 gene rpsN 34879 35184 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975403.1 protein_id gnl|my_center|LOCUS_07000 35293 35550 gene locus_tag LOCUS_07010 gene rpsR 35293 35550 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105399.1 protein_id gnl|my_center|LOCUS_07010 35651 36586 gene locus_tag LOCUS_07020 35651 36586 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859408.1 protein_id gnl|my_center|LOCUS_07020 36645 37298 gene locus_tag LOCUS_07030 36645 37298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 38125 37307 gene locus_tag LOCUS_07040 38125 37307 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037882.1 protein_id gnl|my_center|LOCUS_07040 40125 38122 gene locus_tag LOCUS_07050 40125 38122 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730584.1 protein_id gnl|my_center|LOCUS_07050 41559 40150 gene locus_tag LOCUS_07060 41559 40150 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878358.1 protein_id gnl|my_center|LOCUS_07060 42398 41661 gene locus_tag LOCUS_07070 42398 41661 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893654.1 protein_id gnl|my_center|LOCUS_07070 42566 43582 gene locus_tag LOCUS_07080 42566 43582 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730807.1 protein_id gnl|my_center|LOCUS_07080 43579 44322 gene locus_tag LOCUS_07090 43579 44322 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730808.1 protein_id gnl|my_center|LOCUS_07090 44433 45341 gene locus_tag LOCUS_07100 44433 45341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 45926 45444 gene locus_tag LOCUS_07110 45926 45444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 46192 45845 gene locus_tag LOCUS_07120 46192 45845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 47160 46225 gene locus_tag LOCUS_07130 47160 46225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 48233 47169 gene locus_tag LOCUS_07140 48233 47169 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071126.1 protein_id gnl|my_center|LOCUS_07140 49366 48230 gene locus_tag LOCUS_07150 49366 48230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 50372 49368 gene locus_tag LOCUS_07160 50372 49368 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077892.1 protein_id gnl|my_center|LOCUS_07160 51352 50369 gene locus_tag LOCUS_07170 51352 50369 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085985.1 protein_id gnl|my_center|LOCUS_07170 52505 51267 gene locus_tag LOCUS_07180 52505 51267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 53260 52505 gene locus_tag LOCUS_07190 53260 52505 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085987.1 protein_id gnl|my_center|LOCUS_07190 54212 53619 gene locus_tag LOCUS_07200 54212 53619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07200 54408 55643 gene locus_tag LOCUS_07210 54408 55643 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095590.1 protein_id gnl|my_center|LOCUS_07210 55657 56352 gene locus_tag LOCUS_07220 55657 56352 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087056.1 protein_id gnl|my_center|LOCUS_07220 56606 60202 gene locus_tag LOCUS_07230 56606 60202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 61724 60207 gene locus_tag LOCUS_07240 gene glpK 61724 60207 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898134.1 protein_id gnl|my_center|LOCUS_07240 62509 61721 gene locus_tag LOCUS_07250 62509 61721 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731512.1 protein_id gnl|my_center|LOCUS_07250 62665 64179 gene locus_tag LOCUS_07260 gene glpK 62665 64179 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899643.1 protein_id gnl|my_center|LOCUS_07260 64229 65965 gene locus_tag LOCUS_07270 64229 65965 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878744.1 protein_id gnl|my_center|LOCUS_07270 65962 66711 gene locus_tag LOCUS_07280 65962 66711 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742072.1 protein_id gnl|my_center|LOCUS_07280 66768 67901 gene locus_tag LOCUS_07290 66768 67901 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043078326.1 protein_id gnl|my_center|LOCUS_07290 68123 70063 gene locus_tag LOCUS_07300 68123 70063 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845635.1 protein_id gnl|my_center|LOCUS_07300 70225 71160 gene locus_tag LOCUS_07310 70225 71160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148043383.1 protein_id gnl|my_center|LOCUS_07310 72802 71240 gene locus_tag LOCUS_07320 gene purH 72802 71240 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730588.1 protein_id gnl|my_center|LOCUS_07320 73389 72799 gene locus_tag LOCUS_07330 gene purN 73389 72799 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878360.1 protein_id gnl|my_center|LOCUS_07330 75057 73570 gene locus_tag LOCUS_07340 75057 73570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 76433 75135 gene locus_tag LOCUS_07350 76433 75135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 77872 76634 gene locus_tag LOCUS_07360 77872 76634 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112212.1 protein_id gnl|my_center|LOCUS_07360 79894 77939 gene locus_tag LOCUS_07370 79894 77939 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005134046.1 protein_id gnl|my_center|LOCUS_07370 81549 79891 gene locus_tag LOCUS_07380 81549 79891 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230221.1 protein_id gnl|my_center|LOCUS_07380 81703 85266 gene locus_tag LOCUS_07390 81703 85266 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227656.1 protein_id gnl|my_center|LOCUS_07390 86664 85270 gene locus_tag LOCUS_07400 86664 85270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 86829 87440 gene locus_tag LOCUS_07410 86829 87440 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229111.1 protein_id gnl|my_center|LOCUS_07410 87437 89035 gene locus_tag LOCUS_07420 87437 89035 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727668.1 protein_id gnl|my_center|LOCUS_07420 89881 89045 gene locus_tag LOCUS_07430 89881 89045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 89872 90660 gene locus_tag LOCUS_07440 gene heR 89872 90660 CDS product heliorhodopsin HeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296133.1 protein_id gnl|my_center|LOCUS_07440 90745 92085 gene locus_tag LOCUS_07450 90745 92085 CDS product DUF3533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977086.1 protein_id gnl|my_center|LOCUS_07450 92847 92176 gene locus_tag LOCUS_07460 92847 92176 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068220.1 protein_id gnl|my_center|LOCUS_07460 93944 92850 gene locus_tag LOCUS_07470 93944 92850 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082323.1 protein_id gnl|my_center|LOCUS_07470 94632 93937 gene locus_tag LOCUS_07480 94632 93937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07480 94845 94684 gene locus_tag LOCUS_07490 94845 94684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 95078 95548 gene locus_tag LOCUS_07500 95078 95548 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226865.1 protein_id gnl|my_center|LOCUS_07500 96508 95618 gene locus_tag LOCUS_07510 gene sucD 96508 95618 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896926.1 protein_id gnl|my_center|LOCUS_07510 97686 96523 gene locus_tag LOCUS_07520 gene sucC 97686 96523 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109739.1 protein_id gnl|my_center|LOCUS_07520 98119 99228 gene locus_tag LOCUS_07530 98119 99228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 101749 99257 gene locus_tag LOCUS_07540 gene pcrA 101749 99257 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404859.1 protein_id gnl|my_center|LOCUS_07540 103638 101830 gene locus_tag LOCUS_07550 103638 101830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731073.1 protein_id gnl|my_center|LOCUS_07550 103700 104101 gene locus_tag LOCUS_07560 103700 104101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 104098 105483 gene locus_tag LOCUS_07570 104098 105483 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401544.1 protein_id gnl|my_center|LOCUS_07570 106488 105508 gene locus_tag LOCUS_07580 106488 105508 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_07580 106619 108304 gene locus_tag LOCUS_07590 gene pgi 106619 108304 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730607.1 protein_id gnl|my_center|LOCUS_07590 108288 109655 gene locus_tag LOCUS_07600 108288 109655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 109677 110351 gene locus_tag LOCUS_07610 109677 110351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 111542 110373 gene locus_tag LOCUS_07620 111542 110373 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112106.1 protein_id gnl|my_center|LOCUS_07620 112590 111688 gene locus_tag LOCUS_07630 112590 111688 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082947.1 protein_id gnl|my_center|LOCUS_07630 113335 112655 gene locus_tag LOCUS_07640 113335 112655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 113581 114342 gene locus_tag LOCUS_07650 113581 114342 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862394.1 protein_id gnl|my_center|LOCUS_07650 115150 114362 gene locus_tag LOCUS_07660 gene cobF 115150 114362 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896950.1 protein_id gnl|my_center|LOCUS_07660 115986 115147 gene locus_tag LOCUS_07670 115986 115147 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088003.1 protein_id gnl|my_center|LOCUS_07670 116062 116538 gene locus_tag LOCUS_07680 116062 116538 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919598.1 protein_id gnl|my_center|LOCUS_07680 116632 117267 gene locus_tag LOCUS_07690 116632 117267 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728325.1 protein_id gnl|my_center|LOCUS_07690 117349 117657 gene locus_tag LOCUS_07700 117349 117657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 119450 117735 gene locus_tag LOCUS_07710 119450 117735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 119700 121001 gene locus_tag LOCUS_07720 119700 121001 CDS product PE-PPE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115316754.1 protein_id gnl|my_center|LOCUS_07720 121130 121057 gene locus_tag LOCUS_t00110 121130 121057 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 121277 122896 gene locus_tag LOCUS_07730 121277 122896 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906341.1 protein_id gnl|my_center|LOCUS_07730 123140 125314 gene locus_tag LOCUS_07740 123140 125314 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_07740 127331 125409 gene locus_tag LOCUS_07750 127331 125409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 129113 127440 gene locus_tag LOCUS_07760 129113 127440 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113135.1 protein_id gnl|my_center|LOCUS_07760 129719 129270 gene locus_tag LOCUS_07770 129719 129270 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073393.1 protein_id gnl|my_center|LOCUS_07770 130676 129786 gene locus_tag LOCUS_07780 130676 129786 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113234.1 protein_id gnl|my_center|LOCUS_07780 131593 130673 gene locus_tag LOCUS_07790 131593 130673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087190.1 protein_id gnl|my_center|LOCUS_07790 132796 131606 gene locus_tag LOCUS_07800 132796 131606 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731331.1 protein_id gnl|my_center|LOCUS_07800 133979 132807 gene locus_tag LOCUS_07810 133979 132807 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731330.1 protein_id gnl|my_center|LOCUS_07810 135192 134017 gene locus_tag LOCUS_07820 135192 134017 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228149.1 protein_id gnl|my_center|LOCUS_07820 135304 136191 gene locus_tag LOCUS_07830 135304 136191 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111309.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence05 816 1841 gene locus_tag LOCUS_07840 816 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211410235.1 protein_id gnl|my_center|LOCUS_07840 2169 1870 gene locus_tag LOCUS_07850 2169 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 2345 2995 gene locus_tag LOCUS_07860 2345 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 3487 2999 gene locus_tag LOCUS_07870 3487 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 5064 3484 gene locus_tag LOCUS_07880 5064 3484 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084106.1 protein_id gnl|my_center|LOCUS_07880 5145 5900 gene locus_tag LOCUS_07890 5145 5900 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084095.1 protein_id gnl|my_center|LOCUS_07890 7061 5907 gene locus_tag LOCUS_07900 7061 5907 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112106.1 protein_id gnl|my_center|LOCUS_07900 7313 7071 gene locus_tag LOCUS_07910 7313 7071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 7275 8063 gene locus_tag LOCUS_07920 7275 8063 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897817.1 protein_id gnl|my_center|LOCUS_07920 8095 8895 gene locus_tag LOCUS_07930 8095 8895 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897816.1 protein_id gnl|my_center|LOCUS_07930 8861 9322 gene locus_tag LOCUS_07940 8861 9322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 11515 9335 gene locus_tag LOCUS_07950 11515 9335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 11751 13418 gene locus_tag LOCUS_07960 11751 13418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 13486 14694 gene locus_tag LOCUS_07970 gene glf 13486 14694 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897813.1 protein_id gnl|my_center|LOCUS_07970 14691 16580 gene locus_tag LOCUS_07980 14691 16580 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731265.1 protein_id gnl|my_center|LOCUS_07980 16561 17199 gene locus_tag LOCUS_07990 16561 17199 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062953.1 protein_id gnl|my_center|LOCUS_07990 17196 18122 gene locus_tag LOCUS_08000 17196 18122 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897810.1 protein_id gnl|my_center|LOCUS_08000 18166 20082 gene locus_tag LOCUS_08010 gene zomB 18166 20082 CDS product flagellar motor control protein ZomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496045.1 protein_id gnl|my_center|LOCUS_08010 20458 21381 gene locus_tag LOCUS_08020 20458 21381 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091136.1 protein_id gnl|my_center|LOCUS_08020 21588 23480 gene locus_tag LOCUS_08030 21588 23480 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196151465.1 protein_id gnl|my_center|LOCUS_08030 23486 24094 gene locus_tag LOCUS_08040 23486 24094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 24125 24043 gene locus_tag LOCUS_t00120 24125 24043 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 24101 25096 gene locus_tag LOCUS_08050 24101 25096 CDS product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084076.1 protein_id gnl|my_center|LOCUS_08050 25225 26226 gene locus_tag LOCUS_08060 25225 26226 CDS product TIGR03621 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222573.1 protein_id gnl|my_center|LOCUS_08060 26523 28421 gene locus_tag LOCUS_08070 gene fadD32 26523 28421 CDS product long-chain-fatty-acid--AMP ligase FadD32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112890.1 protein_id gnl|my_center|LOCUS_08070 28433 33730 gene locus_tag LOCUS_08080 gene pks13 28433 33730 CDS product polyketide synthase Pks13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112891.1 protein_id gnl|my_center|LOCUS_08080 33730 35277 gene locus_tag LOCUS_08090 33730 35277 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420767.1 protein_id gnl|my_center|LOCUS_08090 35472 36653 gene locus_tag LOCUS_08100 35472 36653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 37482 36697 gene locus_tag LOCUS_08110 37482 36697 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407672.1 protein_id gnl|my_center|LOCUS_08110 37775 37566 gene locus_tag LOCUS_08120 37775 37566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 37762 38670 gene locus_tag LOCUS_08130 37762 38670 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950551.1 protein_id gnl|my_center|LOCUS_08130 40512 38677 gene locus_tag LOCUS_08140 40512 38677 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978119.1 protein_id gnl|my_center|LOCUS_08140 41261 40578 gene locus_tag LOCUS_08150 41261 40578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 42332 41343 gene locus_tag LOCUS_08160 42332 41343 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977616.1 protein_id gnl|my_center|LOCUS_08160 45870 42451 gene locus_tag LOCUS_08170 45870 42451 CDS product arabinosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731253.1 protein_id gnl|my_center|LOCUS_08170 49139 45867 gene locus_tag LOCUS_08180 gene embA 49139 45867 CDS product arabinosyltransferase EmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899696.1 protein_id gnl|my_center|LOCUS_08180 52618 49286 gene locus_tag LOCUS_08190 gene embC 52618 49286 CDS product arabinosyltransferase EmbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420638.1 protein_id gnl|my_center|LOCUS_08190 52768 53220 gene locus_tag LOCUS_08200 gene aroQ 52768 53220 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106162.1 protein_id gnl|my_center|LOCUS_08200 53479 54396 gene locus_tag LOCUS_08210 53479 54396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 54432 55997 gene locus_tag LOCUS_08220 54432 55997 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029653.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08220 56112 56972 gene locus_tag LOCUS_08230 56112 56972 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056709.1 protein_id gnl|my_center|LOCUS_08230 57756 56977 gene locus_tag LOCUS_08240 57756 56977 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727181.1 protein_id gnl|my_center|LOCUS_08240 59711 57753 gene locus_tag LOCUS_08250 59711 57753 CDS product galactan 5-O-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878631.1 protein_id gnl|my_center|LOCUS_08250 60480 59719 gene locus_tag LOCUS_08260 60480 59719 CDS product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731251.1 protein_id gnl|my_center|LOCUS_08260 61938 60523 gene locus_tag LOCUS_08270 61938 60523 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897792.1 protein_id gnl|my_center|LOCUS_08270 62580 62017 gene locus_tag LOCUS_08280 62580 62017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 62655 63452 gene locus_tag LOCUS_08290 62655 63452 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208394.1 protein_id gnl|my_center|LOCUS_08290 64070 63555 gene locus_tag LOCUS_08300 64070 63555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 64155 65156 gene locus_tag LOCUS_08310 64155 65156 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728135.1 protein_id gnl|my_center|LOCUS_08310 65275 65523 gene locus_tag LOCUS_08320 65275 65523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 65562 67052 gene locus_tag LOCUS_08330 65562 67052 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728345.1 protein_id gnl|my_center|LOCUS_08330 68582 67059 gene locus_tag LOCUS_08340 68582 67059 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223948.1 protein_id gnl|my_center|LOCUS_08340 69847 68585 gene locus_tag LOCUS_08350 69847 68585 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098426.1 protein_id gnl|my_center|LOCUS_08350 69940 70767 gene locus_tag LOCUS_08360 69940 70767 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_08360 70773 72155 gene locus_tag LOCUS_08370 70773 72155 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085466.1 protein_id gnl|my_center|LOCUS_08370 73717 72128 gene locus_tag LOCUS_08380 73717 72128 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267635.1 protein_id gnl|my_center|LOCUS_08380 74613 73720 gene locus_tag LOCUS_08390 74613 73720 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_08390 74769 75392 gene locus_tag LOCUS_08400 74769 75392 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091624.1 protein_id gnl|my_center|LOCUS_08400 75389 75751 gene locus_tag LOCUS_08410 75389 75751 CDS product YidH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703959.1 protein_id gnl|my_center|LOCUS_08410 75844 76485 gene locus_tag LOCUS_08420 75844 76485 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031179.1 protein_id gnl|my_center|LOCUS_08420 76531 77760 gene locus_tag LOCUS_08430 76531 77760 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229261.1 protein_id gnl|my_center|LOCUS_08430 77757 78788 gene locus_tag LOCUS_08440 77757 78788 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731214.1 protein_id gnl|my_center|LOCUS_08440 79499 78816 gene locus_tag LOCUS_08450 79499 78816 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729554.1 protein_id gnl|my_center|LOCUS_08450 79790 79575 gene locus_tag LOCUS_08460 79790 79575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 80097 79861 gene locus_tag LOCUS_08470 80097 79861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 81735 80215 gene locus_tag LOCUS_08480 81735 80215 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870095.1 protein_id gnl|my_center|LOCUS_08480 81784 82593 gene locus_tag LOCUS_08490 81784 82593 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777055.1 protein_id gnl|my_center|LOCUS_08490 82680 83021 gene locus_tag LOCUS_08500 82680 83021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 83647 83087 gene locus_tag LOCUS_08510 83647 83087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 84398 83733 gene locus_tag LOCUS_08520 84398 83733 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 protein_id gnl|my_center|LOCUS_08520 85644 84391 gene locus_tag LOCUS_08530 85644 84391 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 protein_id gnl|my_center|LOCUS_08530 85792 86202 gene locus_tag LOCUS_08540 85792 86202 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095485.1 protein_id gnl|my_center|LOCUS_08540 87268 86231 gene locus_tag LOCUS_08550 87268 86231 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079794.1 protein_id gnl|my_center|LOCUS_08550 87865 87308 gene locus_tag LOCUS_08560 87865 87308 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088894.1 protein_id gnl|my_center|LOCUS_08560 88056 89603 gene locus_tag LOCUS_08570 88056 89603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 90318 89686 gene locus_tag LOCUS_08580 90318 89686 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224249.1 protein_id gnl|my_center|LOCUS_08580 90455 91597 gene locus_tag LOCUS_08590 90455 91597 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971922.1 protein_id gnl|my_center|LOCUS_08590 92824 91610 gene locus_tag LOCUS_08600 92824 91610 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728502.1 protein_id gnl|my_center|LOCUS_08600 93933 92827 gene locus_tag LOCUS_08610 gene sfnG 93933 92827 CDS product dimethyl sulfone monooxygenase SfnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730592.1 protein_id gnl|my_center|LOCUS_08610 95172 93994 gene locus_tag LOCUS_08620 95172 93994 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014210.1 protein_id gnl|my_center|LOCUS_08620 95527 96867 gene locus_tag LOCUS_08630 95527 96867 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876912.1 protein_id gnl|my_center|LOCUS_08630 98128 96872 gene locus_tag LOCUS_08640 98128 96872 CDS product sialate:H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900427.1 protein_id gnl|my_center|LOCUS_08640 99185 98337 gene locus_tag LOCUS_08650 99185 98337 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466752.1 protein_id gnl|my_center|LOCUS_08650 100258 99182 gene locus_tag LOCUS_08660 100258 99182 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_08660 100420 101190 gene locus_tag LOCUS_08670 100420 101190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 101456 101172 gene locus_tag LOCUS_08680 101456 101172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 101578 103593 gene locus_tag LOCUS_08690 101578 103593 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094422.1 protein_id gnl|my_center|LOCUS_08690 104478 103696 gene locus_tag LOCUS_08700 gene surE 104478 103696 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037201557.1 protein_id gnl|my_center|LOCUS_08700 104539 105366 gene locus_tag LOCUS_08710 104539 105366 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_08710 105416 105853 gene locus_tag LOCUS_08720 105416 105853 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467790.1 protein_id gnl|my_center|LOCUS_08720 105889 106653 gene locus_tag LOCUS_08730 gene modA 105889 106653 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110929.1 protein_id gnl|my_center|LOCUS_08730 106650 107453 gene locus_tag LOCUS_08740 106650 107453 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775842.1 protein_id gnl|my_center|LOCUS_08740 107450 108514 gene locus_tag LOCUS_08750 107450 108514 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728088.1 protein_id gnl|my_center|LOCUS_08750 109533 108535 gene locus_tag LOCUS_08760 109533 108535 CDS product 4,5-dihydroxyphthalate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947496.1 protein_id gnl|my_center|LOCUS_08760 109629 110321 gene locus_tag LOCUS_08770 109629 110321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 110893 110324 gene locus_tag LOCUS_08780 110893 110324 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225287.1 protein_id gnl|my_center|LOCUS_08780 111949 110957 gene locus_tag LOCUS_08790 111949 110957 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223470.1 protein_id gnl|my_center|LOCUS_08790 113139 111946 gene locus_tag LOCUS_08800 113139 111946 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229637.1 protein_id gnl|my_center|LOCUS_08800 113293 114501 gene locus_tag LOCUS_08810 113293 114501 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229636.1 protein_id gnl|my_center|LOCUS_08810 114555 116729 gene locus_tag LOCUS_08820 114555 116729 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229635.1 protein_id gnl|my_center|LOCUS_08820 117115 118614 gene locus_tag LOCUS_08830 117115 118614 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407257.1 protein_id gnl|my_center|LOCUS_08830 119272 118688 gene locus_tag LOCUS_08840 119272 118688 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076362.1 protein_id gnl|my_center|LOCUS_08840 119320 120174 gene locus_tag LOCUS_08850 119320 120174 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055673.1 protein_id gnl|my_center|LOCUS_08850 120218 121279 gene locus_tag LOCUS_08860 120218 121279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 122044 121283 gene locus_tag LOCUS_08870 122044 121283 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079514.1 protein_id gnl|my_center|LOCUS_08870 124265 122277 gene locus_tag LOCUS_08880 124265 122277 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726765.1 protein_id gnl|my_center|LOCUS_08880 124393 126039 gene locus_tag LOCUS_08890 124393 126039 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224830.1 protein_id gnl|my_center|LOCUS_08890 126104 127324 gene locus_tag LOCUS_08900 126104 127324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 128897 127329 gene locus_tag LOCUS_08910 128897 127329 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085191.1 protein_id gnl|my_center|LOCUS_08910 129359 128940 gene locus_tag LOCUS_08920 129359 128940 CDS product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079821.1 protein_id gnl|my_center|LOCUS_08920 130495 129356 gene locus_tag LOCUS_08930 130495 129356 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726777.1 protein_id gnl|my_center|LOCUS_08930 130579 131868 gene locus_tag LOCUS_08940 130579 131868 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891590.1 protein_id gnl|my_center|LOCUS_08940 131868 133022 gene locus_tag LOCUS_08950 131868 133022 CDS product DUF5931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728916.1 protein_id gnl|my_center|LOCUS_08950 133019 133681 gene locus_tag LOCUS_08960 133019 133681 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877615.1 protein_id gnl|my_center|LOCUS_08960 133698 133994 gene locus_tag LOCUS_08970 133698 133994 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411038.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence06 <1 1551 gene locus_tag LOCUS_08980 <1 1551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010907763.1:endolytic transglycosylase MltG 1542 2381 gene locus_tag LOCUS_08990 1542 2381 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114425.1 protein_id gnl|my_center|LOCUS_08990 2512 2952 gene locus_tag LOCUS_09000 2512 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 3001 4227 gene locus_tag LOCUS_09010 gene aroC 3001 4227 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093578.1 protein_id gnl|my_center|LOCUS_09010 4224 4826 gene locus_tag LOCUS_09020 gene aroK 4224 4826 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413021.1 protein_id gnl|my_center|LOCUS_09020 4823 5953 gene locus_tag LOCUS_09030 gene aroB 4823 5953 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224604.1 protein_id gnl|my_center|LOCUS_09030 6494 6006 gene locus_tag LOCUS_09040 6494 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 6493 7695 gene locus_tag LOCUS_09050 6493 7695 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082355.1 protein_id gnl|my_center|LOCUS_09050 7763 8326 gene locus_tag LOCUS_09060 gene efp 7763 8326 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412989.1 protein_id gnl|my_center|LOCUS_09060 8360 8836 gene locus_tag LOCUS_09070 8360 8836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 8945 9562 gene locus_tag LOCUS_09080 gene pyrR 8945 9562 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093570.1 protein_id gnl|my_center|LOCUS_09080 9562 10506 gene locus_tag LOCUS_09090 9562 10506 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894427.1 protein_id gnl|my_center|LOCUS_09090 10503 11801 gene locus_tag LOCUS_09100 10503 11801 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728776.1 protein_id gnl|my_center|LOCUS_09100 11798 12361 gene locus_tag LOCUS_09110 11798 12361 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728777.1 protein_id gnl|my_center|LOCUS_09110 12358 13479 gene locus_tag LOCUS_09120 gene carA 12358 13479 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082345.1 protein_id gnl|my_center|LOCUS_09120 13479 16805 gene locus_tag LOCUS_09130 gene carB 13479 16805 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728779.1 protein_id gnl|my_center|LOCUS_09130 16802 17656 gene locus_tag LOCUS_09140 gene pyrF 16802 17656 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407220.1 protein_id gnl|my_center|LOCUS_09140 17851 18072 gene locus_tag LOCUS_09150 17851 18072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 18047 18364 gene locus_tag LOCUS_09160 gene mihF 18047 18364 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894434.1 protein_id gnl|my_center|LOCUS_09160 18375 18971 gene locus_tag LOCUS_09170 gene gmk 18375 18971 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025239507.1 protein_id gnl|my_center|LOCUS_09170 19069 19389 gene locus_tag LOCUS_09180 gene rpoZ 19069 19389 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728783.1 protein_id gnl|my_center|LOCUS_09180 19423 20679 gene locus_tag LOCUS_09190 gene coaBC 19423 20679 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898859.1 protein_id gnl|my_center|LOCUS_09190 20729 22054 gene locus_tag LOCUS_09200 gene metK 20729 22054 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057696.1 protein_id gnl|my_center|LOCUS_09200 22169 24166 gene locus_tag LOCUS_09210 22169 24166 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296599.1 protein_id gnl|my_center|LOCUS_09210 24281 24895 gene locus_tag LOCUS_09220 gene def 24281 24895 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856004.1 protein_id gnl|my_center|LOCUS_09220 24892 25833 gene locus_tag LOCUS_09230 gene fmt 24892 25833 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728792.1 protein_id gnl|my_center|LOCUS_09230 25830 27209 gene locus_tag LOCUS_09240 25830 27209 CDS product 16S rRNA m5C967 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728793.1 protein_id gnl|my_center|LOCUS_09240 27273 27926 gene locus_tag LOCUS_09250 gene rpe 27273 27926 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898866.1 protein_id gnl|my_center|LOCUS_09250 27936 28958 gene locus_tag LOCUS_09260 gene ribD 27936 28958 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104448.1 protein_id gnl|my_center|LOCUS_09260 29243 29905 gene locus_tag LOCUS_09270 29243 29905 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894458.1 protein_id gnl|my_center|LOCUS_09270 29902 31188 gene locus_tag LOCUS_09280 29902 31188 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057753.1 protein_id gnl|my_center|LOCUS_09280 31185 31670 gene locus_tag LOCUS_09290 gene ribH 31185 31670 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728796.1 protein_id gnl|my_center|LOCUS_09290 31679 32134 gene locus_tag LOCUS_09300 31679 32134 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139538.1 protein_id gnl|my_center|LOCUS_09300 34446 32455 gene locus_tag LOCUS_09310 34446 32455 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296594.1 protein_id gnl|my_center|LOCUS_09310 34575 36632 gene locus_tag LOCUS_09320 gene uvrC 34575 36632 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728800.1 protein_id gnl|my_center|LOCUS_09320 36629 37555 gene locus_tag LOCUS_09330 gene rapZ 36629 37555 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466867.1 protein_id gnl|my_center|LOCUS_09330 37552 38622 gene locus_tag LOCUS_09340 gene yvcK 37552 38622 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057786.1 protein_id gnl|my_center|LOCUS_09340 38741 39724 gene locus_tag LOCUS_09350 gene whiA 38741 39724 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057788.1 protein_id gnl|my_center|LOCUS_09350 39781 40836 gene locus_tag LOCUS_09360 gene gap 39781 40836 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057792.1 protein_id gnl|my_center|LOCUS_09360 40858 42069 gene locus_tag LOCUS_09370 40858 42069 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894473.1 protein_id gnl|my_center|LOCUS_09370 42077 42865 gene locus_tag LOCUS_09380 gene tpiA 42077 42865 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728805.1 protein_id gnl|my_center|LOCUS_09380 42946 43179 gene locus_tag LOCUS_09390 gene secG 42946 43179 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076011.1 protein_id gnl|my_center|LOCUS_09390 43235 46105 gene locus_tag LOCUS_09400 gene ppc 43235 46105 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728811.1 protein_id gnl|my_center|LOCUS_09400 46665 46117 gene locus_tag LOCUS_09410 46665 46117 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731182.1 protein_id gnl|my_center|LOCUS_09410 47465 46674 gene locus_tag LOCUS_09420 gene pgl 47465 46674 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894486.1 protein_id gnl|my_center|LOCUS_09420 47605 47700 gene locus_tag LOCUS_t00130 47605 47700 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 49967 48426 gene locus_tag LOCUS_09430 gene zwf 49967 48426 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082283.1 protein_id gnl|my_center|LOCUS_09430 51091 49973 gene locus_tag LOCUS_09440 gene tal 51091 49973 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728814.1 protein_id gnl|my_center|LOCUS_09440 53205 51097 gene locus_tag LOCUS_09450 gene tkt 53205 51097 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087835.1 protein_id gnl|my_center|LOCUS_09450 53495 54481 gene locus_tag LOCUS_09460 53495 54481 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894492.1 protein_id gnl|my_center|LOCUS_09460 55475 54510 gene locus_tag LOCUS_09470 55475 54510 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877580.1 protein_id gnl|my_center|LOCUS_09470 55555 55911 gene locus_tag LOCUS_09480 55555 55911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 56932 55919 gene locus_tag LOCUS_09490 56932 55919 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728826.1 protein_id gnl|my_center|LOCUS_09490 57833 57024 gene locus_tag LOCUS_09500 57833 57024 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728827.1 protein_id gnl|my_center|LOCUS_09500 58813 57830 gene locus_tag LOCUS_09510 58813 57830 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728828.1 protein_id gnl|my_center|LOCUS_09510 60803 58884 gene locus_tag LOCUS_09520 gene mptB 60803 58884 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111288.1 protein_id gnl|my_center|LOCUS_09520 60953 61795 gene locus_tag LOCUS_09530 gene sufR 60953 61795 CDS product suf operon transcriptional regulator SufR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407481.1 protein_id gnl|my_center|LOCUS_09530 61792 63237 gene locus_tag LOCUS_09540 gene sufB 61792 63237 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894509.1 protein_id gnl|my_center|LOCUS_09540 63234 64445 gene locus_tag LOCUS_09550 gene sufD 63234 64445 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407487.1 protein_id gnl|my_center|LOCUS_09550 64522 65295 gene locus_tag LOCUS_09560 gene sufC 64522 65295 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057836.1 protein_id gnl|my_center|LOCUS_09560 65327 66622 gene locus_tag LOCUS_09570 65327 66622 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111284.1 protein_id gnl|my_center|LOCUS_09570 66625 67080 gene locus_tag LOCUS_09580 66625 67080 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894513.1 protein_id gnl|my_center|LOCUS_09580 67082 67435 gene locus_tag LOCUS_09590 67082 67435 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407492.1 protein_id gnl|my_center|LOCUS_09590 67632 68003 gene locus_tag LOCUS_09600 67632 68003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 68052 68777 gene locus_tag LOCUS_09610 68052 68777 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113039.1 protein_id gnl|my_center|LOCUS_09610 68771 69286 gene locus_tag LOCUS_09620 68771 69286 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028328.1 protein_id gnl|my_center|LOCUS_09620 70432 69287 gene locus_tag LOCUS_09630 70432 69287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 71153 70425 gene locus_tag LOCUS_09640 71153 70425 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224989.1 protein_id gnl|my_center|LOCUS_09640 71324 72955 gene locus_tag LOCUS_09650 71324 72955 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894527.1 protein_id gnl|my_center|LOCUS_09650 74602 73079 gene locus_tag LOCUS_09660 74602 73079 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094018.1 protein_id gnl|my_center|LOCUS_09660 74990 74718 gene locus_tag LOCUS_09670 74990 74718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 75738 75004 gene locus_tag LOCUS_09680 75738 75004 CDS product aminoglycoside 3'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084097.1 protein_id gnl|my_center|LOCUS_09680 76384 75743 gene locus_tag LOCUS_09690 76384 75743 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075960.1 protein_id gnl|my_center|LOCUS_09690 79265 76446 gene locus_tag LOCUS_09700 79265 76446 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728843.1 protein_id gnl|my_center|LOCUS_09700 79565 80182 gene locus_tag LOCUS_09710 79565 80182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 80637 82133 gene locus_tag LOCUS_09720 80637 82133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 82233 83486 gene locus_tag LOCUS_09730 82233 83486 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024571137.1 protein_id gnl|my_center|LOCUS_09730 83473 84414 gene locus_tag LOCUS_09740 83473 84414 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057859.1 protein_id gnl|my_center|LOCUS_09740 84416 85390 gene locus_tag LOCUS_09750 84416 85390 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877593.1 protein_id gnl|my_center|LOCUS_09750 85449 86240 gene locus_tag LOCUS_09760 gene fabG1 85449 86240 CDS product 3-oxoacyl-ACP reductase FabG1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057861.1 protein_id gnl|my_center|LOCUS_09760 86302 87138 gene locus_tag LOCUS_09770 gene inhA 86302 87138 CDS product NADH-dependent enoyl-ACP reductase InhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087822.1 protein_id gnl|my_center|LOCUS_09770 87135 88214 gene locus_tag LOCUS_09780 87135 88214 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226767.1 protein_id gnl|my_center|LOCUS_09780 89065 88241 gene locus_tag LOCUS_09790 89065 88241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082254.1 protein_id gnl|my_center|LOCUS_09790 88959 89171 gene locus_tag LOCUS_09800 88959 89171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 89182 90018 gene locus_tag LOCUS_09810 89182 90018 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014432.1 protein_id gnl|my_center|LOCUS_09810 90092 90517 gene locus_tag LOCUS_09820 90092 90517 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407562.1 protein_id gnl|my_center|LOCUS_09820 90525 91727 gene locus_tag LOCUS_09830 90525 91727 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407571.1 protein_id gnl|my_center|LOCUS_09830 92201 91722 gene locus_tag LOCUS_09840 92201 91722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 92980 92384 gene locus_tag LOCUS_09850 92980 92384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 93576 92977 gene locus_tag LOCUS_09860 93576 92977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014430.1 protein_id gnl|my_center|LOCUS_09860 94306 93623 gene locus_tag LOCUS_09870 94306 93623 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856111.1 protein_id gnl|my_center|LOCUS_09870 94556 96454 gene locus_tag LOCUS_09880 gene mutA 94556 96454 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111265.1 protein_id gnl|my_center|LOCUS_09880 96451 98772 gene locus_tag LOCUS_09890 gene scpA 96451 98772 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728858.1 protein_id gnl|my_center|LOCUS_09890 98801 99793 gene locus_tag LOCUS_09900 gene meaB 98801 99793 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005102543.1 protein_id gnl|my_center|LOCUS_09900 99971 100876 gene locus_tag LOCUS_09910 99971 100876 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104253.1 protein_id gnl|my_center|LOCUS_09910 100869 101198 gene locus_tag LOCUS_09920 100869 101198 CDS product MSMEG_0570 family nitrogen starvation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891991.1 protein_id gnl|my_center|LOCUS_09920 101195 102511 gene locus_tag LOCUS_09930 101195 102511 CDS product MSMEG_0569 family flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891990.1 protein_id gnl|my_center|LOCUS_09930 102563 104032 gene locus_tag LOCUS_09940 102563 104032 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079233.1 protein_id gnl|my_center|LOCUS_09940 104178 104702 gene locus_tag LOCUS_09950 104178 104702 CDS product MSMEG_0572 family nitrogen starvation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891993.1 protein_id gnl|my_center|LOCUS_09950 104712 105767 gene locus_tag LOCUS_09960 104712 105767 CDS product MSMEG_0568 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876804.1 protein_id gnl|my_center|LOCUS_09960 105769 107223 gene locus_tag LOCUS_09970 105769 107223 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891988.1 protein_id gnl|my_center|LOCUS_09970 107249 108148 gene locus_tag LOCUS_09980 107249 108148 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727037.1 protein_id gnl|my_center|LOCUS_09980 108160 109296 gene locus_tag LOCUS_09990 108160 109296 CDS product MSMEG_0565 family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876802.1 protein_id gnl|my_center|LOCUS_09990 110312 109284 gene locus_tag LOCUS_10000 110312 109284 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094425.1 protein_id gnl|my_center|LOCUS_10000 110810 110322 gene locus_tag LOCUS_10010 110810 110322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 112162 110804 gene locus_tag LOCUS_10020 112162 110804 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977903.1 protein_id gnl|my_center|LOCUS_10020 112304 112855 gene locus_tag LOCUS_10030 112304 112855 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977146.1 protein_id gnl|my_center|LOCUS_10030 112964 112878 gene locus_tag LOCUS_t00140 112964 112878 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 113079 114458 gene locus_tag LOCUS_10040 113079 114458 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115891.1 protein_id gnl|my_center|LOCUS_10040 114553 115095 gene locus_tag LOCUS_10050 114553 115095 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895586.1 protein_id gnl|my_center|LOCUS_10050 116250 115135 gene locus_tag LOCUS_10060 116250 115135 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411116.1 protein_id gnl|my_center|LOCUS_10060 116501 116247 gene locus_tag LOCUS_10070 116501 116247 CDS product DUF5703 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061122.1 protein_id gnl|my_center|LOCUS_10070 117618 116557 gene locus_tag LOCUS_10080 117618 116557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296513.1 protein_id gnl|my_center|LOCUS_10080 117690 118532 gene locus_tag LOCUS_10090 117690 118532 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729632.1 protein_id gnl|my_center|LOCUS_10090 118649 119317 gene locus_tag LOCUS_10100 118649 119317 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086562.1 protein_id gnl|my_center|LOCUS_10100 >Feature sequence07 427 720 gene locus_tag LOCUS_10110 427 720 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776001.1 protein_id gnl|my_center|LOCUS_10110 750 965 gene locus_tag LOCUS_10120 750 965 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228663.1 protein_id gnl|my_center|LOCUS_10120 962 3307 gene locus_tag LOCUS_10130 962 3307 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730259.1 protein_id gnl|my_center|LOCUS_10130 4629 3475 gene locus_tag LOCUS_10140 4629 3475 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_10140 5653 5081 gene locus_tag LOCUS_10150 5653 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084303.1 protein_id gnl|my_center|LOCUS_10150 6390 5650 gene locus_tag LOCUS_10160 6390 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 6773 6387 gene locus_tag LOCUS_10170 6773 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 6948 6766 gene locus_tag LOCUS_10180 6948 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 7372 7037 gene locus_tag LOCUS_10190 7372 7037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 7724 7359 gene locus_tag LOCUS_10200 7724 7359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 8203 7721 gene locus_tag LOCUS_10210 8203 7721 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074067.1 protein_id gnl|my_center|LOCUS_10210 8408 9235 gene locus_tag LOCUS_10220 8408 9235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 9217 9687 gene locus_tag LOCUS_10230 9217 9687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 9764 11218 gene locus_tag LOCUS_10240 9764 11218 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409207.1 protein_id gnl|my_center|LOCUS_10240 12101 11424 gene locus_tag LOCUS_10250 gene mpt83 12101 11424 CDS product cell surface glycolipoprotein Mpt83 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414630.1 protein_id gnl|my_center|LOCUS_10250 12392 13918 gene locus_tag LOCUS_10260 12392 13918 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112402.1 protein_id gnl|my_center|LOCUS_10260 13951 14526 gene locus_tag LOCUS_10270 gene sigK 13951 14526 CDS product sigma-70 family RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402246.1 protein_id gnl|my_center|LOCUS_10270 14516 15391 gene locus_tag LOCUS_10280 gene rskA 14516 15391 CDS product anti-sigma-K factor RskA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898455.1 protein_id gnl|my_center|LOCUS_10280 15622 16704 gene locus_tag LOCUS_10290 15622 16704 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063775.1 protein_id gnl|my_center|LOCUS_10290 16704 17009 gene locus_tag LOCUS_10300 16704 17009 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891483.1 protein_id gnl|my_center|LOCUS_10300 17006 18532 gene locus_tag LOCUS_10310 17006 18532 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071687.1 protein_id gnl|my_center|LOCUS_10310 18984 18589 gene locus_tag LOCUS_10320 18984 18589 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029511.1 protein_id gnl|my_center|LOCUS_10320 19114 19542 gene locus_tag LOCUS_10330 19114 19542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 19691 21076 gene locus_tag LOCUS_10340 19691 21076 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641832.1 protein_id gnl|my_center|LOCUS_10340 21865 21080 gene locus_tag LOCUS_10350 21865 21080 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899260.1 protein_id gnl|my_center|LOCUS_10350 22619 21867 gene locus_tag LOCUS_10360 22619 21867 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224031.1 protein_id gnl|my_center|LOCUS_10360 25006 22622 gene locus_tag LOCUS_10370 25006 22622 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898655.1 protein_id gnl|my_center|LOCUS_10370 25090 27249 gene locus_tag LOCUS_10380 25090 27249 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229633.1 protein_id gnl|my_center|LOCUS_10380 27286 27696 gene locus_tag LOCUS_10390 27286 27696 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026896.1 protein_id gnl|my_center|LOCUS_10390 27747 28016 gene locus_tag LOCUS_10400 27747 28016 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878317.1 protein_id gnl|my_center|LOCUS_10400 28105 28662 gene locus_tag LOCUS_10410 28105 28662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 31147 28688 gene locus_tag LOCUS_10420 31147 28688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 31404 31643 gene locus_tag LOCUS_10430 31404 31643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 32141 31659 gene locus_tag LOCUS_10440 32141 31659 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859290.1 protein_id gnl|my_center|LOCUS_10440 32908 32177 gene locus_tag LOCUS_10450 32908 32177 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893323.1 protein_id gnl|my_center|LOCUS_10450 33213 33776 gene locus_tag LOCUS_10460 33213 33776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 34831 33860 gene locus_tag LOCUS_10470 34831 33860 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530315.1 protein_id gnl|my_center|LOCUS_10470 35018 35317 gene locus_tag LOCUS_10480 35018 35317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 35319 36278 gene locus_tag LOCUS_10490 35319 36278 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227736.1 protein_id gnl|my_center|LOCUS_10490 36275 36835 gene locus_tag LOCUS_10500 36275 36835 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227735.1 protein_id gnl|my_center|LOCUS_10500 36832 38061 gene locus_tag LOCUS_10510 36832 38061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 38058 38306 gene locus_tag LOCUS_10520 38058 38306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 38358 39305 gene locus_tag LOCUS_10530 38358 39305 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066336.1 protein_id gnl|my_center|LOCUS_10530 40203 39370 gene locus_tag LOCUS_10540 40203 39370 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968672.1 protein_id gnl|my_center|LOCUS_10540 41807 40200 gene locus_tag LOCUS_10550 41807 40200 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222688.1 protein_id gnl|my_center|LOCUS_10550 42509 41874 gene locus_tag LOCUS_10560 42509 41874 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009941085.1 protein_id gnl|my_center|LOCUS_10560 43555 42512 gene locus_tag LOCUS_10570 43555 42512 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080429.1 protein_id gnl|my_center|LOCUS_10570 43620 44408 gene locus_tag LOCUS_10580 43620 44408 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742161.1 protein_id gnl|my_center|LOCUS_10580 45435 44422 gene locus_tag LOCUS_10590 45435 44422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 45651 48467 gene locus_tag LOCUS_10600 45651 48467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 48583 50103 gene locus_tag LOCUS_10610 48583 50103 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728107.1 protein_id gnl|my_center|LOCUS_10610 50245 51603 gene locus_tag LOCUS_10620 gene tet(V) 50245 51603 CDS product tetracycline efflux MFS transporter Tet(V) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896589.1 protein_id gnl|my_center|LOCUS_10620 52446 51541 gene locus_tag LOCUS_10630 52446 51541 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971834.1 protein_id gnl|my_center|LOCUS_10630 52517 53140 gene locus_tag LOCUS_10640 52517 53140 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226074.1 protein_id gnl|my_center|LOCUS_10640 54383 53145 gene locus_tag LOCUS_10650 54383 53145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 54673 55587 gene locus_tag LOCUS_10660 54673 55587 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327302.1 protein_id gnl|my_center|LOCUS_10660 55584 56363 gene locus_tag LOCUS_10670 55584 56363 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973545.1 protein_id gnl|my_center|LOCUS_10670 56372 57595 gene locus_tag LOCUS_10680 56372 57595 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870027.1 protein_id gnl|my_center|LOCUS_10680 57592 58206 gene locus_tag LOCUS_10690 57592 58206 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030258.1 protein_id gnl|my_center|LOCUS_10690 58900 58247 gene locus_tag LOCUS_10700 58900 58247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 58954 59556 gene locus_tag LOCUS_10710 58954 59556 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975821.1 protein_id gnl|my_center|LOCUS_10710 59553 60881 gene locus_tag LOCUS_10720 59553 60881 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992331.1 protein_id gnl|my_center|LOCUS_10720 60948 61352 gene locus_tag LOCUS_10730 60948 61352 CDS product PLDc N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230088.1 protein_id gnl|my_center|LOCUS_10730 61891 61373 gene locus_tag LOCUS_10740 61891 61373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225541.1 protein_id gnl|my_center|LOCUS_10740 62771 61899 gene locus_tag LOCUS_10750 62771 61899 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679981.1 protein_id gnl|my_center|LOCUS_10750 62855 63316 gene locus_tag LOCUS_10760 62855 63316 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115085.1 protein_id gnl|my_center|LOCUS_10760 64303 63416 gene locus_tag LOCUS_10770 64303 63416 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_10770 65606 64371 gene locus_tag LOCUS_10780 65606 64371 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728306.1 protein_id gnl|my_center|LOCUS_10780 66988 65603 gene locus_tag LOCUS_10790 66988 65603 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728306.1 protein_id gnl|my_center|LOCUS_10790 66899 67426 gene locus_tag LOCUS_10800 66899 67426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 67443 68264 gene locus_tag LOCUS_10810 67443 68264 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111593.1 protein_id gnl|my_center|LOCUS_10810 68931 68281 gene locus_tag LOCUS_10820 68931 68281 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227178.1 protein_id gnl|my_center|LOCUS_10820 69034 70173 gene locus_tag LOCUS_10830 69034 70173 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227175.1 protein_id gnl|my_center|LOCUS_10830 70170 71111 gene locus_tag LOCUS_10840 70170 71111 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227174.1 protein_id gnl|my_center|LOCUS_10840 71108 72703 gene locus_tag LOCUS_10850 71108 72703 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467246.1 protein_id gnl|my_center|LOCUS_10850 72700 73899 gene locus_tag LOCUS_10860 72700 73899 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466839.1 protein_id gnl|my_center|LOCUS_10860 74483 73881 gene locus_tag LOCUS_10870 74483 73881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 74603 75550 gene locus_tag LOCUS_10880 74603 75550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10880 75633 76319 gene locus_tag LOCUS_10890 75633 76319 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226549.1 protein_id gnl|my_center|LOCUS_10890 76258 77895 gene locus_tag LOCUS_10900 76258 77895 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727643.1 protein_id gnl|my_center|LOCUS_10900 78780 77902 gene locus_tag LOCUS_10910 78780 77902 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404819.1 protein_id gnl|my_center|LOCUS_10910 79799 78918 gene locus_tag LOCUS_10920 79799 78918 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731236.1 protein_id gnl|my_center|LOCUS_10920 80659 79817 gene locus_tag LOCUS_10930 80659 79817 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731235.1 protein_id gnl|my_center|LOCUS_10930 81533 80670 gene locus_tag LOCUS_10940 81533 80670 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857646.1 protein_id gnl|my_center|LOCUS_10940 82125 81583 gene locus_tag LOCUS_10950 82125 81583 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731234.1 protein_id gnl|my_center|LOCUS_10950 82250 83425 gene locus_tag LOCUS_10960 82250 83425 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063039.1 protein_id gnl|my_center|LOCUS_10960 84445 83468 gene locus_tag LOCUS_10970 84445 83468 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222193.1 protein_id gnl|my_center|LOCUS_10970 84646 85218 gene locus_tag LOCUS_10980 84646 85218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 86214 85252 gene locus_tag LOCUS_10990 86214 85252 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058149.1 protein_id gnl|my_center|LOCUS_10990 86299 86387 gene locus_tag LOCUS_t00150 86299 86387 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 86968 86477 gene locus_tag LOCUS_11000 86968 86477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 88040 86961 gene locus_tag LOCUS_11010 88040 86961 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064197.1 protein_id gnl|my_center|LOCUS_11010 89002 88094 gene locus_tag LOCUS_11020 89002 88094 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223554.1 protein_id gnl|my_center|LOCUS_11020 90093 89215 gene locus_tag LOCUS_11030 90093 89215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 90856 90143 gene locus_tag LOCUS_11040 90856 90143 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730369.1 protein_id gnl|my_center|LOCUS_11040 92021 90861 gene locus_tag LOCUS_11050 92021 90861 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730370.1 protein_id gnl|my_center|LOCUS_11050 93182 92118 gene locus_tag LOCUS_11060 93182 92118 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891444.1 protein_id gnl|my_center|LOCUS_11060 94285 93191 gene locus_tag LOCUS_11070 94285 93191 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256645.1 protein_id gnl|my_center|LOCUS_11070 94410 95720 gene locus_tag LOCUS_11080 94410 95720 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_11080 95798 96871 gene locus_tag LOCUS_11090 95798 96871 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406347.1 protein_id gnl|my_center|LOCUS_11090 96868 98118 gene locus_tag LOCUS_11100 96868 98118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 99638 98274 gene locus_tag LOCUS_11110 99638 98274 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093306.1 protein_id gnl|my_center|LOCUS_11110 100205 99771 gene locus_tag LOCUS_11120 100205 99771 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412703.1 protein_id gnl|my_center|LOCUS_11120 100386 101402 gene locus_tag LOCUS_11130 100386 101402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 101910 101419 gene locus_tag LOCUS_11140 101910 101419 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225564.1 protein_id gnl|my_center|LOCUS_11140 102030 102980 gene locus_tag LOCUS_11150 102030 102980 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225335.1 protein_id gnl|my_center|LOCUS_11150 103195 102986 gene locus_tag LOCUS_11160 103195 102986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 104336 103254 gene locus_tag LOCUS_11170 gene hisC 104336 103254 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112910.1 protein_id gnl|my_center|LOCUS_11170 104438 104529 gene locus_tag LOCUS_t00160 104438 104529 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 104576 104649 gene locus_tag LOCUS_t00170 104576 104649 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 105889 104663 gene locus_tag LOCUS_11180 105889 104663 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112911.1 protein_id gnl|my_center|LOCUS_11180 106515 105889 gene locus_tag LOCUS_11190 106515 105889 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115701.1 protein_id gnl|my_center|LOCUS_11190 106570 106770 gene locus_tag LOCUS_11200 106570 106770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 106798 106962 gene locus_tag LOCUS_11210 106798 106962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 106965 107315 gene locus_tag LOCUS_11220 106965 107315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 107312 107620 gene locus_tag LOCUS_11230 107312 107620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 107617 107991 gene locus_tag LOCUS_11240 107617 107991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 108230 108415 gene locus_tag LOCUS_11250 108230 108415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 108412 108687 gene locus_tag LOCUS_11260 108412 108687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 108684 110228 gene locus_tag LOCUS_11270 108684 110228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 110225 110635 gene locus_tag LOCUS_11280 110225 110635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 110632 110790 gene locus_tag LOCUS_11290 110632 110790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 110790 111119 gene locus_tag LOCUS_11300 110790 111119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 111109 111531 gene locus_tag LOCUS_11310 111109 111531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 111551 116002 gene locus_tag LOCUS_11320 111551 116002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 116038 116607 gene locus_tag LOCUS_11330 116038 116607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 116613 116867 gene locus_tag LOCUS_11340 116613 116867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 116925 117227 gene locus_tag LOCUS_11350 116925 117227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 117500 117258 gene locus_tag LOCUS_11360 117500 117258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 117573 118115 gene locus_tag LOCUS_11370 117573 118115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 118648 118130 gene locus_tag LOCUS_11380 118648 118130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 >Feature sequence08 835 122 gene locus_tag LOCUS_11390 835 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 911 1903 gene locus_tag LOCUS_11400 911 1903 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_11400 2344 1925 gene locus_tag LOCUS_11410 2344 1925 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894385.1 protein_id gnl|my_center|LOCUS_11410 2430 3740 gene locus_tag LOCUS_11420 2430 3740 CDS product pyrimidine permease RutG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729472.1 protein_id gnl|my_center|LOCUS_11420 3842 4417 gene locus_tag LOCUS_11430 3842 4417 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188522900.1 protein_id gnl|my_center|LOCUS_11430 4954 4427 gene locus_tag LOCUS_11440 4954 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 6663 4951 gene locus_tag LOCUS_11450 6663 4951 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731247.1 protein_id gnl|my_center|LOCUS_11450 6978 6670 gene locus_tag LOCUS_11460 6978 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 8185 7112 gene locus_tag LOCUS_11470 8185 7112 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726928.1 protein_id gnl|my_center|LOCUS_11470 8444 8980 gene locus_tag LOCUS_11480 8444 8980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 8983 9549 gene locus_tag LOCUS_11490 8983 9549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 9546 10121 gene locus_tag LOCUS_11500 9546 10121 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320930.1 protein_id gnl|my_center|LOCUS_11500 10118 10690 gene locus_tag LOCUS_11510 10118 10690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 10692 12200 gene locus_tag LOCUS_11520 10692 12200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 12291 13037 gene locus_tag LOCUS_11530 12291 13037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 13040 13471 gene locus_tag LOCUS_11540 13040 13471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 13572 13847 gene locus_tag LOCUS_11550 13572 13847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 13856 14605 gene locus_tag LOCUS_11560 13856 14605 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081153.1 protein_id gnl|my_center|LOCUS_11560 14660 15301 gene locus_tag LOCUS_11570 14660 15301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 15811 15311 gene locus_tag LOCUS_11580 15811 15311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 15864 16157 gene locus_tag LOCUS_11590 15864 16157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 16261 17502 gene locus_tag LOCUS_11600 16261 17502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095944.1 protein_id gnl|my_center|LOCUS_11600 17499 18071 gene locus_tag LOCUS_11610 17499 18071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 18065 18406 gene locus_tag LOCUS_11620 18065 18406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 18569 19012 gene locus_tag LOCUS_11630 18569 19012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 19661 19023 gene locus_tag LOCUS_11640 19661 19023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 20272 20904 gene locus_tag LOCUS_11650 20272 20904 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_11650 21112 21450 gene locus_tag LOCUS_11660 21112 21450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 22579 21512 gene locus_tag LOCUS_11670 22579 21512 CDS product HNH endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727557.1 protein_id gnl|my_center|LOCUS_11670 23883 22576 gene locus_tag LOCUS_11680 23883 22576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727545.1 protein_id gnl|my_center|LOCUS_11680 24192 24998 gene locus_tag LOCUS_11690 24192 24998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 25888 25028 gene locus_tag LOCUS_11700 25888 25028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 27885 25969 gene locus_tag LOCUS_11710 27885 25969 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031049.1 protein_id gnl|my_center|LOCUS_11710 28135 28392 gene locus_tag LOCUS_11720 28135 28392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 28703 28326 gene locus_tag LOCUS_11730 gene queD 28703 28326 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268282.1 protein_id gnl|my_center|LOCUS_11730 29335 28700 gene locus_tag LOCUS_11740 gene queE 29335 28700 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920995.1 protein_id gnl|my_center|LOCUS_11740 30030 29332 gene locus_tag LOCUS_11750 gene queC 30030 29332 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_11750 30129 31019 gene locus_tag LOCUS_11760 30129 31019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 31016 32158 gene locus_tag LOCUS_11770 31016 32158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 32155 33408 gene locus_tag LOCUS_11780 32155 33408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 33392 34507 gene locus_tag LOCUS_11790 33392 34507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 36201 34705 gene locus_tag LOCUS_11800 36201 34705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 37193 36672 gene locus_tag LOCUS_11810 37193 36672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 41581 37190 gene locus_tag LOCUS_11820 41581 37190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 42261 41578 gene locus_tag LOCUS_11830 42261 41578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 45263 42258 gene locus_tag LOCUS_11840 45263 42258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 46141 45260 gene locus_tag LOCUS_11850 46141 45260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 48713 46143 gene locus_tag LOCUS_11860 48713 46143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 51930 48706 gene locus_tag LOCUS_11870 51930 48706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 52520 52894 gene locus_tag LOCUS_11880 52520 52894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11880 52957 53256 gene locus_tag LOCUS_11890 52957 53256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11890 53610 53239 gene locus_tag LOCUS_11900 53610 53239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 54151 53600 gene locus_tag LOCUS_11910 54151 53600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 54431 54667 gene locus_tag LOCUS_11920 54431 54667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 55246 54758 gene locus_tag LOCUS_11930 55246 54758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 55356 55706 gene locus_tag LOCUS_11940 55356 55706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 55715 56233 gene locus_tag LOCUS_11950 55715 56233 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401859.1 protein_id gnl|my_center|LOCUS_11950 56930 56358 gene locus_tag LOCUS_11960 56930 56358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 58243 56942 gene locus_tag LOCUS_11970 58243 56942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 58545 58240 gene locus_tag LOCUS_11980 58545 58240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 59018 58542 gene locus_tag LOCUS_11990 59018 58542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 59231 59716 gene locus_tag LOCUS_12000 gene msrB 59231 59716 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729815.1 protein_id gnl|my_center|LOCUS_12000 59713 60258 gene locus_tag LOCUS_12010 gene msrA 59713 60258 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897888.1 protein_id gnl|my_center|LOCUS_12010 60448 60972 gene locus_tag LOCUS_12020 60448 60972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 61100 61459 gene locus_tag LOCUS_12030 61100 61459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 63130 61535 gene locus_tag LOCUS_12040 63130 61535 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285120.1 protein_id gnl|my_center|LOCUS_12040 64282 63245 gene locus_tag LOCUS_12050 64282 63245 CDS product aliphatic amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113129.1 protein_id gnl|my_center|LOCUS_12050 64445 65515 gene locus_tag LOCUS_12060 64445 65515 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113130.1 protein_id gnl|my_center|LOCUS_12060 66679 65585 gene locus_tag LOCUS_12070 66679 65585 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113293.1 protein_id gnl|my_center|LOCUS_12070 67403 66783 gene locus_tag LOCUS_12080 67403 66783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 68976 67411 gene locus_tag LOCUS_12090 68976 67411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 69969 69268 gene locus_tag LOCUS_12100 69969 69268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 71510 69966 gene locus_tag LOCUS_12110 71510 69966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 71746 71510 gene locus_tag LOCUS_12120 71746 71510 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727968.1 protein_id gnl|my_center|LOCUS_12120 72123 71800 gene locus_tag LOCUS_12130 72123 71800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 72235 72609 gene locus_tag LOCUS_12140 72235 72609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 72794 72618 gene locus_tag LOCUS_12150 72794 72618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 73976 73038 gene locus_tag LOCUS_12160 73976 73038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 74055 74690 gene locus_tag LOCUS_12170 74055 74690 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729926.1 protein_id gnl|my_center|LOCUS_12170 75487 74696 gene locus_tag LOCUS_12180 75487 74696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 75595 76374 gene locus_tag LOCUS_12190 75595 76374 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104317.1 protein_id gnl|my_center|LOCUS_12190 76371 77048 gene locus_tag LOCUS_12200 76371 77048 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028987.1 protein_id gnl|my_center|LOCUS_12200 78211 77045 gene locus_tag LOCUS_12210 78211 77045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 79484 78288 gene locus_tag LOCUS_12220 79484 78288 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162234465.1 protein_id gnl|my_center|LOCUS_12220 79592 80065 gene locus_tag LOCUS_12230 79592 80065 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974469.1 protein_id gnl|my_center|LOCUS_12230 80511 80077 gene locus_tag LOCUS_12240 80511 80077 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977923.1 protein_id gnl|my_center|LOCUS_12240 81844 80528 gene locus_tag LOCUS_12250 81844 80528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12250 81946 82416 gene locus_tag LOCUS_12260 81946 82416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 84466 82511 gene locus_tag LOCUS_12270 84466 82511 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113349.1 protein_id gnl|my_center|LOCUS_12270 85716 84463 gene locus_tag LOCUS_12280 85716 84463 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092724.1 protein_id gnl|my_center|LOCUS_12280 86298 86026 gene locus_tag LOCUS_12290 86298 86026 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230904.1 protein_id gnl|my_center|LOCUS_12290 86595 87554 gene locus_tag LOCUS_12300 86595 87554 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729157.1 protein_id gnl|my_center|LOCUS_12300 88030 87542 gene locus_tag LOCUS_12310 88030 87542 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888560.1 protein_id gnl|my_center|LOCUS_12310 88078 89394 gene locus_tag LOCUS_12320 88078 89394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 89611 89402 gene locus_tag LOCUS_12330 89611 89402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 89809 91290 gene locus_tag LOCUS_12340 89809 91290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 92821 91313 gene locus_tag LOCUS_12350 92821 91313 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742166.1 protein_id gnl|my_center|LOCUS_12350 93560 92922 gene locus_tag LOCUS_12360 93560 92922 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727552.1 protein_id gnl|my_center|LOCUS_12360 93926 93609 gene locus_tag LOCUS_12370 93926 93609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 93832 94584 gene locus_tag LOCUS_12380 93832 94584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12380 94581 95102 gene locus_tag LOCUS_12390 94581 95102 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776976.1 protein_id gnl|my_center|LOCUS_12390 95168 96427 gene locus_tag LOCUS_12400 95168 96427 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877706.1 protein_id gnl|my_center|LOCUS_12400 98859 96418 gene locus_tag LOCUS_12410 98859 96418 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742800.1 protein_id gnl|my_center|LOCUS_12410 99221 102526 gene locus_tag LOCUS_12420 gene lysX 99221 102526 CDS product bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223114.1 protein_id gnl|my_center|LOCUS_12420 102622 103284 gene locus_tag LOCUS_12430 102622 103284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 103281 104588 gene locus_tag LOCUS_12440 103281 104588 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224815.1 protein_id gnl|my_center|LOCUS_12440 104634 105425 gene locus_tag LOCUS_12450 104634 105425 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402248.1 protein_id gnl|my_center|LOCUS_12450 105550 107295 gene locus_tag LOCUS_12460 105550 107295 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110463.1 protein_id gnl|my_center|LOCUS_12460 107366 109585 gene locus_tag LOCUS_12470 107366 109585 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715412.1 protein_id gnl|my_center|LOCUS_12470 110577 109612 gene locus_tag LOCUS_12480 110577 109612 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033434014.1 protein_id gnl|my_center|LOCUS_12480 111905 110679 gene locus_tag LOCUS_12490 111905 110679 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228781.1 protein_id gnl|my_center|LOCUS_12490 112128 112781 gene locus_tag LOCUS_12500 112128 112781 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035335.1 protein_id gnl|my_center|LOCUS_12500 113970 112786 gene locus_tag LOCUS_12510 113970 112786 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894393.1 protein_id gnl|my_center|LOCUS_12510 114109 115251 gene locus_tag LOCUS_12520 114109 115251 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404705.1 protein_id gnl|my_center|LOCUS_12520 115396 115575 gene locus_tag LOCUS_12530 115396 115575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 115686 116984 gene locus_tag LOCUS_12540 115686 116984 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005122091.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence09 387 127 gene locus_tag LOCUS_12550 387 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 527 985 gene locus_tag LOCUS_12560 527 985 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027915.1 protein_id gnl|my_center|LOCUS_12560 1808 975 gene locus_tag LOCUS_12570 1808 975 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026945.1 protein_id gnl|my_center|LOCUS_12570 1950 2696 gene locus_tag LOCUS_12580 1950 2696 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225424.1 protein_id gnl|my_center|LOCUS_12580 2705 3727 gene locus_tag LOCUS_12590 2705 3727 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110924.1 protein_id gnl|my_center|LOCUS_12590 4372 3692 gene locus_tag LOCUS_12600 4372 3692 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225231.1 protein_id gnl|my_center|LOCUS_12600 4488 5840 gene locus_tag LOCUS_12610 4488 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 7312 5870 gene locus_tag LOCUS_12620 7312 5870 CDS product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401257.1 protein_id gnl|my_center|LOCUS_12620 8408 7911 gene locus_tag LOCUS_12630 8408 7911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 12860 8529 gene locus_tag LOCUS_12640 12860 8529 CDS product alpha-(1->3)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726878.1 protein_id gnl|my_center|LOCUS_12640 13083 12874 gene locus_tag LOCUS_12650 13083 12874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 13599 13099 gene locus_tag LOCUS_12660 13599 13099 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015437.1 protein_id gnl|my_center|LOCUS_12660 14043 13678 gene locus_tag LOCUS_12670 14043 13678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 13928 14923 gene locus_tag LOCUS_12680 gene lpqI 13928 14923 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401295.1 protein_id gnl|my_center|LOCUS_12680 15171 14980 gene locus_tag LOCUS_12690 15171 14980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 15278 15886 gene locus_tag LOCUS_12700 15278 15886 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140673.1 protein_id gnl|my_center|LOCUS_12700 15936 16568 gene locus_tag LOCUS_12710 15936 16568 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876752.1 protein_id gnl|my_center|LOCUS_12710 17406 16576 gene locus_tag LOCUS_12720 17406 16576 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878395.1 protein_id gnl|my_center|LOCUS_12720 18396 17458 gene locus_tag LOCUS_12730 18396 17458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 20512 18407 gene locus_tag LOCUS_12740 20512 18407 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876865.1 protein_id gnl|my_center|LOCUS_12740 20586 21095 gene locus_tag LOCUS_12750 20586 21095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 23614 21092 gene locus_tag LOCUS_12760 23614 21092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 23874 24692 gene locus_tag LOCUS_12770 23874 24692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 24692 25396 gene locus_tag LOCUS_12780 24692 25396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 25393 27132 gene locus_tag LOCUS_12790 25393 27132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 28061 27144 gene locus_tag LOCUS_12800 28061 27144 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227567.1 protein_id gnl|my_center|LOCUS_12800 28834 28202 gene locus_tag LOCUS_12810 28834 28202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 29900 29022 gene locus_tag LOCUS_12820 29900 29022 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112405.1 protein_id gnl|my_center|LOCUS_12820 31257 29902 gene locus_tag LOCUS_12830 31257 29902 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726889.1 protein_id gnl|my_center|LOCUS_12830 31395 32711 gene locus_tag LOCUS_12840 31395 32711 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726890.1 protein_id gnl|my_center|LOCUS_12840 32902 33780 gene locus_tag LOCUS_12850 32902 33780 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726607.1 protein_id gnl|my_center|LOCUS_12850 33787 34845 gene locus_tag LOCUS_12860 33787 34845 CDS product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891337.1 protein_id gnl|my_center|LOCUS_12860 34842 35948 gene locus_tag LOCUS_12870 gene fepG 34842 35948 CDS product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817186.1 protein_id gnl|my_center|LOCUS_12870 35945 36742 gene locus_tag LOCUS_12880 35945 36742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726608.1 protein_id gnl|my_center|LOCUS_12880 36853 38601 gene locus_tag LOCUS_12890 36853 38601 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891342.1 protein_id gnl|my_center|LOCUS_12890 38598 40394 gene locus_tag LOCUS_12900 38598 40394 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726610.1 protein_id gnl|my_center|LOCUS_12900 41382 40402 gene locus_tag LOCUS_12910 41382 40402 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726612.1 protein_id gnl|my_center|LOCUS_12910 41470 42354 gene locus_tag LOCUS_12920 41470 42354 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729046.1 protein_id gnl|my_center|LOCUS_12920 42592 42365 gene locus_tag LOCUS_12930 42592 42365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 44499 42622 gene locus_tag LOCUS_12940 44499 42622 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222182.1 protein_id gnl|my_center|LOCUS_12940 44501 45388 gene locus_tag LOCUS_12950 44501 45388 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727338.1 protein_id gnl|my_center|LOCUS_12950 45385 46413 gene locus_tag LOCUS_12960 45385 46413 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727339.1 protein_id gnl|my_center|LOCUS_12960 47814 46426 gene locus_tag LOCUS_12970 47814 46426 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727347.1 protein_id gnl|my_center|LOCUS_12970 47949 48647 gene locus_tag LOCUS_12980 47949 48647 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727342.1 protein_id gnl|my_center|LOCUS_12980 48668 49333 gene locus_tag LOCUS_12990 48668 49333 CDS product DUF2064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402886.1 protein_id gnl|my_center|LOCUS_12990 49320 50051 gene locus_tag LOCUS_13000 49320 50051 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727344.1 protein_id gnl|my_center|LOCUS_13000 50124 50900 gene locus_tag LOCUS_13010 50124 50900 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891557.1 protein_id gnl|my_center|LOCUS_13010 51705 50914 gene locus_tag LOCUS_13020 51705 50914 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484721.1 protein_id gnl|my_center|LOCUS_13020 51914 53002 gene locus_tag LOCUS_13030 51914 53002 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467622.1 protein_id gnl|my_center|LOCUS_13030 53917 53021 gene locus_tag LOCUS_13040 53917 53021 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466733.1 protein_id gnl|my_center|LOCUS_13040 54187 53933 gene locus_tag LOCUS_13050 54187 53933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 56145 54313 gene locus_tag LOCUS_13060 56145 54313 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726920.1 protein_id gnl|my_center|LOCUS_13060 57125 56346 gene locus_tag LOCUS_13070 57125 56346 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467888.1 protein_id gnl|my_center|LOCUS_13070 57211 58614 gene locus_tag LOCUS_13080 57211 58614 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093260.1 protein_id gnl|my_center|LOCUS_13080 60214 58616 gene locus_tag LOCUS_13090 60214 58616 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406598.1 protein_id gnl|my_center|LOCUS_13090 61163 60225 gene locus_tag LOCUS_13100 61163 60225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 61336 62526 gene locus_tag LOCUS_13110 61336 62526 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218045413.1 protein_id gnl|my_center|LOCUS_13110 62523 62942 gene locus_tag LOCUS_13120 62523 62942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 62995 63561 gene locus_tag LOCUS_13130 62995 63561 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225371.1 protein_id gnl|my_center|LOCUS_13130 64539 63583 gene locus_tag LOCUS_13140 64539 63583 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111078.1 protein_id gnl|my_center|LOCUS_13140 64679 65851 gene locus_tag LOCUS_13150 64679 65851 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093155.1 protein_id gnl|my_center|LOCUS_13150 66694 65855 gene locus_tag LOCUS_13160 66694 65855 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908797.1 protein_id gnl|my_center|LOCUS_13160 67527 66691 gene locus_tag LOCUS_13170 67527 66691 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104317.1 protein_id gnl|my_center|LOCUS_13170 68813 67524 gene locus_tag LOCUS_13180 68813 67524 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112837.1 protein_id gnl|my_center|LOCUS_13180 69361 68849 gene locus_tag LOCUS_13190 69361 68849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 69424 70818 gene locus_tag LOCUS_13200 69424 70818 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114158.1 protein_id gnl|my_center|LOCUS_13200 71224 70832 gene locus_tag LOCUS_13210 71224 70832 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080074.1 protein_id gnl|my_center|LOCUS_13210 71437 71234 gene locus_tag LOCUS_13220 71437 71234 CDS product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339146.1 protein_id gnl|my_center|LOCUS_13220 72890 71493 gene locus_tag LOCUS_13230 72890 71493 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896702.1 protein_id gnl|my_center|LOCUS_13230 73037 74653 gene locus_tag LOCUS_13240 73037 74653 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730457.1 protein_id gnl|my_center|LOCUS_13240 74718 75434 gene locus_tag LOCUS_13250 74718 75434 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730458.1 protein_id gnl|my_center|LOCUS_13250 75454 76338 gene locus_tag LOCUS_13260 75454 76338 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706576.1 protein_id gnl|my_center|LOCUS_13260 76348 79752 gene locus_tag LOCUS_13270 76348 79752 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081500.1 protein_id gnl|my_center|LOCUS_13270 79915 80469 gene locus_tag LOCUS_13280 79915 80469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 83233 80576 gene locus_tag LOCUS_13290 83233 80576 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111431.1 protein_id gnl|my_center|LOCUS_13290 84039 83230 gene locus_tag LOCUS_13300 84039 83230 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076312.1 protein_id gnl|my_center|LOCUS_13300 85426 84047 gene locus_tag LOCUS_13310 85426 84047 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296611.1 protein_id gnl|my_center|LOCUS_13310 85473 86864 gene locus_tag LOCUS_13320 85473 86864 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296612.1 protein_id gnl|my_center|LOCUS_13320 87870 86962 gene locus_tag LOCUS_13330 gene pucL 87870 86962 CDS product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057393.1 protein_id gnl|my_center|LOCUS_13330 88204 87881 gene locus_tag LOCUS_13340 gene uraH 88204 87881 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057392.1 protein_id gnl|my_center|LOCUS_13340 88736 88215 gene locus_tag LOCUS_13350 gene uraD 88736 88215 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076325.1 protein_id gnl|my_center|LOCUS_13350 90718 88739 gene locus_tag LOCUS_13360 90718 88739 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111438.1 protein_id gnl|my_center|LOCUS_13360 90948 91481 gene locus_tag LOCUS_13370 90948 91481 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727921.1 protein_id gnl|my_center|LOCUS_13370 92132 93832 gene locus_tag LOCUS_13380 92132 93832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 93973 95226 gene locus_tag LOCUS_13390 93973 95226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 95726 95295 gene locus_tag LOCUS_13400 95726 95295 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404412.1 protein_id gnl|my_center|LOCUS_13400 97012 95735 gene locus_tag LOCUS_13410 97012 95735 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896596.1 protein_id gnl|my_center|LOCUS_13410 97146 98132 gene locus_tag LOCUS_13420 97146 98132 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730373.1 protein_id gnl|my_center|LOCUS_13420 99398 98133 gene locus_tag LOCUS_13430 99398 98133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 101037 99694 gene locus_tag LOCUS_13440 101037 99694 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031634.1 protein_id gnl|my_center|LOCUS_13440 102523 101291 gene locus_tag LOCUS_13450 102523 101291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 102946 102632 gene locus_tag LOCUS_13460 102946 102632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 103469 103396 gene locus_tag LOCUS_t00180 103469 103396 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 103644 105230 gene locus_tag LOCUS_13470 103644 105230 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727668.1 protein_id gnl|my_center|LOCUS_13470 105284 106330 gene locus_tag LOCUS_13480 105284 106330 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869314.1 protein_id gnl|my_center|LOCUS_13480 106448 107920 gene locus_tag LOCUS_13490 106448 107920 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110870.1 protein_id gnl|my_center|LOCUS_13490 107937 108512 gene locus_tag LOCUS_13500 gene dcd 107937 108512 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064104.1 protein_id gnl|my_center|LOCUS_13500 108629 109978 gene locus_tag LOCUS_13510 108629 109978 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080026.1 protein_id gnl|my_center|LOCUS_13510 110700 109981 gene locus_tag LOCUS_13520 110700 109981 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184845.1 protein_id gnl|my_center|LOCUS_13520 110803 111774 gene locus_tag LOCUS_13530 110803 111774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 111776 112675 gene locus_tag LOCUS_13540 111776 112675 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112168.1 protein_id gnl|my_center|LOCUS_13540 112681 114219 gene locus_tag LOCUS_13550 112681 114219 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095417.1 protein_id gnl|my_center|LOCUS_13550 >Feature sequence10 644 727 gene locus_tag LOCUS_t00190 644 727 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 929 786 gene locus_tag LOCUS_13560 929 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 1400 978 gene locus_tag LOCUS_13570 1400 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13570 2450 1410 gene locus_tag LOCUS_13580 2450 1410 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067528888.1 protein_id gnl|my_center|LOCUS_13580 2585 3325 gene locus_tag LOCUS_13590 2585 3325 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296441.1 protein_id gnl|my_center|LOCUS_13590 3928 3344 gene locus_tag LOCUS_13600 3928 3344 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231827.1 protein_id gnl|my_center|LOCUS_13600 4000 4650 gene locus_tag LOCUS_13610 4000 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 5549 4590 gene locus_tag LOCUS_13620 5549 4590 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222050.1 protein_id gnl|my_center|LOCUS_13620 6340 5570 gene locus_tag LOCUS_13630 6340 5570 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222049.1 protein_id gnl|my_center|LOCUS_13630 7539 6337 gene locus_tag LOCUS_13640 7539 6337 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222048.1 protein_id gnl|my_center|LOCUS_13640 8182 7532 gene locus_tag LOCUS_13650 8182 7532 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222047.1 protein_id gnl|my_center|LOCUS_13650 8500 9501 gene locus_tag LOCUS_13660 8500 9501 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729384.1 protein_id gnl|my_center|LOCUS_13660 9561 9995 gene locus_tag LOCUS_13670 9561 9995 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226310.1 protein_id gnl|my_center|LOCUS_13670 10190 11173 gene locus_tag LOCUS_13680 10190 11173 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112106.1 protein_id gnl|my_center|LOCUS_13680 11209 12720 gene locus_tag LOCUS_13690 11209 12720 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229798.1 protein_id gnl|my_center|LOCUS_13690 13070 12747 gene locus_tag LOCUS_13700 13070 12747 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891550.1 protein_id gnl|my_center|LOCUS_13700 13492 13067 gene locus_tag LOCUS_13710 13492 13067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 14453 13569 gene locus_tag LOCUS_13720 14453 13569 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079766.1 protein_id gnl|my_center|LOCUS_13720 14920 14501 gene locus_tag LOCUS_13730 14920 14501 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230234.1 protein_id gnl|my_center|LOCUS_13730 14991 15848 gene locus_tag LOCUS_13740 14991 15848 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892441.1 protein_id gnl|my_center|LOCUS_13740 15901 17181 gene locus_tag LOCUS_13750 15901 17181 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111336.1 protein_id gnl|my_center|LOCUS_13750 17237 17710 gene locus_tag LOCUS_13760 17237 17710 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728757.1 protein_id gnl|my_center|LOCUS_13760 17763 19205 gene locus_tag LOCUS_13770 17763 19205 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226023.1 protein_id gnl|my_center|LOCUS_13770 19296 20069 gene locus_tag LOCUS_13780 19296 20069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 20522 20070 gene locus_tag LOCUS_13790 20522 20070 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971444.1 protein_id gnl|my_center|LOCUS_13790 20585 20953 gene locus_tag LOCUS_13800 20585 20953 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223051.1 protein_id gnl|my_center|LOCUS_13800 23264 21018 gene locus_tag LOCUS_13810 gene katG 23264 21018 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111000.1 protein_id gnl|my_center|LOCUS_13810 23760 23317 gene locus_tag LOCUS_13820 23760 23317 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899076.1 protein_id gnl|my_center|LOCUS_13820 23847 24677 gene locus_tag LOCUS_13830 23847 24677 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728971.1 protein_id gnl|my_center|LOCUS_13830 25230 24688 gene locus_tag LOCUS_13840 25230 24688 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079984.1 protein_id gnl|my_center|LOCUS_13840 25306 26829 gene locus_tag LOCUS_13850 25306 26829 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727276.1 protein_id gnl|my_center|LOCUS_13850 26866 27282 gene locus_tag LOCUS_13860 26866 27282 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727277.1 protein_id gnl|my_center|LOCUS_13860 27512 27294 gene locus_tag LOCUS_13870 27512 27294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 27402 27788 gene locus_tag LOCUS_13880 27402 27788 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027643.1 protein_id gnl|my_center|LOCUS_13880 27839 28729 gene locus_tag LOCUS_13890 27839 28729 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411086.1 protein_id gnl|my_center|LOCUS_13890 30088 28742 gene locus_tag LOCUS_13900 30088 28742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 30919 30092 gene locus_tag LOCUS_13910 30919 30092 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_13910 32168 30933 gene locus_tag LOCUS_13920 32168 30933 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087812.1 protein_id gnl|my_center|LOCUS_13920 32217 33149 gene locus_tag LOCUS_13930 32217 33149 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111261.1 protein_id gnl|my_center|LOCUS_13930 33157 34032 gene locus_tag LOCUS_13940 33157 34032 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411849.1 protein_id gnl|my_center|LOCUS_13940 34332 34910 gene locus_tag LOCUS_13950 34332 34910 CDS product calcium homeostasis/redox stress adaptation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976436.1 protein_id gnl|my_center|LOCUS_13950 35608 34928 gene locus_tag LOCUS_13960 35608 34928 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224283.1 protein_id gnl|my_center|LOCUS_13960 36780 35605 gene locus_tag LOCUS_13970 36780 35605 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029604.1 protein_id gnl|my_center|LOCUS_13970 36839 37498 gene locus_tag LOCUS_13980 36839 37498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 37552 38040 gene locus_tag LOCUS_13990 37552 38040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028551.1 protein_id gnl|my_center|LOCUS_13990 39049 38024 gene locus_tag LOCUS_14000 39049 38024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 39150 40079 gene locus_tag LOCUS_14010 39150 40079 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878179.1 protein_id gnl|my_center|LOCUS_14010 40076 40879 gene locus_tag LOCUS_14020 40076 40879 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228377.1 protein_id gnl|my_center|LOCUS_14020 40876 42072 gene locus_tag LOCUS_14030 40876 42072 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091312173.1 protein_id gnl|my_center|LOCUS_14030 42069 42683 gene locus_tag LOCUS_14040 42069 42683 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228375.1 protein_id gnl|my_center|LOCUS_14040 42793 44742 gene locus_tag LOCUS_14050 42793 44742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 45044 49642 gene locus_tag LOCUS_14060 gene gltB 45044 49642 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878656.1 protein_id gnl|my_center|LOCUS_14060 49635 51101 gene locus_tag LOCUS_14070 49635 51101 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897870.1 protein_id gnl|my_center|LOCUS_14070 51428 51174 gene locus_tag LOCUS_14080 51428 51174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 51579 52130 gene locus_tag LOCUS_14090 51579 52130 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803749.1 protein_id gnl|my_center|LOCUS_14090 53015 52140 gene locus_tag LOCUS_14100 53015 52140 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_14100 53623 53027 gene locus_tag LOCUS_14110 53623 53027 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084868.1 protein_id gnl|my_center|LOCUS_14110 53739 56147 gene locus_tag LOCUS_14120 53739 56147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 56649 56152 gene locus_tag LOCUS_14130 56649 56152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 58009 57107 gene locus_tag LOCUS_14140 58009 57107 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078880017.1 protein_id gnl|my_center|LOCUS_14140 61395 58006 gene locus_tag LOCUS_14150 gene lysX 61395 58006 CDS product bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877820.1 protein_id gnl|my_center|LOCUS_14150 61510 61770 gene locus_tag LOCUS_14160 61510 61770 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728864.1 protein_id gnl|my_center|LOCUS_14160 61798 62274 gene locus_tag LOCUS_14170 gene rraA 61798 62274 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399786.1 protein_id gnl|my_center|LOCUS_14170 62367 63920 gene locus_tag LOCUS_14180 62367 63920 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897308.1 protein_id gnl|my_center|LOCUS_14180 64430 63945 gene locus_tag LOCUS_14190 64430 63945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 65124 64594 gene locus_tag LOCUS_14200 65124 64594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 65825 65121 gene locus_tag LOCUS_14210 65825 65121 CDS product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084137.1 protein_id gnl|my_center|LOCUS_14210 66592 65918 gene locus_tag LOCUS_14220 66592 65918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 67305 66610 gene locus_tag LOCUS_14230 67305 66610 CDS product DUF6474 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897846.1 protein_id gnl|my_center|LOCUS_14230 67453 69177 gene locus_tag LOCUS_14240 67453 69177 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284849.1 protein_id gnl|my_center|LOCUS_14240 69425 69964 gene locus_tag LOCUS_14250 69425 69964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 70711 69938 gene locus_tag LOCUS_14260 70711 69938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 71362 70784 gene locus_tag LOCUS_14270 71362 70784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907504.1 protein_id gnl|my_center|LOCUS_14270 72217 71564 gene locus_tag LOCUS_14280 72217 71564 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062831.1 protein_id gnl|my_center|LOCUS_14280 72540 72382 gene locus_tag LOCUS_14290 72540 72382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 73615 72647 gene locus_tag LOCUS_14300 73615 72647 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160961434.1 protein_id gnl|my_center|LOCUS_14300 73801 75333 gene locus_tag LOCUS_14310 73801 75333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 75330 76157 gene locus_tag LOCUS_14320 75330 76157 CDS product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093056.1 protein_id gnl|my_center|LOCUS_14320 76154 79555 gene locus_tag LOCUS_14330 76154 79555 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084705.1 protein_id gnl|my_center|LOCUS_14330 79563 80648 gene locus_tag LOCUS_14340 79563 80648 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223454.1 protein_id gnl|my_center|LOCUS_14340 81188 80661 gene locus_tag LOCUS_14350 81188 80661 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803711.1 protein_id gnl|my_center|LOCUS_14350 81218 81859 gene locus_tag LOCUS_14360 81218 81859 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727020.1 protein_id gnl|my_center|LOCUS_14360 81856 83103 gene locus_tag LOCUS_14370 81856 83103 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727019.1 protein_id gnl|my_center|LOCUS_14370 83913 83128 gene locus_tag LOCUS_14380 83913 83128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 84650 83886 gene locus_tag LOCUS_14390 84650 83886 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027556.1 protein_id gnl|my_center|LOCUS_14390 85599 84676 gene locus_tag LOCUS_14400 85599 84676 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224046.1 protein_id gnl|my_center|LOCUS_14400 85656 86522 gene locus_tag LOCUS_14410 85656 86522 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222083.1 protein_id gnl|my_center|LOCUS_14410 86946 87824 gene locus_tag LOCUS_14420 86946 87824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14420 87821 88714 gene locus_tag LOCUS_14430 87821 88714 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084130.1 protein_id gnl|my_center|LOCUS_14430 88749 89687 gene locus_tag LOCUS_14440 88749 89687 CDS product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222094.1 protein_id gnl|my_center|LOCUS_14440 89684 90136 gene locus_tag LOCUS_14450 89684 90136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 90734 90138 gene locus_tag LOCUS_14460 90734 90138 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065153.1 protein_id gnl|my_center|LOCUS_14460 91680 90772 gene locus_tag LOCUS_14470 91680 90772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14470 92971 92159 gene locus_tag LOCUS_14480 92971 92159 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731271.1 protein_id gnl|my_center|LOCUS_14480 93754 92999 gene locus_tag LOCUS_14490 93754 92999 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897828.1 protein_id gnl|my_center|LOCUS_14490 93855 94793 gene locus_tag LOCUS_14500 gene pheA 93855 94793 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420906.1 protein_id gnl|my_center|LOCUS_14500 94793 95440 gene locus_tag LOCUS_14510 94793 95440 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084122.1 protein_id gnl|my_center|LOCUS_14510 95792 95442 gene locus_tag LOCUS_14520 95792 95442 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087492.1 protein_id gnl|my_center|LOCUS_14520 97098 95830 gene locus_tag LOCUS_14530 97098 95830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 97153 97563 gene locus_tag LOCUS_14540 97153 97563 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084111.1 protein_id gnl|my_center|LOCUS_14540 97607 98866 gene locus_tag LOCUS_14550 gene serS 97607 98866 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897822.1 protein_id gnl|my_center|LOCUS_14550 98877 99779 gene locus_tag LOCUS_14560 98877 99779 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111078.1 protein_id gnl|my_center|LOCUS_14560 99834 100226 gene locus_tag LOCUS_14570 99834 100226 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398711.1 protein_id gnl|my_center|LOCUS_14570 101042 100230 gene locus_tag LOCUS_14580 101042 100230 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204082927.1 protein_id gnl|my_center|LOCUS_14580 101106 101609 gene locus_tag LOCUS_14590 101106 101609 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896432.1 protein_id gnl|my_center|LOCUS_14590 102291 101629 gene locus_tag LOCUS_14600 102291 101629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 102956 102291 gene locus_tag LOCUS_14610 102956 102291 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731153.1 protein_id gnl|my_center|LOCUS_14610 102955 103791 gene locus_tag LOCUS_14620 102955 103791 CDS product bromoperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074319.1 protein_id gnl|my_center|LOCUS_14620 103888 104370 gene locus_tag LOCUS_14630 103888 104370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 104934 104470 gene locus_tag LOCUS_14640 104934 104470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 104855 107833 gene locus_tag LOCUS_14650 104855 107833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 107830 108336 gene locus_tag LOCUS_14660 107830 108336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 109827 108352 gene locus_tag LOCUS_14670 109827 108352 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112649.1 protein_id gnl|my_center|LOCUS_14670 110512 109928 gene locus_tag LOCUS_14680 110512 109928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 111840 110509 gene locus_tag LOCUS_14690 111840 110509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 >Feature sequence11 1362 127 gene locus_tag LOCUS_14700 1362 127 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228178.1 protein_id gnl|my_center|LOCUS_14700 2315 1449 gene locus_tag LOCUS_14710 2315 1449 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351200.1 protein_id gnl|my_center|LOCUS_14710 3658 2408 gene locus_tag LOCUS_14720 3658 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 4709 3705 gene locus_tag LOCUS_14730 4709 3705 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776829.1 protein_id gnl|my_center|LOCUS_14730 4883 6415 gene locus_tag LOCUS_14740 4883 6415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 9992 6441 gene locus_tag LOCUS_14750 9992 6441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 10225 11925 gene locus_tag LOCUS_14760 10225 11925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 13869 11929 gene locus_tag LOCUS_14770 13869 11929 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_14770 15596 13866 gene locus_tag LOCUS_14780 15596 13866 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227095.1 protein_id gnl|my_center|LOCUS_14780 15882 15688 gene locus_tag LOCUS_14790 15882 15688 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228974.1 protein_id gnl|my_center|LOCUS_14790 17084 15879 gene locus_tag LOCUS_14800 17084 15879 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225331.1 protein_id gnl|my_center|LOCUS_14800 17244 17825 gene locus_tag LOCUS_14810 17244 17825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 19325 17853 gene locus_tag LOCUS_14820 19325 17853 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728196.1 protein_id gnl|my_center|LOCUS_14820 21053 19380 gene locus_tag LOCUS_14830 21053 19380 CDS product allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111162.1 protein_id gnl|my_center|LOCUS_14830 21279 21665 gene locus_tag LOCUS_14840 21279 21665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 22400 21669 gene locus_tag LOCUS_14850 22400 21669 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404702.1 protein_id gnl|my_center|LOCUS_14850 22514 24040 gene locus_tag LOCUS_14860 22514 24040 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092091.1 protein_id gnl|my_center|LOCUS_14860 24009 25166 gene locus_tag LOCUS_14870 24009 25166 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113368.1 protein_id gnl|my_center|LOCUS_14870 25194 25880 gene locus_tag LOCUS_14880 25194 25880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 25956 26975 gene locus_tag LOCUS_14890 25956 26975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 27021 28007 gene locus_tag LOCUS_14900 27021 28007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 28004 28843 gene locus_tag LOCUS_14910 28004 28843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 28840 30120 gene locus_tag LOCUS_14920 28840 30120 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523978.1 protein_id gnl|my_center|LOCUS_14920 30114 31343 gene locus_tag LOCUS_14930 30114 31343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 31343 33022 gene locus_tag LOCUS_14940 31343 33022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 33019 35535 gene locus_tag LOCUS_14950 gene lanKC 33019 35535 CDS product class III lanthionine synthetase LanKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495285.1 protein_id gnl|my_center|LOCUS_14950 35529 36677 gene locus_tag LOCUS_14960 35529 36677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 36681 36854 gene locus_tag LOCUS_14970 36681 36854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 36909 37115 gene locus_tag LOCUS_14980 36909 37115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 37174 37326 gene locus_tag LOCUS_14990 37174 37326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 37450 37725 gene locus_tag LOCUS_15000 37450 37725 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104405.1 protein_id gnl|my_center|LOCUS_15000 37725 38432 gene locus_tag LOCUS_15010 37725 38432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 38489 39385 gene locus_tag LOCUS_15020 38489 39385 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223991.1 protein_id gnl|my_center|LOCUS_15020 39382 40662 gene locus_tag LOCUS_15030 39382 40662 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086674640.1 protein_id gnl|my_center|LOCUS_15030 40698 41510 gene locus_tag LOCUS_15040 40698 41510 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382989.1 protein_id gnl|my_center|LOCUS_15040 41507 42361 gene locus_tag LOCUS_15050 41507 42361 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226900.1 protein_id gnl|my_center|LOCUS_15050 42358 43158 gene locus_tag LOCUS_15060 42358 43158 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893372.1 protein_id gnl|my_center|LOCUS_15060 43167 44225 gene locus_tag LOCUS_15070 43167 44225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 45607 44315 gene locus_tag LOCUS_15080 45607 44315 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082954.1 protein_id gnl|my_center|LOCUS_15080 47103 45691 gene locus_tag LOCUS_15090 47103 45691 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728446.1 protein_id gnl|my_center|LOCUS_15090 47177 47932 gene locus_tag LOCUS_15100 47177 47932 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092754.1 protein_id gnl|my_center|LOCUS_15100 47929 49302 gene locus_tag LOCUS_15110 47929 49302 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908723.1 protein_id gnl|my_center|LOCUS_15110 49448 49828 gene locus_tag LOCUS_15120 49448 49828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 50816 49854 gene locus_tag LOCUS_15130 50816 49854 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583478.1 protein_id gnl|my_center|LOCUS_15130 50877 51359 gene locus_tag LOCUS_15140 50877 51359 CDS product DUF6328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235623980.1 protein_id gnl|my_center|LOCUS_15140 51734 51366 gene locus_tag LOCUS_15150 51734 51366 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897079.1 protein_id gnl|my_center|LOCUS_15150 53053 51734 gene locus_tag LOCUS_15160 53053 51734 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897085.1 protein_id gnl|my_center|LOCUS_15160 54056 53127 gene locus_tag LOCUS_15170 54056 53127 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028065.1 protein_id gnl|my_center|LOCUS_15170 54997 54053 gene locus_tag LOCUS_15180 54997 54053 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230161.1 protein_id gnl|my_center|LOCUS_15180 55103 55792 gene locus_tag LOCUS_15190 55103 55792 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079953.1 protein_id gnl|my_center|LOCUS_15190 55789 56679 gene locus_tag LOCUS_15200 55789 56679 CDS product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079952.1 protein_id gnl|my_center|LOCUS_15200 56739 57722 gene locus_tag LOCUS_15210 56739 57722 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898602.1 protein_id gnl|my_center|LOCUS_15210 57883 58716 gene locus_tag LOCUS_15220 57883 58716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 58873 59952 gene locus_tag LOCUS_15230 58873 59952 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396053.1 protein_id gnl|my_center|LOCUS_15230 59949 60431 gene locus_tag LOCUS_15240 59949 60431 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467233.1 protein_id gnl|my_center|LOCUS_15240 60507 61085 gene locus_tag LOCUS_15250 60507 61085 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093058.1 protein_id gnl|my_center|LOCUS_15250 61233 61532 gene locus_tag LOCUS_15260 61233 61532 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225091.1 protein_id gnl|my_center|LOCUS_15260 61673 62254 gene locus_tag LOCUS_15270 61673 62254 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530118.1 protein_id gnl|my_center|LOCUS_15270 65336 62292 gene locus_tag LOCUS_15280 65336 62292 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296391.1 protein_id gnl|my_center|LOCUS_15280 66280 65480 gene locus_tag LOCUS_15290 66280 65480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 67593 66328 gene locus_tag LOCUS_15300 67593 66328 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730701.1 protein_id gnl|my_center|LOCUS_15300 68255 67593 gene locus_tag LOCUS_15310 gene pdxH 68255 67593 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730702.1 protein_id gnl|my_center|LOCUS_15310 68352 69494 gene locus_tag LOCUS_15320 68352 69494 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898633.1 protein_id gnl|my_center|LOCUS_15320 70710 69517 gene locus_tag LOCUS_15330 70710 69517 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029846.1 protein_id gnl|my_center|LOCUS_15330 72354 70735 gene locus_tag LOCUS_15340 72354 70735 CDS product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222247.1 protein_id gnl|my_center|LOCUS_15340 73264 72326 gene locus_tag LOCUS_15350 73264 72326 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029129.1 protein_id gnl|my_center|LOCUS_15350 73893 73261 gene locus_tag LOCUS_15360 gene raaS 73893 73261 CDS product transcriptional regulator RaaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406254.1 protein_id gnl|my_center|LOCUS_15360 74072 73890 gene locus_tag LOCUS_15370 74072 73890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 74053 75186 gene locus_tag LOCUS_15380 gene serC 74053 75186 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897096.1 protein_id gnl|my_center|LOCUS_15380 75350 76417 gene locus_tag LOCUS_15390 gene sepH 75350 76417 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092707.1 protein_id gnl|my_center|LOCUS_15390 76454 77236 gene locus_tag LOCUS_15400 76454 77236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 77513 77238 gene locus_tag LOCUS_15410 77513 77238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15410 77608 79017 gene locus_tag LOCUS_15420 77608 79017 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407382.1 protein_id gnl|my_center|LOCUS_15420 79858 79028 gene locus_tag LOCUS_15430 79858 79028 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730712.1 protein_id gnl|my_center|LOCUS_15430 81179 79932 gene locus_tag LOCUS_15440 81179 79932 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084375.1 protein_id gnl|my_center|LOCUS_15440 81136 82470 gene locus_tag LOCUS_15450 81136 82470 CDS product enhanced intracellular survival protein Eis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729122.1 protein_id gnl|my_center|LOCUS_15450 83814 82549 gene locus_tag LOCUS_15460 83814 82549 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113311.1 protein_id gnl|my_center|LOCUS_15460 84315 83884 gene locus_tag LOCUS_15470 84315 83884 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063625.1 protein_id gnl|my_center|LOCUS_15470 86059 84422 gene locus_tag LOCUS_15480 86059 84422 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081351.1 protein_id gnl|my_center|LOCUS_15480 86075 86281 gene locus_tag LOCUS_15490 86075 86281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 87176 86274 gene locus_tag LOCUS_15500 87176 86274 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115911.1 protein_id gnl|my_center|LOCUS_15500 87311 88165 gene locus_tag LOCUS_15510 87311 88165 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088525.1 protein_id gnl|my_center|LOCUS_15510 88716 88144 gene locus_tag LOCUS_15520 88716 88144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 91560 88726 gene locus_tag LOCUS_15530 91560 88726 CDS product molecular chaperone Hsp90 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230211.1 protein_id gnl|my_center|LOCUS_15530 92554 91580 gene locus_tag LOCUS_15540 92554 91580 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104387.1 protein_id gnl|my_center|LOCUS_15540 92683 94476 gene locus_tag LOCUS_15550 92683 94476 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139618.1 protein_id gnl|my_center|LOCUS_15550 94483 95019 gene locus_tag LOCUS_15560 94483 95019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 95533 95111 gene locus_tag LOCUS_15570 95533 95111 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404570.1 protein_id gnl|my_center|LOCUS_15570 95757 95966 gene locus_tag LOCUS_15580 95757 95966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 96006 96515 gene locus_tag LOCUS_15590 96006 96515 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409718.1 protein_id gnl|my_center|LOCUS_15590 96583 97686 gene locus_tag LOCUS_15600 gene moaA 96583 97686 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092699.1 protein_id gnl|my_center|LOCUS_15600 97683 97952 gene locus_tag LOCUS_15610 97683 97952 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878424.1 protein_id gnl|my_center|LOCUS_15610 98491 99138 gene locus_tag LOCUS_15620 98491 99138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 99709 99272 gene locus_tag LOCUS_15630 99709 99272 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730722.1 protein_id gnl|my_center|LOCUS_15630 100185 99709 gene locus_tag LOCUS_15640 100185 99709 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878425.1 protein_id gnl|my_center|LOCUS_15640 100697 100182 gene locus_tag LOCUS_15650 gene moaC 100697 100182 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230248.1 protein_id gnl|my_center|LOCUS_15650 100886 100701 gene locus_tag LOCUS_15660 100886 100701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618285.1 protein_id gnl|my_center|LOCUS_15660 100902 103292 gene locus_tag LOCUS_15670 100902 103292 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730725.1 protein_id gnl|my_center|LOCUS_15670 103354 105006 gene locus_tag LOCUS_15680 103354 105006 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063651.1 protein_id gnl|my_center|LOCUS_15680 105627 105016 gene locus_tag LOCUS_15690 105627 105016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence12 1683 112 gene locus_tag LOCUS_15700 1683 112 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728790.1 protein_id gnl|my_center|LOCUS_15700 1707 2270 gene locus_tag LOCUS_15710 1707 2270 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728791.1 protein_id gnl|my_center|LOCUS_15710 3468 2320 gene locus_tag LOCUS_15720 3468 2320 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223404.1 protein_id gnl|my_center|LOCUS_15720 3900 3523 gene locus_tag LOCUS_15730 3900 3523 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727319.1 protein_id gnl|my_center|LOCUS_15730 3995 4303 gene locus_tag LOCUS_15740 3995 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 4303 5310 gene locus_tag LOCUS_15750 4303 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15750 6110 5307 gene locus_tag LOCUS_15760 6110 5307 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731334.1 protein_id gnl|my_center|LOCUS_15760 7789 6113 gene locus_tag LOCUS_15770 7789 6113 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031577.1 protein_id gnl|my_center|LOCUS_15770 7867 8781 gene locus_tag LOCUS_15780 gene rbsK 7867 8781 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526901.1 protein_id gnl|my_center|LOCUS_15780 8839 8997 gene locus_tag LOCUS_15790 8839 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 8984 9442 gene locus_tag LOCUS_15800 8984 9442 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877784.1 protein_id gnl|my_center|LOCUS_15800 11056 9452 gene locus_tag LOCUS_15810 11056 9452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15810 11899 11615 gene locus_tag LOCUS_15820 11899 11615 CDS product DUF1490 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897460.1 protein_id gnl|my_center|LOCUS_15820 12086 12850 gene locus_tag LOCUS_15830 12086 12850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15830 12872 13363 gene locus_tag LOCUS_15840 12872 13363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15840 13372 13638 gene locus_tag LOCUS_15850 13372 13638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 14467 13559 gene locus_tag LOCUS_15860 14467 13559 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726937.1 protein_id gnl|my_center|LOCUS_15860 14487 15962 gene locus_tag LOCUS_15870 14487 15962 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104578.1 protein_id gnl|my_center|LOCUS_15870 16260 15973 gene locus_tag LOCUS_15880 16260 15973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 17648 16257 gene locus_tag LOCUS_15890 17648 16257 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227373.1 protein_id gnl|my_center|LOCUS_15890 18127 17675 gene locus_tag LOCUS_15900 18127 17675 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092949.1 protein_id gnl|my_center|LOCUS_15900 19569 18202 gene locus_tag LOCUS_15910 19569 18202 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110217.1 protein_id gnl|my_center|LOCUS_15910 20594 19566 gene locus_tag LOCUS_15920 20594 19566 CDS product TIGR03842 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111352.1 protein_id gnl|my_center|LOCUS_15920 22031 20610 gene locus_tag LOCUS_15930 gene hydA 22031 20610 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729473.1 protein_id gnl|my_center|LOCUS_15930 22656 22060 gene locus_tag LOCUS_15940 22656 22060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 23852 22650 gene locus_tag LOCUS_15950 23852 22650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 25438 24167 gene locus_tag LOCUS_15960 25438 24167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 25657 26661 gene locus_tag LOCUS_15970 25657 26661 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519616.1 protein_id gnl|my_center|LOCUS_15970 26658 27230 gene locus_tag LOCUS_15980 26658 27230 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528352.1 protein_id gnl|my_center|LOCUS_15980 27943 27218 gene locus_tag LOCUS_15990 27943 27218 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937416.1 protein_id gnl|my_center|LOCUS_15990 28788 27943 gene locus_tag LOCUS_16000 28788 27943 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112052.1 protein_id gnl|my_center|LOCUS_16000 29687 28785 gene locus_tag LOCUS_16010 29687 28785 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116998.1 protein_id gnl|my_center|LOCUS_16010 29789 31000 gene locus_tag LOCUS_16020 29789 31000 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081138.1 protein_id gnl|my_center|LOCUS_16020 31021 32259 gene locus_tag LOCUS_16030 gene arcA 31021 32259 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082883.1 protein_id gnl|my_center|LOCUS_16030 32279 32638 gene locus_tag LOCUS_16040 32279 32638 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222929.1 protein_id gnl|my_center|LOCUS_16040 32751 34496 gene locus_tag LOCUS_16050 32751 34496 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727978.1 protein_id gnl|my_center|LOCUS_16050 34561 35658 gene locus_tag LOCUS_16060 34561 35658 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229698.1 protein_id gnl|my_center|LOCUS_16060 35655 36311 gene locus_tag LOCUS_16070 35655 36311 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229697.1 protein_id gnl|my_center|LOCUS_16070 36308 37042 gene locus_tag LOCUS_16080 36308 37042 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229696.1 protein_id gnl|my_center|LOCUS_16080 37107 38015 gene locus_tag LOCUS_16090 37107 38015 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743594.1 protein_id gnl|my_center|LOCUS_16090 38099 38689 gene locus_tag LOCUS_16100 38099 38689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 38789 39388 gene locus_tag LOCUS_16110 38789 39388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 40999 39401 gene locus_tag LOCUS_16120 40999 39401 CDS product dolichyl-phosphate-mannose--protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898685.1 protein_id gnl|my_center|LOCUS_16120 41094 41912 gene locus_tag LOCUS_16130 gene rsmI 41094 41912 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229988.1 protein_id gnl|my_center|LOCUS_16130 43122 41923 gene locus_tag LOCUS_16140 43122 41923 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092857.1 protein_id gnl|my_center|LOCUS_16140 44674 43124 gene locus_tag LOCUS_16150 gene metG 44674 43124 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296388.1 protein_id gnl|my_center|LOCUS_16150 45620 44709 gene locus_tag LOCUS_16160 gene lipG 45620 44709 CDS product lipase/esterase LipG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403314.1 protein_id gnl|my_center|LOCUS_16160 46724 45639 gene locus_tag LOCUS_16170 46724 45639 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085410.1 protein_id gnl|my_center|LOCUS_16170 47290 46796 gene locus_tag LOCUS_16180 47290 46796 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229404.1 protein_id gnl|my_center|LOCUS_16180 47926 47339 gene locus_tag LOCUS_16190 47926 47339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 48112 48951 gene locus_tag LOCUS_16200 48112 48951 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762776.1 protein_id gnl|my_center|LOCUS_16200 48948 49796 gene locus_tag LOCUS_16210 48948 49796 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896837.1 protein_id gnl|my_center|LOCUS_16210 49868 50989 gene locus_tag LOCUS_16220 49868 50989 CDS product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082874.1 protein_id gnl|my_center|LOCUS_16220 50944 51873 gene locus_tag LOCUS_16230 gene rsmA 50944 51873 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013966.1 protein_id gnl|my_center|LOCUS_16230 51885 52829 gene locus_tag LOCUS_16240 51885 52829 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229975.1 protein_id gnl|my_center|LOCUS_16240 52826 54634 gene locus_tag LOCUS_16250 52826 54634 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092945.1 protein_id gnl|my_center|LOCUS_16250 54647 55657 gene locus_tag LOCUS_16260 54647 55657 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389587.1 protein_id gnl|my_center|LOCUS_16260 56446 55679 gene locus_tag LOCUS_16270 56446 55679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 58046 56427 gene locus_tag LOCUS_16280 58046 56427 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013982.1 protein_id gnl|my_center|LOCUS_16280 60021 58963 gene locus_tag LOCUS_16290 60021 58963 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109965.1 protein_id gnl|my_center|LOCUS_16290 60705 60139 gene locus_tag LOCUS_16300 gene pth 60705 60139 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730530.1 protein_id gnl|my_center|LOCUS_16300 61386 60706 gene locus_tag LOCUS_16310 61386 60706 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896828.1 protein_id gnl|my_center|LOCUS_16310 61713 62192 gene locus_tag LOCUS_16320 61713 62192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 62599 62231 gene locus_tag LOCUS_16330 gene arsC 62599 62231 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896825.1 protein_id gnl|my_center|LOCUS_16330 63582 62605 gene locus_tag LOCUS_16340 63582 62605 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896824.1 protein_id gnl|my_center|LOCUS_16340 65108 63579 gene locus_tag LOCUS_16350 gene glmU 65108 63579 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730527.1 protein_id gnl|my_center|LOCUS_16350 65256 66011 gene locus_tag LOCUS_16360 gene fabG 65256 66011 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_16360 66133 68082 gene locus_tag LOCUS_16370 66133 68082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16370 68142 69038 gene locus_tag LOCUS_16380 68142 69038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 69080 70636 gene locus_tag LOCUS_16390 69080 70636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 70680 70752 gene locus_tag LOCUS_t00200 70680 70752 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 71997 70858 gene locus_tag LOCUS_16400 71997 70858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 72214 72423 gene locus_tag LOCUS_16410 72214 72423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 72555 72779 gene locus_tag LOCUS_16420 72555 72779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 73025 73294 gene locus_tag LOCUS_16430 73025 73294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 73291 74535 gene locus_tag LOCUS_16440 73291 74535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 74734 75000 gene locus_tag LOCUS_16450 74734 75000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 74997 75161 gene locus_tag LOCUS_16460 74997 75161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 75158 75862 gene locus_tag LOCUS_16470 75158 75862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 75859 76191 gene locus_tag LOCUS_16480 75859 76191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 76188 76670 gene locus_tag LOCUS_16490 76188 76670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 76836 77663 gene locus_tag LOCUS_16500 76836 77663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 77858 78250 gene locus_tag LOCUS_16510 77858 78250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 78872 78579 gene locus_tag LOCUS_16520 78872 78579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 79117 78869 gene locus_tag LOCUS_16530 79117 78869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 79415 80029 gene locus_tag LOCUS_16540 79415 80029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 80991 80113 gene locus_tag LOCUS_16550 80991 80113 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079427.1 protein_id gnl|my_center|LOCUS_16550 81537 81094 gene locus_tag LOCUS_16560 81537 81094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 82041 81622 gene locus_tag LOCUS_16570 82041 81622 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414734.1 protein_id gnl|my_center|LOCUS_16570 82154 82870 gene locus_tag LOCUS_16580 82154 82870 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405271.1 protein_id gnl|my_center|LOCUS_16580 83662 82871 gene locus_tag LOCUS_16590 83662 82871 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231012.1 protein_id gnl|my_center|LOCUS_16590 84210 83659 gene locus_tag LOCUS_16600 84210 83659 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393929.1 protein_id gnl|my_center|LOCUS_16600 85079 84207 gene locus_tag LOCUS_16610 85079 84207 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731359.1 protein_id gnl|my_center|LOCUS_16610 85740 85138 gene locus_tag LOCUS_16620 85740 85138 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727382.1 protein_id gnl|my_center|LOCUS_16620 85853 89572 gene locus_tag LOCUS_16630 gene mfd 85853 89572 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109976.1 protein_id gnl|my_center|LOCUS_16630 89569 90255 gene locus_tag LOCUS_16640 89569 90255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 90681 90259 gene locus_tag LOCUS_16650 90681 90259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 92005 90698 gene locus_tag LOCUS_16660 gene efeB 92005 90698 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730522.1 protein_id gnl|my_center|LOCUS_16660 93213 92002 gene locus_tag LOCUS_16670 93213 92002 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090880.1 protein_id gnl|my_center|LOCUS_16670 94121 93237 gene locus_tag LOCUS_16680 94121 93237 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084203.1 protein_id gnl|my_center|LOCUS_16680 94283 95059 gene locus_tag LOCUS_16690 94283 95059 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900256.1 protein_id gnl|my_center|LOCUS_16690 95219 96505 gene locus_tag LOCUS_16700 gene eno 95219 96505 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896814.1 protein_id gnl|my_center|LOCUS_16700 96621 97178 gene locus_tag LOCUS_16710 96621 97178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 97192 97743 gene locus_tag LOCUS_16720 97192 97743 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109980.1 protein_id gnl|my_center|LOCUS_16720 97740 98687 gene locus_tag LOCUS_16730 97740 98687 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109982.1 protein_id gnl|my_center|LOCUS_16730 99248 98697 gene locus_tag LOCUS_16740 99248 98697 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015609.1 protein_id gnl|my_center|LOCUS_16740 100754 99315 gene locus_tag LOCUS_16750 100754 99315 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975618.1 protein_id gnl|my_center|LOCUS_16750 101090 100821 gene locus_tag LOCUS_16760 101090 100821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 102308 101130 gene locus_tag LOCUS_16770 102308 101130 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093119.1 protein_id gnl|my_center|LOCUS_16770 103419 102322 gene locus_tag LOCUS_16780 103419 102322 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074520.1 protein_id gnl|my_center|LOCUS_16780 103637 104365 gene locus_tag LOCUS_16790 103637 104365 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223976.1 protein_id gnl|my_center|LOCUS_16790 104741 104517 gene locus_tag LOCUS_16800 104741 104517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 104779 104979 gene locus_tag LOCUS_16810 104779 104979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 105841 105104 gene locus_tag LOCUS_16820 105841 105104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 106636 105881 gene locus_tag LOCUS_16830 106636 105881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16830 107286 106624 gene locus_tag LOCUS_16840 107286 106624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16840 107231 107512 gene locus_tag LOCUS_16850 107231 107512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 107582 108427 gene locus_tag LOCUS_16860 107582 108427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 109192 108449 gene locus_tag LOCUS_16870 109192 108449 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113130.1 protein_id gnl|my_center|LOCUS_16870 110084 109197 gene locus_tag LOCUS_16880 110084 109197 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729360.1 protein_id gnl|my_center|LOCUS_16880 110170 110868 gene locus_tag LOCUS_16890 110170 110868 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729362.1 protein_id gnl|my_center|LOCUS_16890 111950 110856 gene locus_tag LOCUS_16900 111950 110856 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729265.1 protein_id gnl|my_center|LOCUS_16900 113074 111947 gene locus_tag LOCUS_16910 gene galT 113074 111947 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015287872.1 protein_id gnl|my_center|LOCUS_16910 113862 113071 gene locus_tag LOCUS_16920 113862 113071 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977803.1 protein_id gnl|my_center|LOCUS_16920 114004 115707 gene locus_tag LOCUS_16930 114004 115707 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877788.1 protein_id gnl|my_center|LOCUS_16930 115745 116122 gene locus_tag LOCUS_16940 115745 116122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 117096 116107 gene locus_tag LOCUS_16950 117096 116107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 117231 118085 gene locus_tag LOCUS_16960 117231 118085 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228350.1 protein_id gnl|my_center|LOCUS_16960 118210 118554 gene locus_tag LOCUS_16970 118210 118554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 120277 118568 gene locus_tag LOCUS_16980 120277 118568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 120720 120325 gene locus_tag LOCUS_16990 120720 120325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 120844 120770 gene locus_tag LOCUS_t00210 120844 120770 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 121106 122251 gene locus_tag LOCUS_17000 121106 122251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 122440 122156 gene locus_tag LOCUS_17010 122440 122156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 122346 124727 gene locus_tag LOCUS_17020 122346 124727 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730364.1 protein_id gnl|my_center|LOCUS_17020 124855 125700 gene locus_tag LOCUS_17030 124855 125700 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405719.1 protein_id gnl|my_center|LOCUS_17030 126996 125776 gene locus_tag LOCUS_17040 126996 125776 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730434.1 protein_id gnl|my_center|LOCUS_17040 128016 127072 gene locus_tag LOCUS_17050 128016 127072 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066509.1 protein_id gnl|my_center|LOCUS_17050 128148 129554 gene locus_tag LOCUS_17060 128148 129554 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730431.1 protein_id gnl|my_center|LOCUS_17060 129551 130723 gene locus_tag LOCUS_17070 129551 130723 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084263.1 protein_id gnl|my_center|LOCUS_17070 130766 131962 gene locus_tag LOCUS_17080 gene ilvA 130766 131962 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070936216.1 protein_id gnl|my_center|LOCUS_17080 132268 131963 gene locus_tag LOCUS_17090 132268 131963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 132697 132350 gene locus_tag LOCUS_17100 132697 132350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 133370 132876 gene locus_tag LOCUS_17110 gene greA 133370 132876 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059312.1 protein_id gnl|my_center|LOCUS_17110 134330 133533 gene locus_tag LOCUS_17120 134330 133533 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863385.1 protein_id gnl|my_center|LOCUS_17120 135024 134353 gene locus_tag LOCUS_17130 135024 134353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 135781 135080 gene locus_tag LOCUS_17140 135781 135080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 136481 135783 gene locus_tag LOCUS_17150 136481 135783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 137042 136608 gene locus_tag LOCUS_17160 137042 136608 CDS product DUF4307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896663.1 protein_id gnl|my_center|LOCUS_17160 137243 138106 gene locus_tag LOCUS_17170 gene mca 137243 138106 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405746.1 protein_id gnl|my_center|LOCUS_17170 138103 138384 gene locus_tag LOCUS_17180 138103 138384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 138761 138426 gene locus_tag LOCUS_17190 138761 138426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 138643 138954 gene locus_tag LOCUS_17200 138643 138954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 139305 140411 gene locus_tag LOCUS_17210 139305 140411 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728590.1 protein_id gnl|my_center|LOCUS_17210 141772 140297 gene locus_tag LOCUS_17220 141772 140297 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229297.1 protein_id gnl|my_center|LOCUS_17220 141855 142298 gene locus_tag LOCUS_17230 141855 142298 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229298.1 protein_id gnl|my_center|LOCUS_17230 143003 142311 gene locus_tag LOCUS_17240 143003 142311 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084270.1 protein_id gnl|my_center|LOCUS_17240 143221 144003 gene locus_tag LOCUS_17250 143221 144003 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059325.1 protein_id gnl|my_center|LOCUS_17250 144959 144027 gene locus_tag LOCUS_17260 gene coaA 144959 144027 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059370.1 protein_id gnl|my_center|LOCUS_17260 145132 146358 gene locus_tag LOCUS_17270 145132 146358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104479.1 protein_id gnl|my_center|LOCUS_17270 146368 147678 gene locus_tag LOCUS_17280 gene glyA 146368 147678 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856790.1 protein_id gnl|my_center|LOCUS_17280 147759 148592 gene locus_tag LOCUS_17290 147759 148592 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093403.1 protein_id gnl|my_center|LOCUS_17290 150256 148616 gene locus_tag LOCUS_17300 150256 148616 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978031.1 protein_id gnl|my_center|LOCUS_17300 150604 151902 gene locus_tag LOCUS_17310 150604 151902 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405802.1 protein_id gnl|my_center|LOCUS_17310 152217 152005 gene locus_tag LOCUS_17320 152217 152005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 152108 152749 gene locus_tag LOCUS_17330 152108 152749 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908940.1 protein_id gnl|my_center|LOCUS_17330 152841 153881 gene locus_tag LOCUS_17340 152841 153881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 155363 153957 gene locus_tag LOCUS_17350 155363 153957 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405805.1 protein_id gnl|my_center|LOCUS_17350 156440 155427 gene locus_tag LOCUS_17360 gene glpX 156440 155427 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856830.1 protein_id gnl|my_center|LOCUS_17360 156509 157093 gene locus_tag LOCUS_17370 156509 157093 CDS product DUF4245 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405815.1 protein_id gnl|my_center|LOCUS_17370 157417 157112 gene locus_tag LOCUS_17380 157417 157112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 158640 157420 gene locus_tag LOCUS_17390 gene xseA 158640 157420 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110032.1 protein_id gnl|my_center|LOCUS_17390 159574 158732 gene locus_tag LOCUS_17400 159574 158732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 159468 159725 gene locus_tag LOCUS_17410 159468 159725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 159736 160701 gene locus_tag LOCUS_17420 159736 160701 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296404.1 protein_id gnl|my_center|LOCUS_17420 160711 162015 gene locus_tag LOCUS_17430 160711 162015 CDS product type VII secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111994.1 protein_id gnl|my_center|LOCUS_17430 162204 162647 gene locus_tag LOCUS_17440 gene rplM 162204 162647 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056000.1 protein_id gnl|my_center|LOCUS_17440 162644 163213 gene locus_tag LOCUS_17450 gene rpsI 162644 163213 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892945.1 protein_id gnl|my_center|LOCUS_17450 163329 164681 gene locus_tag LOCUS_17460 gene glmM 163329 164681 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892947.1 protein_id gnl|my_center|LOCUS_17460 164678 165442 gene locus_tag LOCUS_17470 164678 165442 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230405.1 protein_id gnl|my_center|LOCUS_17470 165563 165874 gene locus_tag LOCUS_17480 165563 165874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 165871 167346 gene locus_tag LOCUS_17490 165871 167346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 167343 167588 gene locus_tag LOCUS_17500 167343 167588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 168494 167619 gene locus_tag LOCUS_17510 168494 167619 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418298.1 protein_id gnl|my_center|LOCUS_17510 168558 170420 gene locus_tag LOCUS_17520 gene glmS 168558 170420 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466588.1 protein_id gnl|my_center|LOCUS_17520 170426 171886 gene locus_tag LOCUS_17530 170426 171886 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418280.1 protein_id gnl|my_center|LOCUS_17530 171883 173058 gene locus_tag LOCUS_17540 gene alr 171883 173058 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023637501.1 protein_id gnl|my_center|LOCUS_17540 173084 174139 gene locus_tag LOCUS_17550 173084 174139 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250368.1 protein_id gnl|my_center|LOCUS_17550 174136 174624 gene locus_tag LOCUS_17560 gene tsaE 174136 174624 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080598.1 protein_id gnl|my_center|LOCUS_17560 174636 175307 gene locus_tag LOCUS_17570 gene tsaB 174636 175307 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727750.1 protein_id gnl|my_center|LOCUS_17570 175304 175801 gene locus_tag LOCUS_17580 gene rimI 175304 175801 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418034.1 protein_id gnl|my_center|LOCUS_17580 175798 176829 gene locus_tag LOCUS_17590 gene tsaD 175798 176829 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222664.1 protein_id gnl|my_center|LOCUS_17590 177310 176816 gene locus_tag LOCUS_17600 177310 176816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 177480 178937 gene locus_tag LOCUS_17610 177480 178937 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229300.1 protein_id gnl|my_center|LOCUS_17610 179097 179396 gene locus_tag LOCUS_17620 gene groES 179097 179396 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892970.1 protein_id gnl|my_center|LOCUS_17620 179565 181184 gene locus_tag LOCUS_17630 gene groL 179565 181184 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727753.1 protein_id gnl|my_center|LOCUS_17630 181574 181278 gene locus_tag LOCUS_17640 181574 181278 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893002.1 protein_id gnl|my_center|LOCUS_17640 182033 182911 gene locus_tag LOCUS_17650 182033 182911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080646.1 protein_id gnl|my_center|LOCUS_17650 183281 183676 gene locus_tag LOCUS_17660 183281 183676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 183673 184593 gene locus_tag LOCUS_17670 183673 184593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17670 185023 184637 gene locus_tag LOCUS_17680 185023 184637 CDS product DUF5319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056069.1 protein_id gnl|my_center|LOCUS_17680 185269 186828 gene locus_tag LOCUS_17690 gene guaB 185269 186828 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727766.1 protein_id gnl|my_center|LOCUS_17690 186904 188046 gene locus_tag LOCUS_17700 186904 188046 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727767.1 protein_id gnl|my_center|LOCUS_17700 188184 189992 gene locus_tag LOCUS_17710 188184 189992 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893009.1 protein_id gnl|my_center|LOCUS_17710 190003 191610 gene locus_tag LOCUS_17720 gene guaA 190003 191610 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080654.1 protein_id gnl|my_center|LOCUS_17720 191969 191775 gene locus_tag LOCUS_17730 191969 191775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 193338 191962 gene locus_tag LOCUS_17740 193338 191962 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111981.1 protein_id gnl|my_center|LOCUS_17740 193433 194758 gene locus_tag LOCUS_17750 193433 194758 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080659.1 protein_id gnl|my_center|LOCUS_17750 194755 195426 gene locus_tag LOCUS_17760 194755 195426 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296686.1 protein_id gnl|my_center|LOCUS_17760 195777 197708 gene locus_tag LOCUS_17770 195777 197708 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_17770 199726 198836 gene locus_tag LOCUS_17780 199726 198836 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109953.1 protein_id gnl|my_center|LOCUS_17780 200931 199723 gene locus_tag LOCUS_17790 200931 199723 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896840.1 protein_id gnl|my_center|LOCUS_17790 201751 200963 gene locus_tag LOCUS_17800 201751 200963 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775993.1 protein_id gnl|my_center|LOCUS_17800 202364 201780 gene locus_tag LOCUS_17810 202364 201780 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027648.1 protein_id gnl|my_center|LOCUS_17810 202458 203426 gene locus_tag LOCUS_17820 202458 203426 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111640.1 protein_id gnl|my_center|LOCUS_17820 203596 204450 gene locus_tag LOCUS_17830 203596 204450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 204450 206045 gene locus_tag LOCUS_17840 204450 206045 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005116013.1 protein_id gnl|my_center|LOCUS_17840 207324 206062 gene locus_tag LOCUS_17850 207324 206062 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048040655.1 protein_id gnl|my_center|LOCUS_17850 208460 207384 gene locus_tag LOCUS_17860 208460 207384 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092926.1 protein_id gnl|my_center|LOCUS_17860 208622 209167 gene locus_tag LOCUS_17870 208622 209167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 209260 209949 gene locus_tag LOCUS_17880 209260 209949 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730861.1 protein_id gnl|my_center|LOCUS_17880 209951 210460 gene locus_tag LOCUS_17890 209951 210460 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229707.1 protein_id gnl|my_center|LOCUS_17890 210515 213829 gene locus_tag LOCUS_17900 210515 213829 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727789.1 protein_id gnl|my_center|LOCUS_17900 214016 215284 gene locus_tag LOCUS_17910 214016 215284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 215880 215416 gene locus_tag LOCUS_17920 215880 215416 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727792.1 protein_id gnl|my_center|LOCUS_17920 215971 216831 gene locus_tag LOCUS_17930 215971 216831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 216767 217357 gene locus_tag LOCUS_17940 216767 217357 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893048.1 protein_id gnl|my_center|LOCUS_17940 217395 218258 gene locus_tag LOCUS_17950 217395 218258 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893053.1 protein_id gnl|my_center|LOCUS_17950 218272 218607 gene locus_tag LOCUS_17960 218272 218607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 218650 220200 gene locus_tag LOCUS_17970 218650 220200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 221386 220229 gene locus_tag LOCUS_17980 221386 220229 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417458.1 protein_id gnl|my_center|LOCUS_17980 222720 221389 gene locus_tag LOCUS_17990 222720 221389 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893059.1 protein_id gnl|my_center|LOCUS_17990 223116 224375 gene locus_tag LOCUS_18000 223116 224375 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084599.1 protein_id gnl|my_center|LOCUS_18000 224404 225231 gene locus_tag LOCUS_18010 224404 225231 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080720.1 protein_id gnl|my_center|LOCUS_18010 225246 226262 gene locus_tag LOCUS_18020 gene trpS 225246 226262 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727804.1 protein_id gnl|my_center|LOCUS_18020 226293 227348 gene locus_tag LOCUS_18030 gene yhjD 226293 227348 CDS product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727805.1 protein_id gnl|my_center|LOCUS_18030 228679 227354 gene locus_tag LOCUS_18040 228679 227354 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056119.1 protein_id gnl|my_center|LOCUS_18040 229503 228706 gene locus_tag LOCUS_18050 229503 228706 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014152.1 protein_id gnl|my_center|LOCUS_18050 231185 229788 gene locus_tag LOCUS_18060 231185 229788 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893069.1 protein_id gnl|my_center|LOCUS_18060 231634 231182 gene locus_tag LOCUS_18070 231634 231182 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877152.1 protein_id gnl|my_center|LOCUS_18070 231745 233235 gene locus_tag LOCUS_18080 231745 233235 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877153.1 protein_id gnl|my_center|LOCUS_18080 233232 234656 gene locus_tag LOCUS_18090 233232 234656 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_18090 234765 235229 gene locus_tag LOCUS_18100 234765 235229 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776962.1 protein_id gnl|my_center|LOCUS_18100 236169 235258 gene locus_tag LOCUS_18110 236169 235258 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727781.1 protein_id gnl|my_center|LOCUS_18110 237649 236159 gene locus_tag LOCUS_18120 237649 236159 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081393.1 protein_id gnl|my_center|LOCUS_18120 237820 238479 gene locus_tag LOCUS_18130 237820 238479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 239381 238458 gene locus_tag LOCUS_18140 239381 238458 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401058.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18140 240075 239569 gene locus_tag LOCUS_18150 240075 239569 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401060.1 protein_id gnl|my_center|LOCUS_18150 240170 241096 gene locus_tag LOCUS_18160 240170 241096 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728516.1 protein_id gnl|my_center|LOCUS_18160 242406 241144 gene locus_tag LOCUS_18170 242406 241144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 242517 243509 gene locus_tag LOCUS_18180 242517 243509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 244403 243594 gene locus_tag LOCUS_18190 244403 243594 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893076.1 protein_id gnl|my_center|LOCUS_18190 246157 244403 gene locus_tag LOCUS_18200 gene sdhA 246157 244403 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056124.1 protein_id gnl|my_center|LOCUS_18200 246664 246209 gene locus_tag LOCUS_18210 246664 246209 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417269.1 protein_id gnl|my_center|LOCUS_18210 247015 246680 gene locus_tag LOCUS_18220 247015 246680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 247310 247735 gene locus_tag LOCUS_18230 247310 247735 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056128.1 protein_id gnl|my_center|LOCUS_18230 247732 249060 gene locus_tag LOCUS_18240 247732 249060 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872150.1 protein_id gnl|my_center|LOCUS_18240 249057 250202 gene locus_tag LOCUS_18250 249057 250202 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080733.1 protein_id gnl|my_center|LOCUS_18250 251517 250225 gene locus_tag LOCUS_18260 251517 250225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111962.1 protein_id gnl|my_center|LOCUS_18260 252688 251606 gene locus_tag LOCUS_18270 252688 251606 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727826.1 protein_id gnl|my_center|LOCUS_18270 252990 252685 gene locus_tag LOCUS_18280 252990 252685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 253069 253692 gene locus_tag LOCUS_18290 gene upp 253069 253692 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893093.1 protein_id gnl|my_center|LOCUS_18290 254474 253674 gene locus_tag LOCUS_18300 254474 253674 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775985.1 protein_id gnl|my_center|LOCUS_18300 256138 254471 gene locus_tag LOCUS_18310 256138 254471 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080741.1 protein_id gnl|my_center|LOCUS_18310 256965 256135 gene locus_tag LOCUS_18320 256965 256135 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727836.1 protein_id gnl|my_center|LOCUS_18320 257021 257704 gene locus_tag LOCUS_18330 257021 257704 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063534.1 protein_id gnl|my_center|LOCUS_18330 257704 258861 gene locus_tag LOCUS_18340 257704 258861 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510626.1 protein_id gnl|my_center|LOCUS_18340 259320 258865 gene locus_tag LOCUS_18350 259320 258865 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417219.1 protein_id gnl|my_center|LOCUS_18350 259512 260933 gene locus_tag LOCUS_18360 259512 260933 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080749.1 protein_id gnl|my_center|LOCUS_18360 261064 262242 gene locus_tag LOCUS_18370 261064 262242 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028898.1 protein_id gnl|my_center|LOCUS_18370 262286 263110 gene locus_tag LOCUS_18380 262286 263110 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227801.1 protein_id gnl|my_center|LOCUS_18380 263964 263122 gene locus_tag LOCUS_18390 263964 263122 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731359.1 protein_id gnl|my_center|LOCUS_18390 264479 264057 gene locus_tag LOCUS_18400 264479 264057 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894178.1 protein_id gnl|my_center|LOCUS_18400 265315 264533 gene locus_tag LOCUS_18410 265315 264533 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_18410 270167 265317 gene locus_tag LOCUS_18420 270167 265317 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727880.1 protein_id gnl|my_center|LOCUS_18420 270459 270692 gene locus_tag LOCUS_18430 270459 270692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 270730 271551 gene locus_tag LOCUS_18440 270730 271551 CDS product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731030.1 protein_id gnl|my_center|LOCUS_18440 271686 272111 gene locus_tag LOCUS_18450 271686 272111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 272200 273423 gene locus_tag LOCUS_18460 272200 273423 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877816.1 protein_id gnl|my_center|LOCUS_18460 274516 273494 gene locus_tag LOCUS_18470 274516 273494 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013583.1 protein_id gnl|my_center|LOCUS_18470 275086 274694 gene locus_tag LOCUS_18480 275086 274694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080773.1 protein_id gnl|my_center|LOCUS_18480 276921 275125 gene locus_tag LOCUS_18490 276921 275125 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893197.1 protein_id gnl|my_center|LOCUS_18490 278525 277056 gene locus_tag LOCUS_18500 278525 277056 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029681.1 protein_id gnl|my_center|LOCUS_18500 278979 278545 gene locus_tag LOCUS_18510 278979 278545 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080777.1 protein_id gnl|my_center|LOCUS_18510 279860 278976 gene locus_tag LOCUS_18520 279860 278976 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077428.1 protein_id gnl|my_center|LOCUS_18520 281336 279951 gene locus_tag LOCUS_18530 281336 279951 CDS product peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014153.1 protein_id gnl|my_center|LOCUS_18530 282810 281317 gene locus_tag LOCUS_18540 282810 281317 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726923.1 protein_id gnl|my_center|LOCUS_18540 284332 282821 gene locus_tag LOCUS_18550 284332 282821 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029681.1 protein_id gnl|my_center|LOCUS_18550 284802 285821 gene locus_tag LOCUS_18560 284802 285821 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029252.1 protein_id gnl|my_center|LOCUS_18560 285818 286624 gene locus_tag LOCUS_18570 285818 286624 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975109.1 protein_id gnl|my_center|LOCUS_18570 287559 286657 gene locus_tag LOCUS_18580 287559 286657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 288962 287658 gene locus_tag LOCUS_18590 288962 287658 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407676.1 protein_id gnl|my_center|LOCUS_18590 289143 290504 gene locus_tag LOCUS_18600 289143 290504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730045.1 protein_id gnl|my_center|LOCUS_18600 290557 291894 gene locus_tag LOCUS_18610 290557 291894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086672.1 protein_id gnl|my_center|LOCUS_18610 293263 291905 gene locus_tag LOCUS_18620 293263 291905 CDS product peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014153.1 protein_id gnl|my_center|LOCUS_18620 294699 293260 gene locus_tag LOCUS_18630 294699 293260 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730043.1 protein_id gnl|my_center|LOCUS_18630 296204 294696 gene locus_tag LOCUS_18640 296204 294696 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083311.1 protein_id gnl|my_center|LOCUS_18640 297442 296465 gene locus_tag LOCUS_18650 297442 296465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 298899 297604 gene locus_tag LOCUS_18660 298899 297604 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730052.1 protein_id gnl|my_center|LOCUS_18660 300257 298905 gene locus_tag LOCUS_18670 300257 298905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 301184 300333 gene locus_tag LOCUS_18680 301184 300333 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640613.1 protein_id gnl|my_center|LOCUS_18680 302245 301181 gene locus_tag LOCUS_18690 302245 301181 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230441.1 protein_id gnl|my_center|LOCUS_18690 303014 302415 gene locus_tag LOCUS_18700 303014 302415 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222850.1 protein_id gnl|my_center|LOCUS_18700 303463 303062 gene locus_tag LOCUS_18710 303463 303062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 305088 303460 gene locus_tag LOCUS_18720 305088 303460 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056191.1 protein_id gnl|my_center|LOCUS_18720 305200 306033 gene locus_tag LOCUS_18730 305200 306033 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727931.1 protein_id gnl|my_center|LOCUS_18730 306705 306034 gene locus_tag LOCUS_18740 306705 306034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 306887 307426 gene locus_tag LOCUS_18750 306887 307426 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056202.1 protein_id gnl|my_center|LOCUS_18750 307443 308120 gene locus_tag LOCUS_18760 307443 308120 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222890.1 protein_id gnl|my_center|LOCUS_18760 308152 309468 gene locus_tag LOCUS_18770 308152 309468 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222891.1 protein_id gnl|my_center|LOCUS_18770 310048 309482 gene locus_tag LOCUS_18780 310048 309482 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893209.1 protein_id gnl|my_center|LOCUS_18780 310256 311434 gene locus_tag LOCUS_18790 310256 311434 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056211.1 protein_id gnl|my_center|LOCUS_18790 311427 311984 gene locus_tag LOCUS_18800 gene purE 311427 311984 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877211.1 protein_id gnl|my_center|LOCUS_18800 312816 311992 gene locus_tag LOCUS_18810 312816 311992 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111854.1 protein_id gnl|my_center|LOCUS_18810 312962 314122 gene locus_tag LOCUS_18820 312962 314122 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893212.1 protein_id gnl|my_center|LOCUS_18820 314891 314160 gene locus_tag LOCUS_18830 314891 314160 CDS product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111929.1 protein_id gnl|my_center|LOCUS_18830 316389 314959 gene locus_tag LOCUS_18840 gene lcp1 316389 314959 CDS product phosphotransferase Lcp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417107.1 protein_id gnl|my_center|LOCUS_18840 316913 317848 gene locus_tag LOCUS_18850 gene rfbD 316913 317848 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417101.1 protein_id gnl|my_center|LOCUS_18850 317911 318810 gene locus_tag LOCUS_18860 317911 318810 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094336.1 protein_id gnl|my_center|LOCUS_18860 318811 319923 gene locus_tag LOCUS_18870 318811 319923 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080830.1 protein_id gnl|my_center|LOCUS_18870 319935 320735 gene locus_tag LOCUS_18880 319935 320735 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742086.1 protein_id gnl|my_center|LOCUS_18880 321453 320761 gene locus_tag LOCUS_18890 321453 320761 CDS product SAM-dependent O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911448.1 protein_id gnl|my_center|LOCUS_18890 321750 322412 gene locus_tag LOCUS_18900 321750 322412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 322573 323082 gene locus_tag LOCUS_18910 322573 323082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 323111 324661 gene locus_tag LOCUS_18920 323111 324661 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110085.1 protein_id gnl|my_center|LOCUS_18920 324675 325190 gene locus_tag LOCUS_18930 324675 325190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 326346 325210 gene locus_tag LOCUS_18940 326346 325210 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074275.1 protein_id gnl|my_center|LOCUS_18940 327724 326408 gene locus_tag LOCUS_18950 327724 326408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 328499 327957 gene locus_tag LOCUS_18960 328499 327957 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060011.1 protein_id gnl|my_center|LOCUS_18960 329788 328496 gene locus_tag LOCUS_18970 329788 328496 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084763.1 protein_id gnl|my_center|LOCUS_18970 329954 330922 gene locus_tag LOCUS_18980 329954 330922 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730292.1 protein_id gnl|my_center|LOCUS_18980 330994 331485 gene locus_tag LOCUS_18990 330994 331485 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406290.1 protein_id gnl|my_center|LOCUS_18990 331638 333134 gene locus_tag LOCUS_19000 331638 333134 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730290.1 protein_id gnl|my_center|LOCUS_19000 333131 334138 gene locus_tag LOCUS_19010 333131 334138 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074284.1 protein_id gnl|my_center|LOCUS_19010 334147 334977 gene locus_tag LOCUS_19020 334147 334977 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059671.1 protein_id gnl|my_center|LOCUS_19020 334980 336155 gene locus_tag LOCUS_19030 gene ugpC 334980 336155 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222991.1 protein_id gnl|my_center|LOCUS_19030 337083 336226 gene locus_tag LOCUS_19040 337083 336226 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223001.1 protein_id gnl|my_center|LOCUS_19040 337855 337073 gene locus_tag LOCUS_19050 337855 337073 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223002.1 protein_id gnl|my_center|LOCUS_19050 337917 338516 gene locus_tag LOCUS_19060 337917 338516 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110093.1 protein_id gnl|my_center|LOCUS_19060 339586 338519 gene locus_tag LOCUS_19070 gene corA 339586 338519 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730286.1 protein_id gnl|my_center|LOCUS_19070 339639 340637 gene locus_tag LOCUS_19080 339639 340637 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093006.1 protein_id gnl|my_center|LOCUS_19080 340639 341427 gene locus_tag LOCUS_19090 340639 341427 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972454.1 protein_id gnl|my_center|LOCUS_19090 342603 341419 gene locus_tag LOCUS_19100 342603 341419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065474.1 protein_id gnl|my_center|LOCUS_19100 343548 342634 gene locus_tag LOCUS_19110 343548 342634 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206170.1 protein_id gnl|my_center|LOCUS_19110 344380 343553 gene locus_tag LOCUS_19120 344380 343553 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416074.1 protein_id gnl|my_center|LOCUS_19120 345915 344395 gene locus_tag LOCUS_19130 345915 344395 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028809.1 protein_id gnl|my_center|LOCUS_19130 345965 346585 gene locus_tag LOCUS_19140 345965 346585 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164275233.1 protein_id gnl|my_center|LOCUS_19140 350594 346686 gene locus_tag LOCUS_19150 350594 346686 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730279.1 protein_id gnl|my_center|LOCUS_19150 354777 350890 gene locus_tag LOCUS_19160 354777 350890 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229685.1 protein_id gnl|my_center|LOCUS_19160 355565 354774 gene locus_tag LOCUS_19170 355565 354774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896454.1 protein_id gnl|my_center|LOCUS_19170 356635 355562 gene locus_tag LOCUS_19180 356635 355562 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079769.1 protein_id gnl|my_center|LOCUS_19180 356764 357468 gene locus_tag LOCUS_19190 356764 357468 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222853.1 protein_id gnl|my_center|LOCUS_19190 357465 359036 gene locus_tag LOCUS_19200 357465 359036 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730278.1 protein_id gnl|my_center|LOCUS_19200 359085 359768 gene locus_tag LOCUS_19210 359085 359768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 361386 359755 gene locus_tag LOCUS_19220 361386 359755 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728275.1 protein_id gnl|my_center|LOCUS_19220 361467 362654 gene locus_tag LOCUS_19230 361467 362654 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284170.1 protein_id gnl|my_center|LOCUS_19230 362651 365635 gene locus_tag LOCUS_19240 362651 365635 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229784.1 protein_id gnl|my_center|LOCUS_19240 365710 365785 gene locus_tag LOCUS_t00220 365710 365785 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 365840 367126 gene locus_tag LOCUS_19250 365840 367126 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730052.1 protein_id gnl|my_center|LOCUS_19250 368048 367179 gene locus_tag LOCUS_19260 gene pcaA 368048 367179 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892739.1 protein_id gnl|my_center|LOCUS_19260 369183 368164 gene locus_tag LOCUS_19270 369183 368164 CDS product (R)-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082714.1 protein_id gnl|my_center|LOCUS_19270 370071 369301 gene locus_tag LOCUS_19280 370071 369301 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229546.1 protein_id gnl|my_center|LOCUS_19280 370876 370076 gene locus_tag LOCUS_19290 370876 370076 CDS product DUF3105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229545.1 protein_id gnl|my_center|LOCUS_19290 370806 371090 gene locus_tag LOCUS_19300 370806 371090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 371136 372788 gene locus_tag LOCUS_19310 gene argS 371136 372788 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730214.1 protein_id gnl|my_center|LOCUS_19310 372788 374206 gene locus_tag LOCUS_19320 gene lysA 372788 374206 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296430.1 protein_id gnl|my_center|LOCUS_19320 374203 375513 gene locus_tag LOCUS_19330 374203 375513 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730212.1 protein_id gnl|my_center|LOCUS_19330 375506 376597 gene locus_tag LOCUS_19340 gene thrC 375506 376597 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730211.1 protein_id gnl|my_center|LOCUS_19340 376606 377529 gene locus_tag LOCUS_19350 gene thrB 376606 377529 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110130.1 protein_id gnl|my_center|LOCUS_19350 377874 380051 gene locus_tag LOCUS_19360 377874 380051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 380798 380085 gene locus_tag LOCUS_19370 380798 380085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19370 381071 381319 gene locus_tag LOCUS_19380 gene rpmE 381071 381319 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059822.1 protein_id gnl|my_center|LOCUS_19380 381407 382486 gene locus_tag LOCUS_19390 gene prfA 381407 382486 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059825.1 protein_id gnl|my_center|LOCUS_19390 382483 383421 gene locus_tag LOCUS_19400 gene prmC 382483 383421 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730206.1 protein_id gnl|my_center|LOCUS_19400 383426 384079 gene locus_tag LOCUS_19410 383426 384079 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730205.1 protein_id gnl|my_center|LOCUS_19410 384196 385365 gene locus_tag LOCUS_19420 gene rfe 384196 385365 CDS product UDP-N-acetylglucosamine--decaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898816.1 protein_id gnl|my_center|LOCUS_19420 385634 386050 gene locus_tag LOCUS_19430 385634 386050 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074366.1 protein_id gnl|my_center|LOCUS_19430 386047 386829 gene locus_tag LOCUS_19440 gene atpB 386047 386829 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878188.1 protein_id gnl|my_center|LOCUS_19440 387033 387284 gene locus_tag LOCUS_19450 387033 387284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 387323 387823 gene locus_tag LOCUS_19460 387323 387823 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059844.1 protein_id gnl|my_center|LOCUS_19460 387826 389175 gene locus_tag LOCUS_19470 387826 389175 CDS product F0F1 ATP synthase subunit B/delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110133.1 protein_id gnl|my_center|LOCUS_19470 389236 390867 gene locus_tag LOCUS_19480 gene atpA 389236 390867 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896330.1 protein_id gnl|my_center|LOCUS_19480 390922 391866 gene locus_tag LOCUS_19490 390922 391866 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229523.1 protein_id gnl|my_center|LOCUS_19490 391954 393405 gene locus_tag LOCUS_19500 gene atpD 391954 393405 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014204.1 protein_id gnl|my_center|LOCUS_19500 393415 393801 gene locus_tag LOCUS_19510 393415 393801 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229521.1 protein_id gnl|my_center|LOCUS_19510 393980 394420 gene locus_tag LOCUS_19520 393980 394420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 395018 394425 gene locus_tag LOCUS_19530 395018 394425 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406839.1 protein_id gnl|my_center|LOCUS_19530 395093 396352 gene locus_tag LOCUS_19540 gene murA 395093 396352 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084647.1 protein_id gnl|my_center|LOCUS_19540 >Feature sequence13 <1 1122 gene locus_tag LOCUS_19550 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730797.1:folate-binding protein YgfZ 1119 1805 gene locus_tag LOCUS_19560 1119 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 3101 1809 gene locus_tag LOCUS_19570 3101 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 3322 3501 gene locus_tag LOCUS_19580 3322 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 4684 3566 gene locus_tag LOCUS_19590 gene purM 4684 3566 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897216.1 protein_id gnl|my_center|LOCUS_19590 6385 4706 gene locus_tag LOCUS_19600 6385 4706 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092467.1 protein_id gnl|my_center|LOCUS_19600 7347 6382 gene locus_tag LOCUS_19610 7347 6382 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115089.1 protein_id gnl|my_center|LOCUS_19610 8484 7357 gene locus_tag LOCUS_19620 8484 7357 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087153.1 protein_id gnl|my_center|LOCUS_19620 10102 8486 gene locus_tag LOCUS_19630 10102 8486 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113217.1 protein_id gnl|my_center|LOCUS_19630 10321 12312 gene locus_tag LOCUS_19640 10321 12312 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727591.1 protein_id gnl|my_center|LOCUS_19640 13903 12329 gene locus_tag LOCUS_19650 gene purF 13903 12329 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730800.1 protein_id gnl|my_center|LOCUS_19650 14408 14025 gene locus_tag LOCUS_19660 14408 14025 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404127.1 protein_id gnl|my_center|LOCUS_19660 14478 14825 gene locus_tag LOCUS_19670 14478 14825 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976333.1 protein_id gnl|my_center|LOCUS_19670 14889 16397 gene locus_tag LOCUS_19680 14889 16397 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033261568.1 protein_id gnl|my_center|LOCUS_19680 16440 16892 gene locus_tag LOCUS_19690 16440 16892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 17763 16918 gene locus_tag LOCUS_19700 17763 16918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 18887 17808 gene locus_tag LOCUS_19710 18887 17808 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112528.1 protein_id gnl|my_center|LOCUS_19710 19211 19017 gene locus_tag LOCUS_19720 19211 19017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 21493 19208 gene locus_tag LOCUS_19730 gene purL 21493 19208 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064180.1 protein_id gnl|my_center|LOCUS_19730 21642 23447 gene locus_tag LOCUS_19740 gene eccA1 21642 23447 CDS product type VII secretion system ESX-1 AAA family ATPase EccA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891386.1 protein_id gnl|my_center|LOCUS_19740 23546 24298 gene locus_tag LOCUS_19750 23546 24298 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731593.1 protein_id gnl|my_center|LOCUS_19750 28315 24305 gene locus_tag LOCUS_19760 28315 24305 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055990.1 protein_id gnl|my_center|LOCUS_19760 28394 29962 gene locus_tag LOCUS_19770 gene eccD 28394 29962 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055988.1 protein_id gnl|my_center|LOCUS_19770 29959 31425 gene locus_tag LOCUS_19780 gene mycP 29959 31425 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111995.1 protein_id gnl|my_center|LOCUS_19780 31425 32198 gene locus_tag LOCUS_19790 31425 32198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 32212 32940 gene locus_tag LOCUS_19800 32212 32940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 32937 34799 gene locus_tag LOCUS_19810 32937 34799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 35240 34815 gene locus_tag LOCUS_19820 35240 34815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 36679 35240 gene locus_tag LOCUS_19830 gene eccB 36679 35240 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077544.1 protein_id gnl|my_center|LOCUS_19830 36796 38829 gene locus_tag LOCUS_19840 gene eccE 36796 38829 CDS product type VII secretion protein EccE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094468.1 protein_id gnl|my_center|LOCUS_19840 39198 38908 gene locus_tag LOCUS_19850 39198 38908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 39542 39228 gene locus_tag LOCUS_19860 39542 39228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 40427 39630 gene locus_tag LOCUS_19870 40427 39630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 41416 40424 gene locus_tag LOCUS_19880 41416 40424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 41780 41475 gene locus_tag LOCUS_19890 41780 41475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 43062 41824 gene locus_tag LOCUS_19900 43062 41824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 43433 43116 gene locus_tag LOCUS_19910 43433 43116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 45172 43565 gene locus_tag LOCUS_19920 45172 43565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 45495 45172 gene locus_tag LOCUS_19930 45495 45172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 45964 45530 gene locus_tag LOCUS_19940 45964 45530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 46211 46666 gene locus_tag LOCUS_19950 46211 46666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 46663 47088 gene locus_tag LOCUS_19960 46663 47088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 47418 47101 gene locus_tag LOCUS_19970 47418 47101 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777070.1 protein_id gnl|my_center|LOCUS_19970 47780 47418 gene locus_tag LOCUS_19980 47780 47418 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777071.1 protein_id gnl|my_center|LOCUS_19980 48550 47777 gene locus_tag LOCUS_19990 48550 47777 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_19990 50409 48547 gene locus_tag LOCUS_20000 gene cysC 50409 48547 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085844.1 protein_id gnl|my_center|LOCUS_20000 51323 50409 gene locus_tag LOCUS_20010 gene cysD 51323 50409 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466878.1 protein_id gnl|my_center|LOCUS_20010 51418 52275 gene locus_tag LOCUS_20020 51418 52275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 52318 53214 gene locus_tag LOCUS_20030 52318 53214 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225244.1 protein_id gnl|my_center|LOCUS_20030 53215 54399 gene locus_tag LOCUS_20040 53215 54399 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 protein_id gnl|my_center|LOCUS_20040 54396 55364 gene locus_tag LOCUS_20050 54396 55364 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113158.1 protein_id gnl|my_center|LOCUS_20050 55361 56470 gene locus_tag LOCUS_20060 55361 56470 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742091.1 protein_id gnl|my_center|LOCUS_20060 56540 57790 gene locus_tag LOCUS_20070 56540 57790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 58953 57787 gene locus_tag LOCUS_20080 58953 57787 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878493.1 protein_id gnl|my_center|LOCUS_20080 59764 58982 gene locus_tag LOCUS_20090 59764 58982 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419223.1 protein_id gnl|my_center|LOCUS_20090 60992 59772 gene locus_tag LOCUS_20100 60992 59772 CDS product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085850.1 protein_id gnl|my_center|LOCUS_20100 61321 60983 gene locus_tag LOCUS_20110 61321 60983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20110 61557 61318 gene locus_tag LOCUS_20120 61557 61318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20120 62485 61559 gene locus_tag LOCUS_20130 gene hsaC 62485 61559 CDS product iron-dependent extradiol dioxygenase HsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419378.1 protein_id gnl|my_center|LOCUS_20130 63671 62490 gene locus_tag LOCUS_20140 gene hsaA 63671 62490 CDS product flavin-dependent monooxygenase oxygenase subunit HsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900101.1 protein_id gnl|my_center|LOCUS_20140 63853 65055 gene locus_tag LOCUS_20150 63853 65055 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897322.1 protein_id gnl|my_center|LOCUS_20150 65060 65422 gene locus_tag LOCUS_20160 65060 65422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 65490 66290 gene locus_tag LOCUS_20170 65490 66290 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113379.1 protein_id gnl|my_center|LOCUS_20170 66416 67342 gene locus_tag LOCUS_20180 66416 67342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148043383.1 protein_id gnl|my_center|LOCUS_20180 68453 67404 gene locus_tag LOCUS_20190 gene dmpG 68453 67404 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419250.1 protein_id gnl|my_center|LOCUS_20190 69354 68455 gene locus_tag LOCUS_20200 69354 68455 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064835.1 protein_id gnl|my_center|LOCUS_20200 70161 69364 gene locus_tag LOCUS_20210 70161 69364 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419252.1 protein_id gnl|my_center|LOCUS_20210 70334 72022 gene locus_tag LOCUS_20220 gene kstD 70334 72022 CDS product 3-oxosteroid 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064832.1 protein_id gnl|my_center|LOCUS_20220 72022 72885 gene locus_tag LOCUS_20230 72022 72885 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224387.1 protein_id gnl|my_center|LOCUS_20230 73858 72896 gene locus_tag LOCUS_20240 73858 72896 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224311.1 protein_id gnl|my_center|LOCUS_20240 74609 73995 gene locus_tag LOCUS_20250 74609 73995 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727665.1 protein_id gnl|my_center|LOCUS_20250 74833 74705 gene locus_tag LOCUS_20260 74833 74705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 75004 76686 gene locus_tag LOCUS_20270 75004 76686 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135359439.1 protein_id gnl|my_center|LOCUS_20270 78350 76683 gene locus_tag LOCUS_20280 78350 76683 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086372.1 protein_id gnl|my_center|LOCUS_20280 79522 78347 gene locus_tag LOCUS_20290 79522 78347 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_20290 79959 79519 gene locus_tag LOCUS_20300 79959 79519 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064825.1 protein_id gnl|my_center|LOCUS_20300 80969 79956 gene locus_tag LOCUS_20310 gene chsH2 80969 79956 CDS product 3-oxo-23,24-bisnorchol-4,17(20)-dien-22-oyl-CoA hydratase subunit alpha ChsH2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419293.1 protein_id gnl|my_center|LOCUS_20310 82142 80976 gene locus_tag LOCUS_20320 82142 80976 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419296.1 protein_id gnl|my_center|LOCUS_20320 83229 82144 gene locus_tag LOCUS_20330 83229 82144 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085495.1 protein_id gnl|my_center|LOCUS_20330 84585 83386 gene locus_tag LOCUS_20340 84585 83386 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043779541.1 protein_id gnl|my_center|LOCUS_20340 84724 87270 gene locus_tag LOCUS_20350 84724 87270 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222319.1 protein_id gnl|my_center|LOCUS_20350 89508 87292 gene locus_tag LOCUS_20360 89508 87292 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113153.1 protein_id gnl|my_center|LOCUS_20360 89660 90361 gene locus_tag LOCUS_20370 gene kstR 89660 90361 CDS product cholesterol catabolism transcriptional regulator KstR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878540.1 protein_id gnl|my_center|LOCUS_20370 90358 91521 gene locus_tag LOCUS_20380 90358 91521 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727646.1 protein_id gnl|my_center|LOCUS_20380 91571 91984 gene locus_tag LOCUS_20390 91571 91984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 92594 92013 gene locus_tag LOCUS_20400 92594 92013 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977126.1 protein_id gnl|my_center|LOCUS_20400 92711 94489 gene locus_tag LOCUS_20410 92711 94489 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266447.1 protein_id gnl|my_center|LOCUS_20410 94773 95069 gene locus_tag LOCUS_20420 94773 95069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 95057 96313 gene locus_tag LOCUS_20430 95057 96313 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110870.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20430 97226 96333 gene locus_tag LOCUS_20440 97226 96333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726630.1 protein_id gnl|my_center|LOCUS_20440 98283 97291 gene locus_tag LOCUS_20450 98283 97291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729051.1 protein_id gnl|my_center|LOCUS_20450 101059 98531 gene locus_tag LOCUS_20460 gene clpC1 101059 98531 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731031.1 protein_id gnl|my_center|LOCUS_20460 101701 101276 gene locus_tag LOCUS_20470 101701 101276 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224929.1 protein_id gnl|my_center|LOCUS_20470 101796 102650 gene locus_tag LOCUS_20480 101796 102650 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035576.1 protein_id gnl|my_center|LOCUS_20480 102720 103334 gene locus_tag LOCUS_20490 102720 103334 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110057.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence14 1228 1722 gene locus_tag LOCUS_20500 1228 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 1719 2600 gene locus_tag LOCUS_20510 1719 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 3142 2597 gene locus_tag LOCUS_20520 3142 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 3168 3371 gene locus_tag LOCUS_20530 3168 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 3537 5855 gene locus_tag LOCUS_20540 gene lon 3537 5855 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729178.1 protein_id gnl|my_center|LOCUS_20540 6335 5913 gene locus_tag LOCUS_20550 6335 5913 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089439.1 protein_id gnl|my_center|LOCUS_20550 7064 6363 gene locus_tag LOCUS_20560 7064 6363 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089437.1 protein_id gnl|my_center|LOCUS_20560 7818 7129 gene locus_tag LOCUS_20570 7818 7129 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495802.1 protein_id gnl|my_center|LOCUS_20570 8138 7809 gene locus_tag LOCUS_20580 8138 7809 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897009.1 protein_id gnl|my_center|LOCUS_20580 8196 9311 gene locus_tag LOCUS_20590 8196 9311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 9332 9667 gene locus_tag LOCUS_20600 9332 9667 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112420.1 protein_id gnl|my_center|LOCUS_20600 10373 9672 gene locus_tag LOCUS_20610 10373 9672 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053776210.1 protein_id gnl|my_center|LOCUS_20610 13270 10382 gene locus_tag LOCUS_20620 gene leuS 13270 10382 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112800.1 protein_id gnl|my_center|LOCUS_20620 13272 13733 gene locus_tag LOCUS_20630 13272 13733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 13752 14744 gene locus_tag LOCUS_20640 13752 14744 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095694.1 protein_id gnl|my_center|LOCUS_20640 15996 14695 gene locus_tag LOCUS_20650 15996 14695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 16216 16848 gene locus_tag LOCUS_20660 16216 16848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 17478 16837 gene locus_tag LOCUS_20670 17478 16837 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978722.1 protein_id gnl|my_center|LOCUS_20670 17586 18251 gene locus_tag LOCUS_20680 17586 18251 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026888.1 protein_id gnl|my_center|LOCUS_20680 18990 18268 gene locus_tag LOCUS_20690 18990 18268 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 protein_id gnl|my_center|LOCUS_20690 19740 19024 gene locus_tag LOCUS_20700 19740 19024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 20448 19849 gene locus_tag LOCUS_20710 20448 19849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 20551 21744 gene locus_tag LOCUS_20720 20551 21744 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896567.1 protein_id gnl|my_center|LOCUS_20720 21823 23274 gene locus_tag LOCUS_20730 21823 23274 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392258.1 protein_id gnl|my_center|LOCUS_20730 23271 24377 gene locus_tag LOCUS_20740 23271 24377 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872371.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20740 24374 24778 gene locus_tag LOCUS_20750 24374 24778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 24775 25800 gene locus_tag LOCUS_20760 24775 25800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 25797 27146 gene locus_tag LOCUS_20770 25797 27146 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227665.1 protein_id gnl|my_center|LOCUS_20770 27621 27148 gene locus_tag LOCUS_20780 27621 27148 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223540.1 protein_id gnl|my_center|LOCUS_20780 28189 27629 gene locus_tag LOCUS_20790 28189 27629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 28414 28839 gene locus_tag LOCUS_20800 28414 28839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 28945 29793 gene locus_tag LOCUS_20810 28945 29793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 30738 29824 gene locus_tag LOCUS_20820 30738 29824 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189804125.1 protein_id gnl|my_center|LOCUS_20820 31406 30744 gene locus_tag LOCUS_20830 31406 30744 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064585.1 protein_id gnl|my_center|LOCUS_20830 31557 32963 gene locus_tag LOCUS_20840 31557 32963 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082819.1 protein_id gnl|my_center|LOCUS_20840 33589 32849 gene locus_tag LOCUS_20850 33589 32849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082823.1 protein_id gnl|my_center|LOCUS_20850 33482 33691 gene locus_tag LOCUS_20860 33482 33691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 33724 34815 gene locus_tag LOCUS_20870 gene egtE 33724 34815 CDS product ergothioneine biosynthesis PLP-dependent enzyme EgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731155.1 protein_id gnl|my_center|LOCUS_20870 36556 34841 gene locus_tag LOCUS_20880 36556 34841 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227541.1 protein_id gnl|my_center|LOCUS_20880 37709 36681 gene locus_tag LOCUS_20890 37709 36681 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898036.1 protein_id gnl|my_center|LOCUS_20890 37854 38129 gene locus_tag LOCUS_20900 37854 38129 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908691.1 protein_id gnl|my_center|LOCUS_20900 39395 38133 gene locus_tag LOCUS_20910 39395 38133 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728221.1 protein_id gnl|my_center|LOCUS_20910 41030 39441 gene locus_tag LOCUS_20920 41030 39441 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729740.1 protein_id gnl|my_center|LOCUS_20920 41692 41027 gene locus_tag LOCUS_20930 41692 41027 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089008.1 protein_id gnl|my_center|LOCUS_20930 41773 43374 gene locus_tag LOCUS_20940 41773 43374 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729741.1 protein_id gnl|my_center|LOCUS_20940 43371 44324 gene locus_tag LOCUS_20950 43371 44324 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411603.1 protein_id gnl|my_center|LOCUS_20950 44628 44458 gene locus_tag LOCUS_20960 44628 44458 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226939.1 protein_id gnl|my_center|LOCUS_20960 45267 44728 gene locus_tag LOCUS_20970 45267 44728 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897878.1 protein_id gnl|my_center|LOCUS_20970 45447 45671 gene locus_tag LOCUS_20980 45447 45671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 46307 45678 gene locus_tag LOCUS_20990 46307 45678 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889390.1 protein_id gnl|my_center|LOCUS_20990 47107 46304 gene locus_tag LOCUS_21000 47107 46304 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275383.1 protein_id gnl|my_center|LOCUS_21000 48045 47104 gene locus_tag LOCUS_21010 48045 47104 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275382.1 protein_id gnl|my_center|LOCUS_21010 48740 48042 gene locus_tag LOCUS_21020 48740 48042 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727406.1 protein_id gnl|my_center|LOCUS_21020 49417 48737 gene locus_tag LOCUS_21030 49417 48737 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225121.1 protein_id gnl|my_center|LOCUS_21030 49631 50356 gene locus_tag LOCUS_21040 49631 50356 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896957.1 protein_id gnl|my_center|LOCUS_21040 50840 50379 gene locus_tag LOCUS_21050 50840 50379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250160.1 protein_id gnl|my_center|LOCUS_21050 51996 50833 gene locus_tag LOCUS_21060 51996 50833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 53857 52388 gene locus_tag LOCUS_21070 53857 52388 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087655.1 protein_id gnl|my_center|LOCUS_21070 54011 55180 gene locus_tag LOCUS_21080 54011 55180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 55177 57774 gene locus_tag LOCUS_21090 55177 57774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950965.1 protein_id gnl|my_center|LOCUS_21090 57767 62086 gene locus_tag LOCUS_21100 57767 62086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 62158 62718 gene locus_tag LOCUS_21110 62158 62718 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015424.1 protein_id gnl|my_center|LOCUS_21110 62729 63796 gene locus_tag LOCUS_21120 62729 63796 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154831064.1 protein_id gnl|my_center|LOCUS_21120 63848 64510 gene locus_tag LOCUS_21130 gene sigM 63848 64510 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284380.1 protein_id gnl|my_center|LOCUS_21130 64575 65387 gene locus_tag LOCUS_21140 64575 65387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231057.1 protein_id gnl|my_center|LOCUS_21140 65455 66444 gene locus_tag LOCUS_21150 gene trxB 65455 66444 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731638.1 protein_id gnl|my_center|LOCUS_21150 66518 66865 gene locus_tag LOCUS_21160 gene trxA 66518 66865 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082899.1 protein_id gnl|my_center|LOCUS_21160 67043 68221 gene locus_tag LOCUS_21170 67043 68221 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898354.1 protein_id gnl|my_center|LOCUS_21170 68953 68249 gene locus_tag LOCUS_21180 68953 68249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731640.1 protein_id gnl|my_center|LOCUS_21180 70090 69116 gene locus_tag LOCUS_21190 70090 69116 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731641.1 protein_id gnl|my_center|LOCUS_21190 71160 70129 gene locus_tag LOCUS_21200 gene parA 71160 70129 CDS product chromosome partitioning ATPase ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731642.1 protein_id gnl|my_center|LOCUS_21200 71935 71264 gene locus_tag LOCUS_21210 gene rsmG 71935 71264 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036454143.1 protein_id gnl|my_center|LOCUS_21210 72614 72021 gene locus_tag LOCUS_21220 72614 72021 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064537.1 protein_id gnl|my_center|LOCUS_21220 73889 72696 gene locus_tag LOCUS_21230 gene yidC 73889 72696 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731644.1 protein_id gnl|my_center|LOCUS_21230 74256 73894 gene locus_tag LOCUS_21240 74256 73894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 74552 74253 gene locus_tag LOCUS_21250 74552 74253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 74837 74694 gene locus_tag LOCUS_21260 gene rpmH 74837 74694 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855320.1 protein_id gnl|my_center|LOCUS_21260 75442 76959 gene locus_tag LOCUS_21270 gene dnaA 75442 76959 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400253.1 protein_id gnl|my_center|LOCUS_21270 77512 78675 gene locus_tag LOCUS_21280 gene dnaN 77512 78675 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064525.1 protein_id gnl|my_center|LOCUS_21280 78741 79631 gene locus_tag LOCUS_21290 gene gnd 78741 79631 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079128.1 protein_id gnl|my_center|LOCUS_21290 79638 80828 gene locus_tag LOCUS_21300 gene recF 79638 80828 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726603.1 protein_id gnl|my_center|LOCUS_21300 80825 81373 gene locus_tag LOCUS_21310 80825 81373 CDS product DUF721 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087667.1 protein_id gnl|my_center|LOCUS_21310 81565 83748 gene locus_tag LOCUS_21320 gene gyrB 81565 83748 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082841.1 protein_id gnl|my_center|LOCUS_21320 83806 86319 gene locus_tag LOCUS_21330 gene gyrA 83806 86319 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064494.1 protein_id gnl|my_center|LOCUS_21330 86380 87495 gene locus_tag LOCUS_21340 86380 87495 CDS product DUF3566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950324.1 protein_id gnl|my_center|LOCUS_21340 87550 87624 gene locus_tag LOCUS_t00230 87550 87624 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 87749 87822 gene locus_tag LOCUS_t00240 87749 87822 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 88560 87847 gene locus_tag LOCUS_21350 88560 87847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 89031 88570 gene locus_tag LOCUS_21360 89031 88570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 89168 89695 gene locus_tag LOCUS_21370 89168 89695 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891350.1 protein_id gnl|my_center|LOCUS_21370 89851 90573 gene locus_tag LOCUS_21380 89851 90573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 91077 90592 gene locus_tag LOCUS_21390 91077 90592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 91448 91158 gene locus_tag LOCUS_21400 gene crgA 91448 91158 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891352.1 protein_id gnl|my_center|LOCUS_21400 91596 92327 gene locus_tag LOCUS_21410 91596 92327 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891354.1 protein_id gnl|my_center|LOCUS_21410 94243 92339 gene locus_tag LOCUS_21420 gene pknB 94243 92339 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400356.1 protein_id gnl|my_center|LOCUS_21420 >Feature sequence15 1735 233 gene locus_tag LOCUS_21430 gene gatB 1735 233 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093966.1 protein_id gnl|my_center|LOCUS_21430 1884 2564 gene locus_tag LOCUS_21440 1884 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 2561 3166 gene locus_tag LOCUS_21450 2561 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21450 3176 4078 gene locus_tag LOCUS_21460 3176 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21460 4206 4415 gene locus_tag LOCUS_21470 4206 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 5031 4399 gene locus_tag LOCUS_21480 5031 4399 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731532.1 protein_id gnl|my_center|LOCUS_21480 6105 5077 gene locus_tag LOCUS_21490 6105 5077 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804723.1 protein_id gnl|my_center|LOCUS_21490 6285 7160 gene locus_tag LOCUS_21500 6285 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 7783 7121 gene locus_tag LOCUS_21510 7783 7121 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031938971.1 protein_id gnl|my_center|LOCUS_21510 9008 7788 gene locus_tag LOCUS_21520 9008 7788 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009688.1 protein_id gnl|my_center|LOCUS_21520 9190 9786 gene locus_tag LOCUS_21530 9190 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 9986 11014 gene locus_tag LOCUS_21540 9986 11014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 11083 12210 gene locus_tag LOCUS_21550 11083 12210 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730637.1 protein_id gnl|my_center|LOCUS_21550 12223 12957 gene locus_tag LOCUS_21560 12223 12957 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729123.1 protein_id gnl|my_center|LOCUS_21560 14472 12982 gene locus_tag LOCUS_21570 gene gatA 14472 12982 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081368.1 protein_id gnl|my_center|LOCUS_21570 14768 14469 gene locus_tag LOCUS_21580 gene gatC 14768 14469 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056788.1 protein_id gnl|my_center|LOCUS_21580 15435 14839 gene locus_tag LOCUS_21590 15435 14839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111015.1 protein_id gnl|my_center|LOCUS_21590 15474 15827 gene locus_tag LOCUS_21600 15474 15827 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056510.1 protein_id gnl|my_center|LOCUS_21600 15870 16553 gene locus_tag LOCUS_21610 15870 16553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901515.1 protein_id gnl|my_center|LOCUS_21610 18760 16550 gene locus_tag LOCUS_21620 gene ligA 18760 16550 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728295.1 protein_id gnl|my_center|LOCUS_21620 18778 19182 gene locus_tag LOCUS_21630 18778 19182 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893728.1 protein_id gnl|my_center|LOCUS_21630 19511 19263 gene locus_tag LOCUS_21640 19511 19263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 19501 19830 gene locus_tag LOCUS_21650 19501 19830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 20877 19846 gene locus_tag LOCUS_21660 20877 19846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415268.1 protein_id gnl|my_center|LOCUS_21660 21956 20874 gene locus_tag LOCUS_21670 gene mnmA 21956 20874 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893725.1 protein_id gnl|my_center|LOCUS_21670 23161 21956 gene locus_tag LOCUS_21680 23161 21956 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728292.1 protein_id gnl|my_center|LOCUS_21680 24181 23264 gene locus_tag LOCUS_21690 24181 23264 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081343.1 protein_id gnl|my_center|LOCUS_21690 25026 24196 gene locus_tag LOCUS_21700 25026 24196 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877365.1 protein_id gnl|my_center|LOCUS_21700 26147 25191 gene locus_tag LOCUS_21710 26147 25191 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056737.1 protein_id gnl|my_center|LOCUS_21710 26969 26184 gene locus_tag LOCUS_21720 26969 26184 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728286.1 protein_id gnl|my_center|LOCUS_21720 27102 28016 gene locus_tag LOCUS_21730 27102 28016 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086476.1 protein_id gnl|my_center|LOCUS_21730 28013 29539 gene locus_tag LOCUS_21740 28013 29539 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728284.1 protein_id gnl|my_center|LOCUS_21740 29568 30824 gene locus_tag LOCUS_21750 29568 30824 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056727.1 protein_id gnl|my_center|LOCUS_21750 30859 31920 gene locus_tag LOCUS_21760 30859 31920 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190236313.1 protein_id gnl|my_center|LOCUS_21760 32695 31949 gene locus_tag LOCUS_21770 32695 31949 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111782.1 protein_id gnl|my_center|LOCUS_21770 32790 34115 gene locus_tag LOCUS_21780 32790 34115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 35636 34122 gene locus_tag LOCUS_21790 35636 34122 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110870.1 protein_id gnl|my_center|LOCUS_21790 36949 35984 gene locus_tag LOCUS_21800 36949 35984 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727373.1 protein_id gnl|my_center|LOCUS_21800 37745 36957 gene locus_tag LOCUS_21810 37745 36957 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223512.1 protein_id gnl|my_center|LOCUS_21810 37865 38767 gene locus_tag LOCUS_21820 37865 38767 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401227.1 protein_id gnl|my_center|LOCUS_21820 38833 39858 gene locus_tag LOCUS_21830 gene ligD 38833 39858 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226451.1 protein_id gnl|my_center|LOCUS_21830 39855 41933 gene locus_tag LOCUS_21840 39855 41933 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726765.1 protein_id gnl|my_center|LOCUS_21840 42774 41947 gene locus_tag LOCUS_21850 42774 41947 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230560.1 protein_id gnl|my_center|LOCUS_21850 43640 42771 gene locus_tag LOCUS_21860 43640 42771 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727371.1 protein_id gnl|my_center|LOCUS_21860 44171 43716 gene locus_tag LOCUS_21870 44171 43716 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897021.1 protein_id gnl|my_center|LOCUS_21870 45000 44185 gene locus_tag LOCUS_21880 45000 44185 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229474.1 protein_id gnl|my_center|LOCUS_21880 46242 45019 gene locus_tag LOCUS_21890 gene serB 46242 45019 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056675.1 protein_id gnl|my_center|LOCUS_21890 48052 46286 gene locus_tag LOCUS_21900 gene ctaD 48052 46286 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056670.1 protein_id gnl|my_center|LOCUS_21900 48271 49251 gene locus_tag LOCUS_21910 48271 49251 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727368.1 protein_id gnl|my_center|LOCUS_21910 49315 49806 gene locus_tag LOCUS_21920 49315 49806 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730233.1 protein_id gnl|my_center|LOCUS_21920 50337 49897 gene locus_tag LOCUS_21930 50337 49897 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026971.1 protein_id gnl|my_center|LOCUS_21930 50398 51138 gene locus_tag LOCUS_21940 50398 51138 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198766.1 protein_id gnl|my_center|LOCUS_21940 52230 51226 gene locus_tag LOCUS_21950 gene nrdF 52230 51226 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070938867.1 protein_id gnl|my_center|LOCUS_21950 54484 52283 gene locus_tag LOCUS_21960 gene nrdE 54484 52283 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876938.1 protein_id gnl|my_center|LOCUS_21960 55111 54608 gene locus_tag LOCUS_21970 gene nrdI 55111 54608 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415981.1 protein_id gnl|my_center|LOCUS_21970 55389 55156 gene locus_tag LOCUS_21980 55389 55156 CDS product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056596.1 protein_id gnl|my_center|LOCUS_21980 56317 55760 gene locus_tag LOCUS_21990 56317 55760 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893663.1 protein_id gnl|my_center|LOCUS_21990 56497 57162 gene locus_tag LOCUS_22000 56497 57162 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027418.1 protein_id gnl|my_center|LOCUS_22000 58453 57146 gene locus_tag LOCUS_22010 gene manA 58453 57146 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111913.1 protein_id gnl|my_center|LOCUS_22010 59571 58453 gene locus_tag LOCUS_22020 59571 58453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111915.1 protein_id gnl|my_center|LOCUS_22020 60994 59576 gene locus_tag LOCUS_22030 60994 59576 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727940.1 protein_id gnl|my_center|LOCUS_22030 61235 61047 gene locus_tag LOCUS_22040 61235 61047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 61168 62205 gene locus_tag LOCUS_22050 61168 62205 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218045413.1 protein_id gnl|my_center|LOCUS_22050 62583 62185 gene locus_tag LOCUS_22060 62583 62185 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417073.1 protein_id gnl|my_center|LOCUS_22060 62837 63253 gene locus_tag LOCUS_22070 62837 63253 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080840.1 protein_id gnl|my_center|LOCUS_22070 63703 63323 gene locus_tag LOCUS_22080 63703 63323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 64098 65105 gene locus_tag LOCUS_22090 gene cofD 64098 65105 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727938.1 protein_id gnl|my_center|LOCUS_22090 65095 66465 gene locus_tag LOCUS_22100 65095 66465 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727937.1 protein_id gnl|my_center|LOCUS_22100 66462 67043 gene locus_tag LOCUS_22110 66462 67043 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727936.1 protein_id gnl|my_center|LOCUS_22110 68247 67030 gene locus_tag LOCUS_22120 gene glgC 68247 67030 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730299.1 protein_id gnl|my_center|LOCUS_22120 68388 69548 gene locus_tag LOCUS_22130 gene glgA 68388 69548 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730300.1 protein_id gnl|my_center|LOCUS_22130 70398 69574 gene locus_tag LOCUS_22140 70398 69574 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014130.1 protein_id gnl|my_center|LOCUS_22140 71076 70735 gene locus_tag LOCUS_22150 71076 70735 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222965.1 protein_id gnl|my_center|LOCUS_22150 71869 71084 gene locus_tag LOCUS_22160 71869 71084 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730893.1 protein_id gnl|my_center|LOCUS_22160 72742 71873 gene locus_tag LOCUS_22170 72742 71873 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900075.1 protein_id gnl|my_center|LOCUS_22170 73835 72822 gene locus_tag LOCUS_22180 73835 72822 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084466.1 protein_id gnl|my_center|LOCUS_22180 74743 73832 gene locus_tag LOCUS_22190 gene folP 74743 73832 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296421.1 protein_id gnl|my_center|LOCUS_22190 76487 74748 gene locus_tag LOCUS_22200 gene fadD6 76487 74748 CDS product long-chain-acyl-CoA synthetase FadD6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074247.1 protein_id gnl|my_center|LOCUS_22200 77107 76571 gene locus_tag LOCUS_22210 77107 76571 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088046.1 protein_id gnl|my_center|LOCUS_22210 77898 77104 gene locus_tag LOCUS_22220 77898 77104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 79044 77935 gene locus_tag LOCUS_22230 gene dapE 79044 77935 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908103.1 protein_id gnl|my_center|LOCUS_22230 79184 79801 gene locus_tag LOCUS_22240 79184 79801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 79871 80269 gene locus_tag LOCUS_22250 79871 80269 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030668.1 protein_id gnl|my_center|LOCUS_22250 80973 80203 gene locus_tag LOCUS_22260 80973 80203 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030664.1 protein_id gnl|my_center|LOCUS_22260 81002 81958 gene locus_tag LOCUS_22270 gene dapD 81002 81958 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730317.1 protein_id gnl|my_center|LOCUS_22270 83167 82049 gene locus_tag LOCUS_22280 gene dapC 83167 82049 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730331.1 protein_id gnl|my_center|LOCUS_22280 83550 83164 gene locus_tag LOCUS_22290 83550 83164 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083029.1 protein_id gnl|my_center|LOCUS_22290 83681 84895 gene locus_tag LOCUS_22300 gene nupC 83681 84895 CDS product nucleoside permease NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244143.1 protein_id gnl|my_center|LOCUS_22300 85013 85585 gene locus_tag LOCUS_22310 85013 85585 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405649.1 protein_id gnl|my_center|LOCUS_22310 85586 85990 gene locus_tag LOCUS_22320 85586 85990 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405651.1 protein_id gnl|my_center|LOCUS_22320 85987 86646 gene locus_tag LOCUS_22330 85987 86646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 87526 86729 gene locus_tag LOCUS_22340 87526 86729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005116003.1 protein_id gnl|my_center|LOCUS_22340 90146 87543 gene locus_tag LOCUS_22350 90146 87543 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092974.1 protein_id gnl|my_center|LOCUS_22350 90555 90196 gene locus_tag LOCUS_22360 90555 90196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229757.1 protein_id gnl|my_center|LOCUS_22360 91460 90561 gene locus_tag LOCUS_22370 gene mshB 91460 90561 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730335.1 protein_id gnl|my_center|LOCUS_22370 <93302 91457 gene locus_tag LOCUS_22380 <93302 91457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162618330.1:ABC transporter family substrate-binding protein >Feature sequence16 186 1598 gene locus_tag LOCUS_22390 186 1598 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206043.1 protein_id gnl|my_center|LOCUS_22390 2192 1611 gene locus_tag LOCUS_22400 2192 1611 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730328.1 protein_id gnl|my_center|LOCUS_22400 2270 2956 gene locus_tag LOCUS_22410 gene nucS 2270 2956 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059861.1 protein_id gnl|my_center|LOCUS_22410 3026 3247 gene locus_tag LOCUS_22420 3026 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 4376 3297 gene locus_tag LOCUS_22430 4376 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 4997 4518 gene locus_tag LOCUS_22440 gene mce 4997 4518 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730193.1 protein_id gnl|my_center|LOCUS_22440 5100 6287 gene locus_tag LOCUS_22450 5100 6287 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878184.1 protein_id gnl|my_center|LOCUS_22450 6359 6718 gene locus_tag LOCUS_22460 6359 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 6767 7072 gene locus_tag LOCUS_22470 6767 7072 CDS product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223499.1 protein_id gnl|my_center|LOCUS_22470 7069 8322 gene locus_tag LOCUS_22480 7069 8322 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227636.1 protein_id gnl|my_center|LOCUS_22480 8319 9290 gene locus_tag LOCUS_22490 8319 9290 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223501.1 protein_id gnl|my_center|LOCUS_22490 11548 9305 gene locus_tag LOCUS_22500 gene glgB 11548 9305 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093048.1 protein_id gnl|my_center|LOCUS_22500 13563 11545 gene locus_tag LOCUS_22510 13563 11545 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110136.1 protein_id gnl|my_center|LOCUS_22510 15776 13716 gene locus_tag LOCUS_22520 15776 13716 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229470.1 protein_id gnl|my_center|LOCUS_22520 17065 15773 gene locus_tag LOCUS_22530 17065 15773 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093052.1 protein_id gnl|my_center|LOCUS_22530 17176 17493 gene locus_tag LOCUS_22540 17176 17493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 17498 18079 gene locus_tag LOCUS_22550 17498 18079 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059906.1 protein_id gnl|my_center|LOCUS_22550 18091 19200 gene locus_tag LOCUS_22560 18091 19200 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730182.1 protein_id gnl|my_center|LOCUS_22560 19281 19952 gene locus_tag LOCUS_22570 19281 19952 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084689.1 protein_id gnl|my_center|LOCUS_22570 19949 20773 gene locus_tag LOCUS_22580 gene murI 19949 20773 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406919.1 protein_id gnl|my_center|LOCUS_22580 20787 21587 gene locus_tag LOCUS_22590 20787 21587 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059917.1 protein_id gnl|my_center|LOCUS_22590 21712 22419 gene locus_tag LOCUS_22600 gene rph 21712 22419 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730177.1 protein_id gnl|my_center|LOCUS_22600 22431 23066 gene locus_tag LOCUS_22610 gene rdgB 22431 23066 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229451.1 protein_id gnl|my_center|LOCUS_22610 23426 23073 gene locus_tag LOCUS_22620 23426 23073 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406937.1 protein_id gnl|my_center|LOCUS_22620 23896 23423 gene locus_tag LOCUS_22630 23896 23423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898833.1 protein_id gnl|my_center|LOCUS_22630 23897 23980 gene locus_tag LOCUS_t00250 23897 23980 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 23996 25390 gene locus_tag LOCUS_22640 23996 25390 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410042.1 protein_id gnl|my_center|LOCUS_22640 26233 25412 gene locus_tag LOCUS_22650 26233 25412 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_22650 26748 26299 gene locus_tag LOCUS_22660 26748 26299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 26654 27130 gene locus_tag LOCUS_22670 26654 27130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22670 27472 27152 gene locus_tag LOCUS_22680 27472 27152 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776253.1 protein_id gnl|my_center|LOCUS_22680 28580 27546 gene locus_tag LOCUS_22690 28580 27546 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728056.1 protein_id gnl|my_center|LOCUS_22690 29358 28606 gene locus_tag LOCUS_22700 29358 28606 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026967.1 protein_id gnl|my_center|LOCUS_22700 30395 29358 gene locus_tag LOCUS_22710 30395 29358 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026966.1 protein_id gnl|my_center|LOCUS_22710 30593 32074 gene locus_tag LOCUS_22720 30593 32074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 32219 33730 gene locus_tag LOCUS_22730 32219 33730 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226334.1 protein_id gnl|my_center|LOCUS_22730 33747 34694 gene locus_tag LOCUS_22740 33747 34694 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728075.1 protein_id gnl|my_center|LOCUS_22740 36579 34741 gene locus_tag LOCUS_22750 36579 34741 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224318.1 protein_id gnl|my_center|LOCUS_22750 36798 38531 gene locus_tag LOCUS_22760 36798 38531 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896448.1 protein_id gnl|my_center|LOCUS_22760 38727 39038 gene locus_tag LOCUS_22770 38727 39038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 39244 43446 gene locus_tag LOCUS_22780 39244 43446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 43892 43467 gene locus_tag LOCUS_22790 43892 43467 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730267.1 protein_id gnl|my_center|LOCUS_22790 44410 53685 gene locus_tag LOCUS_22800 44410 53685 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730064.1 protein_id gnl|my_center|LOCUS_22800 53682 54083 gene locus_tag LOCUS_22810 53682 54083 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896157.1 protein_id gnl|my_center|LOCUS_22810 54750 54094 gene locus_tag LOCUS_22820 54750 54094 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857691.1 protein_id gnl|my_center|LOCUS_22820 55244 54771 gene locus_tag LOCUS_22830 gene bcp 55244 54771 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730061.1 protein_id gnl|my_center|LOCUS_22830 55300 55584 gene locus_tag LOCUS_22840 55300 55584 CDS product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059996.1 protein_id gnl|my_center|LOCUS_22840 55728 55655 gene locus_tag LOCUS_t00260 55728 55655 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 56083 57315 gene locus_tag LOCUS_22850 56083 57315 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084773.1 protein_id gnl|my_center|LOCUS_22850 57400 58542 gene locus_tag LOCUS_22860 57400 58542 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110589.1 protein_id gnl|my_center|LOCUS_22860 58626 59102 gene locus_tag LOCUS_22870 58626 59102 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726821.1 protein_id gnl|my_center|LOCUS_22870 59143 61374 gene locus_tag LOCUS_22880 59143 61374 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225223.1 protein_id gnl|my_center|LOCUS_22880 61491 61417 gene locus_tag LOCUS_t00270 61491 61417 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 62175 61576 gene locus_tag LOCUS_22890 gene orn 62175 61576 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878121.1 protein_id gnl|my_center|LOCUS_22890 62268 63821 gene locus_tag LOCUS_22900 62268 63821 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730039.1 protein_id gnl|my_center|LOCUS_22900 64638 63835 gene locus_tag LOCUS_22910 gene cmrA 64638 63835 CDS product mycolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084785.1 protein_id gnl|my_center|LOCUS_22910 66694 64664 gene locus_tag LOCUS_22920 66694 64664 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730332.1 protein_id gnl|my_center|LOCUS_22920 67344 66691 gene locus_tag LOCUS_22930 67344 66691 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222261.1 protein_id gnl|my_center|LOCUS_22930 67381 67920 gene locus_tag LOCUS_22940 67381 67920 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228370.1 protein_id gnl|my_center|LOCUS_22940 67944 68561 gene locus_tag LOCUS_22950 67944 68561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 68637 68563 gene locus_tag LOCUS_t00280 68637 68563 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 68722 70791 gene locus_tag LOCUS_22960 68722 70791 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878112.1 protein_id gnl|my_center|LOCUS_22960 70951 72624 gene locus_tag LOCUS_22970 gene ettA 70951 72624 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896081.1 protein_id gnl|my_center|LOCUS_22970 72635 77350 gene locus_tag LOCUS_22980 72635 77350 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730019.1 protein_id gnl|my_center|LOCUS_22980 77352 77855 gene locus_tag LOCUS_22990 77352 77855 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060104.1 protein_id gnl|my_center|LOCUS_22990 77881 78585 gene locus_tag LOCUS_23000 77881 78585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730018.1 protein_id gnl|my_center|LOCUS_23000 80344 78590 gene locus_tag LOCUS_23010 80344 78590 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084851.1 protein_id gnl|my_center|LOCUS_23010 80858 80445 gene locus_tag LOCUS_23020 80858 80445 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060114.1 protein_id gnl|my_center|LOCUS_23020 81046 81726 gene locus_tag LOCUS_23030 81046 81726 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878108.1 protein_id gnl|my_center|LOCUS_23030 81860 82111 gene locus_tag LOCUS_23040 81860 82111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 82098 82571 gene locus_tag LOCUS_23050 82098 82571 CDS product DUF5130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084855.1 protein_id gnl|my_center|LOCUS_23050 85275 82666 gene locus_tag LOCUS_23060 gene pepN 85275 82666 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730013.1 protein_id gnl|my_center|LOCUS_23060 85496 86143 gene locus_tag LOCUS_23070 85496 86143 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730011.1 protein_id gnl|my_center|LOCUS_23070 86198 86671 gene locus_tag LOCUS_23080 86198 86671 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859211.1 protein_id gnl|my_center|LOCUS_23080 86679 87473 gene locus_tag LOCUS_23090 86679 87473 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730006.1 protein_id gnl|my_center|LOCUS_23090 87553 88422 gene locus_tag LOCUS_23100 87553 88422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 88526 89959 gene locus_tag LOCUS_23110 gene sthA 88526 89959 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308313.1 protein_id gnl|my_center|LOCUS_23110 90628 90056 gene locus_tag LOCUS_23120 90628 90056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 >Feature sequence17 1464 148 gene locus_tag LOCUS_23130 1464 148 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027365.1 protein_id gnl|my_center|LOCUS_23130 1646 2287 gene locus_tag LOCUS_23140 1646 2287 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164275233.1 protein_id gnl|my_center|LOCUS_23140 3110 2274 gene locus_tag LOCUS_23150 3110 2274 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897311.1 protein_id gnl|my_center|LOCUS_23150 3186 4844 gene locus_tag LOCUS_23160 3186 4844 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730889.1 protein_id gnl|my_center|LOCUS_23160 4876 6021 gene locus_tag LOCUS_23170 4876 6021 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085883.1 protein_id gnl|my_center|LOCUS_23170 7416 6010 gene locus_tag LOCUS_23180 gene fadD17 7416 6010 CDS product long-chain-fatty-acid--CoA ligase FadD17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730885.1 protein_id gnl|my_center|LOCUS_23180 8648 7542 gene locus_tag LOCUS_23190 8648 7542 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112221.1 protein_id gnl|my_center|LOCUS_23190 9861 8674 gene locus_tag LOCUS_23200 9861 8674 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094904.1 protein_id gnl|my_center|LOCUS_23200 10001 10189 gene locus_tag LOCUS_23210 10001 10189 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062259.1 protein_id gnl|my_center|LOCUS_23210 10269 11159 gene locus_tag LOCUS_23220 10269 11159 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078006.1 protein_id gnl|my_center|LOCUS_23220 11381 12142 gene locus_tag LOCUS_23230 11381 12142 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071300.1 protein_id gnl|my_center|LOCUS_23230 12147 12995 gene locus_tag LOCUS_23240 12147 12995 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897299.1 protein_id gnl|my_center|LOCUS_23240 13044 14216 gene locus_tag LOCUS_23250 13044 14216 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730089.1 protein_id gnl|my_center|LOCUS_23250 14209 15282 gene locus_tag LOCUS_23260 14209 15282 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730088.1 protein_id gnl|my_center|LOCUS_23260 15279 16424 gene locus_tag LOCUS_23270 15279 16424 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904746.1 protein_id gnl|my_center|LOCUS_23270 16421 17692 gene locus_tag LOCUS_23280 16421 17692 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730877.1 protein_id gnl|my_center|LOCUS_23280 17710 18915 gene locus_tag LOCUS_23290 17710 18915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 18912 20342 gene locus_tag LOCUS_23300 18912 20342 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728632.1 protein_id gnl|my_center|LOCUS_23300 20426 21172 gene locus_tag LOCUS_23310 20426 21172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 21172 21759 gene locus_tag LOCUS_23320 21172 21759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 22775 21756 gene locus_tag LOCUS_23330 22775 21756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 23344 22790 gene locus_tag LOCUS_23340 23344 22790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 24959 23457 gene locus_tag LOCUS_23350 24959 23457 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899865.1 protein_id gnl|my_center|LOCUS_23350 25652 25038 gene locus_tag LOCUS_23360 25652 25038 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727230.1 protein_id gnl|my_center|LOCUS_23360 26177 25749 gene locus_tag LOCUS_23370 26177 25749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 26554 26249 gene locus_tag LOCUS_23380 gene mhuD 26554 26249 CDS product mycobilin-forming heme oxygenase MhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419501.1 protein_id gnl|my_center|LOCUS_23380 26574 27377 gene locus_tag LOCUS_23390 26574 27377 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092176.1 protein_id gnl|my_center|LOCUS_23390 28286 27399 gene locus_tag LOCUS_23400 28286 27399 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113145.1 protein_id gnl|my_center|LOCUS_23400 28285 28935 gene locus_tag LOCUS_23410 28285 28935 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057001.1 protein_id gnl|my_center|LOCUS_23410 29007 29777 gene locus_tag LOCUS_23420 29007 29777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 30868 29786 gene locus_tag LOCUS_23430 gene disA 30868 29786 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731023.1 protein_id gnl|my_center|LOCUS_23430 30937 31449 gene locus_tag LOCUS_23440 30937 31449 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030506.1 protein_id gnl|my_center|LOCUS_23440 32813 31437 gene locus_tag LOCUS_23450 gene radA 32813 31437 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230399.1 protein_id gnl|my_center|LOCUS_23450 33550 32870 gene locus_tag LOCUS_23460 33550 32870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092184.1 protein_id gnl|my_center|LOCUS_23460 33797 34285 gene locus_tag LOCUS_23470 gene carD 33797 34285 CDS product RNA polymerase-binding transcription factor CarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419482.1 protein_id gnl|my_center|LOCUS_23470 34304 34984 gene locus_tag LOCUS_23480 gene ispD 34304 34984 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074324290.1 protein_id gnl|my_center|LOCUS_23480 34985 35452 gene locus_tag LOCUS_23490 gene ispF 34985 35452 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064989.1 protein_id gnl|my_center|LOCUS_23490 35468 36859 gene locus_tag LOCUS_23500 gene cysS 35468 36859 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731017.1 protein_id gnl|my_center|LOCUS_23500 36859 37830 gene locus_tag LOCUS_23510 gene rlmB 36859 37830 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065566.1 protein_id gnl|my_center|LOCUS_23510 38396 37827 gene locus_tag LOCUS_23520 38396 37827 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226000.1 protein_id gnl|my_center|LOCUS_23520 38448 39701 gene locus_tag LOCUS_23530 38448 39701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 40203 39622 gene locus_tag LOCUS_23540 40203 39622 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973718.1 protein_id gnl|my_center|LOCUS_23540 41557 40232 gene locus_tag LOCUS_23550 41557 40232 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936020.1 protein_id gnl|my_center|LOCUS_23550 42259 41624 gene locus_tag LOCUS_23560 42259 41624 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222729.1 protein_id gnl|my_center|LOCUS_23560 43896 42343 gene locus_tag LOCUS_23570 43896 42343 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188488774.1 protein_id gnl|my_center|LOCUS_23570 44714 43896 gene locus_tag LOCUS_23580 44714 43896 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907677.1 protein_id gnl|my_center|LOCUS_23580 44696 46231 gene locus_tag LOCUS_23590 44696 46231 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729367.1 protein_id gnl|my_center|LOCUS_23590 47017 46190 gene locus_tag LOCUS_23600 47017 46190 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975902.1 protein_id gnl|my_center|LOCUS_23600 47071 47535 gene locus_tag LOCUS_23610 47071 47535 CDS product DUF2599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402344.1 protein_id gnl|my_center|LOCUS_23610 47552 47956 gene locus_tag LOCUS_23620 gene kmtR 47552 47956 CDS product Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404335.1 protein_id gnl|my_center|LOCUS_23620 47953 49008 gene locus_tag LOCUS_23630 47953 49008 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410146.1 protein_id gnl|my_center|LOCUS_23630 49808 48933 gene locus_tag LOCUS_23640 49808 48933 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072717.1 protein_id gnl|my_center|LOCUS_23640 50545 49805 gene locus_tag LOCUS_23650 50545 49805 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230419.1 protein_id gnl|my_center|LOCUS_23650 51584 50646 gene locus_tag LOCUS_23660 51584 50646 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230420.1 protein_id gnl|my_center|LOCUS_23660 53791 51668 gene locus_tag LOCUS_23670 53791 51668 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057131.1 protein_id gnl|my_center|LOCUS_23670 54924 53959 gene locus_tag LOCUS_23680 54924 53959 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726658.1 protein_id gnl|my_center|LOCUS_23680 55022 55960 gene locus_tag LOCUS_23690 55022 55960 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222388.1 protein_id gnl|my_center|LOCUS_23690 55957 57297 gene locus_tag LOCUS_23700 gene mshA 55957 57297 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727296.1 protein_id gnl|my_center|LOCUS_23700 57294 57908 gene locus_tag LOCUS_23710 57294 57908 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892360.1 protein_id gnl|my_center|LOCUS_23710 58011 59627 gene locus_tag LOCUS_23720 58011 59627 CDS product 4-coumarate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728294.1 protein_id gnl|my_center|LOCUS_23720 60996 59560 gene locus_tag LOCUS_23730 60996 59560 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229629.1 protein_id gnl|my_center|LOCUS_23730 62617 61061 gene locus_tag LOCUS_23740 62617 61061 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225330.1 protein_id gnl|my_center|LOCUS_23740 62779 63525 gene locus_tag LOCUS_23750 62779 63525 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892361.1 protein_id gnl|my_center|LOCUS_23750 63559 63900 gene locus_tag LOCUS_23760 63559 63900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 64089 65495 gene locus_tag LOCUS_23770 64089 65495 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112166.1 protein_id gnl|my_center|LOCUS_23770 65492 66181 gene locus_tag LOCUS_23780 gene regX 65492 66181 CDS product two-component sensory transduction protein RegX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876914.1 protein_id gnl|my_center|LOCUS_23780 66497 66249 gene locus_tag LOCUS_23790 66497 66249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 67081 66470 gene locus_tag LOCUS_23800 67081 66470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 68129 67209 gene locus_tag LOCUS_23810 68129 67209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077870.1 protein_id gnl|my_center|LOCUS_23810 68116 69060 gene locus_tag LOCUS_23820 gene ppx1 68116 69060 CDS product exopolyphosphatase Ppx1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402419.1 protein_id gnl|my_center|LOCUS_23820 69095 70552 gene locus_tag LOCUS_23830 69095 70552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 70552 71415 gene locus_tag LOCUS_23840 70552 71415 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080273.1 protein_id gnl|my_center|LOCUS_23840 71433 72278 gene locus_tag LOCUS_23850 71433 72278 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098444.1 protein_id gnl|my_center|LOCUS_23850 72310 73188 gene locus_tag LOCUS_23860 gene proC 72310 73188 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727304.1 protein_id gnl|my_center|LOCUS_23860 73404 73697 gene locus_tag LOCUS_23870 73404 73697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 73713 74015 gene locus_tag LOCUS_23880 73713 74015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 74106 75164 gene locus_tag LOCUS_23890 74106 75164 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876916.1 protein_id gnl|my_center|LOCUS_23890 75275 76408 gene locus_tag LOCUS_23900 75275 76408 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892373.1 protein_id gnl|my_center|LOCUS_23900 77392 76490 gene locus_tag LOCUS_23910 77392 76490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148043383.1 protein_id gnl|my_center|LOCUS_23910 78649 77507 gene locus_tag LOCUS_23920 78649 77507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 78771 79022 gene locus_tag LOCUS_23930 78771 79022 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061885.1 protein_id gnl|my_center|LOCUS_23930 79071 79787 gene locus_tag LOCUS_23940 79071 79787 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141850309.1 protein_id gnl|my_center|LOCUS_23940 79784 81136 gene locus_tag LOCUS_23950 79784 81136 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061882.1 protein_id gnl|my_center|LOCUS_23950 81133 82059 gene locus_tag LOCUS_23960 gene hemC 81133 82059 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402702.1 protein_id gnl|my_center|LOCUS_23960 82105 83760 gene locus_tag LOCUS_23970 82105 83760 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624021.1 protein_id gnl|my_center|LOCUS_23970 83765 84748 gene locus_tag LOCUS_23980 gene hemB 83765 84748 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727312.1 protein_id gnl|my_center|LOCUS_23980 >Feature sequence18 508 579 gene locus_tag LOCUS_t00290 508 579 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 747 821 gene locus_tag LOCUS_t00300 747 821 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 931 2343 gene locus_tag LOCUS_23990 gene tig 931 2343 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228513.1 protein_id gnl|my_center|LOCUS_23990 2527 3138 gene locus_tag LOCUS_24000 2527 3138 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878099.1 protein_id gnl|my_center|LOCUS_24000 3204 3875 gene locus_tag LOCUS_24010 3204 3875 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896046.1 protein_id gnl|my_center|LOCUS_24010 4097 5419 gene locus_tag LOCUS_24020 gene clpX 4097 5419 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060151.1 protein_id gnl|my_center|LOCUS_24020 5429 7483 gene locus_tag LOCUS_24030 5429 7483 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729974.1 protein_id gnl|my_center|LOCUS_24030 8324 7503 gene locus_tag LOCUS_24040 gene fdhD 8324 7503 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228505.1 protein_id gnl|my_center|LOCUS_24040 10654 8324 gene locus_tag LOCUS_24050 10654 8324 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110168.1 protein_id gnl|my_center|LOCUS_24050 10704 11339 gene locus_tag LOCUS_24060 10704 11339 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729980.1 protein_id gnl|my_center|LOCUS_24060 11364 14036 gene locus_tag LOCUS_24070 11364 14036 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896007.1 protein_id gnl|my_center|LOCUS_24070 14033 15481 gene locus_tag LOCUS_24080 14033 15481 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110172.1 protein_id gnl|my_center|LOCUS_24080 15478 15903 gene locus_tag LOCUS_24090 15478 15903 CDS product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074540.1 protein_id gnl|my_center|LOCUS_24090 16048 16482 gene locus_tag LOCUS_24100 16048 16482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 16505 16918 gene locus_tag LOCUS_24110 gene ndk 16505 16918 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729972.1 protein_id gnl|my_center|LOCUS_24110 17384 20725 gene locus_tag LOCUS_24120 17384 20725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 20996 21307 gene locus_tag LOCUS_24130 gene rplU 20996 21307 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060209.1 protein_id gnl|my_center|LOCUS_24130 21340 21603 gene locus_tag LOCUS_24140 gene rpmA 21340 21603 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896001.1 protein_id gnl|my_center|LOCUS_24140 21760 23301 gene locus_tag LOCUS_24150 gene obgE 21760 23301 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729970.1 protein_id gnl|my_center|LOCUS_24150 23309 24421 gene locus_tag LOCUS_24160 gene proB 23309 24421 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412568.1 protein_id gnl|my_center|LOCUS_24160 25315 24377 gene locus_tag LOCUS_24170 25315 24377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729967.1 protein_id gnl|my_center|LOCUS_24170 25944 25378 gene locus_tag LOCUS_24180 25944 25378 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225464.1 protein_id gnl|my_center|LOCUS_24180 26031 26783 gene locus_tag LOCUS_24190 26031 26783 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225465.1 protein_id gnl|my_center|LOCUS_24190 27714 26794 gene locus_tag LOCUS_24200 27714 26794 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861134.1 protein_id gnl|my_center|LOCUS_24200 28127 27732 gene locus_tag LOCUS_24210 28127 27732 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895350.1 protein_id gnl|my_center|LOCUS_24210 29448 28195 gene locus_tag LOCUS_24220 gene ectB 29448 28195 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729399.1 protein_id gnl|my_center|LOCUS_24220 30128 29610 gene locus_tag LOCUS_24230 gene ectA 30128 29610 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976956.1 protein_id gnl|my_center|LOCUS_24230 30410 30153 gene locus_tag LOCUS_24240 30410 30153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 30451 30924 gene locus_tag LOCUS_24250 gene rsmD 30451 30924 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104349.1 protein_id gnl|my_center|LOCUS_24250 30965 31441 gene locus_tag LOCUS_24260 gene coaD 30965 31441 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728327.1 protein_id gnl|my_center|LOCUS_24260 31772 31506 gene locus_tag LOCUS_24270 31772 31506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 31665 32345 gene locus_tag LOCUS_24280 31665 32345 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893781.1 protein_id gnl|my_center|LOCUS_24280 32492 33019 gene locus_tag LOCUS_24290 32492 33019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 33025 33792 gene locus_tag LOCUS_24300 gene rnc 33025 33792 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742189.1 protein_id gnl|my_center|LOCUS_24300 33820 34728 gene locus_tag LOCUS_24310 gene mutM 33820 34728 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223692.1 protein_id gnl|my_center|LOCUS_24310 35122 36807 gene locus_tag LOCUS_24320 gene kdpA 35122 36807 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111699.1 protein_id gnl|my_center|LOCUS_24320 36804 38924 gene locus_tag LOCUS_24330 gene kdpB 36804 38924 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296651.1 protein_id gnl|my_center|LOCUS_24330 38931 39557 gene locus_tag LOCUS_24340 38931 39557 CDS product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087732.1 protein_id gnl|my_center|LOCUS_24340 39588 42245 gene locus_tag LOCUS_24350 39588 42245 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111695.1 protein_id gnl|my_center|LOCUS_24350 42245 42952 gene locus_tag LOCUS_24360 42245 42952 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081527.1 protein_id gnl|my_center|LOCUS_24360 42991 43425 gene locus_tag LOCUS_24370 42991 43425 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893786.1 protein_id gnl|my_center|LOCUS_24370 43422 43718 gene locus_tag LOCUS_24380 43422 43718 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414811.1 protein_id gnl|my_center|LOCUS_24380 43818 47426 gene locus_tag LOCUS_24390 gene smc 43818 47426 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728333.1 protein_id gnl|my_center|LOCUS_24390 47461 48882 gene locus_tag LOCUS_24400 gene ftsY 47461 48882 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899541.1 protein_id gnl|my_center|LOCUS_24400 49111 50508 gene locus_tag LOCUS_24410 49111 50508 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087724.1 protein_id gnl|my_center|LOCUS_24410 50513 50851 gene locus_tag LOCUS_24420 50513 50851 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056967.1 protein_id gnl|my_center|LOCUS_24420 50868 53510 gene locus_tag LOCUS_24430 50868 53510 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081546.1 protein_id gnl|my_center|LOCUS_24430 53515 55086 gene locus_tag LOCUS_24440 gene ffh 53515 55086 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069602.1 protein_id gnl|my_center|LOCUS_24440 55095 56183 gene locus_tag LOCUS_24450 55095 56183 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111684.1 protein_id gnl|my_center|LOCUS_24450 56360 56809 gene locus_tag LOCUS_24460 56360 56809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 56806 57048 gene locus_tag LOCUS_24470 56806 57048 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081564.1 protein_id gnl|my_center|LOCUS_24470 57077 57592 gene locus_tag LOCUS_24480 gene rimM 57077 57592 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111677.1 protein_id gnl|my_center|LOCUS_24480 57589 58365 gene locus_tag LOCUS_24490 gene trmD 57589 58365 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223852.1 protein_id gnl|my_center|LOCUS_24490 58375 59367 gene locus_tag LOCUS_24500 58375 59367 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729672.1 protein_id gnl|my_center|LOCUS_24500 59459 59800 gene locus_tag LOCUS_24510 gene rplS 59459 59800 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893806.1 protein_id gnl|my_center|LOCUS_24510 59874 60740 gene locus_tag LOCUS_24520 gene lepB 59874 60740 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728343.1 protein_id gnl|my_center|LOCUS_24520 60753 61415 gene locus_tag LOCUS_24530 60753 61415 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087713.1 protein_id gnl|my_center|LOCUS_24530 61439 61762 gene locus_tag LOCUS_24540 61439 61762 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893809.1 protein_id gnl|my_center|LOCUS_24540 63373 61751 gene locus_tag LOCUS_24550 63373 61751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 64887 63457 gene locus_tag LOCUS_24560 64887 63457 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083311.1 protein_id gnl|my_center|LOCUS_24560 65495 65211 gene locus_tag LOCUS_24570 65495 65211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 65386 66372 gene locus_tag LOCUS_24580 65386 66372 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013583.1 protein_id gnl|my_center|LOCUS_24580 66497 66889 gene locus_tag LOCUS_24590 66497 66889 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081582.1 protein_id gnl|my_center|LOCUS_24590 66906 68417 gene locus_tag LOCUS_24600 66906 68417 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111670.1 protein_id gnl|my_center|LOCUS_24600 68414 69634 gene locus_tag LOCUS_24610 gene dprA 68414 69634 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081583.1 protein_id gnl|my_center|LOCUS_24610 69708 70262 gene locus_tag LOCUS_24620 69708 70262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 70266 70631 gene locus_tag LOCUS_24630 70266 70631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 70635 71921 gene locus_tag LOCUS_24640 70635 71921 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129235689.1 protein_id gnl|my_center|LOCUS_24640 71977 72825 gene locus_tag LOCUS_24650 71977 72825 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900590.1 protein_id gnl|my_center|LOCUS_24650 72925 73878 gene locus_tag LOCUS_24660 72925 73878 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728395.1 protein_id gnl|my_center|LOCUS_24660 74423 73863 gene locus_tag LOCUS_24670 74423 73863 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115974.1 protein_id gnl|my_center|LOCUS_24670 74389 74688 gene locus_tag LOCUS_24680 74389 74688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 74868 75746 gene locus_tag LOCUS_24690 gene rpsB 74868 75746 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893880.1 protein_id gnl|my_center|LOCUS_24690 75915 76739 gene locus_tag LOCUS_24700 gene tsf 75915 76739 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893881.1 protein_id gnl|my_center|LOCUS_24700 76895 77641 gene locus_tag LOCUS_24710 gene pyrH 76895 77641 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057025.1 protein_id gnl|my_center|LOCUS_24710 77706 78263 gene locus_tag LOCUS_24720 gene frr 77706 78263 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893897.1 protein_id gnl|my_center|LOCUS_24720 78354 79262 gene locus_tag LOCUS_24730 78354 79262 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728419.1 protein_id gnl|my_center|LOCUS_24730 79694 79329 gene locus_tag LOCUS_24740 79694 79329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 79796 80917 gene locus_tag LOCUS_24750 gene rlmN 79796 80917 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223876.1 protein_id gnl|my_center|LOCUS_24750 >Feature sequence19 895 1539 gene locus_tag LOCUS_24760 895 1539 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878199.1 protein_id gnl|my_center|LOCUS_24760 1542 1805 gene locus_tag LOCUS_24770 1542 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 1905 2072 gene locus_tag LOCUS_24780 1905 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 2131 2892 gene locus_tag LOCUS_24790 2131 2892 CDS product putative protein N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226080.1 protein_id gnl|my_center|LOCUS_24790 2954 4417 gene locus_tag LOCUS_24800 2954 4417 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027383.1 protein_id gnl|my_center|LOCUS_24800 5705 4437 gene locus_tag LOCUS_24810 5705 4437 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111120.1 protein_id gnl|my_center|LOCUS_24810 6711 5779 gene locus_tag LOCUS_24820 6711 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 6858 7319 gene locus_tag LOCUS_24830 6858 7319 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063625.1 protein_id gnl|my_center|LOCUS_24830 7379 9232 gene locus_tag LOCUS_24840 7379 9232 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223921.1 protein_id gnl|my_center|LOCUS_24840 9312 9776 gene locus_tag LOCUS_24850 9312 9776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 9827 10066 gene locus_tag LOCUS_24860 9827 10066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 10382 10170 gene locus_tag LOCUS_24870 10382 10170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 10612 11757 gene locus_tag LOCUS_24880 10612 11757 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072191.1 protein_id gnl|my_center|LOCUS_24880 11806 12567 gene locus_tag LOCUS_24890 gene fabG 11806 12567 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_24890 12584 13699 gene locus_tag LOCUS_24900 12584 13699 CDS product DUF1524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390253.1 protein_id gnl|my_center|LOCUS_24900 13750 16746 gene locus_tag LOCUS_24910 13750 16746 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161897637.1 protein_id gnl|my_center|LOCUS_24910 16743 17513 gene locus_tag LOCUS_24920 16743 17513 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899172.1 protein_id gnl|my_center|LOCUS_24920 18919 17669 gene locus_tag LOCUS_24930 18919 17669 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742232.1 protein_id gnl|my_center|LOCUS_24930 19403 18966 gene locus_tag LOCUS_24940 19403 18966 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405633.1 protein_id gnl|my_center|LOCUS_24940 19593 20039 gene locus_tag LOCUS_24950 19593 20039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 21961 20090 gene locus_tag LOCUS_24960 21961 20090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 22539 22018 gene locus_tag LOCUS_24970 22539 22018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 23701 22628 gene locus_tag LOCUS_24980 23701 22628 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895326.1 protein_id gnl|my_center|LOCUS_24980 24795 23698 gene locus_tag LOCUS_24990 24795 23698 CDS product TIGR03857 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877342.1 protein_id gnl|my_center|LOCUS_24990 24915 25481 gene locus_tag LOCUS_25000 24915 25481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 25944 25486 gene locus_tag LOCUS_25010 25944 25486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 26079 26444 gene locus_tag LOCUS_25020 26079 26444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 28007 26469 gene locus_tag LOCUS_25030 28007 26469 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107859.1 protein_id gnl|my_center|LOCUS_25030 28540 28049 gene locus_tag LOCUS_25040 28540 28049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 30802 29138 gene locus_tag LOCUS_25050 30802 29138 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104457.1 protein_id gnl|my_center|LOCUS_25050 30864 32273 gene locus_tag LOCUS_25060 30864 32273 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407926.1 protein_id gnl|my_center|LOCUS_25060 32670 32224 gene locus_tag LOCUS_25070 32670 32224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 32719 33102 gene locus_tag LOCUS_25080 32719 33102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 33352 34227 gene locus_tag LOCUS_25090 33352 34227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 38266 34781 gene locus_tag LOCUS_25100 38266 34781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 38928 39509 gene locus_tag LOCUS_25110 38928 39509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 39517 40566 gene locus_tag LOCUS_25120 39517 40566 CDS product DUF3089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918560.1 protein_id gnl|my_center|LOCUS_25120 41115 40663 gene locus_tag LOCUS_25130 gene rplI 41115 40663 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079044.1 protein_id gnl|my_center|LOCUS_25130 41393 41133 gene locus_tag LOCUS_25140 gene rpsR 41393 41133 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909030.1 protein_id gnl|my_center|LOCUS_25140 41986 41462 gene locus_tag LOCUS_25150 41986 41462 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400534.1 protein_id gnl|my_center|LOCUS_25150 42438 42154 gene locus_tag LOCUS_25160 gene rpsF 42438 42154 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898321.1 protein_id gnl|my_center|LOCUS_25160 42634 44676 gene locus_tag LOCUS_25170 42634 44676 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729365.1 protein_id gnl|my_center|LOCUS_25170 44680 46104 gene locus_tag LOCUS_25180 44680 46104 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029301.1 protein_id gnl|my_center|LOCUS_25180 46176 46700 gene locus_tag LOCUS_25190 46176 46700 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680361.1 protein_id gnl|my_center|LOCUS_25190 48324 46693 gene locus_tag LOCUS_25200 48324 46693 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112782.1 protein_id gnl|my_center|LOCUS_25200 50501 48339 gene locus_tag LOCUS_25210 50501 48339 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731616.1 protein_id gnl|my_center|LOCUS_25210 48761 48684 gene locus_tag LOCUS_t00310 48761 48684 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 51019 50615 gene locus_tag LOCUS_25220 51019 50615 CDS product DUF5318 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731617.1 protein_id gnl|my_center|LOCUS_25220 51239 51835 gene locus_tag LOCUS_25230 51239 51835 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898328.1 protein_id gnl|my_center|LOCUS_25230 51828 52925 gene locus_tag LOCUS_25240 51828 52925 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112786.1 protein_id gnl|my_center|LOCUS_25240 53070 53633 gene locus_tag LOCUS_25250 53070 53633 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258313.1 protein_id gnl|my_center|LOCUS_25250 53630 54553 gene locus_tag LOCUS_25260 53630 54553 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110139.1 protein_id gnl|my_center|LOCUS_25260 55923 54646 gene locus_tag LOCUS_25270 55923 54646 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031634.1 protein_id gnl|my_center|LOCUS_25270 57215 55977 gene locus_tag LOCUS_25280 gene dinB 57215 55977 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226402.1 protein_id gnl|my_center|LOCUS_25280 57338 58150 gene locus_tag LOCUS_25290 57338 58150 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878800.1 protein_id gnl|my_center|LOCUS_25290 58147 58560 gene locus_tag LOCUS_25300 58147 58560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 58689 59039 gene locus_tag LOCUS_25310 58689 59039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 59165 61249 gene locus_tag LOCUS_25320 59165 61249 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029237.1 protein_id gnl|my_center|LOCUS_25320 61657 61265 gene locus_tag LOCUS_25330 61657 61265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 61796 62953 gene locus_tag LOCUS_25340 61796 62953 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893212.1 protein_id gnl|my_center|LOCUS_25340 63292 62966 gene locus_tag LOCUS_25350 63292 62966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 64354 63341 gene locus_tag LOCUS_25360 64354 63341 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014191.1 protein_id gnl|my_center|LOCUS_25360 65742 64351 gene locus_tag LOCUS_25370 65742 64351 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014192.1 protein_id gnl|my_center|LOCUS_25370 67178 65829 gene locus_tag LOCUS_25380 67178 65829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898336.1 protein_id gnl|my_center|LOCUS_25380 67264 67971 gene locus_tag LOCUS_25390 67264 67971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 68072 68698 gene locus_tag LOCUS_25400 68072 68698 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226338.1 protein_id gnl|my_center|LOCUS_25400 68735 69412 gene locus_tag LOCUS_25410 68735 69412 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230982.1 protein_id gnl|my_center|LOCUS_25410 69809 69438 gene locus_tag LOCUS_25420 69809 69438 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084268.1 protein_id gnl|my_center|LOCUS_25420 70159 69929 gene locus_tag LOCUS_25430 70159 69929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 70059 71078 gene locus_tag LOCUS_25440 70059 71078 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110376.1 protein_id gnl|my_center|LOCUS_25440 71123 72283 gene locus_tag LOCUS_25450 71123 72283 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112106.1 protein_id gnl|my_center|LOCUS_25450 73156 72287 gene locus_tag LOCUS_25460 73156 72287 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727874.1 protein_id gnl|my_center|LOCUS_25460 73661 73161 gene locus_tag LOCUS_25470 73661 73161 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257245.1 protein_id gnl|my_center|LOCUS_25470 74663 73707 gene locus_tag LOCUS_25480 74663 73707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408760.1 protein_id gnl|my_center|LOCUS_25480 74774 75355 gene locus_tag LOCUS_25490 74774 75355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 76295 75390 gene locus_tag LOCUS_25500 76295 75390 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973201.1 protein_id gnl|my_center|LOCUS_25500 >Feature sequence20 420 701 gene locus_tag LOCUS_25510 420 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 1354 704 gene locus_tag LOCUS_25520 1354 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 1500 1354 gene locus_tag LOCUS_25530 1500 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 2970 1582 gene locus_tag LOCUS_25540 2970 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 3326 2997 gene locus_tag LOCUS_25550 3326 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 3901 3680 gene locus_tag LOCUS_25560 3901 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 4875 3958 gene locus_tag LOCUS_25570 4875 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912342.1 protein_id gnl|my_center|LOCUS_25570 6298 5339 gene locus_tag LOCUS_25580 6298 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 8093 6642 gene locus_tag LOCUS_25590 8093 6642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 8473 8090 gene locus_tag LOCUS_25600 8473 8090 CDS product E2/UBC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533406.1 protein_id gnl|my_center|LOCUS_25600 8937 8470 gene locus_tag LOCUS_25610 8937 8470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 9031 9261 gene locus_tag LOCUS_25620 9031 9261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 9544 10458 gene locus_tag LOCUS_25630 9544 10458 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083539905.1 protein_id gnl|my_center|LOCUS_25630 11106 10723 gene locus_tag LOCUS_25640 11106 10723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 11162 11896 gene locus_tag LOCUS_25650 11162 11896 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776018.1 protein_id gnl|my_center|LOCUS_25650 12563 12120 gene locus_tag LOCUS_25660 12563 12120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 13762 12590 gene locus_tag LOCUS_25670 13762 12590 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201417591.1 protein_id gnl|my_center|LOCUS_25670 13840 14397 gene locus_tag LOCUS_25680 13840 14397 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229903.1 protein_id gnl|my_center|LOCUS_25680 14696 14505 gene locus_tag LOCUS_25690 14696 14505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 14882 15025 gene locus_tag LOCUS_25700 14882 15025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 15749 15159 gene locus_tag LOCUS_25710 15749 15159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 16140 15838 gene locus_tag LOCUS_25720 16140 15838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 16937 16242 gene locus_tag LOCUS_25730 16937 16242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 17112 17429 gene locus_tag LOCUS_25740 17112 17429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 17426 18457 gene locus_tag LOCUS_25750 17426 18457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25750 18939 18712 gene locus_tag LOCUS_25760 18939 18712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 19523 18936 gene locus_tag LOCUS_25770 19523 18936 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058038.1 protein_id gnl|my_center|LOCUS_25770 20691 19876 gene locus_tag LOCUS_25780 20691 19876 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035954.1 protein_id gnl|my_center|LOCUS_25780 22750 20579 gene locus_tag LOCUS_25790 22750 20579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 23105 22908 gene locus_tag LOCUS_25800 23105 22908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 24273 23269 gene locus_tag LOCUS_25810 24273 23269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 24312 25313 gene locus_tag LOCUS_25820 24312 25313 CDS product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079871.1 protein_id gnl|my_center|LOCUS_25820 25931 25254 gene locus_tag LOCUS_25830 25931 25254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 26689 26216 gene locus_tag LOCUS_25840 26689 26216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 26949 28580 gene locus_tag LOCUS_25850 26949 28580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 28738 29805 gene locus_tag LOCUS_25860 28738 29805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 29783 30448 gene locus_tag LOCUS_25870 29783 30448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 30445 31176 gene locus_tag LOCUS_25880 30445 31176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 31196 31531 gene locus_tag LOCUS_25890 31196 31531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 31531 32040 gene locus_tag LOCUS_25900 31531 32040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 32072 32812 gene locus_tag LOCUS_25910 32072 32812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 32829 33551 gene locus_tag LOCUS_25920 32829 33551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 33548 35443 gene locus_tag LOCUS_25930 33548 35443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 35440 35832 gene locus_tag LOCUS_25940 35440 35832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 35832 37316 gene locus_tag LOCUS_25950 35832 37316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068083.1 protein_id gnl|my_center|LOCUS_25950 37319 39019 gene locus_tag LOCUS_25960 37319 39019 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080790597.1 protein_id gnl|my_center|LOCUS_25960 38997 39680 gene locus_tag LOCUS_25970 38997 39680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 39677 41431 gene locus_tag LOCUS_25980 39677 41431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 41458 42066 gene locus_tag LOCUS_25990 41458 42066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 42174 42314 gene locus_tag LOCUS_26000 42174 42314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 42906 42289 gene locus_tag LOCUS_26010 42906 42289 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088057164.1 protein_id gnl|my_center|LOCUS_26010 43094 43426 gene locus_tag LOCUS_26020 43094 43426 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897009.1 protein_id gnl|my_center|LOCUS_26020 43426 44139 gene locus_tag LOCUS_26030 43426 44139 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495802.1 protein_id gnl|my_center|LOCUS_26030 44246 45244 gene locus_tag LOCUS_26040 44246 45244 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084065.1 protein_id gnl|my_center|LOCUS_26040 45288 45890 gene locus_tag LOCUS_26050 45288 45890 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083597.1 protein_id gnl|my_center|LOCUS_26050 47225 45954 gene locus_tag LOCUS_26060 47225 45954 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005132388.1 protein_id gnl|my_center|LOCUS_26060 48349 47222 gene locus_tag LOCUS_26070 48349 47222 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088561.1 protein_id gnl|my_center|LOCUS_26070 48841 48440 gene locus_tag LOCUS_26080 48841 48440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 52126 49184 gene locus_tag LOCUS_26090 52126 49184 CDS product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480405.1 protein_id gnl|my_center|LOCUS_26090 52401 52901 gene locus_tag LOCUS_26100 52401 52901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 52898 53254 gene locus_tag LOCUS_26110 52898 53254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 53283 53597 gene locus_tag LOCUS_26120 53283 53597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 54683 53820 gene locus_tag LOCUS_26130 54683 53820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 56634 55018 gene locus_tag LOCUS_26140 56634 55018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 57535 56765 gene locus_tag LOCUS_26150 57535 56765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 58931 57519 gene locus_tag LOCUS_26160 58931 57519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 60565 58928 gene locus_tag LOCUS_26170 60565 58928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 60966 60562 gene locus_tag LOCUS_26180 60966 60562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 61402 61833 gene locus_tag LOCUS_26190 61402 61833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 61830 62573 gene locus_tag LOCUS_26200 61830 62573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 62570 63244 gene locus_tag LOCUS_26210 62570 63244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 63257 63673 gene locus_tag LOCUS_26220 63257 63673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 63670 64470 gene locus_tag LOCUS_26230 63670 64470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 64541 65872 gene locus_tag LOCUS_26240 64541 65872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 66035 66370 gene locus_tag LOCUS_26250 66035 66370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 67211 66378 gene locus_tag LOCUS_26260 67211 66378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 67412 67227 gene locus_tag LOCUS_26270 67412 67227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 67687 67484 gene locus_tag LOCUS_26280 67687 67484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 67974 67711 gene locus_tag LOCUS_26290 67974 67711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 68194 67985 gene locus_tag LOCUS_26300 68194 67985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 68850 68197 gene locus_tag LOCUS_26310 68850 68197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 69019 68861 gene locus_tag LOCUS_26320 69019 68861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 69280 69035 gene locus_tag LOCUS_26330 gene nrdH 69280 69035 CDS product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415982.1 protein_id gnl|my_center|LOCUS_26330 69671 69883 gene locus_tag LOCUS_26340 69671 69883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 70103 69939 gene locus_tag LOCUS_26350 70103 69939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 71038 70403 gene locus_tag LOCUS_26360 71038 70403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 71611 71369 gene locus_tag LOCUS_26370 71611 71369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 71796 71614 gene locus_tag LOCUS_26380 71796 71614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 71969 71793 gene locus_tag LOCUS_26390 71969 71793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 72166 71987 gene locus_tag LOCUS_26400 72166 71987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 72667 72990 gene locus_tag LOCUS_26410 72667 72990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 73932 73039 gene locus_tag LOCUS_26420 73932 73039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 74378 74887 gene locus_tag LOCUS_26430 74378 74887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 74973 75182 gene locus_tag LOCUS_26440 74973 75182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 76175 75243 gene locus_tag LOCUS_26450 76175 75243 CDS product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111537.1 protein_id gnl|my_center|LOCUS_26450 >Feature sequence21 343 140 gene locus_tag LOCUS_26460 343 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 300 794 gene locus_tag LOCUS_26470 300 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 1185 892 gene locus_tag LOCUS_26480 1185 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 1430 1182 gene locus_tag LOCUS_26490 gene rpmC 1430 1182 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403594.1 protein_id gnl|my_center|LOCUS_26490 1846 1430 gene locus_tag LOCUS_26500 gene rplP 1846 1430 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892830.1 protein_id gnl|my_center|LOCUS_26500 2689 1850 gene locus_tag LOCUS_26510 gene rpsC 2689 1850 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080488.1 protein_id gnl|my_center|LOCUS_26510 3147 2689 gene locus_tag LOCUS_26520 gene rplV 3147 2689 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727673.1 protein_id gnl|my_center|LOCUS_26520 3425 3144 gene locus_tag LOCUS_26530 gene rpsS 3425 3144 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908582.1 protein_id gnl|my_center|LOCUS_26530 4279 3443 gene locus_tag LOCUS_26540 gene rplB 4279 3443 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727672.1 protein_id gnl|my_center|LOCUS_26540 4628 4323 gene locus_tag LOCUS_26550 gene rplW 4628 4323 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892825.1 protein_id gnl|my_center|LOCUS_26550 5319 4630 gene locus_tag LOCUS_26560 gene rplD 5319 4630 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403580.1 protein_id gnl|my_center|LOCUS_26560 5972 5316 gene locus_tag LOCUS_26570 gene rplC 5972 5316 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055632.1 protein_id gnl|my_center|LOCUS_26570 6313 6008 gene locus_tag LOCUS_26580 gene rpsJ 6313 6008 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102098.1 protein_id gnl|my_center|LOCUS_26580 7052 7201 gene locus_tag LOCUS_26590 7052 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 7198 8139 gene locus_tag LOCUS_26600 7198 8139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 8227 8940 gene locus_tag LOCUS_26610 8227 8940 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057387.1 protein_id gnl|my_center|LOCUS_26610 9040 10605 gene locus_tag LOCUS_26620 9040 10605 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057378.1 protein_id gnl|my_center|LOCUS_26620 10623 11363 gene locus_tag LOCUS_26630 10623 11363 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730745.1 protein_id gnl|my_center|LOCUS_26630 11447 12262 gene locus_tag LOCUS_26640 11447 12262 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407672.1 protein_id gnl|my_center|LOCUS_26640 12356 13162 gene locus_tag LOCUS_26650 12356 13162 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407672.1 protein_id gnl|my_center|LOCUS_26650 13311 14249 gene locus_tag LOCUS_26660 13311 14249 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027946.1 protein_id gnl|my_center|LOCUS_26660 40455 14299 gene locus_tag LOCUS_26670 40455 14299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26670 40636 41067 gene locus_tag LOCUS_26680 40636 41067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 43346 43591 gene locus_tag LOCUS_26690 43346 43591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 43588 44538 gene locus_tag LOCUS_26700 43588 44538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 44806 45858 gene locus_tag LOCUS_26710 44806 45858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 46181 46576 gene locus_tag LOCUS_26720 46181 46576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 46600 48492 gene locus_tag LOCUS_26730 46600 48492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 49123 48719 gene locus_tag LOCUS_26740 49123 48719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 49643 49422 gene locus_tag LOCUS_26750 gene mbtH 49643 49422 CDS product mycobactin NRPS accessory protein MbtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412265.1 protein_id gnl|my_center|LOCUS_26750 50154 49741 gene locus_tag LOCUS_26760 50154 49741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 50405 51454 gene locus_tag LOCUS_26770 gene drrB 50405 51454 CDS product daunorubicin ABC transporter permease DrrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414846.1 protein_id gnl|my_center|LOCUS_26770 51451 52266 gene locus_tag LOCUS_26780 gene drrA 51451 52266 CDS product daunorubicin ABC transporter ATP-binding protein DrrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414848.1 protein_id gnl|my_center|LOCUS_26780 52263 53498 gene locus_tag LOCUS_26790 52263 53498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 53560 54402 gene locus_tag LOCUS_26800 53560 54402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 54878 54426 gene locus_tag LOCUS_26810 54878 54426 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027616.1 protein_id gnl|my_center|LOCUS_26810 56170 54875 gene locus_tag LOCUS_26820 gene mftG 56170 54875 CDS product mycofactocin system GMC family oxidoreductase MftG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403503.1 protein_id gnl|my_center|LOCUS_26820 57830 56229 gene locus_tag LOCUS_26830 gene mftF 57830 56229 CDS product mycofactocin biosynthesis glycosyltransferase MftF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403501.1 protein_id gnl|my_center|LOCUS_26830 58543 57827 gene locus_tag LOCUS_26840 gene mftE 58543 57827 CDS product mycofactocin biosynthesis peptidyl-dipeptidase MftE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112045.1 protein_id gnl|my_center|LOCUS_26840 58747 59865 gene locus_tag LOCUS_26850 58747 59865 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730368.1 protein_id gnl|my_center|LOCUS_26850 >Feature sequence22 1287 577 gene locus_tag LOCUS_26860 1287 577 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893258.1 protein_id gnl|my_center|LOCUS_26860 3557 1794 gene locus_tag LOCUS_26870 gene lpqB 3557 1794 CDS product MtrAB system accessory lipoprotein LpqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088448.1 protein_id gnl|my_center|LOCUS_26870 5205 3550 gene locus_tag LOCUS_26880 gene mtrB 5205 3550 CDS product MtrAB system histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907922.1 protein_id gnl|my_center|LOCUS_26880 5888 5202 gene locus_tag LOCUS_26890 gene mtrA 5888 5202 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899985.1 protein_id gnl|my_center|LOCUS_26890 6007 6666 gene locus_tag LOCUS_26900 6007 6666 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229736.1 protein_id gnl|my_center|LOCUS_26900 8806 6749 gene locus_tag LOCUS_26910 8806 6749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 9662 9033 gene locus_tag LOCUS_26920 9662 9033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 11172 9703 gene locus_tag LOCUS_26930 gene ahcY 11172 9703 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080862.1 protein_id gnl|my_center|LOCUS_26930 12937 11378 gene locus_tag LOCUS_26940 12937 11378 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727944.1 protein_id gnl|my_center|LOCUS_26940 13912 13028 gene locus_tag LOCUS_26950 13912 13028 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080850.1 protein_id gnl|my_center|LOCUS_26950 13797 14054 gene locus_tag LOCUS_26960 13797 14054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 14178 16307 gene locus_tag LOCUS_26970 14178 16307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 17061 16324 gene locus_tag LOCUS_26980 17061 16324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 17238 18302 gene locus_tag LOCUS_26990 17238 18302 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900558.1 protein_id gnl|my_center|LOCUS_26990 18299 18727 gene locus_tag LOCUS_27000 18299 18727 CDS product NINE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005132930.1 protein_id gnl|my_center|LOCUS_27000 19665 18733 gene locus_tag LOCUS_27010 gene truA 19665 18733 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418344.1 protein_id gnl|my_center|LOCUS_27010 20298 19681 gene locus_tag LOCUS_27020 20298 19681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 21410 20355 gene locus_tag LOCUS_27030 21410 20355 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055961.1 protein_id gnl|my_center|LOCUS_27030 22139 21534 gene locus_tag LOCUS_27040 gene rpsD 22139 21534 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418354.1 protein_id gnl|my_center|LOCUS_27040 22573 22163 gene locus_tag LOCUS_27050 gene rpsK 22573 22163 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055956.1 protein_id gnl|my_center|LOCUS_27050 22941 22573 gene locus_tag LOCUS_27060 gene rpsM 22941 22573 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055954.1 protein_id gnl|my_center|LOCUS_27060 23630 23346 gene locus_tag LOCUS_27070 gene infA 23630 23346 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418601.1 protein_id gnl|my_center|LOCUS_27070 24628 23783 gene locus_tag LOCUS_27080 24628 23783 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727715.1 protein_id gnl|my_center|LOCUS_27080 25108 24668 gene locus_tag LOCUS_27090 25108 24668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 25225 25662 gene locus_tag LOCUS_27100 gene dtd 25225 25662 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729707.1 protein_id gnl|my_center|LOCUS_27100 25671 26195 gene locus_tag LOCUS_27110 25671 26195 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726833.1 protein_id gnl|my_center|LOCUS_27110 27015 26212 gene locus_tag LOCUS_27120 gene map 27015 26212 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112014.1 protein_id gnl|my_center|LOCUS_27120 27572 27027 gene locus_tag LOCUS_27130 27572 27027 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854403.1 protein_id gnl|my_center|LOCUS_27130 28894 27569 gene locus_tag LOCUS_27140 gene secY 28894 27569 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892870.1 protein_id gnl|my_center|LOCUS_27140 29611 29168 gene locus_tag LOCUS_27150 gene rplO 29611 29168 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055720.1 protein_id gnl|my_center|LOCUS_27150 29799 29611 gene locus_tag LOCUS_27160 gene rpmD 29799 29611 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222615.1 protein_id gnl|my_center|LOCUS_27160 30482 29796 gene locus_tag LOCUS_27170 gene rpsE 30482 29796 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892859.1 protein_id gnl|my_center|LOCUS_27170 30936 30532 gene locus_tag LOCUS_27180 gene rplR 30936 30532 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130474831.1 protein_id gnl|my_center|LOCUS_27180 31474 30938 gene locus_tag LOCUS_27190 gene rplF 31474 30938 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403673.1 protein_id gnl|my_center|LOCUS_27190 31885 31487 gene locus_tag LOCUS_27200 gene rpsH 31885 31487 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055710.1 protein_id gnl|my_center|LOCUS_27200 32871 32206 gene locus_tag LOCUS_27210 32871 32206 CDS product EthD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729166.1 protein_id gnl|my_center|LOCUS_27210 33071 33664 gene locus_tag LOCUS_27220 33071 33664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 34581 33751 gene locus_tag LOCUS_27230 34581 33751 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776690.1 protein_id gnl|my_center|LOCUS_27230 34924 34739 gene locus_tag LOCUS_27240 34924 34739 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892855.1 protein_id gnl|my_center|LOCUS_27240 35507 34926 gene locus_tag LOCUS_27250 gene rplE 35507 34926 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055683.1 protein_id gnl|my_center|LOCUS_27250 35826 35509 gene locus_tag LOCUS_27260 gene rplX 35826 35509 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055682.1 protein_id gnl|my_center|LOCUS_27260 36196 35828 gene locus_tag LOCUS_27270 gene rplN 36196 35828 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892852.1 protein_id gnl|my_center|LOCUS_27270 36466 37323 gene locus_tag LOCUS_27280 36466 37323 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814760.1 protein_id gnl|my_center|LOCUS_27280 37320 38939 gene locus_tag LOCUS_27290 37320 38939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 39052 39318 gene locus_tag LOCUS_27300 39052 39318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 39397 40764 gene locus_tag LOCUS_27310 39397 40764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 41136 40831 gene locus_tag LOCUS_27320 41136 40831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 41390 42142 gene locus_tag LOCUS_27330 41390 42142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 42139 42774 gene locus_tag LOCUS_27340 42139 42774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 42684 43733 gene locus_tag LOCUS_27350 42684 43733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 43747 45291 gene locus_tag LOCUS_27360 43747 45291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 45288 46478 gene locus_tag LOCUS_27370 45288 46478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 46607 47674 gene locus_tag LOCUS_27380 46607 47674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27380 47653 47949 gene locus_tag LOCUS_27390 47653 47949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27390 48038 49294 gene locus_tag LOCUS_27400 48038 49294 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104544.1 protein_id gnl|my_center|LOCUS_27400 >Feature sequence23 552 7 gene locus_tag LOCUS_27410 552 7 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269997.1 protein_id gnl|my_center|LOCUS_27410 1445 552 gene locus_tag LOCUS_27420 1445 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 1602 2870 gene locus_tag LOCUS_27430 1602 2870 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895076.1 protein_id gnl|my_center|LOCUS_27430 3227 2880 gene locus_tag LOCUS_27440 3227 2880 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113301.1 protein_id gnl|my_center|LOCUS_27440 4609 3278 gene locus_tag LOCUS_27450 4609 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084962.1 protein_id gnl|my_center|LOCUS_27450 4830 4606 gene locus_tag LOCUS_27460 4830 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 6689 4827 gene locus_tag LOCUS_27470 6689 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731322.1 protein_id gnl|my_center|LOCUS_27470 8290 6737 gene locus_tag LOCUS_27480 8290 6737 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972427.1 protein_id gnl|my_center|LOCUS_27480 8423 9013 gene locus_tag LOCUS_27490 8423 9013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 10014 9010 gene locus_tag LOCUS_27500 gene rfbB 10014 9010 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080535.1 protein_id gnl|my_center|LOCUS_27500 10108 10977 gene locus_tag LOCUS_27510 gene rfbA 10108 10977 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062166.1 protein_id gnl|my_center|LOCUS_27510 10979 11605 gene locus_tag LOCUS_27520 10979 11605 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080532.1 protein_id gnl|my_center|LOCUS_27520 12047 11622 gene locus_tag LOCUS_27530 12047 11622 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406060.1 protein_id gnl|my_center|LOCUS_27530 12116 12616 gene locus_tag LOCUS_27540 12116 12616 CDS product DUF5709 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027611.1 protein_id gnl|my_center|LOCUS_27540 13973 12618 gene locus_tag LOCUS_27550 13973 12618 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086878.1 protein_id gnl|my_center|LOCUS_27550 14111 14530 gene locus_tag LOCUS_27560 14111 14530 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013947.1 protein_id gnl|my_center|LOCUS_27560 18415 14534 gene locus_tag LOCUS_27570 18415 14534 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731067.1 protein_id gnl|my_center|LOCUS_27570 18708 19691 gene locus_tag LOCUS_27580 18708 19691 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083496.1 protein_id gnl|my_center|LOCUS_27580 19884 19702 gene locus_tag LOCUS_27590 19884 19702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 20683 19877 gene locus_tag LOCUS_27600 20683 19877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 20766 21950 gene locus_tag LOCUS_27610 20766 21950 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730427.1 protein_id gnl|my_center|LOCUS_27610 21987 22325 gene locus_tag LOCUS_27620 21987 22325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 23173 22322 gene locus_tag LOCUS_27630 23173 22322 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229199.1 protein_id gnl|my_center|LOCUS_27630 24194 23175 gene locus_tag LOCUS_27640 24194 23175 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229198.1 protein_id gnl|my_center|LOCUS_27640 24292 24876 gene locus_tag LOCUS_27650 24292 24876 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229197.1 protein_id gnl|my_center|LOCUS_27650 25717 24893 gene locus_tag LOCUS_27660 25717 24893 CDS product DUF2127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082127.1 protein_id gnl|my_center|LOCUS_27660 25867 27576 gene locus_tag LOCUS_27670 25867 27576 CDS product TIGR03767 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230137.1 protein_id gnl|my_center|LOCUS_27670 28104 27736 gene locus_tag LOCUS_27680 28104 27736 CDS product DUF4267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227795.1 protein_id gnl|my_center|LOCUS_27680 28182 28736 gene locus_tag LOCUS_27690 28182 28736 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726626.1 protein_id gnl|my_center|LOCUS_27690 28796 29182 gene locus_tag LOCUS_27700 28796 29182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 29179 29799 gene locus_tag LOCUS_27710 29179 29799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 31738 29849 gene locus_tag LOCUS_27720 31738 29849 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031376.1 protein_id gnl|my_center|LOCUS_27720 33018 31804 gene locus_tag LOCUS_27730 33018 31804 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225440.1 protein_id gnl|my_center|LOCUS_27730 34340 33030 gene locus_tag LOCUS_27740 34340 33030 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225441.1 protein_id gnl|my_center|LOCUS_27740 34678 34337 gene locus_tag LOCUS_27750 34678 34337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 34608 35078 gene locus_tag LOCUS_27760 34608 35078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 35109 35792 gene locus_tag LOCUS_27770 35109 35792 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225438.1 protein_id gnl|my_center|LOCUS_27770 35789 37132 gene locus_tag LOCUS_27780 35789 37132 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225439.1 protein_id gnl|my_center|LOCUS_27780 38029 37136 gene locus_tag LOCUS_27790 38029 37136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 38217 39230 gene locus_tag LOCUS_27800 gene fgd 38217 39230 CDS product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062430.1 protein_id gnl|my_center|LOCUS_27800 39401 39559 gene locus_tag LOCUS_27810 39401 39559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 39641 40441 gene locus_tag LOCUS_27820 39641 40441 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223645.1 protein_id gnl|my_center|LOCUS_27820 40452 41375 gene locus_tag LOCUS_27830 40452 41375 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027928.1 protein_id gnl|my_center|LOCUS_27830 41387 41950 gene locus_tag LOCUS_27840 41387 41950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 41960 42670 gene locus_tag LOCUS_27850 41960 42670 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223909.1 protein_id gnl|my_center|LOCUS_27850 43236 42733 gene locus_tag LOCUS_27860 43236 42733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 43379 45442 gene locus_tag LOCUS_27870 43379 45442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 45585 46667 gene locus_tag LOCUS_27880 45585 46667 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731552.1 protein_id gnl|my_center|LOCUS_27880 46688 47326 gene locus_tag LOCUS_27890 46688 47326 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227176.1 protein_id gnl|my_center|LOCUS_27890 47347 49428 gene locus_tag LOCUS_27900 gene pta 47347 49428 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727187.1 protein_id gnl|my_center|LOCUS_27900 49428 50651 gene locus_tag LOCUS_27910 49428 50651 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727188.1 protein_id gnl|my_center|LOCUS_27910 51458 50655 gene locus_tag LOCUS_27920 51458 50655 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119848.1 protein_id gnl|my_center|LOCUS_27920 52492 51470 gene locus_tag LOCUS_27930 52492 51470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 53642 52506 gene locus_tag LOCUS_27940 53642 52506 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119846.1 protein_id gnl|my_center|LOCUS_27940 54763 53639 gene locus_tag LOCUS_27950 54763 53639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 54885 55802 gene locus_tag LOCUS_27960 54885 55802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 55856 56857 gene locus_tag LOCUS_27970 55856 56857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 56854 58188 gene locus_tag LOCUS_27980 56854 58188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 60669 58189 gene locus_tag LOCUS_27990 60669 58189 CDS product serine/threonine-protein kinase PknG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727190.1 protein_id gnl|my_center|LOCUS_27990 61686 60706 gene locus_tag LOCUS_28000 61686 60706 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900142.1 protein_id gnl|my_center|LOCUS_28000 63188 61683 gene locus_tag LOCUS_28010 gene glnX 63188 61683 CDS product protein kinase G-activating protein GlnX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911172.1 protein_id gnl|my_center|LOCUS_28010 63350 63835 gene locus_tag LOCUS_28020 63350 63835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 64337 63885 gene locus_tag LOCUS_28030 64337 63885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013472216.1 protein_id gnl|my_center|LOCUS_28030 64610 65983 gene locus_tag LOCUS_28040 64610 65983 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410095.1 protein_id gnl|my_center|LOCUS_28040 66684 66013 gene locus_tag LOCUS_28050 gene thiE 66684 66013 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095063.1 protein_id gnl|my_center|LOCUS_28050 66851 67930 gene locus_tag LOCUS_28060 gene thiO 66851 67930 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727195.1 protein_id gnl|my_center|LOCUS_28060 67927 68142 gene locus_tag LOCUS_28070 gene thiS 67927 68142 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727196.1 protein_id gnl|my_center|LOCUS_28070 68144 68917 gene locus_tag LOCUS_28080 68144 68917 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727197.1 protein_id gnl|my_center|LOCUS_28080 70681 68933 gene locus_tag LOCUS_28090 70681 68933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 70782 71741 gene locus_tag LOCUS_28100 70782 71741 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230969.1 protein_id gnl|my_center|LOCUS_28100 71738 72508 gene locus_tag LOCUS_28110 71738 72508 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727198.1 protein_id gnl|my_center|LOCUS_28110 73375 72530 gene locus_tag LOCUS_28120 gene thiD 73375 72530 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727221.1 protein_id gnl|my_center|LOCUS_28120 75060 73411 gene locus_tag LOCUS_28130 gene thiC 75060 73411 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900143.1 protein_id gnl|my_center|LOCUS_28130 75360 75704 gene locus_tag LOCUS_28140 75360 75704 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804862.1 protein_id gnl|my_center|LOCUS_28140 75773 76531 gene locus_tag LOCUS_28150 75773 76531 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110745.1 protein_id gnl|my_center|LOCUS_28150 78177 76501 gene locus_tag LOCUS_28160 78177 76501 CDS product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104139.1 protein_id gnl|my_center|LOCUS_28160 78269 79597 gene locus_tag LOCUS_28170 gene mbtI 78269 79597 CDS product mycobactin biosynthesis salicylate synthase MbtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729893.1 protein_id gnl|my_center|LOCUS_28170 79594 80592 gene locus_tag LOCUS_28180 79594 80592 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908851.1 protein_id gnl|my_center|LOCUS_28180 80589 81368 gene locus_tag LOCUS_28190 gene drrA 80589 81368 CDS product daunorubicin ABC transporter ATP-binding protein DrrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414848.1 protein_id gnl|my_center|LOCUS_28190 81365 82180 gene locus_tag LOCUS_28200 81365 82180 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414851.1 protein_id gnl|my_center|LOCUS_28200 82248 82511 gene locus_tag LOCUS_28210 82248 82511 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893505.1 protein_id gnl|my_center|LOCUS_28210 82508 83815 gene locus_tag LOCUS_28220 82508 83815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 85316 83967 gene locus_tag LOCUS_28230 85316 83967 CDS product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976800.1 protein_id gnl|my_center|LOCUS_28230 88269 85306 gene locus_tag LOCUS_28240 88269 85306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 90578 88266 gene locus_tag LOCUS_28250 90578 88266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 92401 90575 gene locus_tag LOCUS_28260 gene desD 92401 90575 CDS product desferrioxamine E synthetase DesD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028585.1 protein_id gnl|my_center|LOCUS_28260 96432 92419 gene locus_tag LOCUS_28270 96432 92419 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110650.1 protein_id gnl|my_center|LOCUS_28270 96523 98196 gene locus_tag LOCUS_28280 gene mbtM 96523 98196 CDS product long-chain-fatty acid--ACP ligase MbtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406950.1 protein_id gnl|my_center|LOCUS_28280 98187 99353 gene locus_tag LOCUS_28290 gene mbtN 98187 99353 CDS product mycobactin biosynthesis acyl-ACP dehydrogenase MbtN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104518.1 protein_id gnl|my_center|LOCUS_28290 99446 100249 gene locus_tag LOCUS_28300 99446 100249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 100296 101279 gene locus_tag LOCUS_28310 100296 101279 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198708.1 protein_id gnl|my_center|LOCUS_28310 102095 101298 gene locus_tag LOCUS_28320 102095 101298 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078040.1 protein_id gnl|my_center|LOCUS_28320 102642 102142 gene locus_tag LOCUS_28330 102642 102142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 103314 102784 gene locus_tag LOCUS_28340 103314 102784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 103199 103468 gene locus_tag LOCUS_28350 103199 103468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 103772 103449 gene locus_tag LOCUS_28360 103772 103449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 103892 105145 gene locus_tag LOCUS_28370 103892 105145 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729771.1 protein_id gnl|my_center|LOCUS_28370 105520 105152 gene locus_tag LOCUS_28380 105520 105152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 105626 105871 gene locus_tag LOCUS_28390 105626 105871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 105904 106251 gene locus_tag LOCUS_28400 105904 106251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 106464 107900 gene locus_tag LOCUS_28410 gene eat 106464 107900 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111333.1 protein_id gnl|my_center|LOCUS_28410 107904 109328 gene locus_tag LOCUS_28420 107904 109328 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892941.1 protein_id gnl|my_center|LOCUS_28420 109325 110050 gene locus_tag LOCUS_28430 gene eutC 109325 110050 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727733.1 protein_id gnl|my_center|LOCUS_28430 110174 111052 gene locus_tag LOCUS_28440 110174 111052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 112098 111124 gene locus_tag LOCUS_28450 112098 111124 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296736.1 protein_id gnl|my_center|LOCUS_28450 112729 112109 gene locus_tag LOCUS_28460 112729 112109 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727226.1 protein_id gnl|my_center|LOCUS_28460 112892 113260 gene locus_tag LOCUS_28470 112892 113260 CDS product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062316.1 protein_id gnl|my_center|LOCUS_28470 113325 113849 gene locus_tag LOCUS_28480 113325 113849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 113974 114693 gene locus_tag LOCUS_28490 113974 114693 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402198.1 protein_id gnl|my_center|LOCUS_28490 114690 115820 gene locus_tag LOCUS_28500 114690 115820 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085842.1 protein_id gnl|my_center|LOCUS_28500 117150 115831 gene locus_tag LOCUS_28510 117150 115831 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228715.1 protein_id gnl|my_center|LOCUS_28510 117658 117326 gene locus_tag LOCUS_28520 gene mnhG 117658 117326 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727233.1 protein_id gnl|my_center|LOCUS_28520 118019 117705 gene locus_tag LOCUS_28530 118019 117705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 118804 118016 gene locus_tag LOCUS_28540 118804 118016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 120408 118801 gene locus_tag LOCUS_28550 120408 118801 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092260.1 protein_id gnl|my_center|LOCUS_28550 121109 120405 gene locus_tag LOCUS_28560 121109 120405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 124042 121106 gene locus_tag LOCUS_28570 124042 121106 CDS product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113179.1 protein_id gnl|my_center|LOCUS_28570 124302 124697 gene locus_tag LOCUS_28580 124302 124697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 124811 125281 gene locus_tag LOCUS_28590 124811 125281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 126157 125288 gene locus_tag LOCUS_28600 gene pssA 126157 125288 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064848.1 protein_id gnl|my_center|LOCUS_28600 127062 126259 gene locus_tag LOCUS_28610 127062 126259 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113180.1 protein_id gnl|my_center|LOCUS_28610 128516 127203 gene locus_tag LOCUS_28620 128516 127203 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113181.1 protein_id gnl|my_center|LOCUS_28620 129892 128513 gene locus_tag LOCUS_28630 129892 128513 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285284.1 protein_id gnl|my_center|LOCUS_28630 129955 130755 gene locus_tag LOCUS_28640 129955 130755 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064851.1 protein_id gnl|my_center|LOCUS_28640 130873 131091 gene locus_tag LOCUS_28650 130873 131091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079856.1 protein_id gnl|my_center|LOCUS_28650 131607 131146 gene locus_tag LOCUS_28660 131607 131146 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897102.1 protein_id gnl|my_center|LOCUS_28660 132535 131669 gene locus_tag LOCUS_28670 132535 131669 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085604.1 protein_id gnl|my_center|LOCUS_28670 133717 132593 gene locus_tag LOCUS_28680 133717 132593 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731331.1 protein_id gnl|my_center|LOCUS_28680 134948 133776 gene locus_tag LOCUS_28690 134948 133776 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731330.1 protein_id gnl|my_center|LOCUS_28690 135160 135426 gene locus_tag LOCUS_28700 135160 135426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 136874 135507 gene locus_tag LOCUS_28710 136874 135507 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729017.1 protein_id gnl|my_center|LOCUS_28710 136969 137553 gene locus_tag LOCUS_28720 136969 137553 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626529.1 protein_id gnl|my_center|LOCUS_28720 138035 137562 gene locus_tag LOCUS_28730 138035 137562 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226322.1 protein_id gnl|my_center|LOCUS_28730 138137 138352 gene locus_tag LOCUS_28740 138137 138352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28740 138349 139407 gene locus_tag LOCUS_28750 138349 139407 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162234465.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28750 139837 139382 gene locus_tag LOCUS_28760 139837 139382 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027141.1 protein_id gnl|my_center|LOCUS_28760 139948 140967 gene locus_tag LOCUS_28770 139948 140967 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027140.1 protein_id gnl|my_center|LOCUS_28770 140964 141344 gene locus_tag LOCUS_28780 140964 141344 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031865.1 protein_id gnl|my_center|LOCUS_28780 142722 141349 gene locus_tag LOCUS_28790 142722 141349 CDS product NtaA/DmoA family FMN-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728200.1 protein_id gnl|my_center|LOCUS_28790 143909 142719 gene locus_tag LOCUS_28800 143909 142719 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728201.1 protein_id gnl|my_center|LOCUS_28800 144044 144214 gene locus_tag LOCUS_28810 144044 144214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 144211 145329 gene locus_tag LOCUS_28820 144211 145329 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086421.1 protein_id gnl|my_center|LOCUS_28820 146234 145407 gene locus_tag LOCUS_28830 146234 145407 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776690.1 protein_id gnl|my_center|LOCUS_28830 146689 148314 gene locus_tag LOCUS_28840 gene groL 146689 148314 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064866.1 protein_id gnl|my_center|LOCUS_28840 148911 148420 gene locus_tag LOCUS_28850 148911 148420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 149350 148940 gene locus_tag LOCUS_28860 149350 148940 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230831.1 protein_id gnl|my_center|LOCUS_28860 149616 149350 gene locus_tag LOCUS_28870 149616 149350 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304855.1 protein_id gnl|my_center|LOCUS_28870 149942 152674 gene locus_tag LOCUS_28880 149942 152674 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674070.1 protein_id gnl|my_center|LOCUS_28880 152678 154291 gene locus_tag LOCUS_28890 152678 154291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 154281 154901 gene locus_tag LOCUS_28900 gene casB 154281 154901 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227613.1 protein_id gnl|my_center|LOCUS_28900 154907 156034 gene locus_tag LOCUS_28910 gene cas7e 154907 156034 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674072.1 protein_id gnl|my_center|LOCUS_28910 156031 156726 gene locus_tag LOCUS_28920 gene cas5e 156031 156726 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227611.1 protein_id gnl|my_center|LOCUS_28920 156728 157405 gene locus_tag LOCUS_28930 gene cas6e 156728 157405 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229112.1 protein_id gnl|my_center|LOCUS_28930 157402 158358 gene locus_tag LOCUS_28940 gene cas1e 157402 158358 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674075.1 protein_id gnl|my_center|LOCUS_28940 158621 158316 gene locus_tag LOCUS_28950 158621 158316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 158776 163196 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgctccccgcgaacgcggggatgagccc 164605 163490 gene locus_tag LOCUS_28960 164605 163490 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080059.1 protein_id gnl|my_center|LOCUS_28960 165639 164602 gene locus_tag LOCUS_28970 165639 164602 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296523.1 protein_id gnl|my_center|LOCUS_28970 166387 165668 gene locus_tag LOCUS_28980 166387 165668 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729372.1 protein_id gnl|my_center|LOCUS_28980 167109 166384 gene locus_tag LOCUS_28990 167109 166384 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895300.1 protein_id gnl|my_center|LOCUS_28990 167479 168147 gene locus_tag LOCUS_29000 gene frnE 167479 168147 CDS product protein disulfide isomerase FrnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 protein_id gnl|my_center|LOCUS_29000 168223 170064 gene locus_tag LOCUS_29010 168223 170064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 170185 170754 gene locus_tag LOCUS_29020 170185 170754 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731327.1 protein_id gnl|my_center|LOCUS_29020 171526 170762 gene locus_tag LOCUS_29030 171526 170762 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727078.1 protein_id gnl|my_center|LOCUS_29030 172444 171680 gene locus_tag LOCUS_29040 172444 171680 CDS product acyl-[acyl-carrier-protein] thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900448.1 protein_id gnl|my_center|LOCUS_29040 173211 172444 gene locus_tag LOCUS_29050 173211 172444 CDS product acyl-[acyl-carrier-protein] thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900448.1 protein_id gnl|my_center|LOCUS_29050 173419 174093 gene locus_tag LOCUS_29060 173419 174093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 174107 174592 gene locus_tag LOCUS_29070 174107 174592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 174779 175294 gene locus_tag LOCUS_29080 174779 175294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 175369 176304 gene locus_tag LOCUS_29090 gene ppk2 175369 176304 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062218.1 protein_id gnl|my_center|LOCUS_29090 176333 177172 gene locus_tag LOCUS_29100 176333 177172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 177501 178961 gene locus_tag LOCUS_29110 177501 178961 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110870.1 protein_id gnl|my_center|LOCUS_29110 181180 179111 gene locus_tag LOCUS_29120 181180 179111 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466817.1 protein_id gnl|my_center|LOCUS_29120 182051 181206 gene locus_tag LOCUS_29130 182051 181206 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111115.1 protein_id gnl|my_center|LOCUS_29130 182328 183716 gene locus_tag LOCUS_29140 gene lpdA 182328 183716 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085912.1 protein_id gnl|my_center|LOCUS_29140 183730 184626 gene locus_tag LOCUS_29150 183730 184626 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098665.1 protein_id gnl|my_center|LOCUS_29150 185520 184642 gene locus_tag LOCUS_29160 185520 184642 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814755.1 protein_id gnl|my_center|LOCUS_29160 186845 185562 gene locus_tag LOCUS_29170 186845 185562 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228715.1 protein_id gnl|my_center|LOCUS_29170 187705 186947 gene locus_tag LOCUS_29180 187705 186947 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080268.1 protein_id gnl|my_center|LOCUS_29180 188232 187702 gene locus_tag LOCUS_29190 188232 187702 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908916.1 protein_id gnl|my_center|LOCUS_29190 189723 188251 gene locus_tag LOCUS_29200 gene ramB 189723 188251 CDS product acetate metabolism transcriptional regulator RamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296731.1 protein_id gnl|my_center|LOCUS_29200 189979 191400 gene locus_tag LOCUS_29210 gene aceA 189979 191400 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085937.1 protein_id gnl|my_center|LOCUS_29210 191561 192439 gene locus_tag LOCUS_29220 191561 192439 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062138.1 protein_id gnl|my_center|LOCUS_29220 194041 193169 gene locus_tag LOCUS_29230 194041 193169 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727285.1 protein_id gnl|my_center|LOCUS_29230 194882 194046 gene locus_tag LOCUS_29240 194882 194046 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728691.1 protein_id gnl|my_center|LOCUS_29240 195226 194879 gene locus_tag LOCUS_29250 195226 194879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 196041 195244 gene locus_tag LOCUS_29260 196041 195244 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086261.1 protein_id gnl|my_center|LOCUS_29260 196140 197465 gene locus_tag LOCUS_29270 196140 197465 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402332.1 protein_id gnl|my_center|LOCUS_29270 197589 198023 gene locus_tag LOCUS_29280 197589 198023 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727288.1 protein_id gnl|my_center|LOCUS_29280 198083 198781 gene locus_tag LOCUS_29290 198083 198781 CDS product heparin-binding hemagglutinin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085945.1 protein_id gnl|my_center|LOCUS_29290 198893 199195 gene locus_tag LOCUS_29300 198893 199195 CDS product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908910.1 protein_id gnl|my_center|LOCUS_29300 199345 200265 gene locus_tag LOCUS_29310 199345 200265 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225257.1 protein_id gnl|my_center|LOCUS_29310 200311 201072 gene locus_tag LOCUS_29320 200311 201072 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143427.1 protein_id gnl|my_center|LOCUS_29320 201179 202231 gene locus_tag LOCUS_29330 201179 202231 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028808.1 protein_id gnl|my_center|LOCUS_29330 202886 202236 gene locus_tag LOCUS_29340 gene deoC 202886 202236 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049234098.1 protein_id gnl|my_center|LOCUS_29340 203318 203046 gene locus_tag LOCUS_29350 203318 203046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 204912 203425 gene locus_tag LOCUS_29360 204912 203425 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484182.1 protein_id gnl|my_center|LOCUS_29360 205916 204909 gene locus_tag LOCUS_29370 205916 204909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 206865 206023 gene locus_tag LOCUS_29380 206865 206023 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908906.1 protein_id gnl|my_center|LOCUS_29380 207597 206896 gene locus_tag LOCUS_29390 207597 206896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085951.1 protein_id gnl|my_center|LOCUS_29390 208186 207677 gene locus_tag LOCUS_29400 208186 207677 CDS product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876911.1 protein_id gnl|my_center|LOCUS_29400 208711 208211 gene locus_tag LOCUS_29410 208711 208211 CDS product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222385.1 protein_id gnl|my_center|LOCUS_29410 208737 209831 gene locus_tag LOCUS_29420 208737 209831 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222386.1 protein_id gnl|my_center|LOCUS_29420 209941 211230 gene locus_tag LOCUS_29430 209941 211230 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496089.1 protein_id gnl|my_center|LOCUS_29430 211997 211239 gene locus_tag LOCUS_29440 211997 211239 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900154.1 protein_id gnl|my_center|LOCUS_29440 212113 212925 gene locus_tag LOCUS_29450 212113 212925 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078164.1 protein_id gnl|my_center|LOCUS_29450 215576 213018 gene locus_tag LOCUS_29460 gene otsB 215576 213018 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085421.1 protein_id gnl|my_center|LOCUS_29460 217191 215653 gene locus_tag LOCUS_29470 217191 215653 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730872.1 protein_id gnl|my_center|LOCUS_29470 217385 217194 gene locus_tag LOCUS_29480 217385 217194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897289.1 protein_id gnl|my_center|LOCUS_29480 219046 217484 gene locus_tag LOCUS_29490 219046 217484 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853939.1 protein_id gnl|my_center|LOCUS_29490 219056 219130 gene locus_tag LOCUS_t00320 219056 219130 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 219282 220352 gene locus_tag LOCUS_29500 219282 220352 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093625.1 protein_id gnl|my_center|LOCUS_29500 220474 220644 gene locus_tag LOCUS_29510 220474 220644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 220790 221068 gene locus_tag LOCUS_29520 220790 221068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 221998 221141 gene locus_tag LOCUS_29530 221998 221141 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729731.1 protein_id gnl|my_center|LOCUS_29530 223611 222115 gene locus_tag LOCUS_29540 223611 222115 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243012.1 protein_id gnl|my_center|LOCUS_29540 224659 223685 gene locus_tag LOCUS_29550 224659 223685 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038968070.1 protein_id gnl|my_center|LOCUS_29550 225895 224738 gene locus_tag LOCUS_29560 225895 224738 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728095.1 protein_id gnl|my_center|LOCUS_29560 226092 227000 gene locus_tag LOCUS_29570 226092 227000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223235.1 protein_id gnl|my_center|LOCUS_29570 227957 227019 gene locus_tag LOCUS_29580 227957 227019 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119735.1 protein_id gnl|my_center|LOCUS_29580 228538 228035 gene locus_tag LOCUS_29590 228538 228035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 228695 229096 gene locus_tag LOCUS_29600 228695 229096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 229116 230303 gene locus_tag LOCUS_29610 229116 230303 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729341.1 protein_id gnl|my_center|LOCUS_29610 230300 230839 gene locus_tag LOCUS_29620 230300 230839 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081924.1 protein_id gnl|my_center|LOCUS_29620 230957 231655 gene locus_tag LOCUS_29630 230957 231655 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730856.1 protein_id gnl|my_center|LOCUS_29630 231652 233169 gene locus_tag LOCUS_29640 231652 233169 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878477.1 protein_id gnl|my_center|LOCUS_29640 233273 233698 gene locus_tag LOCUS_29650 233273 233698 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087112.1 protein_id gnl|my_center|LOCUS_29650 233751 234506 gene locus_tag LOCUS_29660 233751 234506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 234585 235889 gene locus_tag LOCUS_29670 234585 235889 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092724.1 protein_id gnl|my_center|LOCUS_29670 235886 238051 gene locus_tag LOCUS_29680 235886 238051 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029390.1 protein_id gnl|my_center|LOCUS_29680 238180 238668 gene locus_tag LOCUS_29690 238180 238668 CDS product FBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055566559.1 protein_id gnl|my_center|LOCUS_29690 239653 238682 gene locus_tag LOCUS_29700 gene pip 239653 238682 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204007.1 protein_id gnl|my_center|LOCUS_29700 239750 241030 gene locus_tag LOCUS_29710 239750 241030 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730071.1 protein_id gnl|my_center|LOCUS_29710 241104 242351 gene locus_tag LOCUS_29720 gene purD 241104 242351 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085596.1 protein_id gnl|my_center|LOCUS_29720 243286 242363 gene locus_tag LOCUS_29730 243286 242363 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730845.1 protein_id gnl|my_center|LOCUS_29730 243476 244615 gene locus_tag LOCUS_29740 243476 244615 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113200.1 protein_id gnl|my_center|LOCUS_29740 244693 245313 gene locus_tag LOCUS_29750 244693 245313 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878471.1 protein_id gnl|my_center|LOCUS_29750 245371 246444 gene locus_tag LOCUS_29760 245371 246444 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085410.1 protein_id gnl|my_center|LOCUS_29760 246578 248017 gene locus_tag LOCUS_29770 gene purB 246578 248017 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085600.1 protein_id gnl|my_center|LOCUS_29770 249601 248036 gene locus_tag LOCUS_29780 249601 248036 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142818.1 protein_id gnl|my_center|LOCUS_29780 250409 249882 gene locus_tag LOCUS_29790 250409 249882 CDS product mycothiol transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892314.1 protein_id gnl|my_center|LOCUS_29790 250523 251416 gene locus_tag LOCUS_29800 250523 251416 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085602.1 protein_id gnl|my_center|LOCUS_29800 251413 253521 gene locus_tag LOCUS_29810 251413 253521 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730837.1 protein_id gnl|my_center|LOCUS_29810 254446 253583 gene locus_tag LOCUS_29820 254446 253583 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900096.1 protein_id gnl|my_center|LOCUS_29820 256300 254825 gene locus_tag LOCUS_29830 256300 254825 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403977.1 protein_id gnl|my_center|LOCUS_29830 256845 256300 gene locus_tag LOCUS_29840 256845 256300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 256950 257435 gene locus_tag LOCUS_29850 256950 257435 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730834.1 protein_id gnl|my_center|LOCUS_29850 257500 258207 gene locus_tag LOCUS_29860 257500 258207 CDS product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064160.1 protein_id gnl|my_center|LOCUS_29860 258279 258518 gene locus_tag LOCUS_29870 gene purS 258279 258518 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403993.1 protein_id gnl|my_center|LOCUS_29870 258515 259195 gene locus_tag LOCUS_29880 gene purQ 258515 259195 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730830.1 protein_id gnl|my_center|LOCUS_29880 259201 260484 gene locus_tag LOCUS_29890 259201 260484 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730828.1 protein_id gnl|my_center|LOCUS_29890 261042 260473 gene locus_tag LOCUS_29900 261042 260473 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876664.1 protein_id gnl|my_center|LOCUS_29900 261116 261520 gene locus_tag LOCUS_29910 261116 261520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 261553 262809 gene locus_tag LOCUS_29920 261553 262809 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895997.1 protein_id gnl|my_center|LOCUS_29920 262812 263603 gene locus_tag LOCUS_29930 262812 263603 CDS product coniferyl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401012.1 protein_id gnl|my_center|LOCUS_29930 263616 265019 gene locus_tag LOCUS_29940 263616 265019 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400974.1 protein_id gnl|my_center|LOCUS_29940 265033 265221 gene locus_tag LOCUS_29950 265033 265221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 265218 265628 gene locus_tag LOCUS_29960 265218 265628 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035582.1 protein_id gnl|my_center|LOCUS_29960 266899 265625 gene locus_tag LOCUS_29970 266899 265625 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892803.1 protein_id gnl|my_center|LOCUS_29970 267483 266896 gene locus_tag LOCUS_29980 267483 266896 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892804.1 protein_id gnl|my_center|LOCUS_29980 267475 268491 gene locus_tag LOCUS_29990 267475 268491 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222909.1 protein_id gnl|my_center|LOCUS_29990 268461 269405 gene locus_tag LOCUS_30000 268461 269405 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223173.1 protein_id gnl|my_center|LOCUS_30000 269443 270225 gene locus_tag LOCUS_30010 269443 270225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 270278 271246 gene locus_tag LOCUS_30020 270278 271246 CDS product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014387.1 protein_id gnl|my_center|LOCUS_30020 271318 272271 gene locus_tag LOCUS_30030 271318 272271 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110071.1 protein_id gnl|my_center|LOCUS_30030 273718 272282 gene locus_tag LOCUS_30040 273718 272282 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227809.1 protein_id gnl|my_center|LOCUS_30040 274721 273771 gene locus_tag LOCUS_30050 274721 273771 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485415.1 protein_id gnl|my_center|LOCUS_30050 274891 275271 gene locus_tag LOCUS_30060 274891 275271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 275279 276166 gene locus_tag LOCUS_30070 275279 276166 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390392.1 protein_id gnl|my_center|LOCUS_30070 276311 277636 gene locus_tag LOCUS_30080 276311 277636 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936020.1 protein_id gnl|my_center|LOCUS_30080 >Feature sequence24 1957 542 gene locus_tag LOCUS_30090 1957 542 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730698.1 protein_id gnl|my_center|LOCUS_30090 2388 3131 gene locus_tag LOCUS_30100 2388 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 3142 3384 gene locus_tag LOCUS_30110 3142 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 4137 5045 gene locus_tag LOCUS_30120 4137 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 5066 6613 gene locus_tag LOCUS_30130 5066 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 6606 7499 gene locus_tag LOCUS_30140 6606 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 7527 8417 gene locus_tag LOCUS_30150 7527 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 8441 9343 gene locus_tag LOCUS_30160 8441 9343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 10443 9403 gene locus_tag LOCUS_30170 10443 9403 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223381.1 protein_id gnl|my_center|LOCUS_30170 10739 11050 gene locus_tag LOCUS_30180 10739 11050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 11047 12345 gene locus_tag LOCUS_30190 11047 12345 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411663.1 protein_id gnl|my_center|LOCUS_30190 15963 12901 gene locus_tag LOCUS_30200 15963 12901 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624304.1 protein_id gnl|my_center|LOCUS_30200 16412 16071 gene locus_tag LOCUS_30210 16412 16071 CDS product DUF4873 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223017.1 protein_id gnl|my_center|LOCUS_30210 16539 17507 gene locus_tag LOCUS_30220 16539 17507 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061562.1 protein_id gnl|my_center|LOCUS_30220 17611 19128 gene locus_tag LOCUS_30230 17611 19128 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727363.1 protein_id gnl|my_center|LOCUS_30230 19254 20036 gene locus_tag LOCUS_30240 19254 20036 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061558.1 protein_id gnl|my_center|LOCUS_30240 20033 21103 gene locus_tag LOCUS_30250 20033 21103 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088985.1 protein_id gnl|my_center|LOCUS_30250 21093 22007 gene locus_tag LOCUS_30260 21093 22007 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028808.1 protein_id gnl|my_center|LOCUS_30260 22080 22874 gene locus_tag LOCUS_30270 22080 22874 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618334.1 protein_id gnl|my_center|LOCUS_30270 23549 23839 gene locus_tag LOCUS_30280 23549 23839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 23986 24720 gene locus_tag LOCUS_30290 23986 24720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 24730 25596 gene locus_tag LOCUS_30300 24730 25596 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085987.1 protein_id gnl|my_center|LOCUS_30300 25605 26639 gene locus_tag LOCUS_30310 25605 26639 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085986.1 protein_id gnl|my_center|LOCUS_30310 26636 27640 gene locus_tag LOCUS_30320 26636 27640 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085985.1 protein_id gnl|my_center|LOCUS_30320 27646 28635 gene locus_tag LOCUS_30330 27646 28635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 28677 29699 gene locus_tag LOCUS_30340 28677 29699 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224302.1 protein_id gnl|my_center|LOCUS_30340 29696 30736 gene locus_tag LOCUS_30350 29696 30736 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071126.1 protein_id gnl|my_center|LOCUS_30350 30733 31689 gene locus_tag LOCUS_30360 30733 31689 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094759.1 protein_id gnl|my_center|LOCUS_30360 31737 32408 gene locus_tag LOCUS_30370 31737 32408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 33923 32568 gene locus_tag LOCUS_30380 33923 32568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 34154 35275 gene locus_tag LOCUS_30390 34154 35275 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110589.1 protein_id gnl|my_center|LOCUS_30390 35802 36212 gene locus_tag LOCUS_30400 35802 36212 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110592.1 protein_id gnl|my_center|LOCUS_30400 36309 37877 gene locus_tag LOCUS_30410 36309 37877 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110588.1 protein_id gnl|my_center|LOCUS_30410 37921 39027 gene locus_tag LOCUS_30420 37921 39027 CDS product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110593.1 protein_id gnl|my_center|LOCUS_30420 39175 40572 gene locus_tag LOCUS_30430 39175 40572 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079749.1 protein_id gnl|my_center|LOCUS_30430 40778 41098 gene locus_tag LOCUS_30440 40778 41098 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086615.1 protein_id gnl|my_center|LOCUS_30440 41124 42512 gene locus_tag LOCUS_30450 41124 42512 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086616.1 protein_id gnl|my_center|LOCUS_30450 42509 43711 gene locus_tag LOCUS_30460 42509 43711 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086617.1 protein_id gnl|my_center|LOCUS_30460 43802 44863 gene locus_tag LOCUS_30470 43802 44863 CDS product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110591.1 protein_id gnl|my_center|LOCUS_30470 44860 45216 gene locus_tag LOCUS_30480 44860 45216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 45213 46103 gene locus_tag LOCUS_30490 45213 46103 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086619.1 protein_id gnl|my_center|LOCUS_30490 >Feature sequence25 1501 509 gene locus_tag LOCUS_30500 1501 509 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079944.1 protein_id gnl|my_center|LOCUS_30500 2145 1639 gene locus_tag LOCUS_30510 2145 1639 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897886.1 protein_id gnl|my_center|LOCUS_30510 3012 2197 gene locus_tag LOCUS_30520 3012 2197 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731193.1 protein_id gnl|my_center|LOCUS_30520 4481 3009 gene locus_tag LOCUS_30530 4481 3009 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897727.1 protein_id gnl|my_center|LOCUS_30530 5412 4573 gene locus_tag LOCUS_30540 5412 4573 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225768.1 protein_id gnl|my_center|LOCUS_30540 6299 5391 gene locus_tag LOCUS_30550 6299 5391 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406215.1 protein_id gnl|my_center|LOCUS_30550 6383 7924 gene locus_tag LOCUS_30560 6383 7924 CDS product CitMHS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855416.1 protein_id gnl|my_center|LOCUS_30560 7951 9657 gene locus_tag LOCUS_30570 7951 9657 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222206.1 protein_id gnl|my_center|LOCUS_30570 9657 10328 gene locus_tag LOCUS_30580 9657 10328 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855418.1 protein_id gnl|my_center|LOCUS_30580 10405 10695 gene locus_tag LOCUS_30590 10405 10695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 10771 10697 gene locus_tag LOCUS_t00330 10771 10697 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 11490 10816 gene locus_tag LOCUS_30600 11490 10816 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095318.1 protein_id gnl|my_center|LOCUS_30600 11594 13108 gene locus_tag LOCUS_30610 11594 13108 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222995.1 protein_id gnl|my_center|LOCUS_30610 13223 13296 gene locus_tag LOCUS_t00340 13223 13296 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 13357 13431 gene locus_tag LOCUS_t00350 13357 13431 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 13497 13571 gene locus_tag LOCUS_t00360 13497 13571 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 14565 13612 gene locus_tag LOCUS_30620 14565 13612 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856459.1 protein_id gnl|my_center|LOCUS_30620 15457 14987 gene locus_tag LOCUS_30630 15457 14987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 16591 16169 gene locus_tag LOCUS_30640 16591 16169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 17129 16608 gene locus_tag LOCUS_30650 17129 16608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 18830 17478 gene locus_tag LOCUS_30660 18830 17478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 19564 18845 gene locus_tag LOCUS_30670 19564 18845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 19622 19924 gene locus_tag LOCUS_30680 19622 19924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 21539 19935 gene locus_tag LOCUS_30690 21539 19935 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811563.1 protein_id gnl|my_center|LOCUS_30690 21585 22304 gene locus_tag LOCUS_30700 21585 22304 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228507.1 protein_id gnl|my_center|LOCUS_30700 23303 22311 gene locus_tag LOCUS_30710 23303 22311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 23928 23437 gene locus_tag LOCUS_30720 23928 23437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225541.1 protein_id gnl|my_center|LOCUS_30720 25212 23977 gene locus_tag LOCUS_30730 25212 23977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 26279 25281 gene locus_tag LOCUS_30740 26279 25281 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530514.1 protein_id gnl|my_center|LOCUS_30740 27157 26276 gene locus_tag LOCUS_30750 27157 26276 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228200.1 protein_id gnl|my_center|LOCUS_30750 27876 27154 gene locus_tag LOCUS_30760 27876 27154 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728668.1 protein_id gnl|my_center|LOCUS_30760 28054 28632 gene locus_tag LOCUS_30770 28054 28632 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416617.1 protein_id gnl|my_center|LOCUS_30770 29691 28801 gene locus_tag LOCUS_30780 29691 28801 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416628.1 protein_id gnl|my_center|LOCUS_30780 31192 29813 gene locus_tag LOCUS_30790 31192 29813 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157120614.1 protein_id gnl|my_center|LOCUS_30790 31335 32417 gene locus_tag LOCUS_30800 gene splB 31335 32417 CDS product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393427.1 protein_id gnl|my_center|LOCUS_30800 32558 33007 gene locus_tag LOCUS_30810 32558 33007 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226310.1 protein_id gnl|my_center|LOCUS_30810 33108 33827 gene locus_tag LOCUS_30820 33108 33827 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896957.1 protein_id gnl|my_center|LOCUS_30820 34378 33794 gene locus_tag LOCUS_30830 34378 33794 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976592.1 protein_id gnl|my_center|LOCUS_30830 34443 35702 gene locus_tag LOCUS_30840 34443 35702 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090631.1 protein_id gnl|my_center|LOCUS_30840 35699 36547 gene locus_tag LOCUS_30850 35699 36547 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236296.1 protein_id gnl|my_center|LOCUS_30850 36556 37296 gene locus_tag LOCUS_30860 36556 37296 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206915.1 protein_id gnl|my_center|LOCUS_30860 37293 38381 gene locus_tag LOCUS_30870 37293 38381 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228741.1 protein_id gnl|my_center|LOCUS_30870 38540 40000 gene locus_tag LOCUS_30880 38540 40000 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110870.1 protein_id gnl|my_center|LOCUS_30880 40423 40016 gene locus_tag LOCUS_30890 40423 40016 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112739.1 protein_id gnl|my_center|LOCUS_30890 41505 40420 gene locus_tag LOCUS_30900 gene arsB 41505 40420 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727470.1 protein_id gnl|my_center|LOCUS_30900 41864 41502 gene locus_tag LOCUS_30910 41864 41502 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222675.1 protein_id gnl|my_center|LOCUS_30910 42003 43484 gene locus_tag LOCUS_30920 42003 43484 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048125.1 protein_id gnl|my_center|LOCUS_30920 >Feature sequence26 976 122 gene locus_tag LOCUS_30930 976 122 CDS product TIGR02569 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056363.1 protein_id gnl|my_center|LOCUS_30930 2393 1005 gene locus_tag LOCUS_30940 2393 1005 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 protein_id gnl|my_center|LOCUS_30940 2350 2565 gene locus_tag LOCUS_30950 2350 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 3733 2519 gene locus_tag LOCUS_30960 gene moeZ 3733 2519 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111867.1 protein_id gnl|my_center|LOCUS_30960 4797 3751 gene locus_tag LOCUS_30970 4797 3751 CDS product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728024.1 protein_id gnl|my_center|LOCUS_30970 6185 5166 gene locus_tag LOCUS_30980 6185 5166 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223022.1 protein_id gnl|my_center|LOCUS_30980 6457 6224 gene locus_tag LOCUS_30990 6457 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 6344 6919 gene locus_tag LOCUS_31000 6344 6919 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056360.1 protein_id gnl|my_center|LOCUS_31000 7313 7074 gene locus_tag LOCUS_31010 7313 7074 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080983.1 protein_id gnl|my_center|LOCUS_31010 8222 7449 gene locus_tag LOCUS_31020 8222 7449 CDS product ferritin-like fold-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728021.1 protein_id gnl|my_center|LOCUS_31020 8466 10184 gene locus_tag LOCUS_31030 8466 10184 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728020.1 protein_id gnl|my_center|LOCUS_31030 10181 11485 gene locus_tag LOCUS_31040 10181 11485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080978.1 protein_id gnl|my_center|LOCUS_31040 12283 11489 gene locus_tag LOCUS_31050 12283 11489 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098387.1 protein_id gnl|my_center|LOCUS_31050 12448 13086 gene locus_tag LOCUS_31060 12448 13086 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728016.1 protein_id gnl|my_center|LOCUS_31060 14596 13088 gene locus_tag LOCUS_31070 14596 13088 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110870.1 protein_id gnl|my_center|LOCUS_31070 15371 14931 gene locus_tag LOCUS_31080 15371 14931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 15485 16480 gene locus_tag LOCUS_31090 15485 16480 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080966.1 protein_id gnl|my_center|LOCUS_31090 16766 17023 gene locus_tag LOCUS_31100 gene whiB1 16766 17023 CDS product transcriptional regulator WhiB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893300.1 protein_id gnl|my_center|LOCUS_31100 18593 17103 gene locus_tag LOCUS_31110 18593 17103 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056342.1 protein_id gnl|my_center|LOCUS_31110 18856 18641 gene locus_tag LOCUS_31120 18856 18641 CDS product biotin/lipoyl-binding carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877243.1 protein_id gnl|my_center|LOCUS_31120 19553 19239 gene locus_tag LOCUS_31130 gene rsrA 19553 19239 CDS product mycothiol system anti-sigma-R factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056340.1 protein_id gnl|my_center|LOCUS_31130 20359 19550 gene locus_tag LOCUS_31140 20359 19550 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046255947.1 protein_id gnl|my_center|LOCUS_31140 20539 21051 gene locus_tag LOCUS_31150 gene ybaK 20539 21051 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728005.1 protein_id gnl|my_center|LOCUS_31150 21920 21060 gene locus_tag LOCUS_31160 21920 21060 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877238.1 protein_id gnl|my_center|LOCUS_31160 22006 22482 gene locus_tag LOCUS_31170 22006 22482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 22498 22905 gene locus_tag LOCUS_31180 22498 22905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 24045 22927 gene locus_tag LOCUS_31190 24045 22927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 24206 25318 gene locus_tag LOCUS_31200 24206 25318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 25804 25328 gene locus_tag LOCUS_31210 gene soxR 25804 25328 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977128.1 protein_id gnl|my_center|LOCUS_31210 26001 25816 gene locus_tag LOCUS_31220 26001 25816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 25928 27148 gene locus_tag LOCUS_31230 gene aroA 25928 27148 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727983.1 protein_id gnl|my_center|LOCUS_31230 27112 28152 gene locus_tag LOCUS_31240 gene rsgA 27112 28152 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727982.1 protein_id gnl|my_center|LOCUS_31240 29432 28191 gene locus_tag LOCUS_31250 gene desA3 29432 28191 CDS product NADPH-dependent stearoyl-CoA 9-desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416919.1 protein_id gnl|my_center|LOCUS_31250 30896 29586 gene locus_tag LOCUS_31260 gene desA3 30896 29586 CDS product NADPH-dependent stearoyl-CoA 9-desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416919.1 protein_id gnl|my_center|LOCUS_31260 31605 31090 gene locus_tag LOCUS_31270 31605 31090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229719.1 protein_id gnl|my_center|LOCUS_31270 33118 31637 gene locus_tag LOCUS_31280 33118 31637 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296672.1 protein_id gnl|my_center|LOCUS_31280 33756 33169 gene locus_tag LOCUS_31290 33756 33169 CDS product Rv3235 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416932.1 protein_id gnl|my_center|LOCUS_31290 33895 34524 gene locus_tag LOCUS_31300 33895 34524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 >Feature sequence27 557 123 gene locus_tag LOCUS_31310 557 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 1581 2276 gene locus_tag LOCUS_31320 1581 2276 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920739.1 protein_id gnl|my_center|LOCUS_31320 2276 3130 gene locus_tag LOCUS_31330 2276 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 3619 3173 gene locus_tag LOCUS_31340 3619 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 3990 3616 gene locus_tag LOCUS_31350 3990 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 4454 3987 gene locus_tag LOCUS_31360 4454 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 6744 4606 gene locus_tag LOCUS_31370 gene ctpG 6744 4606 CDS product cation transporter ATPase CptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899120.1 protein_id gnl|my_center|LOCUS_31370 7123 6737 gene locus_tag LOCUS_31380 7123 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 8306 7347 gene locus_tag LOCUS_31390 8306 7347 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112734.1 protein_id gnl|my_center|LOCUS_31390 8680 8303 gene locus_tag LOCUS_31400 8680 8303 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112732.1 protein_id gnl|my_center|LOCUS_31400 8812 8973 gene locus_tag LOCUS_31410 8812 8973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 9324 10358 gene locus_tag LOCUS_31420 9324 10358 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529419.1 protein_id gnl|my_center|LOCUS_31420 10466 11944 gene locus_tag LOCUS_31430 10466 11944 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215840.1 protein_id gnl|my_center|LOCUS_31430 11941 12981 gene locus_tag LOCUS_31440 11941 12981 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529417.1 protein_id gnl|my_center|LOCUS_31440 14579 13350 gene locus_tag LOCUS_31450 14579 13350 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727602.1 protein_id gnl|my_center|LOCUS_31450 14917 16299 gene locus_tag LOCUS_31460 14917 16299 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110043.1 protein_id gnl|my_center|LOCUS_31460 17795 16659 gene locus_tag LOCUS_31470 17795 16659 CDS product ISL3-like element IS1096 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726739.1 protein_id gnl|my_center|LOCUS_31470 18742 18104 gene locus_tag LOCUS_31480 18742 18104 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080300.1 protein_id gnl|my_center|LOCUS_31480 19677 18739 gene locus_tag LOCUS_31490 19677 18739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 20800 19988 gene locus_tag LOCUS_31500 20800 19988 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080301.1 protein_id gnl|my_center|LOCUS_31500 21094 20852 gene locus_tag LOCUS_31510 21094 20852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 21197 21751 gene locus_tag LOCUS_31520 21197 21751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 21735 22097 gene locus_tag LOCUS_31530 21735 22097 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225370.1 protein_id gnl|my_center|LOCUS_31530 22196 23032 gene locus_tag LOCUS_31540 22196 23032 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225369.1 protein_id gnl|my_center|LOCUS_31540 23212 23060 gene locus_tag LOCUS_31550 23212 23060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 23153 23770 gene locus_tag LOCUS_31560 23153 23770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 25231 23795 gene locus_tag LOCUS_31570 25231 23795 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098258.1 protein_id gnl|my_center|LOCUS_31570 25699 26145 gene locus_tag LOCUS_31580 25699 26145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 26812 26195 gene locus_tag LOCUS_31590 26812 26195 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225371.1 protein_id gnl|my_center|LOCUS_31590 27188 27559 gene locus_tag LOCUS_31600 27188 27559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 27638 28744 gene locus_tag LOCUS_31610 27638 28744 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088561.1 protein_id gnl|my_center|LOCUS_31610 28741 30003 gene locus_tag LOCUS_31620 28741 30003 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005132388.1 protein_id gnl|my_center|LOCUS_31620 30300 30118 gene locus_tag LOCUS_31630 30300 30118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 30424 30777 gene locus_tag LOCUS_31640 30424 30777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 30774 32360 gene locus_tag LOCUS_31650 gene lnt 30774 32360 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109789858.1 protein_id gnl|my_center|LOCUS_31650 32779 32399 gene locus_tag LOCUS_31660 32779 32399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 >Feature sequence28 247 672 gene locus_tag LOCUS_31670 247 672 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630611.1 protein_id gnl|my_center|LOCUS_31670 669 1586 gene locus_tag LOCUS_31680 gene gluQRS 669 1586 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112955.1 protein_id gnl|my_center|LOCUS_31680 1718 2422 gene locus_tag LOCUS_31690 1718 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 3451 2495 gene locus_tag LOCUS_31700 3451 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 4841 3558 gene locus_tag LOCUS_31710 gene tgt 4841 3558 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112950.1 protein_id gnl|my_center|LOCUS_31710 5363 4884 gene locus_tag LOCUS_31720 5363 4884 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224026.1 protein_id gnl|my_center|LOCUS_31720 7831 5474 gene locus_tag LOCUS_31730 7831 5474 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013977.1 protein_id gnl|my_center|LOCUS_31730 8525 7902 gene locus_tag LOCUS_31740 8525 7902 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227094.1 protein_id gnl|my_center|LOCUS_31740 8642 9157 gene locus_tag LOCUS_31750 8642 9157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 10552 9209 gene locus_tag LOCUS_31760 10552 9209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 10768 10678 gene locus_tag LOCUS_t00370 10768 10678 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11048 10839 gene locus_tag LOCUS_31770 11048 10839 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088593.1 protein_id gnl|my_center|LOCUS_31770 11613 11176 gene locus_tag LOCUS_31780 11613 11176 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112945.1 protein_id gnl|my_center|LOCUS_31780 12138 11674 gene locus_tag LOCUS_31790 12138 11674 CDS product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112944.1 protein_id gnl|my_center|LOCUS_31790 12270 13316 gene locus_tag LOCUS_31800 12270 13316 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731208.1 protein_id gnl|my_center|LOCUS_31800 13897 13289 gene locus_tag LOCUS_31810 13897 13289 CDS product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878619.1 protein_id gnl|my_center|LOCUS_31810 14862 14044 gene locus_tag LOCUS_31820 14862 14044 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727986.1 protein_id gnl|my_center|LOCUS_31820 16167 14872 gene locus_tag LOCUS_31830 16167 14872 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031573.1 protein_id gnl|my_center|LOCUS_31830 18052 16349 gene locus_tag LOCUS_31840 18052 16349 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971843.1 protein_id gnl|my_center|LOCUS_31840 18240 18971 gene locus_tag LOCUS_31850 18240 18971 CDS product YqjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409685.1 protein_id gnl|my_center|LOCUS_31850 19880 18957 gene locus_tag LOCUS_31860 19880 18957 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728589.1 protein_id gnl|my_center|LOCUS_31860 19986 21077 gene locus_tag LOCUS_31870 19986 21077 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728588.1 protein_id gnl|my_center|LOCUS_31870 21151 22224 gene locus_tag LOCUS_31880 21151 22224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 22344 23021 gene locus_tag LOCUS_31890 22344 23021 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973533.1 protein_id gnl|my_center|LOCUS_31890 23150 24391 gene locus_tag LOCUS_31900 23150 24391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 24388 26466 gene locus_tag LOCUS_31910 24388 26466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 26560 27789 gene locus_tag LOCUS_31920 26560 27789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 28369 27809 gene locus_tag LOCUS_31930 28369 27809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 28480 29667 gene locus_tag LOCUS_31940 28480 29667 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081395.1 protein_id gnl|my_center|LOCUS_31940 29687 30619 gene locus_tag LOCUS_31950 29687 30619 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486295.1 protein_id gnl|my_center|LOCUS_31950 30915 31139 gene locus_tag LOCUS_31960 30915 31139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 31327 31136 gene locus_tag LOCUS_31970 31327 31136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 31391 31609 gene locus_tag LOCUS_31980 31391 31609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 >Feature sequence29 434 141 gene locus_tag LOCUS_31990 434 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 563 1513 gene locus_tag LOCUS_32000 gene puuE 563 1513 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897147.1 protein_id gnl|my_center|LOCUS_32000 1518 2705 gene locus_tag LOCUS_32010 gene dxr 1518 2705 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728448.1 protein_id gnl|my_center|LOCUS_32010 2762 3973 gene locus_tag LOCUS_32020 gene rip 2762 3973 CDS product zinc metalloprotease Rip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414610.1 protein_id gnl|my_center|LOCUS_32020 3986 5173 gene locus_tag LOCUS_32030 gene ispG 3986 5173 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081652.1 protein_id gnl|my_center|LOCUS_32030 5264 6100 gene locus_tag LOCUS_32040 5264 6100 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877435.1 protein_id gnl|my_center|LOCUS_32040 6253 8031 gene locus_tag LOCUS_32050 6253 8031 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081656.1 protein_id gnl|my_center|LOCUS_32050 8077 8940 gene locus_tag LOCUS_32060 gene map 8077 8940 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728452.1 protein_id gnl|my_center|LOCUS_32060 8948 10525 gene locus_tag LOCUS_32070 8948 10525 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093851.1 protein_id gnl|my_center|LOCUS_32070 10525 11349 gene locus_tag LOCUS_32080 10525 11349 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030789.1 protein_id gnl|my_center|LOCUS_32080 11401 11766 gene locus_tag LOCUS_32090 11401 11766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 11798 13162 gene locus_tag LOCUS_32100 11798 13162 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878613.1 protein_id gnl|my_center|LOCUS_32100 14530 13142 gene locus_tag LOCUS_32110 gene mtr 14530 13142 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728470.1 protein_id gnl|my_center|LOCUS_32110 15612 14548 gene locus_tag LOCUS_32120 15612 14548 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081672.1 protein_id gnl|my_center|LOCUS_32120 15783 17345 gene locus_tag LOCUS_32130 gene mqo 15783 17345 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624310.1 protein_id gnl|my_center|LOCUS_32130 17359 17829 gene locus_tag LOCUS_32140 17359 17829 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728473.1 protein_id gnl|my_center|LOCUS_32140 17922 19895 gene locus_tag LOCUS_32150 17922 19895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 19978 20595 gene locus_tag LOCUS_32160 gene cobO 19978 20595 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228816.1 protein_id gnl|my_center|LOCUS_32160 20589 22085 gene locus_tag LOCUS_32170 20589 22085 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728476.1 protein_id gnl|my_center|LOCUS_32170 22082 23329 gene locus_tag LOCUS_32180 gene cobA 22082 23329 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893999.1 protein_id gnl|my_center|LOCUS_32180 23417 24922 gene locus_tag LOCUS_32190 23417 24922 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093840.1 protein_id gnl|my_center|LOCUS_32190 25684 24941 gene locus_tag LOCUS_32200 gene yaaA 25684 24941 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729112.1 protein_id gnl|my_center|LOCUS_32200 25743 27479 gene locus_tag LOCUS_32210 25743 27479 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081714.1 protein_id gnl|my_center|LOCUS_32210 27893 27459 gene locus_tag LOCUS_32220 27893 27459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 28480 27890 gene locus_tag LOCUS_32230 28480 27890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414516.1 protein_id gnl|my_center|LOCUS_32230 28677 29330 gene locus_tag LOCUS_32240 28677 29330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 29327 30349 gene locus_tag LOCUS_32250 gene nusA 29327 30349 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894006.1 protein_id gnl|my_center|LOCUS_32250 30411 30764 gene locus_tag LOCUS_32260 30411 30764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 >Feature sequence30 <1 1020 gene locus_tag LOCUS_32270 <1 1020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005086678.1:pyridoxal phosphate-dependent aminotransferase 1069 1701 gene locus_tag LOCUS_32280 1069 1701 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225286.1 protein_id gnl|my_center|LOCUS_32280 3241 1712 gene locus_tag LOCUS_32290 3241 1712 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110870.1 protein_id gnl|my_center|LOCUS_32290 4282 3536 gene locus_tag LOCUS_32300 4282 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 5257 4385 gene locus_tag LOCUS_32310 5257 4385 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109967.1 protein_id gnl|my_center|LOCUS_32310 5302 6291 gene locus_tag LOCUS_32320 5302 6291 CDS product threo-3-hydroxy-L-aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039172.1 protein_id gnl|my_center|LOCUS_32320 8088 6304 gene locus_tag LOCUS_32330 8088 6304 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225256.1 protein_id gnl|my_center|LOCUS_32330 8184 8765 gene locus_tag LOCUS_32340 8184 8765 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027269.1 protein_id gnl|my_center|LOCUS_32340 8967 8770 gene locus_tag LOCUS_32350 8967 8770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 9711 9160 gene locus_tag LOCUS_32360 9711 9160 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896521.1 protein_id gnl|my_center|LOCUS_32360 10492 9839 gene locus_tag LOCUS_32370 10492 9839 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062378.1 protein_id gnl|my_center|LOCUS_32370 12188 10527 gene locus_tag LOCUS_32380 12188 10527 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223393.1 protein_id gnl|my_center|LOCUS_32380 12280 12762 gene locus_tag LOCUS_32390 12280 12762 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223356.1 protein_id gnl|my_center|LOCUS_32390 13245 12784 gene locus_tag LOCUS_32400 13245 12784 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222912.1 protein_id gnl|my_center|LOCUS_32400 13700 13338 gene locus_tag LOCUS_32410 13700 13338 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776272.1 protein_id gnl|my_center|LOCUS_32410 13882 15093 gene locus_tag LOCUS_32420 13882 15093 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 protein_id gnl|my_center|LOCUS_32420 15892 15101 gene locus_tag LOCUS_32430 15892 15101 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 protein_id gnl|my_center|LOCUS_32430 16002 16463 gene locus_tag LOCUS_32440 16002 16463 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229804.1 protein_id gnl|my_center|LOCUS_32440 16549 17367 gene locus_tag LOCUS_32450 16549 17367 CDS product Stf0 family sulphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093093.1 protein_id gnl|my_center|LOCUS_32450 17364 18293 gene locus_tag LOCUS_32460 gene cysD 17364 18293 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060060.1 protein_id gnl|my_center|LOCUS_32460 18293 20167 gene locus_tag LOCUS_32470 gene cysC 18293 20167 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084798.1 protein_id gnl|my_center|LOCUS_32470 21789 20185 gene locus_tag LOCUS_32480 21789 20185 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537751.1 protein_id gnl|my_center|LOCUS_32480 22679 21786 gene locus_tag LOCUS_32490 22679 21786 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804198.1 protein_id gnl|my_center|LOCUS_32490 23670 22672 gene locus_tag LOCUS_32500 23670 22672 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104380.1 protein_id gnl|my_center|LOCUS_32500 25291 23675 gene locus_tag LOCUS_32510 25291 23675 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538164.1 protein_id gnl|my_center|LOCUS_32510 25411 26298 gene locus_tag LOCUS_32520 25411 26298 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228409.1 protein_id gnl|my_center|LOCUS_32520 26534 26316 gene locus_tag LOCUS_32530 26534 26316 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084181.1 protein_id gnl|my_center|LOCUS_32530 26660 26944 gene locus_tag LOCUS_32540 26660 26944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268497.1 protein_id gnl|my_center|LOCUS_32540 27144 29381 gene locus_tag LOCUS_32550 27144 29381 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899797.1 protein_id gnl|my_center|LOCUS_32550 >Feature sequence31 229 942 gene locus_tag LOCUS_32560 229 942 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225438.1 protein_id gnl|my_center|LOCUS_32560 996 2603 gene locus_tag LOCUS_32570 996 2603 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225439.1 protein_id gnl|my_center|LOCUS_32570 2752 4017 gene locus_tag LOCUS_32580 gene egtA 2752 4017 CDS product ergothioneine biosynthesis glutamate--cysteine ligase EgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226794.1 protein_id gnl|my_center|LOCUS_32580 4014 5360 gene locus_tag LOCUS_32590 gene egtB 4014 5360 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226793.1 protein_id gnl|my_center|LOCUS_32590 5364 6140 gene locus_tag LOCUS_32600 gene egtC 5364 6140 CDS product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226792.1 protein_id gnl|my_center|LOCUS_32600 6197 7180 gene locus_tag LOCUS_32610 gene egtD 6197 7180 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226791.1 protein_id gnl|my_center|LOCUS_32610 7231 8022 gene locus_tag LOCUS_32620 7231 8022 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110142.1 protein_id gnl|my_center|LOCUS_32620 8604 8023 gene locus_tag LOCUS_32630 8604 8023 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728111.1 protein_id gnl|my_center|LOCUS_32630 8859 10136 gene locus_tag LOCUS_32640 8859 10136 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878473.1 protein_id gnl|my_center|LOCUS_32640 10133 10288 gene locus_tag LOCUS_32650 10133 10288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 11624 11001 gene locus_tag LOCUS_32660 11624 11001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 13028 11637 gene locus_tag LOCUS_32670 13028 11637 CDS product NADP-dependent succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081095.1 protein_id gnl|my_center|LOCUS_32670 13216 13028 gene locus_tag LOCUS_32680 13216 13028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730739.1 protein_id gnl|my_center|LOCUS_32680 13464 14426 gene locus_tag LOCUS_32690 13464 14426 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061562.1 protein_id gnl|my_center|LOCUS_32690 16178 14412 gene locus_tag LOCUS_32700 16178 14412 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028298.1 protein_id gnl|my_center|LOCUS_32700 16643 16260 gene locus_tag LOCUS_32710 16643 16260 CDS product DUF4873 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080347.1 protein_id gnl|my_center|LOCUS_32710 16778 17785 gene locus_tag LOCUS_32720 16778 17785 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112097.1 protein_id gnl|my_center|LOCUS_32720 17898 18884 gene locus_tag LOCUS_32730 17898 18884 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061562.1 protein_id gnl|my_center|LOCUS_32730 18993 19826 gene locus_tag LOCUS_32740 18993 19826 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061558.1 protein_id gnl|my_center|LOCUS_32740 19823 20902 gene locus_tag LOCUS_32750 19823 20902 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088985.1 protein_id gnl|my_center|LOCUS_32750 20991 22637 gene locus_tag LOCUS_32760 20991 22637 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901204.1 protein_id gnl|my_center|LOCUS_32760 23533 22667 gene locus_tag LOCUS_32770 23533 22667 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730384.1 protein_id gnl|my_center|LOCUS_32770 23775 24917 gene locus_tag LOCUS_32780 23775 24917 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896599.1 protein_id gnl|my_center|LOCUS_32780 25021 25176 gene locus_tag LOCUS_32790 25021 25176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 >Feature sequence32 <1 1631 gene locus_tag LOCUS_32800 <1 1631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728918.1:DUF2339 domain-containing protein 4618 1619 gene locus_tag LOCUS_32810 4618 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 5453 4749 gene locus_tag LOCUS_32820 5453 4749 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104288.1 protein_id gnl|my_center|LOCUS_32820 6217 5453 gene locus_tag LOCUS_32830 gene trmB 6217 5453 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005116071.1 protein_id gnl|my_center|LOCUS_32830 6285 7193 gene locus_tag LOCUS_32840 6285 7193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 7190 8479 gene locus_tag LOCUS_32850 7190 8479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 8545 8838 gene locus_tag LOCUS_32860 8545 8838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 8982 10805 gene locus_tag LOCUS_32870 8982 10805 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063924.1 protein_id gnl|my_center|LOCUS_32870 10919 12016 gene locus_tag LOCUS_32880 10919 12016 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231036.1 protein_id gnl|my_center|LOCUS_32880 12148 12906 gene locus_tag LOCUS_32890 12148 12906 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860245.1 protein_id gnl|my_center|LOCUS_32890 12903 15455 gene locus_tag LOCUS_32900 12903 15455 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857914.1 protein_id gnl|my_center|LOCUS_32900 15951 15463 gene locus_tag LOCUS_32910 15951 15463 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889277.1 protein_id gnl|my_center|LOCUS_32910 16463 15948 gene locus_tag LOCUS_32920 16463 15948 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728757.1 protein_id gnl|my_center|LOCUS_32920 16523 17701 gene locus_tag LOCUS_32930 16523 17701 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090103.1 protein_id gnl|my_center|LOCUS_32930 18855 17689 gene locus_tag LOCUS_32940 18855 17689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 18784 19539 gene locus_tag LOCUS_32950 18784 19539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 >Feature sequence33 123 1655 gene locus_tag LOCUS_32960 123 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 1771 2415 gene locus_tag LOCUS_32970 gene phoU 1771 2415 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404314.1 protein_id gnl|my_center|LOCUS_32970 3418 2642 gene locus_tag LOCUS_32980 gene pstB 3418 2642 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730783.1 protein_id gnl|my_center|LOCUS_32980 4383 3484 gene locus_tag LOCUS_32990 gene pstA 4383 3484 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015222.1 protein_id gnl|my_center|LOCUS_32990 5411 4380 gene locus_tag LOCUS_33000 gene pstC 5411 4380 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092497.1 protein_id gnl|my_center|LOCUS_33000 6683 5571 gene locus_tag LOCUS_33010 gene pstS 6683 5571 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730786.1 protein_id gnl|my_center|LOCUS_33010 7924 6995 gene locus_tag LOCUS_33020 gene mshD 7924 6995 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404307.1 protein_id gnl|my_center|LOCUS_33020 8681 7914 gene locus_tag LOCUS_33030 8681 7914 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897204.1 protein_id gnl|my_center|LOCUS_33030 8790 9743 gene locus_tag LOCUS_33040 8790 9743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 10015 9812 gene locus_tag LOCUS_33050 10015 9812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 10014 10850 gene locus_tag LOCUS_33060 10014 10850 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113224.1 protein_id gnl|my_center|LOCUS_33060 10853 11158 gene locus_tag LOCUS_33070 10853 11158 CDS product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878457.1 protein_id gnl|my_center|LOCUS_33070 11337 12014 gene locus_tag LOCUS_33080 11337 12014 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730793.1 protein_id gnl|my_center|LOCUS_33080 12070 12654 gene locus_tag LOCUS_33090 12070 12654 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223196.1 protein_id gnl|my_center|LOCUS_33090 14583 12826 gene locus_tag LOCUS_33100 gene cydC 14583 12826 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111158.1 protein_id gnl|my_center|LOCUS_33100 16219 14576 gene locus_tag LOCUS_33110 gene cydD 16219 14576 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114396.1 protein_id gnl|my_center|LOCUS_33110 17259 16216 gene locus_tag LOCUS_33120 gene cydB 17259 16216 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894621.1 protein_id gnl|my_center|LOCUS_33120 18774 17269 gene locus_tag LOCUS_33130 18774 17269 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111152.1 protein_id gnl|my_center|LOCUS_33130 19827 18910 gene locus_tag LOCUS_33140 19827 18910 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104397.1 protein_id gnl|my_center|LOCUS_33140 >Feature sequence34 213 896 gene locus_tag LOCUS_33150 213 896 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110636.1 protein_id gnl|my_center|LOCUS_33150 896 1735 gene locus_tag LOCUS_33160 896 1735 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729629.1 protein_id gnl|my_center|LOCUS_33160 1807 3051 gene locus_tag LOCUS_33170 gene mshC 1807 3051 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729628.1 protein_id gnl|my_center|LOCUS_33170 3098 3406 gene locus_tag LOCUS_33180 3098 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 3779 3432 gene locus_tag LOCUS_33190 gene nirD 3779 3432 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275366.1 protein_id gnl|my_center|LOCUS_33190 6304 3776 gene locus_tag LOCUS_33200 gene nasD 6304 3776 CDS product NADPH-nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234637.1 protein_id gnl|my_center|LOCUS_33200 6657 6325 gene locus_tag LOCUS_33210 6657 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 7671 6793 gene locus_tag LOCUS_33220 7671 6793 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061177.1 protein_id gnl|my_center|LOCUS_33220 7723 11331 gene locus_tag LOCUS_33230 gene metH 7723 11331 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900472.1 protein_id gnl|my_center|LOCUS_33230 11333 12064 gene locus_tag LOCUS_33240 11333 12064 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729623.1 protein_id gnl|my_center|LOCUS_33240 12071 12334 gene locus_tag LOCUS_33250 12071 12334 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061184.1 protein_id gnl|my_center|LOCUS_33250 12390 13235 gene locus_tag LOCUS_33260 gene hisG 12390 13235 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877960.1 protein_id gnl|my_center|LOCUS_33260 14084 13251 gene locus_tag LOCUS_33270 14084 13251 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895361.1 protein_id gnl|my_center|LOCUS_33270 14983 14081 gene locus_tag LOCUS_33280 14983 14081 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899178.1 protein_id gnl|my_center|LOCUS_33280 15003 15896 gene locus_tag LOCUS_33290 15003 15896 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080122.1 protein_id gnl|my_center|LOCUS_33290 16041 17807 gene locus_tag LOCUS_33300 gene arc 16041 17807 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895355.1 protein_id gnl|my_center|LOCUS_33300 17836 19335 gene locus_tag LOCUS_33310 gene dop 17836 19335 CDS product pup deamidase/depupylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895348.1 protein_id gnl|my_center|LOCUS_33310 19475 19669 gene locus_tag LOCUS_33320 19475 19669 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411026.1 protein_id gnl|my_center|LOCUS_33320 19666 20517 gene locus_tag LOCUS_33330 gene prcB 19666 20517 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877854.1 protein_id gnl|my_center|LOCUS_33330 20514 21284 gene locus_tag LOCUS_33340 gene prcA 20514 21284 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908272.1 protein_id gnl|my_center|LOCUS_33340 21382 22725 gene locus_tag LOCUS_33350 gene pafA 21382 22725 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061320.1 protein_id gnl|my_center|LOCUS_33350 22753 23745 gene locus_tag LOCUS_33360 22753 23745 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080096.1 protein_id gnl|my_center|LOCUS_33360 23742 24743 gene locus_tag LOCUS_33370 23742 24743 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080095.1 protein_id gnl|my_center|LOCUS_33370 24825 25097 gene locus_tag LOCUS_33380 gene tatA 24825 25097 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908276.1 protein_id gnl|my_center|LOCUS_33380 25265 26182 gene locus_tag LOCUS_33390 gene tatC 25265 26182 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729395.1 protein_id gnl|my_center|LOCUS_33390 26169 29057 gene locus_tag LOCUS_33400 26169 29057 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086507.1 protein_id gnl|my_center|LOCUS_33400 29180 29905 gene locus_tag LOCUS_33410 29180 29905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 30906 29935 gene locus_tag LOCUS_33420 30906 29935 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935270.1 protein_id gnl|my_center|LOCUS_33420 30959 32092 gene locus_tag LOCUS_33430 30959 32092 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729390.1 protein_id gnl|my_center|LOCUS_33430 32496 32116 gene locus_tag LOCUS_33440 32496 32116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 32909 32493 gene locus_tag LOCUS_33450 32909 32493 CDS product F420-dependent biliverdin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899157.1 protein_id gnl|my_center|LOCUS_33450 32941 33729 gene locus_tag LOCUS_33460 32941 33729 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900457.1 protein_id gnl|my_center|LOCUS_33460 33726 34949 gene locus_tag LOCUS_33470 gene cbiE 33726 34949 CDS product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114023.1 protein_id gnl|my_center|LOCUS_33470 34946 35707 gene locus_tag LOCUS_33480 gene cobM 34946 35707 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228819.1 protein_id gnl|my_center|LOCUS_33480 35694 36458 gene locus_tag LOCUS_33490 35694 36458 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228821.1 protein_id gnl|my_center|LOCUS_33490 38010 36466 gene locus_tag LOCUS_33500 38010 36466 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086498.1 protein_id gnl|my_center|LOCUS_33500 38642 38007 gene locus_tag LOCUS_33510 38642 38007 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 protein_id gnl|my_center|LOCUS_33510 39832 38639 gene locus_tag LOCUS_33520 gene cobG 39832 38639 CDS product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729385.1 protein_id gnl|my_center|LOCUS_33520 40013 43636 gene locus_tag LOCUS_33530 gene cobN 40013 43636 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086495.1 protein_id gnl|my_center|LOCUS_33530 43731 44204 gene locus_tag LOCUS_33540 43731 44204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 44253 45860 gene locus_tag LOCUS_33550 44253 45860 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729377.1 protein_id gnl|my_center|LOCUS_33550 45929 47503 gene locus_tag LOCUS_33560 gene lnt 45929 47503 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109789858.1 protein_id gnl|my_center|LOCUS_33560 47518 48348 gene locus_tag LOCUS_33570 47518 48348 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061374.1 protein_id gnl|my_center|LOCUS_33570 48721 48377 gene locus_tag LOCUS_33580 gene rbpA 48721 48377 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895305.1 protein_id gnl|my_center|LOCUS_33580 48950 49285 gene locus_tag LOCUS_33590 48950 49285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080063.1 protein_id gnl|my_center|LOCUS_33590 50450 49296 gene locus_tag LOCUS_33600 50450 49296 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028040.1 protein_id gnl|my_center|LOCUS_33600 51357 50497 gene locus_tag LOCUS_33610 51357 50497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028306.1 protein_id gnl|my_center|LOCUS_33610 52469 51354 gene locus_tag LOCUS_33620 52469 51354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33620 53749 52466 gene locus_tag LOCUS_33630 53749 52466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33630 55011 53746 gene locus_tag LOCUS_33640 55011 53746 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028308.1 protein_id gnl|my_center|LOCUS_33640 56240 55008 gene locus_tag LOCUS_33650 56240 55008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 56407 56982 gene locus_tag LOCUS_33660 56407 56982 CDS product calcium homeostasis/redox stress adaptation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976436.1 protein_id gnl|my_center|LOCUS_33660 57014 58168 gene locus_tag LOCUS_33670 57014 58168 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419580.1 protein_id gnl|my_center|LOCUS_33670 58277 59395 gene locus_tag LOCUS_33680 58277 59395 CDS product NADPH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416922.1 protein_id gnl|my_center|LOCUS_33680 59392 60201 gene locus_tag LOCUS_33690 59392 60201 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495987.1 protein_id gnl|my_center|LOCUS_33690 60907 60230 gene locus_tag LOCUS_33700 60907 60230 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899825.1 protein_id gnl|my_center|LOCUS_33700 61062 62168 gene locus_tag LOCUS_33710 61062 62168 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899004.1 protein_id gnl|my_center|LOCUS_33710 63066 62203 gene locus_tag LOCUS_33720 gene pcaA 63066 62203 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892739.1 protein_id gnl|my_center|LOCUS_33720 63322 63753 gene locus_tag LOCUS_33730 63322 63753 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729050.1 protein_id gnl|my_center|LOCUS_33730 63750 64628 gene locus_tag LOCUS_33740 63750 64628 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223699.1 protein_id gnl|my_center|LOCUS_33740 64675 65142 gene locus_tag LOCUS_33750 64675 65142 CDS product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226790.1 protein_id gnl|my_center|LOCUS_33750 65199 66641 gene locus_tag LOCUS_33760 gene zwf 65199 66641 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402864.1 protein_id gnl|my_center|LOCUS_33760 67080 66628 gene locus_tag LOCUS_33770 gene cynS 67080 66628 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082956.1 protein_id gnl|my_center|LOCUS_33770 69016 67163 gene locus_tag LOCUS_33780 69016 67163 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225751.1 protein_id gnl|my_center|LOCUS_33780 69535 69044 gene locus_tag LOCUS_33790 69535 69044 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891579.1 protein_id gnl|my_center|LOCUS_33790 70841 69528 gene locus_tag LOCUS_33800 70841 69528 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726769.1 protein_id gnl|my_center|LOCUS_33800 71397 70885 gene locus_tag LOCUS_33810 71397 70885 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017206458.1 protein_id gnl|my_center|LOCUS_33810 71673 75728 gene locus_tag LOCUS_33820 71673 75728 CDS product bifunctional nitrate reductase/sulfite reductase flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205569.1 protein_id gnl|my_center|LOCUS_33820 75744 76172 gene locus_tag LOCUS_33830 75744 76172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 76311 77279 gene locus_tag LOCUS_33840 76311 77279 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706561.1 protein_id gnl|my_center|LOCUS_33840 77338 77871 gene locus_tag LOCUS_33850 77338 77871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 77991 81557 gene locus_tag LOCUS_33860 77991 81557 CDS product thioester reductase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728718.1 protein_id gnl|my_center|LOCUS_33860 82868 81582 gene locus_tag LOCUS_33870 82868 81582 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876838.1 protein_id gnl|my_center|LOCUS_33870 83045 83653 gene locus_tag LOCUS_33880 83045 83653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 84670 83678 gene locus_tag LOCUS_33890 84670 83678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 85682 84816 gene locus_tag LOCUS_33900 85682 84816 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229860.1 protein_id gnl|my_center|LOCUS_33900 86029 85745 gene locus_tag LOCUS_33910 86029 85745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 86975 86049 gene locus_tag LOCUS_33920 86975 86049 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225257.1 protein_id gnl|my_center|LOCUS_33920 87796 87053 gene locus_tag LOCUS_33930 87796 87053 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971784.1 protein_id gnl|my_center|LOCUS_33930 88157 87852 gene locus_tag LOCUS_33940 88157 87852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 88320 88943 gene locus_tag LOCUS_33950 88320 88943 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495312.1 protein_id gnl|my_center|LOCUS_33950 89036 90742 gene locus_tag LOCUS_33960 gene ilvD 89036 90742 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726760.1 protein_id gnl|my_center|LOCUS_33960 90799 91410 gene locus_tag LOCUS_33970 90799 91410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 91524 92069 gene locus_tag LOCUS_33980 91524 92069 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028034.1 protein_id gnl|my_center|LOCUS_33980 92066 92680 gene locus_tag LOCUS_33990 92066 92680 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967700.1 protein_id gnl|my_center|LOCUS_33990 92767 93381 gene locus_tag LOCUS_34000 92767 93381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 93992 93372 gene locus_tag LOCUS_34010 93992 93372 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416599.1 protein_id gnl|my_center|LOCUS_34010 94044 95174 gene locus_tag LOCUS_34020 94044 95174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416605.1 protein_id gnl|my_center|LOCUS_34020 95171 96175 gene locus_tag LOCUS_34030 95171 96175 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104523.1 protein_id gnl|my_center|LOCUS_34030 96172 98553 gene locus_tag LOCUS_34040 96172 98553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 99577 98573 gene locus_tag LOCUS_34050 99577 98573 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284397.1 protein_id gnl|my_center|LOCUS_34050 100839 99574 gene locus_tag LOCUS_34060 100839 99574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 103115 100881 gene locus_tag LOCUS_34070 103115 100881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 103753 103148 gene locus_tag LOCUS_34080 103753 103148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 107652 103750 gene locus_tag LOCUS_34090 107652 103750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 109056 107800 gene locus_tag LOCUS_34100 109056 107800 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225085.1 protein_id gnl|my_center|LOCUS_34100 109784 109161 gene locus_tag LOCUS_34110 109784 109161 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727155.1 protein_id gnl|my_center|LOCUS_34110 109888 110907 gene locus_tag LOCUS_34120 109888 110907 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113220.1 protein_id gnl|my_center|LOCUS_34120 110935 112020 gene locus_tag LOCUS_34130 110935 112020 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727153.1 protein_id gnl|my_center|LOCUS_34130 113235 112045 gene locus_tag LOCUS_34140 113235 112045 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229955.1 protein_id gnl|my_center|LOCUS_34140 113747 113307 gene locus_tag LOCUS_34150 113747 113307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 113903 114280 gene locus_tag LOCUS_34160 113903 114280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 114298 114540 gene locus_tag LOCUS_34170 114298 114540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 114926 114510 gene locus_tag LOCUS_34180 114926 114510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 115422 115144 gene locus_tag LOCUS_34190 115422 115144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 115634 116338 gene locus_tag LOCUS_34200 115634 116338 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896957.1 protein_id gnl|my_center|LOCUS_34200 118148 117240 gene locus_tag LOCUS_34210 118148 117240 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224926.1 protein_id gnl|my_center|LOCUS_34210 118880 118566 gene locus_tag LOCUS_34220 118880 118566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 119335 118940 gene locus_tag LOCUS_34230 119335 118940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 121391 120384 gene locus_tag LOCUS_34240 121391 120384 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026947.1 protein_id gnl|my_center|LOCUS_34240 121509 122342 gene locus_tag LOCUS_34250 121509 122342 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026945.1 protein_id gnl|my_center|LOCUS_34250 122413 122952 gene locus_tag LOCUS_34260 122413 122952 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409503.1 protein_id gnl|my_center|LOCUS_34260 123953 122967 gene locus_tag LOCUS_34270 123953 122967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 124756 123944 gene locus_tag LOCUS_34280 124756 123944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 124828 125688 gene locus_tag LOCUS_34290 124828 125688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 126168 126581 gene locus_tag LOCUS_34300 126168 126581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 126659 127018 gene locus_tag LOCUS_34310 126659 127018 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730753.1 protein_id gnl|my_center|LOCUS_34310 127887 127060 gene locus_tag LOCUS_34320 127887 127060 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224290.1 protein_id gnl|my_center|LOCUS_34320 127959 129170 gene locus_tag LOCUS_34330 127959 129170 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_34330 129216 130097 gene locus_tag LOCUS_34340 129216 130097 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_34340 130094 131227 gene locus_tag LOCUS_34350 130094 131227 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104228.1 protein_id gnl|my_center|LOCUS_34350 131224 132084 gene locus_tag LOCUS_34360 131224 132084 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728951.1 protein_id gnl|my_center|LOCUS_34360 133241 132102 gene locus_tag LOCUS_34370 133241 132102 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891441.1 protein_id gnl|my_center|LOCUS_34370 133349 134464 gene locus_tag LOCUS_34380 133349 134464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 134922 134494 gene locus_tag LOCUS_34390 134922 134494 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895709.1 protein_id gnl|my_center|LOCUS_34390 134994 136049 gene locus_tag LOCUS_34400 134994 136049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 136873 136136 gene locus_tag LOCUS_34410 136873 136136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 137592 136888 gene locus_tag LOCUS_34420 137592 136888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 139256 137928 gene locus_tag LOCUS_34430 139256 137928 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063182.1 protein_id gnl|my_center|LOCUS_34430 141311 139338 gene locus_tag LOCUS_34440 gene htpG 141311 139338 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411855.1 protein_id gnl|my_center|LOCUS_34440 141405 142811 gene locus_tag LOCUS_34450 141405 142811 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727746.1 protein_id gnl|my_center|LOCUS_34450 142852 143643 gene locus_tag LOCUS_34460 142852 143643 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067360532.1 protein_id gnl|my_center|LOCUS_34460 143872 144483 gene locus_tag LOCUS_34470 143872 144483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 146391 144514 gene locus_tag LOCUS_34480 gene recD 146391 144514 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900979.1 protein_id gnl|my_center|LOCUS_34480 149753 146391 gene locus_tag LOCUS_34490 gene recB 149753 146391 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092099.1 protein_id gnl|my_center|LOCUS_34490 153076 149750 gene locus_tag LOCUS_34500 gene recC 153076 149750 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950425.1 protein_id gnl|my_center|LOCUS_34500 153565 153107 gene locus_tag LOCUS_34510 153565 153107 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110421.1 protein_id gnl|my_center|LOCUS_34510 154867 153623 gene locus_tag LOCUS_34520 154867 153623 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224736.1 protein_id gnl|my_center|LOCUS_34520 155630 154869 gene locus_tag LOCUS_34530 155630 154869 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224817.1 protein_id gnl|my_center|LOCUS_34530 156954 155650 gene locus_tag LOCUS_34540 156954 155650 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224816.1 protein_id gnl|my_center|LOCUS_34540 157170 158513 gene locus_tag LOCUS_34550 157170 158513 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462762.1 protein_id gnl|my_center|LOCUS_34550 158632 159225 gene locus_tag LOCUS_34560 158632 159225 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 protein_id gnl|my_center|LOCUS_34560 160118 159123 gene locus_tag LOCUS_34570 160118 159123 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111996.1 protein_id gnl|my_center|LOCUS_34570 160006 160323 gene locus_tag LOCUS_34580 160006 160323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 160307 160858 gene locus_tag LOCUS_34590 160307 160858 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080565.1 protein_id gnl|my_center|LOCUS_34590 161066 162604 gene locus_tag LOCUS_34600 161066 162604 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895076.1 protein_id gnl|my_center|LOCUS_34600 163251 162601 gene locus_tag LOCUS_34610 163251 162601 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729210.1 protein_id gnl|my_center|LOCUS_34610 163937 163251 gene locus_tag LOCUS_34620 gene ureG 163937 163251 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079400.1 protein_id gnl|my_center|LOCUS_34620 164681 164037 gene locus_tag LOCUS_34630 164681 164037 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110918.1 protein_id gnl|my_center|LOCUS_34630 166402 164681 gene locus_tag LOCUS_34640 166402 164681 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895080.1 protein_id gnl|my_center|LOCUS_34640 166742 166404 gene locus_tag LOCUS_34650 166742 166404 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729213.1 protein_id gnl|my_center|LOCUS_34650 167041 166739 gene locus_tag LOCUS_34660 167041 166739 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729214.1 protein_id gnl|my_center|LOCUS_34660 168425 167166 gene locus_tag LOCUS_34670 168425 167166 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730743.1 protein_id gnl|my_center|LOCUS_34670 168855 168436 gene locus_tag LOCUS_34680 168855 168436 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903650.1 protein_id gnl|my_center|LOCUS_34680 169151 169531 gene locus_tag LOCUS_34690 gene blaI 169151 169531 CDS product transcriptional repressor BlaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409301.1 protein_id gnl|my_center|LOCUS_34690 169623 170570 gene locus_tag LOCUS_34700 169623 170570 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075506.1 protein_id gnl|my_center|LOCUS_34700 170616 172082 gene locus_tag LOCUS_34710 gene gndA 170616 172082 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091773.1 protein_id gnl|my_center|LOCUS_34710 172087 173526 gene locus_tag LOCUS_34720 172087 173526 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729218.1 protein_id gnl|my_center|LOCUS_34720 173641 175023 gene locus_tag LOCUS_34730 173641 175023 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079373.1 protein_id gnl|my_center|LOCUS_34730 175020 176096 gene locus_tag LOCUS_34740 175020 176096 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895093.1 protein_id gnl|my_center|LOCUS_34740 176093 176974 gene locus_tag LOCUS_34750 176093 176974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729223.1 protein_id gnl|my_center|LOCUS_34750 177048 179222 gene locus_tag LOCUS_34760 177048 179222 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075497.1 protein_id gnl|my_center|LOCUS_34760 179247 180419 gene locus_tag LOCUS_34770 179247 180419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 183308 180450 gene locus_tag LOCUS_34780 gene gcvP 183308 180450 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088877.1 protein_id gnl|my_center|LOCUS_34780 184238 183594 gene locus_tag LOCUS_34790 184238 183594 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079363.1 protein_id gnl|my_center|LOCUS_34790 185064 184564 gene locus_tag LOCUS_34800 185064 184564 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409242.1 protein_id gnl|my_center|LOCUS_34800 185899 185216 gene locus_tag LOCUS_34810 185899 185216 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729229.1 protein_id gnl|my_center|LOCUS_34810 186436 185975 gene locus_tag LOCUS_34820 186436 185975 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877774.1 protein_id gnl|my_center|LOCUS_34820 186980 186576 gene locus_tag LOCUS_34830 gene gcvH 186980 186576 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409234.1 protein_id gnl|my_center|LOCUS_34830 187640 187011 gene locus_tag LOCUS_34840 187640 187011 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079356.1 protein_id gnl|my_center|LOCUS_34840 190106 187677 gene locus_tag LOCUS_34850 gene secA2 190106 187677 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729234.1 protein_id gnl|my_center|LOCUS_34850 191118 190213 gene locus_tag LOCUS_34860 191118 190213 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206791.1 protein_id gnl|my_center|LOCUS_34860 191722 191168 gene locus_tag LOCUS_34870 191722 191168 CDS product DUF1990 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413569.1 protein_id gnl|my_center|LOCUS_34870 192348 191719 gene locus_tag LOCUS_34880 gene mug 192348 191719 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230901.1 protein_id gnl|my_center|LOCUS_34880 192432 192857 gene locus_tag LOCUS_34890 192432 192857 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091046.1 protein_id gnl|my_center|LOCUS_34890 193359 192868 gene locus_tag LOCUS_34900 193359 192868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 193519 194343 gene locus_tag LOCUS_34910 193519 194343 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727421.1 protein_id gnl|my_center|LOCUS_34910 195396 194425 gene locus_tag LOCUS_34920 195396 194425 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930069.1 protein_id gnl|my_center|LOCUS_34920 196562 195408 gene locus_tag LOCUS_34930 196562 195408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 196876 196559 gene locus_tag LOCUS_34940 196876 196559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 197901 196873 gene locus_tag LOCUS_34950 197901 196873 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257000.1 protein_id gnl|my_center|LOCUS_34950 199483 197915 gene locus_tag LOCUS_34960 199483 197915 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211696200.1 protein_id gnl|my_center|LOCUS_34960 203035 199520 gene locus_tag LOCUS_34970 203035 199520 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110240682.1 protein_id gnl|my_center|LOCUS_34970 203571 203098 gene locus_tag LOCUS_34980 203571 203098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 205307 203577 gene locus_tag LOCUS_34990 205307 203577 CDS product DUF3556 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730378.1 protein_id gnl|my_center|LOCUS_34990 207725 205356 gene locus_tag LOCUS_35000 207725 205356 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224401.1 protein_id gnl|my_center|LOCUS_35000 207953 207869 gene locus_tag LOCUS_t00380 207953 207869 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 208638 208180 gene locus_tag LOCUS_35010 208638 208180 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224404.1 protein_id gnl|my_center|LOCUS_35010 209642 208623 gene locus_tag LOCUS_35020 209642 208623 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877754.1 protein_id gnl|my_center|LOCUS_35020 209682 211193 gene locus_tag LOCUS_35030 209682 211193 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296698.1 protein_id gnl|my_center|LOCUS_35030 211542 212582 gene locus_tag LOCUS_35040 211542 212582 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113933.1 protein_id gnl|my_center|LOCUS_35040 212579 213037 gene locus_tag LOCUS_35050 212579 213037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35050 213084 213383 gene locus_tag LOCUS_35060 213084 213383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35060 213380 214396 gene locus_tag LOCUS_35070 213380 214396 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092172.1 protein_id gnl|my_center|LOCUS_35070 214547 214714 gene locus_tag LOCUS_35080 214547 214714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 215144 214734 gene locus_tag LOCUS_35090 215144 214734 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031693.1 protein_id gnl|my_center|LOCUS_35090 215225 215602 gene locus_tag LOCUS_35100 215225 215602 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390276.1 protein_id gnl|my_center|LOCUS_35100 218059 215699 gene locus_tag LOCUS_35110 218059 215699 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877502.1 protein_id gnl|my_center|LOCUS_35110 218883 218056 gene locus_tag LOCUS_35120 218883 218056 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896853.1 protein_id gnl|my_center|LOCUS_35120 219422 218880 gene locus_tag LOCUS_35130 219422 218880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 219475 220032 gene locus_tag LOCUS_35140 219475 220032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 220139 220816 gene locus_tag LOCUS_35150 220139 220816 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057155.1 protein_id gnl|my_center|LOCUS_35150 220818 221636 gene locus_tag LOCUS_35160 220818 221636 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283913.1 protein_id gnl|my_center|LOCUS_35160 221824 223278 gene locus_tag LOCUS_35170 221824 223278 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224508.1 protein_id gnl|my_center|LOCUS_35170 224756 223275 gene locus_tag LOCUS_35180 224756 223275 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928898.1 protein_id gnl|my_center|LOCUS_35180 226123 224798 gene locus_tag LOCUS_35190 226123 224798 CDS product gluconolaconase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726747.1 protein_id gnl|my_center|LOCUS_35190 226165 227094 gene locus_tag LOCUS_35200 226165 227094 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227879.1 protein_id gnl|my_center|LOCUS_35200 227245 227171 gene locus_tag LOCUS_t00390 227245 227171 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 228766 227339 gene locus_tag LOCUS_35210 gene der 228766 227339 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467391.1 protein_id gnl|my_center|LOCUS_35210 229449 228763 gene locus_tag LOCUS_35220 gene cmk 229449 228763 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729300.1 protein_id gnl|my_center|LOCUS_35220 230408 229446 gene locus_tag LOCUS_35230 230408 229446 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408439.1 protein_id gnl|my_center|LOCUS_35230 231076 230411 gene locus_tag LOCUS_35240 gene scpB 231076 230411 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079323.1 protein_id gnl|my_center|LOCUS_35240 231944 231087 gene locus_tag LOCUS_35250 231944 231087 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729302.1 protein_id gnl|my_center|LOCUS_35250 232909 231944 gene locus_tag LOCUS_35260 232909 231944 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110864.1 protein_id gnl|my_center|LOCUS_35260 233937 232996 gene locus_tag LOCUS_35270 gene xerD 233937 232996 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729303.1 protein_id gnl|my_center|LOCUS_35270 234601 233948 gene locus_tag LOCUS_35280 234601 233948 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895191.1 protein_id gnl|my_center|LOCUS_35280 236346 234598 gene locus_tag LOCUS_35290 236346 234598 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091806.1 protein_id gnl|my_center|LOCUS_35290 237381 236473 gene locus_tag LOCUS_35300 237381 236473 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058615.1 protein_id gnl|my_center|LOCUS_35300 238608 237385 gene locus_tag LOCUS_35310 gene steA 238608 237385 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408387.1 protein_id gnl|my_center|LOCUS_35310 240449 238680 gene locus_tag LOCUS_35320 gene recN 240449 238680 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467394.1 protein_id gnl|my_center|LOCUS_35320 241431 240451 gene locus_tag LOCUS_35330 241431 240451 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058622.1 protein_id gnl|my_center|LOCUS_35330 242291 241428 gene locus_tag LOCUS_35340 242291 241428 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227822.1 protein_id gnl|my_center|LOCUS_35340 242561 242298 gene locus_tag LOCUS_35350 242561 242298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 244489 242558 gene locus_tag LOCUS_35360 244489 242558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 244663 245925 gene locus_tag LOCUS_35370 244663 245925 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876933.1 protein_id gnl|my_center|LOCUS_35370 245922 246392 gene locus_tag LOCUS_35380 245922 246392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 247634 246345 gene locus_tag LOCUS_35390 247634 246345 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878214.1 protein_id gnl|my_center|LOCUS_35390 248727 247681 gene locus_tag LOCUS_35400 248727 247681 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896426.1 protein_id gnl|my_center|LOCUS_35400 248918 250786 gene locus_tag LOCUS_35410 248918 250786 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896427.1 protein_id gnl|my_center|LOCUS_35410 >Feature sequence35 524 123 gene locus_tag LOCUS_35420 524 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 2016 517 gene locus_tag LOCUS_35430 2016 517 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135359439.1 protein_id gnl|my_center|LOCUS_35430 2182 2814 gene locus_tag LOCUS_35440 2182 2814 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727665.1 protein_id gnl|my_center|LOCUS_35440 4580 2970 gene locus_tag LOCUS_35450 4580 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 5964 4591 gene locus_tag LOCUS_35460 5964 4591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35460 6561 6091 gene locus_tag LOCUS_35470 6561 6091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 8142 6925 gene locus_tag LOCUS_35480 8142 6925 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966466.1 protein_id gnl|my_center|LOCUS_35480 8678 8139 gene locus_tag LOCUS_35490 8678 8139 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030506.1 protein_id gnl|my_center|LOCUS_35490 8900 9496 gene locus_tag LOCUS_35500 8900 9496 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296502.1 protein_id gnl|my_center|LOCUS_35500 12190 10505 gene locus_tag LOCUS_35510 12190 10505 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730708.1 protein_id gnl|my_center|LOCUS_35510 13216 12200 gene locus_tag LOCUS_35520 13216 12200 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897094.1 protein_id gnl|my_center|LOCUS_35520 >Feature sequence36 2478 970 gene locus_tag LOCUS_35530 gene pbpA 2478 970 CDS product D,D-transpeptidase PbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891359.1 protein_id gnl|my_center|LOCUS_35530 3902 2475 gene locus_tag LOCUS_35540 3902 2475 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726618.1 protein_id gnl|my_center|LOCUS_35540 5398 3902 gene locus_tag LOCUS_35550 gene pstP 5398 3902 CDS product serine/threonine phosphatase PstP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886062.1 protein_id gnl|my_center|LOCUS_35550 5868 5395 gene locus_tag LOCUS_35560 5868 5395 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400373.1 protein_id gnl|my_center|LOCUS_35560 6984 6061 gene locus_tag LOCUS_35570 6984 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 >Feature sequence37 1130 363 gene locus_tag LOCUS_35580 1130 363 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079865.1 protein_id gnl|my_center|LOCUS_35580 1164 2402 gene locus_tag LOCUS_35590 1164 2402 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296766.1 protein_id gnl|my_center|LOCUS_35590 4494 2758 gene locus_tag LOCUS_35600 4494 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095415.1 protein_id gnl|my_center|LOCUS_35600 5612 4506 gene locus_tag LOCUS_35610 5612 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 5690 6874 gene locus_tag LOCUS_35620 5690 6874 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229291.1 protein_id gnl|my_center|LOCUS_35620 >Feature sequence38 19 1532 gene locus_tag LOCUS_r00010 19 1532 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1873 5003 gene locus_tag LOCUS_r00020 1873 5003 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5146 5247 gene locus_tag LOCUS_r00030 5146 5247 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence39 <3347 2633 gene locus_tag LOCUS_35630 <3347 2633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727974.1:ribosome-associated translation inhibitor RaiA >Feature sequence40 801 475 gene locus_tag LOCUS_35640 801 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 2535 880 gene locus_tag LOCUS_35650 2535 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 2964 2629 gene locus_tag LOCUS_35660 2964 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 >Feature sequence41 1097 123 gene locus_tag LOCUS_35670 1097 123 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089460.1 protein_id gnl|my_center|LOCUS_35670 >Feature sequence42 736 23 gene locus_tag LOCUS_35680 736 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35680 1266 946 gene locus_tag LOCUS_35690 1266 946 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899493.1 protein_id gnl|my_center|LOCUS_35690 >Feature sequence43 >Feature sequence44 116 1114 gene locus_tag LOCUS_35700 116 1114 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058916821.1 protein_id gnl|my_center|LOCUS_35700 >Feature sequence45 314 1987 gene locus_tag LOCUS_35710 gene ctaD 314 1987 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056670.1 protein_id gnl|my_center|LOCUS_35710 2430 2101 gene locus_tag LOCUS_35720 2430 2101 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776001.1 protein_id gnl|my_center|LOCUS_35720 4408 2447 gene locus_tag LOCUS_35730 4408 2447 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777103.1 protein_id gnl|my_center|LOCUS_35730 4736 4945 gene locus_tag LOCUS_35740 4736 4945 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775998.1 protein_id gnl|my_center|LOCUS_35740 5066 7336 gene locus_tag LOCUS_35750 5066 7336 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776000.1 protein_id gnl|my_center|LOCUS_35750 8366 7689 gene locus_tag LOCUS_35760 8366 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 9193 8855 gene locus_tag LOCUS_35770 9193 8855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 9149 9343 gene locus_tag LOCUS_35780 9149 9343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 9813 9340 gene locus_tag LOCUS_35790 9813 9340 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727472.1 protein_id gnl|my_center|LOCUS_35790 9885 10244 gene locus_tag LOCUS_35800 9885 10244 CDS product Rv2640c family ArsR-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727473.1 protein_id gnl|my_center|LOCUS_35800 11302 10241 gene locus_tag LOCUS_35810 11302 10241 CDS product ArsO family NAD(P)H-dependent flavin-containing monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043376805.1 protein_id gnl|my_center|LOCUS_35810 11694 11299 gene locus_tag LOCUS_35820 11694 11299 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112739.1 protein_id gnl|my_center|LOCUS_35820 12125 11706 gene locus_tag LOCUS_35830 12125 11706 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_35830 12685 12260 gene locus_tag LOCUS_35840 12685 12260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35840 13749 12688 gene locus_tag LOCUS_35850 gene arsB 13749 12688 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112738.1 protein_id gnl|my_center|LOCUS_35850 14174 13785 gene locus_tag LOCUS_35860 14174 13785 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222675.1 protein_id gnl|my_center|LOCUS_35860 14721 14254 gene locus_tag LOCUS_35870 14721 14254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 14614 14868 gene locus_tag LOCUS_35880 14614 14868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 14869 15192 gene locus_tag LOCUS_35890 14869 15192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 16391 16125 gene locus_tag LOCUS_35900 16391 16125 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878317.1 protein_id gnl|my_center|LOCUS_35900 16878 16468 gene locus_tag LOCUS_35910 16878 16468 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026896.1 protein_id gnl|my_center|LOCUS_35910 19082 16920 gene locus_tag LOCUS_35920 19082 16920 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229633.1 protein_id gnl|my_center|LOCUS_35920 19863 19252 gene locus_tag LOCUS_35930 19863 19252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804782.1 protein_id gnl|my_center|LOCUS_35930 21237 20227 gene locus_tag LOCUS_35940 21237 20227 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027713.1 protein_id gnl|my_center|LOCUS_35940 21363 21743 gene locus_tag LOCUS_35950 21363 21743 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227633.1 protein_id gnl|my_center|LOCUS_35950 23146 21989 gene locus_tag LOCUS_35960 23146 21989 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227156.1 protein_id gnl|my_center|LOCUS_35960 23477 23226 gene locus_tag LOCUS_35970 23477 23226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 24994 23618 gene locus_tag LOCUS_35980 gene mmcO 24994 23618 CDS product multicopper oxidase MmcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404392.1 protein_id gnl|my_center|LOCUS_35980 25674 25243 gene locus_tag LOCUS_35990 25674 25243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 26056 25835 gene locus_tag LOCUS_36000 26056 25835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 25947 26327 gene locus_tag LOCUS_36010 25947 26327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 26400 27047 gene locus_tag LOCUS_36020 26400 27047 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225371.1 protein_id gnl|my_center|LOCUS_36020 27999 27247 gene locus_tag LOCUS_36030 27999 27247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 28349 27924 gene locus_tag LOCUS_36040 28349 27924 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226453.1 protein_id gnl|my_center|LOCUS_36040 28449 28958 gene locus_tag LOCUS_36050 28449 28958 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027915.1 protein_id gnl|my_center|LOCUS_36050 29032 29187 gene locus_tag LOCUS_36060 29032 29187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 30683 30045 gene locus_tag LOCUS_36070 30683 30045 CDS product DUF5134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898666.1 protein_id gnl|my_center|LOCUS_36070 32161 30680 gene locus_tag LOCUS_36080 32161 30680 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114546.1 protein_id gnl|my_center|LOCUS_36080 32282 33004 gene locus_tag LOCUS_36090 32282 33004 CDS product DUF2275 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094014.1 protein_id gnl|my_center|LOCUS_36090 33125 35110 gene locus_tag LOCUS_36100 33125 35110 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900808.1 protein_id gnl|my_center|LOCUS_36100 37435 35093 gene locus_tag LOCUS_36110 37435 35093 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400679.1 protein_id gnl|my_center|LOCUS_36110 37558 38115 gene locus_tag LOCUS_36120 gene sigC 37558 38115 CDS product RNA polymerase sigma factor SigC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410678.1 protein_id gnl|my_center|LOCUS_36120 38843 38250 gene locus_tag LOCUS_36130 38843 38250 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728325.1 protein_id gnl|my_center|LOCUS_36130 39610 38870 gene locus_tag LOCUS_36140 39610 38870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 39892 39716 gene locus_tag LOCUS_36150 39892 39716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 40157 41437 gene locus_tag LOCUS_36160 40157 41437 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727602.1 protein_id gnl|my_center|LOCUS_36160 42387 41443 gene locus_tag LOCUS_36170 42387 41443 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112443.1 protein_id gnl|my_center|LOCUS_36170 43502 42570 gene locus_tag LOCUS_36180 43502 42570 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225369.1 protein_id gnl|my_center|LOCUS_36180 43861 43499 gene locus_tag LOCUS_36190 43861 43499 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080036.1 protein_id gnl|my_center|LOCUS_36190 44260 43901 gene locus_tag LOCUS_36200 44260 43901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 45116 45958 gene locus_tag LOCUS_36210 45116 45958 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229548.1 protein_id gnl|my_center|LOCUS_36210 46024 47790 gene locus_tag LOCUS_36220 gene ctaD 46024 47790 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056670.1 protein_id gnl|my_center|LOCUS_36220 48381 50591 gene locus_tag LOCUS_36230 48381 50591 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057131.1 protein_id gnl|my_center|LOCUS_36230 53117 50856 gene locus_tag LOCUS_36240 53117 50856 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104325.1 protein_id gnl|my_center|LOCUS_36240 53383 54174 gene locus_tag LOCUS_36250 53383 54174 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080301.1 protein_id gnl|my_center|LOCUS_36250 54832 54221 gene locus_tag LOCUS_36260 54832 54221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 55028 55627 gene locus_tag LOCUS_36270 55028 55627 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727323.1 protein_id gnl|my_center|LOCUS_36270 55809 56036 gene locus_tag LOCUS_36280 55809 56036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 56147 57715 gene locus_tag LOCUS_36290 56147 57715 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496094.1 protein_id gnl|my_center|LOCUS_36290 58441 58238 gene locus_tag LOCUS_36300 58441 58238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 58469 59239 gene locus_tag LOCUS_36310 58469 59239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 61418 59250 gene locus_tag LOCUS_36320 61418 59250 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112725.1 protein_id gnl|my_center|LOCUS_36320 61671 61411 gene locus_tag LOCUS_36330 61671 61411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 62154 62645 gene locus_tag LOCUS_36340 62154 62645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 63641 63003 gene locus_tag LOCUS_36350 63641 63003 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057003.1 protein_id gnl|my_center|LOCUS_36350 64183 65043 gene locus_tag LOCUS_36360 64183 65043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 65944 65006 gene locus_tag LOCUS_36370 65944 65006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 66466 65963 gene locus_tag LOCUS_36380 66466 65963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 67002 66562 gene locus_tag LOCUS_36390 67002 66562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 67779 67021 gene locus_tag LOCUS_36400 67779 67021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 68077 68325 gene locus_tag LOCUS_36410 68077 68325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 68491 68700 gene locus_tag LOCUS_36420 68491 68700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 68900 70525 gene locus_tag LOCUS_36430 68900 70525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 70522 71757 gene locus_tag LOCUS_36440 70522 71757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 71768 72325 gene locus_tag LOCUS_36450 71768 72325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 72448 73251 gene locus_tag LOCUS_36460 72448 73251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 73251 73844 gene locus_tag LOCUS_36470 73251 73844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 73870 74145 gene locus_tag LOCUS_36480 73870 74145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 74215 74445 gene locus_tag LOCUS_36490 74215 74445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 74583 75053 gene locus_tag LOCUS_36500 74583 75053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 75053 75901 gene locus_tag LOCUS_36510 75053 75901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 75889 77415 gene locus_tag LOCUS_36520 75889 77415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 77415 78902 gene locus_tag LOCUS_36530 77415 78902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068083.1 protein_id gnl|my_center|LOCUS_36530 78899 80656 gene locus_tag LOCUS_36540 78899 80656 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080790597.1 protein_id gnl|my_center|LOCUS_36540 80653 80940 gene locus_tag LOCUS_36550 80653 80940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 80948 82174 gene locus_tag LOCUS_36560 80948 82174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 82208 82867 gene locus_tag LOCUS_36570 82208 82867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 82867 83181 gene locus_tag LOCUS_36580 82867 83181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 83178 83765 gene locus_tag LOCUS_36590 83178 83765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 84094 83759 gene locus_tag LOCUS_36600 84094 83759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 84014 84541 gene locus_tag LOCUS_36610 84014 84541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 84583 86424 gene locus_tag LOCUS_36620 84583 86424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 86424 86807 gene locus_tag LOCUS_36630 86424 86807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 87087 87674 gene locus_tag LOCUS_36640 87087 87674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 87938 93466 gene locus_tag LOCUS_36650 87938 93466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 93730 94437 gene locus_tag LOCUS_36660 93730 94437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 94434 95351 gene locus_tag LOCUS_36670 94434 95351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 101560 95639 gene locus_tag LOCUS_36680 101560 95639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 101858 102295 gene locus_tag LOCUS_36690 101858 102295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 102916 102695 gene locus_tag LOCUS_36700 102916 102695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 103422 102919 gene locus_tag LOCUS_36710 103422 102919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 106897 103415 gene locus_tag LOCUS_36720 106897 103415 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918509.1 protein_id gnl|my_center|LOCUS_36720 107880 106897 gene locus_tag LOCUS_36730 107880 106897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 110081 108141 gene locus_tag LOCUS_36740 110081 108141 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918506.1 protein_id gnl|my_center|LOCUS_36740 111328 110234 gene locus_tag LOCUS_36750 111328 110234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 111649 111341 gene locus_tag LOCUS_36760 111649 111341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 112552 112064 gene locus_tag LOCUS_36770 112552 112064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 112706 112909 gene locus_tag LOCUS_36780 112706 112909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 113001 113231 gene locus_tag LOCUS_36790 113001 113231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 113294 114958 gene locus_tag LOCUS_36800 113294 114958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 114955 116199 gene locus_tag LOCUS_36810 114955 116199 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178940705.1 protein_id gnl|my_center|LOCUS_36810 116356 116282 gene locus_tag LOCUS_t00400 116356 116282 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 117433 116435 gene locus_tag LOCUS_36820 117433 116435 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083536.1 protein_id gnl|my_center|LOCUS_36820 117315 117989 gene locus_tag LOCUS_36830 117315 117989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 120498 118006 gene locus_tag LOCUS_36840 gene ponA2 120498 118006 CDS product transglycosylase/D,D-transpeptidase PonA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296304.1 protein_id gnl|my_center|LOCUS_36840 120710 121024 gene locus_tag LOCUS_36850 120710 121024 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731112.1 protein_id gnl|my_center|LOCUS_36850 122159 121047 gene locus_tag LOCUS_36860 122159 121047 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083535.1 protein_id gnl|my_center|LOCUS_36860 123214 122159 gene locus_tag LOCUS_36870 123214 122159 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050545102.1 protein_id gnl|my_center|LOCUS_36870 123259 123423 gene locus_tag LOCUS_36880 123259 123423 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897587.1 protein_id gnl|my_center|LOCUS_36880 123429 123917 gene locus_tag LOCUS_36890 123429 123917 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092109.1 protein_id gnl|my_center|LOCUS_36890 124785 123931 gene locus_tag LOCUS_36900 124785 123931 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731106.1 protein_id gnl|my_center|LOCUS_36900 124950 125258 gene locus_tag LOCUS_36910 124950 125258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 125511 125957 gene locus_tag LOCUS_36920 125511 125957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 125987 127246 gene locus_tag LOCUS_36930 gene eno 125987 127246 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896814.1 protein_id gnl|my_center|LOCUS_36930 127261 127968 gene locus_tag LOCUS_36940 127261 127968 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804515.1 protein_id gnl|my_center|LOCUS_36940 128525 127965 gene locus_tag LOCUS_36950 128525 127965 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895958.1 protein_id gnl|my_center|LOCUS_36950 129040 128522 gene locus_tag LOCUS_36960 129040 128522 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079420.1 protein_id gnl|my_center|LOCUS_36960 129453 129085 gene locus_tag LOCUS_36970 gene crcB 129453 129085 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079419.1 protein_id gnl|my_center|LOCUS_36970 129965 129450 gene locus_tag LOCUS_36980 129965 129450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36980 130348 130037 gene locus_tag LOCUS_36990 130348 130037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 131571 130396 gene locus_tag LOCUS_37000 131571 130396 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728588.1 protein_id gnl|my_center|LOCUS_37000 132720 131731 gene locus_tag LOCUS_37010 132720 131731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 133247 132864 gene locus_tag LOCUS_37020 133247 132864 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225939.1 protein_id gnl|my_center|LOCUS_37020 134394 133237 gene locus_tag LOCUS_37030 134394 133237 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227156.1 protein_id gnl|my_center|LOCUS_37030 135855 134413 gene locus_tag LOCUS_37040 gene mmcO 135855 134413 CDS product multicopper oxidase MmcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404392.1 protein_id gnl|my_center|LOCUS_37040 136499 136020 gene locus_tag LOCUS_37050 136499 136020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 136684 136941 gene locus_tag LOCUS_37060 136684 136941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 138935 137670 gene locus_tag LOCUS_37070 138935 137670 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187588.1 protein_id gnl|my_center|LOCUS_37070 140281 139196 gene locus_tag LOCUS_37080 140281 139196 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911638.1 protein_id gnl|my_center|LOCUS_37080 141731 140376 gene locus_tag LOCUS_37090 141731 140376 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205459.1 protein_id gnl|my_center|LOCUS_37090 141817 142425 gene locus_tag LOCUS_37100 141817 142425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 143271 142411 gene locus_tag LOCUS_37110 143271 142411 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230738.1 protein_id gnl|my_center|LOCUS_37110 144039 143281 gene locus_tag LOCUS_37120 gene hypB 144039 143281 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728271.1 protein_id gnl|my_center|LOCUS_37120 145488 144049 gene locus_tag LOCUS_37130 145488 144049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 145649 146251 gene locus_tag LOCUS_37140 145649 146251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 146991 146317 gene locus_tag LOCUS_37150 gene crp 146991 146317 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897584.1 protein_id gnl|my_center|LOCUS_37150 147429 147169 gene locus_tag LOCUS_37160 147429 147169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 147613 148413 gene locus_tag LOCUS_37170 gene nth 147613 148413 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078343767.1 protein_id gnl|my_center|LOCUS_37170 148422 149114 gene locus_tag LOCUS_37180 148422 149114 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113013.1 protein_id gnl|my_center|LOCUS_37180 149111 149887 gene locus_tag LOCUS_37190 149111 149887 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083528.1 protein_id gnl|my_center|LOCUS_37190 149884 151080 gene locus_tag LOCUS_37200 gene marP 149884 151080 CDS product acid resistance serine protease MarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731101.1 protein_id gnl|my_center|LOCUS_37200 152022 151087 gene locus_tag LOCUS_37210 152022 151087 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731100.1 protein_id gnl|my_center|LOCUS_37210 152574 152074 gene locus_tag LOCUS_37220 152574 152074 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897577.1 protein_id gnl|my_center|LOCUS_37220 153800 152691 gene locus_tag LOCUS_37230 153800 152691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 154723 154193 gene locus_tag LOCUS_37240 154723 154193 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087202.1 protein_id gnl|my_center|LOCUS_37240 154810 156024 gene locus_tag LOCUS_37250 154810 156024 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844744.1 protein_id gnl|my_center|LOCUS_37250 156637 156002 gene locus_tag LOCUS_37260 156637 156002 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080755.1 protein_id gnl|my_center|LOCUS_37260 156661 157167 gene locus_tag LOCUS_37270 156661 157167 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088271.1 protein_id gnl|my_center|LOCUS_37270 158423 157182 gene locus_tag LOCUS_37280 gene nhaA 158423 157182 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230542.1 protein_id gnl|my_center|LOCUS_37280 158529 160040 gene locus_tag LOCUS_37290 158529 160040 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727675.1 protein_id gnl|my_center|LOCUS_37290 160040 160426 gene locus_tag LOCUS_37300 160040 160426 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892834.1 protein_id gnl|my_center|LOCUS_37300 162431 160458 gene locus_tag LOCUS_37310 gene acs 162431 160458 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086931.1 protein_id gnl|my_center|LOCUS_37310 164345 162558 gene locus_tag LOCUS_37320 164345 162558 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113016.1 protein_id gnl|my_center|LOCUS_37320 164397 165014 gene locus_tag LOCUS_37330 164397 165014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 166056 164983 gene locus_tag LOCUS_37340 166056 164983 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229761.1 protein_id gnl|my_center|LOCUS_37340 167543 166053 gene locus_tag LOCUS_37350 167543 166053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 169510 167792 gene locus_tag LOCUS_37360 169510 167792 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093597.1 protein_id gnl|my_center|LOCUS_37360 169778 170527 gene locus_tag LOCUS_37370 169778 170527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296309.1 protein_id gnl|my_center|LOCUS_37370 171641 170973 gene locus_tag LOCUS_37380 171641 170973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 172280 173380 gene locus_tag LOCUS_37390 172280 173380 CDS product CpaE-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113018.1 protein_id gnl|my_center|LOCUS_37390 173377 174567 gene locus_tag LOCUS_37400 173377 174567 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731088.1 protein_id gnl|my_center|LOCUS_37400 174564 175388 gene locus_tag LOCUS_37410 174564 175388 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083514.1 protein_id gnl|my_center|LOCUS_37410 175385 175981 gene locus_tag LOCUS_37420 175385 175981 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731085.1 protein_id gnl|my_center|LOCUS_37420 176049 176255 gene locus_tag LOCUS_37430 176049 176255 CDS product DUF4244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083512.1 protein_id gnl|my_center|LOCUS_37430 176425 177006 gene locus_tag LOCUS_37440 176425 177006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 177822 177019 gene locus_tag LOCUS_37450 177822 177019 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225859.1 protein_id gnl|my_center|LOCUS_37450 178790 177987 gene locus_tag LOCUS_37460 178790 177987 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225859.1 protein_id gnl|my_center|LOCUS_37460 179642 178842 gene locus_tag LOCUS_37470 179642 178842 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225859.1 protein_id gnl|my_center|LOCUS_37470 179797 180204 gene locus_tag LOCUS_37480 179797 180204 CDS product TadE family type IV pilus minor pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181825002.1 protein_id gnl|my_center|LOCUS_37480 180201 180566 gene locus_tag LOCUS_37490 180201 180566 CDS product flp pilus-assembly TadE/G-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083510.1 protein_id gnl|my_center|LOCUS_37490 182045 180567 gene locus_tag LOCUS_37500 182045 180567 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730628.1 protein_id gnl|my_center|LOCUS_37500 183128 182163 gene locus_tag LOCUS_37510 183128 182163 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727630.1 protein_id gnl|my_center|LOCUS_37510 184299 183199 gene locus_tag LOCUS_37520 184299 183199 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727629.1 protein_id gnl|my_center|LOCUS_37520 185075 184299 gene locus_tag LOCUS_37530 185075 184299 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892760.1 protein_id gnl|my_center|LOCUS_37530 185857 185135 gene locus_tag LOCUS_37540 185857 185135 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731541.1 protein_id gnl|my_center|LOCUS_37540 186185 186910 gene locus_tag LOCUS_37550 186185 186910 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191609.1 protein_id gnl|my_center|LOCUS_37550 186954 187973 gene locus_tag LOCUS_37560 186954 187973 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892757.1 protein_id gnl|my_center|LOCUS_37560 189232 187985 gene locus_tag LOCUS_37570 189232 187985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 189307 190314 gene locus_tag LOCUS_37580 189307 190314 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892757.1 protein_id gnl|my_center|LOCUS_37580 190311 191651 gene locus_tag LOCUS_37590 190311 191651 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727632.1 protein_id gnl|my_center|LOCUS_37590 191726 192628 gene locus_tag LOCUS_37600 gene lacD 191726 192628 CDS product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836307.1 protein_id gnl|my_center|LOCUS_37600 192705 193688 gene locus_tag LOCUS_37610 gene cpdA 192705 193688 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404120.1 protein_id gnl|my_center|LOCUS_37610 195181 193625 gene locus_tag LOCUS_37620 195181 193625 CDS product stealth family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898594.1 protein_id gnl|my_center|LOCUS_37620 197677 195347 gene locus_tag LOCUS_37630 197677 195347 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113919.1 protein_id gnl|my_center|LOCUS_37630 198000 198203 gene locus_tag LOCUS_37640 198000 198203 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064941.1 protein_id gnl|my_center|LOCUS_37640 198355 198933 gene locus_tag LOCUS_37650 198355 198933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083493.1 protein_id gnl|my_center|LOCUS_37650 199160 202273 gene locus_tag LOCUS_37660 gene topA 199160 202273 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731080.1 protein_id gnl|my_center|LOCUS_37660 202308 203132 gene locus_tag LOCUS_37670 202308 203132 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331267.1 protein_id gnl|my_center|LOCUS_37670 204920 203145 gene locus_tag LOCUS_37680 204920 203145 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731079.1 protein_id gnl|my_center|LOCUS_37680 204828 206240 gene locus_tag LOCUS_37690 204828 206240 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731078.1 protein_id gnl|my_center|LOCUS_37690 206322 206397 gene locus_tag LOCUS_t00410 206322 206397 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 206516 207994 gene locus_tag LOCUS_37700 206516 207994 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092361.1 protein_id gnl|my_center|LOCUS_37700 208042 208392 gene locus_tag LOCUS_37710 208042 208392 CDS product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894681.1 protein_id gnl|my_center|LOCUS_37710 208470 209906 gene locus_tag LOCUS_37720 208470 209906 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028622.1 protein_id gnl|my_center|LOCUS_37720 209903 210676 gene locus_tag LOCUS_37730 209903 210676 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228778.1 protein_id gnl|my_center|LOCUS_37730 211464 210682 gene locus_tag LOCUS_37740 211464 210682 CDS product pirin-like bicupin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089568.1 protein_id gnl|my_center|LOCUS_37740 212060 211461 gene locus_tag LOCUS_37750 gene wrbA 212060 211461 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728300.1 protein_id gnl|my_center|LOCUS_37750 212159 212629 gene locus_tag LOCUS_37760 212159 212629 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897002.1 protein_id gnl|my_center|LOCUS_37760 212702 213715 gene locus_tag LOCUS_37770 212702 213715 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727579.1 protein_id gnl|my_center|LOCUS_37770 214134 213712 gene locus_tag LOCUS_37780 214134 213712 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005102829.1 protein_id gnl|my_center|LOCUS_37780 215572 214127 gene locus_tag LOCUS_37790 215572 214127 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730698.1 protein_id gnl|my_center|LOCUS_37790 215723 216838 gene locus_tag LOCUS_37800 215723 216838 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898087.1 protein_id gnl|my_center|LOCUS_37800 >Feature sequence46 >Feature sequence47 718 578 gene locus_tag LOCUS_37810 718 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 2629 1067 gene locus_tag LOCUS_37820 2629 1067 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083171434.1 protein_id gnl|my_center|LOCUS_37820 3712 2657 gene locus_tag LOCUS_37830 3712 2657 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078017.1 protein_id gnl|my_center|LOCUS_37830 3781 4797 gene locus_tag LOCUS_37840 3781 4797 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005116049.1 protein_id gnl|my_center|LOCUS_37840 4808 5854 gene locus_tag LOCUS_37850 4808 5854 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419199.1 protein_id gnl|my_center|LOCUS_37850 5854 7023 gene locus_tag LOCUS_37860 5854 7023 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901662.1 protein_id gnl|my_center|LOCUS_37860 7088 7525 gene locus_tag LOCUS_37870 7088 7525 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062283.1 protein_id gnl|my_center|LOCUS_37870 8419 7532 gene locus_tag LOCUS_37880 gene blaPEN-bpc 8419 7532 CDS product PEN family class A beta-lactamase, Bpc-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551611.1 protein_id gnl|my_center|LOCUS_37880 9706 8459 gene locus_tag LOCUS_37890 9706 8459 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878473.1 protein_id gnl|my_center|LOCUS_37890 9870 11036 gene locus_tag LOCUS_37900 9870 11036 CDS product steroid 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085491.1 protein_id gnl|my_center|LOCUS_37900 11049 11555 gene locus_tag LOCUS_37910 11049 11555 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065587.1 protein_id gnl|my_center|LOCUS_37910 11637 13019 gene locus_tag LOCUS_37920 11637 13019 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229605.1 protein_id gnl|my_center|LOCUS_37920 13065 13727 gene locus_tag LOCUS_37930 13065 13727 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093324.1 protein_id gnl|my_center|LOCUS_37930 13729 14097 gene locus_tag LOCUS_37940 13729 14097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 16374 14104 gene locus_tag LOCUS_37950 gene katG 16374 14104 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142765.1 protein_id gnl|my_center|LOCUS_37950 16856 16497 gene locus_tag LOCUS_37960 16856 16497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 17773 16853 gene locus_tag LOCUS_37970 17773 16853 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092227.1 protein_id gnl|my_center|LOCUS_37970 18549 17770 gene locus_tag LOCUS_37980 18549 17770 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072792.1 protein_id gnl|my_center|LOCUS_37980 18656 19411 gene locus_tag LOCUS_37990 18656 19411 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085480.1 protein_id gnl|my_center|LOCUS_37990 19408 20331 gene locus_tag LOCUS_38000 19408 20331 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089071.1 protein_id gnl|my_center|LOCUS_38000 20328 21092 gene locus_tag LOCUS_38010 20328 21092 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085471.1 protein_id gnl|my_center|LOCUS_38010 21089 22168 gene locus_tag LOCUS_38020 21089 22168 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113167.1 protein_id gnl|my_center|LOCUS_38020 22213 23694 gene locus_tag LOCUS_38030 22213 23694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 24196 23696 gene locus_tag LOCUS_38040 24196 23696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 24279 24803 gene locus_tag LOCUS_38050 24279 24803 CDS product phenolic acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099178.1 protein_id gnl|my_center|LOCUS_38050 24803 25270 gene locus_tag LOCUS_38060 24803 25270 CDS product DUF3237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090566.1 protein_id gnl|my_center|LOCUS_38060 27074 25416 gene locus_tag LOCUS_38070 gene atzF 27074 25416 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728210.1 protein_id gnl|my_center|LOCUS_38070 29071 27071 gene locus_tag LOCUS_38080 29071 27071 CDS product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728209.1 protein_id gnl|my_center|LOCUS_38080 29748 29071 gene locus_tag LOCUS_38090 29748 29071 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893561.1 protein_id gnl|my_center|LOCUS_38090 30600 29764 gene locus_tag LOCUS_38100 30600 29764 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104257.1 protein_id gnl|my_center|LOCUS_38100 32171 30597 gene locus_tag LOCUS_38110 32171 30597 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728208.1 protein_id gnl|my_center|LOCUS_38110 32337 32954 gene locus_tag LOCUS_38120 gene amtR 32337 32954 CDS product transcriptional regulator AmtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729715.1 protein_id gnl|my_center|LOCUS_38120 33046 33333 gene locus_tag LOCUS_38130 33046 33333 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142851.1 protein_id gnl|my_center|LOCUS_38130 33947 33369 gene locus_tag LOCUS_38140 gene kstR2 33947 33369 CDS product TetR family transcriptional regulator KstR2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897410.1 protein_id gnl|my_center|LOCUS_38140 35528 34026 gene locus_tag LOCUS_38150 35528 34026 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728247.1 protein_id gnl|my_center|LOCUS_38150 35648 36034 gene locus_tag LOCUS_38160 35648 36034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083500.1 protein_id gnl|my_center|LOCUS_38160 36401 37915 gene locus_tag LOCUS_38170 36401 37915 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110870.1 protein_id gnl|my_center|LOCUS_38170 39365 38211 gene locus_tag LOCUS_38180 39365 38211 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225240.1 protein_id gnl|my_center|LOCUS_38180 40195 39383 gene locus_tag LOCUS_38190 40195 39383 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089068.1 protein_id gnl|my_center|LOCUS_38190 41445 40192 gene locus_tag LOCUS_38200 41445 40192 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113162.1 protein_id gnl|my_center|LOCUS_38200 41512 43110 gene locus_tag LOCUS_38210 41512 43110 CDS product FadD3 family acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113161.1 protein_id gnl|my_center|LOCUS_38210 43458 43129 gene locus_tag LOCUS_38220 43458 43129 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065018.1 protein_id gnl|my_center|LOCUS_38220 45122 43614 gene locus_tag LOCUS_38230 gene lysS 45122 43614 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731034.1 protein_id gnl|my_center|LOCUS_38230 45587 45147 gene locus_tag LOCUS_38240 45587 45147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 46509 45676 gene locus_tag LOCUS_38250 46509 45676 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897496.1 protein_id gnl|my_center|LOCUS_38250 46932 46516 gene locus_tag LOCUS_38260 46932 46516 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083440.1 protein_id gnl|my_center|LOCUS_38260 47907 46939 gene locus_tag LOCUS_38270 gene panC 47907 46939 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092170.1 protein_id gnl|my_center|LOCUS_38270 48854 47904 gene locus_tag LOCUS_38280 48854 47904 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113142.1 protein_id gnl|my_center|LOCUS_38280 50065 48980 gene locus_tag LOCUS_38290 50065 48980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 50722 50156 gene locus_tag LOCUS_38300 50722 50156 CDS product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230462.1 protein_id gnl|my_center|LOCUS_38300 51228 50692 gene locus_tag LOCUS_38310 gene folK 51228 50692 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113139.1 protein_id gnl|my_center|LOCUS_38310 51623 51225 gene locus_tag LOCUS_38320 gene folB 51623 51225 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897503.1 protein_id gnl|my_center|LOCUS_38320 52521 51595 gene locus_tag LOCUS_38330 gene folP 52521 51595 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048402.1 protein_id gnl|my_center|LOCUS_38330 53269 52550 gene locus_tag LOCUS_38340 gene folE 53269 52550 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731040.1 protein_id gnl|my_center|LOCUS_38340 55677 53266 gene locus_tag LOCUS_38350 gene ftsH 55677 53266 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897506.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38350 55871 56989 gene locus_tag LOCUS_38360 55871 56989 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533145.1 protein_id gnl|my_center|LOCUS_38360 56974 57459 gene locus_tag LOCUS_38370 56974 57459 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974936.1 protein_id gnl|my_center|LOCUS_38370 58170 57499 gene locus_tag LOCUS_38380 gene bluB 58170 57499 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404272.1 protein_id gnl|my_center|LOCUS_38380 59540 58167 gene locus_tag LOCUS_38390 59540 58167 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406369.1 protein_id gnl|my_center|LOCUS_38390 60134 59553 gene locus_tag LOCUS_38400 gene hpt 60134 59553 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878560.1 protein_id gnl|my_center|LOCUS_38400 60444 61085 gene locus_tag LOCUS_38410 60444 61085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 62056 61112 gene locus_tag LOCUS_38420 gene tilS 62056 61112 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731045.1 protein_id gnl|my_center|LOCUS_38420 63129 62053 gene locus_tag LOCUS_38430 63129 62053 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731046.1 protein_id gnl|my_center|LOCUS_38430 64502 63126 gene locus_tag LOCUS_38440 gene dacB 64502 63126 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113125.1 protein_id gnl|my_center|LOCUS_38440 64685 65197 gene locus_tag LOCUS_38450 64685 65197 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064895.1 protein_id gnl|my_center|LOCUS_38450 67170 65275 gene locus_tag LOCUS_38460 67170 65275 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230478.1 protein_id gnl|my_center|LOCUS_38460 67746 67291 gene locus_tag LOCUS_38470 67746 67291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 67860 68909 gene locus_tag LOCUS_38480 gene alc 67860 68909 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111443.1 protein_id gnl|my_center|LOCUS_38480 69239 69009 gene locus_tag LOCUS_38490 69239 69009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38490 69852 69244 gene locus_tag LOCUS_38500 69852 69244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38500 71430 70093 gene locus_tag LOCUS_38510 71430 70093 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296326.1 protein_id gnl|my_center|LOCUS_38510 71614 72771 gene locus_tag LOCUS_38520 71614 72771 CDS product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323726.1 protein_id gnl|my_center|LOCUS_38520 73460 72825 gene locus_tag LOCUS_38530 73460 72825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 74690 73485 gene locus_tag LOCUS_38540 74690 73485 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727178.1 protein_id gnl|my_center|LOCUS_38540 75206 74721 gene locus_tag LOCUS_38550 75206 74721 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078099.1 protein_id gnl|my_center|LOCUS_38550 75697 75203 gene locus_tag LOCUS_38560 75697 75203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 75792 76802 gene locus_tag LOCUS_38570 75792 76802 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259666.1 protein_id gnl|my_center|LOCUS_38570 76947 78326 gene locus_tag LOCUS_38580 76947 78326 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978182.1 protein_id gnl|my_center|LOCUS_38580 78531 78869 gene locus_tag LOCUS_38590 78531 78869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111477.1 protein_id gnl|my_center|LOCUS_38590 79391 78999 gene locus_tag LOCUS_38600 79391 78999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 79642 80658 gene locus_tag LOCUS_38610 79642 80658 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082397.1 protein_id gnl|my_center|LOCUS_38610 80655 81767 gene locus_tag LOCUS_38620 80655 81767 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009675.1 protein_id gnl|my_center|LOCUS_38620 81764 82591 gene locus_tag LOCUS_38630 81764 82591 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027158.1 protein_id gnl|my_center|LOCUS_38630 83141 82662 gene locus_tag LOCUS_38640 83141 82662 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079757.1 protein_id gnl|my_center|LOCUS_38640 84845 83142 gene locus_tag LOCUS_38650 84845 83142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 85194 84871 gene locus_tag LOCUS_38660 85194 84871 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727177.1 protein_id gnl|my_center|LOCUS_38660 85331 86935 gene locus_tag LOCUS_38670 85331 86935 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892189.1 protein_id gnl|my_center|LOCUS_38670 87644 86937 gene locus_tag LOCUS_38680 87644 86937 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057003.1 protein_id gnl|my_center|LOCUS_38680 89327 87705 gene locus_tag LOCUS_38690 89327 87705 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074376.1 protein_id gnl|my_center|LOCUS_38690 90976 89399 gene locus_tag LOCUS_38700 90976 89399 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111991.1 protein_id gnl|my_center|LOCUS_38700 92402 91110 gene locus_tag LOCUS_38710 92402 91110 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085742.1 protein_id gnl|my_center|LOCUS_38710 92552 93238 gene locus_tag LOCUS_38720 92552 93238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401831.1 protein_id gnl|my_center|LOCUS_38720 93235 94017 gene locus_tag LOCUS_38730 93235 94017 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727171.1 protein_id gnl|my_center|LOCUS_38730 94180 94485 gene locus_tag LOCUS_38740 94180 94485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 94455 97589 gene locus_tag LOCUS_38750 94455 97589 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031572.1 protein_id gnl|my_center|LOCUS_38750 98356 97736 gene locus_tag LOCUS_38760 98356 97736 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730225.1 protein_id gnl|my_center|LOCUS_38760 99361 98417 gene locus_tag LOCUS_38770 99361 98417 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727169.1 protein_id gnl|my_center|LOCUS_38770 100308 99385 gene locus_tag LOCUS_38780 100308 99385 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853634.1 protein_id gnl|my_center|LOCUS_38780 100316 100465 gene locus_tag LOCUS_38790 100316 100465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 100999 100538 gene locus_tag LOCUS_38800 100999 100538 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898414.1 protein_id gnl|my_center|LOCUS_38800 101117 102394 gene locus_tag LOCUS_38810 101117 102394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 103514 102477 gene locus_tag LOCUS_38820 gene fbaA 103514 102477 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296741.1 protein_id gnl|my_center|LOCUS_38820 103612 104379 gene locus_tag LOCUS_38830 103612 104379 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062515.1 protein_id gnl|my_center|LOCUS_38830 105372 104449 gene locus_tag LOCUS_38840 105372 104449 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143212.1 protein_id gnl|my_center|LOCUS_38840 106203 105508 gene locus_tag LOCUS_38850 106203 105508 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511861.1 protein_id gnl|my_center|LOCUS_38850 106714 106184 gene locus_tag LOCUS_38860 gene pyrE 106714 106184 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862850.1 protein_id gnl|my_center|LOCUS_38860 107823 106720 gene locus_tag LOCUS_38870 107823 106720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 108391 107858 gene locus_tag LOCUS_38880 108391 107858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 109505 108507 gene locus_tag LOCUS_38890 109505 108507 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728382.1 protein_id gnl|my_center|LOCUS_38890 109587 110927 gene locus_tag LOCUS_38900 109587 110927 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229620.1 protein_id gnl|my_center|LOCUS_38900 110936 113947 gene locus_tag LOCUS_38910 110936 113947 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228786.1 protein_id gnl|my_center|LOCUS_38910 113944 115428 gene locus_tag LOCUS_38920 113944 115428 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031393.1 protein_id gnl|my_center|LOCUS_38920 115442 116635 gene locus_tag LOCUS_38930 115442 116635 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728381.1 protein_id gnl|my_center|LOCUS_38930 116668 117894 gene locus_tag LOCUS_38940 116668 117894 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893854.1 protein_id gnl|my_center|LOCUS_38940 117891 119093 gene locus_tag LOCUS_38950 117891 119093 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728380.1 protein_id gnl|my_center|LOCUS_38950 119254 119859 gene locus_tag LOCUS_38960 119254 119859 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921301.1 protein_id gnl|my_center|LOCUS_38960 121362 119980 gene locus_tag LOCUS_38970 121362 119980 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091851.1 protein_id gnl|my_center|LOCUS_38970 122298 121570 gene locus_tag LOCUS_38980 122298 121570 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728378.1 protein_id gnl|my_center|LOCUS_38980 122417 123859 gene locus_tag LOCUS_38990 122417 123859 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087162.1 protein_id gnl|my_center|LOCUS_38990 123897 124712 gene locus_tag LOCUS_39000 123897 124712 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227632.1 protein_id gnl|my_center|LOCUS_39000 125621 124722 gene locus_tag LOCUS_39010 125621 124722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223235.1 protein_id gnl|my_center|LOCUS_39010 125713 127101 gene locus_tag LOCUS_39020 gene gabP 125713 127101 CDS product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105441.1 protein_id gnl|my_center|LOCUS_39020 127094 128743 gene locus_tag LOCUS_39030 127094 128743 CDS product dihydroxyacetone kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112898.1 protein_id gnl|my_center|LOCUS_39030 128740 129414 gene locus_tag LOCUS_39040 128740 129414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 129411 130091 gene locus_tag LOCUS_39050 129411 130091 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224186.1 protein_id gnl|my_center|LOCUS_39050 130895 130095 gene locus_tag LOCUS_39060 130895 130095 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027763.1 protein_id gnl|my_center|LOCUS_39060 131150 131007 gene locus_tag LOCUS_39070 131150 131007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 131438 131286 gene locus_tag LOCUS_39080 131438 131286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 131555 131908 gene locus_tag LOCUS_39090 131555 131908 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729125.1 protein_id gnl|my_center|LOCUS_39090 132568 131912 gene locus_tag LOCUS_39100 132568 131912 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730700.1 protein_id gnl|my_center|LOCUS_39100 132705 134225 gene locus_tag LOCUS_39110 132705 134225 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029543.1 protein_id gnl|my_center|LOCUS_39110 135103 134324 gene locus_tag LOCUS_39120 135103 134324 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770966.1 protein_id gnl|my_center|LOCUS_39120 135786 135100 gene locus_tag LOCUS_39130 135786 135100 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229414.1 protein_id gnl|my_center|LOCUS_39130 135919 136275 gene locus_tag LOCUS_39140 135919 136275 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228135.1 protein_id gnl|my_center|LOCUS_39140 138852 136288 gene locus_tag LOCUS_39150 gene clpB 138852 136288 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085713.1 protein_id gnl|my_center|LOCUS_39150 139633 139028 gene locus_tag LOCUS_39160 139633 139028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39160 140147 140971 gene locus_tag LOCUS_39170 140147 140971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 142470 140989 gene locus_tag LOCUS_39180 142470 140989 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224038.1 protein_id gnl|my_center|LOCUS_39180 143175 142522 gene locus_tag LOCUS_39190 143175 142522 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029611.1 protein_id gnl|my_center|LOCUS_39190 143637 143188 gene locus_tag LOCUS_39200 143637 143188 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229703.1 protein_id gnl|my_center|LOCUS_39200 144053 143634 gene locus_tag LOCUS_39210 144053 143634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 144154 144867 gene locus_tag LOCUS_39220 144154 144867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115937.1 protein_id gnl|my_center|LOCUS_39220 145583 144942 gene locus_tag LOCUS_39230 145583 144942 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031843.1 protein_id gnl|my_center|LOCUS_39230 145750 146166 gene locus_tag LOCUS_39240 145750 146166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 146282 147055 gene locus_tag LOCUS_39250 146282 147055 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143646.1 protein_id gnl|my_center|LOCUS_39250 149284 147059 gene locus_tag LOCUS_39260 149284 147059 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728432.1 protein_id gnl|my_center|LOCUS_39260 150776 149361 gene locus_tag LOCUS_39270 150776 149361 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081235.1 protein_id gnl|my_center|LOCUS_39270 152057 150846 gene locus_tag LOCUS_39280 152057 150846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 152145 153314 gene locus_tag LOCUS_39290 152145 153314 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876850.1 protein_id gnl|my_center|LOCUS_39290 154418 153324 gene locus_tag LOCUS_39300 154418 153324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 154546 155190 gene locus_tag LOCUS_39310 154546 155190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 156681 155212 gene locus_tag LOCUS_39320 156681 155212 CDS product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892122.1 protein_id gnl|my_center|LOCUS_39320 158654 156678 gene locus_tag LOCUS_39330 gene iniA 158654 156678 CDS product isoniazid-induced dynamin-like GTPase IniA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876844.1 protein_id gnl|my_center|LOCUS_39330 163209 158863 gene locus_tag LOCUS_39340 163209 158863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 163541 165292 gene locus_tag LOCUS_39350 163541 165292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 165482 167056 gene locus_tag LOCUS_39360 165482 167056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 167070 169595 gene locus_tag LOCUS_39370 gene iniR 167070 169595 CDS product isoniazid response ATPase/transcriptional regulator IniR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727123.1 protein_id gnl|my_center|LOCUS_39370 169733 170071 gene locus_tag LOCUS_39380 169733 170071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 170107 170961 gene locus_tag LOCUS_39390 170107 170961 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978337.1 protein_id gnl|my_center|LOCUS_39390 171376 170969 gene locus_tag LOCUS_39400 171376 170969 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085703.1 protein_id gnl|my_center|LOCUS_39400 172572 171376 gene locus_tag LOCUS_39410 gene dnaJ 172572 171376 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401821.1 protein_id gnl|my_center|LOCUS_39410 173337 172723 gene locus_tag LOCUS_39420 gene grpE 173337 172723 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086446.1 protein_id gnl|my_center|LOCUS_39420 175187 173334 gene locus_tag LOCUS_39430 gene dnaK 175187 173334 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892134.1 protein_id gnl|my_center|LOCUS_39430 175431 176438 gene locus_tag LOCUS_39440 175431 176438 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730358.1 protein_id gnl|my_center|LOCUS_39440 176673 177932 gene locus_tag LOCUS_39450 176673 177932 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227809.1 protein_id gnl|my_center|LOCUS_39450 178059 181340 gene locus_tag LOCUS_39460 178059 181340 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112277.1 protein_id gnl|my_center|LOCUS_39460 181826 183139 gene locus_tag LOCUS_39470 181826 183139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 183219 184472 gene locus_tag LOCUS_39480 183219 184472 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401733.1 protein_id gnl|my_center|LOCUS_39480 185230 186558 gene locus_tag LOCUS_39490 185230 186558 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229159.1 protein_id gnl|my_center|LOCUS_39490 186951 186586 gene locus_tag LOCUS_39500 186951 186586 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_39500 188060 186948 gene locus_tag LOCUS_39510 188060 186948 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113397.1 protein_id gnl|my_center|LOCUS_39510 190519 188057 gene locus_tag LOCUS_39520 190519 188057 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550889.1 protein_id gnl|my_center|LOCUS_39520 191490 190516 gene locus_tag LOCUS_39530 191490 190516 CDS product DUF1839 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196302.1 protein_id gnl|my_center|LOCUS_39530 191726 191487 gene locus_tag LOCUS_39540 191726 191487 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003504852.1 protein_id gnl|my_center|LOCUS_39540 192054 193235 gene locus_tag LOCUS_39550 192054 193235 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972410.1 protein_id gnl|my_center|LOCUS_39550 193241 194233 gene locus_tag LOCUS_39560 193241 194233 CDS product amino acid--[acyl-carrier-protein] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189723.1 protein_id gnl|my_center|LOCUS_39560 194265 195551 gene locus_tag LOCUS_39570 194265 195551 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257578.1 protein_id gnl|my_center|LOCUS_39570 195548 198895 gene locus_tag LOCUS_39580 195548 198895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 198892 200082 gene locus_tag LOCUS_39590 198892 200082 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973141.1 protein_id gnl|my_center|LOCUS_39590 200079 201467 gene locus_tag LOCUS_39600 200079 201467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 201521 202630 gene locus_tag LOCUS_39610 201521 202630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 204684 202819 gene locus_tag LOCUS_39620 204684 202819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 204895 205977 gene locus_tag LOCUS_39630 204895 205977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 206038 207807 gene locus_tag LOCUS_39640 206038 207807 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112148.1 protein_id gnl|my_center|LOCUS_39640 207819 208724 gene locus_tag LOCUS_39650 207819 208724 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729253.1 protein_id gnl|my_center|LOCUS_39650 208763 209863 gene locus_tag LOCUS_39660 208763 209863 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729254.1 protein_id gnl|my_center|LOCUS_39660 211448 209847 gene locus_tag LOCUS_39670 211448 209847 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811563.1 protein_id gnl|my_center|LOCUS_39670 211529 212101 gene locus_tag LOCUS_39680 211529 212101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 212566 212129 gene locus_tag LOCUS_39690 212566 212129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 212561 212770 gene locus_tag LOCUS_39700 212561 212770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 >Feature sequence48 <1 2674 gene locus_tag LOCUS_39710 <1 2674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012296639.1:translation initiation factor IF-2 note possible pseudo, internal stop codon, frameshifted 2874 3410 gene locus_tag LOCUS_39720 gene rbfA 2874 3410 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076703.1 protein_id gnl|my_center|LOCUS_39720 3479 4462 gene locus_tag LOCUS_39730 3479 4462 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728486.1 protein_id gnl|my_center|LOCUS_39730 4459 5811 gene locus_tag LOCUS_39740 4459 5811 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414506.1 protein_id gnl|my_center|LOCUS_39740 5871 6866 gene locus_tag LOCUS_39750 5871 6866 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057109.1 protein_id gnl|my_center|LOCUS_39750 6863 7531 gene locus_tag LOCUS_39760 6863 7531 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728500.1 protein_id gnl|my_center|LOCUS_39760 7539 8468 gene locus_tag LOCUS_39770 gene truB 7539 8468 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014799.1 protein_id gnl|my_center|LOCUS_39770 9252 8494 gene locus_tag LOCUS_39780 gene mntR 9252 8494 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728504.1 protein_id gnl|my_center|LOCUS_39780 9280 10371 gene locus_tag LOCUS_39790 9280 10371 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728505.1 protein_id gnl|my_center|LOCUS_39790 10504 10773 gene locus_tag LOCUS_39800 gene rpsO 10504 10773 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057119.1 protein_id gnl|my_center|LOCUS_39800 11194 13476 gene locus_tag LOCUS_39810 11194 13476 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728507.1 protein_id gnl|my_center|LOCUS_39810 13728 14804 gene locus_tag LOCUS_39820 13728 14804 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510573.1 protein_id gnl|my_center|LOCUS_39820 16301 14805 gene locus_tag LOCUS_39830 16301 14805 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226438.1 protein_id gnl|my_center|LOCUS_39830 16479 18317 gene locus_tag LOCUS_39840 16479 18317 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932716.1 protein_id gnl|my_center|LOCUS_39840 19432 18320 gene locus_tag LOCUS_39850 gene ald 19432 18320 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894041.1 protein_id gnl|my_center|LOCUS_39850 19582 20076 gene locus_tag LOCUS_39860 19582 20076 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899476.1 protein_id gnl|my_center|LOCUS_39860 21332 20109 gene locus_tag LOCUS_39870 21332 20109 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165781113.1 protein_id gnl|my_center|LOCUS_39870 21747 21343 gene locus_tag LOCUS_39880 21747 21343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 21834 22691 gene locus_tag LOCUS_39890 21834 22691 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775990.1 protein_id gnl|my_center|LOCUS_39890 22857 25334 gene locus_tag LOCUS_39900 22857 25334 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229304.1 protein_id gnl|my_center|LOCUS_39900 25331 26563 gene locus_tag LOCUS_39910 gene solA 25331 26563 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_39910 26560 27708 gene locus_tag LOCUS_39920 26560 27708 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229312.1 protein_id gnl|my_center|LOCUS_39920 27719 29203 gene locus_tag LOCUS_39930 27719 29203 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029892.1 protein_id gnl|my_center|LOCUS_39930 29307 30857 gene locus_tag LOCUS_39940 29307 30857 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229315.1 protein_id gnl|my_center|LOCUS_39940 30862 32469 gene locus_tag LOCUS_39950 30862 32469 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776259.1 protein_id gnl|my_center|LOCUS_39950 32494 33252 gene locus_tag LOCUS_39960 gene dapB 32494 33252 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728512.1 protein_id gnl|my_center|LOCUS_39960 33262 33765 gene locus_tag LOCUS_39970 33262 33765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728513.1 protein_id gnl|my_center|LOCUS_39970 33762 34217 gene locus_tag LOCUS_39980 33762 34217 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414091.1 protein_id gnl|my_center|LOCUS_39980 34263 35060 gene locus_tag LOCUS_39990 34263 35060 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728518.1 protein_id gnl|my_center|LOCUS_39990 35057 35575 gene locus_tag LOCUS_40000 35057 35575 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728519.1 protein_id gnl|my_center|LOCUS_40000 35572 36798 gene locus_tag LOCUS_40010 35572 36798 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228093.1 protein_id gnl|my_center|LOCUS_40010 36895 37647 gene locus_tag LOCUS_40020 gene thyX 36895 37647 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057143.1 protein_id gnl|my_center|LOCUS_40020 37710 38615 gene locus_tag LOCUS_40030 gene dapA 37710 38615 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900564.1 protein_id gnl|my_center|LOCUS_40030 38612 40681 gene locus_tag LOCUS_40040 38612 40681 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167454980.1 protein_id gnl|my_center|LOCUS_40040 40968 41426 gene locus_tag LOCUS_40050 40968 41426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 41429 42238 gene locus_tag LOCUS_40060 41429 42238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 42235 42834 gene locus_tag LOCUS_40070 42235 42834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 43266 43961 gene locus_tag LOCUS_40080 43266 43961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 44114 44734 gene locus_tag LOCUS_40090 44114 44734 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727132.1 protein_id gnl|my_center|LOCUS_40090 45232 44846 gene locus_tag LOCUS_40100 45232 44846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 45225 47828 gene locus_tag LOCUS_40110 45225 47828 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877465.1 protein_id gnl|my_center|LOCUS_40110 48069 49073 gene locus_tag LOCUS_40120 48069 49073 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014789.1 protein_id gnl|my_center|LOCUS_40120 49456 49172 gene locus_tag LOCUS_40130 49456 49172 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803874.1 protein_id gnl|my_center|LOCUS_40130 50037 49492 gene locus_tag LOCUS_40140 50037 49492 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057157.1 protein_id gnl|my_center|LOCUS_40140 50231 50854 gene locus_tag LOCUS_40150 gene pgsA 50231 50854 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228068.1 protein_id gnl|my_center|LOCUS_40150 51026 51358 gene locus_tag LOCUS_40160 51026 51358 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894079.1 protein_id gnl|my_center|LOCUS_40160 51495 52298 gene locus_tag LOCUS_40170 gene pspA 51495 52298 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057162.1 protein_id gnl|my_center|LOCUS_40170 52470 52652 gene locus_tag LOCUS_40180 52470 52652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 52695 53903 gene locus_tag LOCUS_40190 52695 53903 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728535.1 protein_id gnl|my_center|LOCUS_40190 53915 54109 gene locus_tag LOCUS_40200 53915 54109 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728536.1 protein_id gnl|my_center|LOCUS_40200 54432 55472 gene locus_tag LOCUS_40210 gene recA 54432 55472 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894107.1 protein_id gnl|my_center|LOCUS_40210 55441 56094 gene locus_tag LOCUS_40220 gene recX 55441 56094 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005116815.1 protein_id gnl|my_center|LOCUS_40220 56991 56125 gene locus_tag LOCUS_40230 56991 56125 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090302.1 protein_id gnl|my_center|LOCUS_40230 57671 56988 gene locus_tag LOCUS_40240 57671 56988 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057178.1 protein_id gnl|my_center|LOCUS_40240 58654 57668 gene locus_tag LOCUS_40250 58654 57668 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111551.1 protein_id gnl|my_center|LOCUS_40250 59502 58720 gene locus_tag LOCUS_40260 gene gluA 59502 58720 CDS product glutamate ABC transporter ATP-binding protein GluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081846.1 protein_id gnl|my_center|LOCUS_40260 59645 61201 gene locus_tag LOCUS_40270 gene miaB 59645 61201 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728547.1 protein_id gnl|my_center|LOCUS_40270 61198 61848 gene locus_tag LOCUS_40280 61198 61848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081855.1 protein_id gnl|my_center|LOCUS_40280 63460 61868 gene locus_tag LOCUS_40290 63460 61868 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296629.1 protein_id gnl|my_center|LOCUS_40290 63488 64342 gene locus_tag LOCUS_40300 63488 64342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728550.1 protein_id gnl|my_center|LOCUS_40300 64393 65325 gene locus_tag LOCUS_40310 gene miaA 64393 65325 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894118.1 protein_id gnl|my_center|LOCUS_40310 65335 66255 gene locus_tag LOCUS_40320 gene dapF 65335 66255 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728551.1 protein_id gnl|my_center|LOCUS_40320 66348 67901 gene locus_tag LOCUS_40330 gene hflX 66348 67901 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894120.1 protein_id gnl|my_center|LOCUS_40330 68312 68052 gene locus_tag LOCUS_40340 68312 68052 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726655.1 protein_id gnl|my_center|LOCUS_40340 70484 68349 gene locus_tag LOCUS_40350 70484 68349 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726656.1 protein_id gnl|my_center|LOCUS_40350 71561 70587 gene locus_tag LOCUS_40360 71561 70587 CDS product hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891418.1 protein_id gnl|my_center|LOCUS_40360 72325 71558 gene locus_tag LOCUS_40370 72325 71558 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891419.1 protein_id gnl|my_center|LOCUS_40370 72521 74260 gene locus_tag LOCUS_40380 72521 74260 CDS product phosphoenolpyruvate-utilizing N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104530.1 protein_id gnl|my_center|LOCUS_40380 75146 74283 gene locus_tag LOCUS_40390 75146 74283 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206792.1 protein_id gnl|my_center|LOCUS_40390 75911 75231 gene locus_tag LOCUS_40400 gene lexA 75911 75231 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894124.1 protein_id gnl|my_center|LOCUS_40400 76114 76605 gene locus_tag LOCUS_40410 76114 76605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 76729 77229 gene locus_tag LOCUS_40420 gene nrdR 76729 77229 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413973.1 protein_id gnl|my_center|LOCUS_40420 81210 77167 gene locus_tag LOCUS_40430 gene hrpA 81210 77167 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 protein_id gnl|my_center|LOCUS_40430 81329 82564 gene locus_tag LOCUS_40440 81329 82564 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229595.1 protein_id gnl|my_center|LOCUS_40440 83027 82596 gene locus_tag LOCUS_40450 83027 82596 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095485158.1 protein_id gnl|my_center|LOCUS_40450 83671 83042 gene locus_tag LOCUS_40460 83671 83042 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193598.1 protein_id gnl|my_center|LOCUS_40460 86149 83768 gene locus_tag LOCUS_40470 86149 83768 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222778.1 protein_id gnl|my_center|LOCUS_40470 87309 86296 gene locus_tag LOCUS_40480 87309 86296 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057202.1 protein_id gnl|my_center|LOCUS_40480 87375 87602 gene locus_tag LOCUS_40490 87375 87602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 87578 88666 gene locus_tag LOCUS_40500 87578 88666 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729747.1 protein_id gnl|my_center|LOCUS_40500 88663 89289 gene locus_tag LOCUS_40510 88663 89289 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013561.1 protein_id gnl|my_center|LOCUS_40510 89398 90108 gene locus_tag LOCUS_40520 89398 90108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 90197 91249 gene locus_tag LOCUS_40530 90197 91249 CDS product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111537.1 protein_id gnl|my_center|LOCUS_40530 92253 91267 gene locus_tag LOCUS_40540 gene galE 92253 91267 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014754.1 protein_id gnl|my_center|LOCUS_40540 92959 92270 gene locus_tag LOCUS_40550 gene ideR 92959 92270 CDS product iron-dependent transcriptional regulator IdeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413962.1 protein_id gnl|my_center|LOCUS_40550 93075 94358 gene locus_tag LOCUS_40560 93075 94358 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224291.1 protein_id gnl|my_center|LOCUS_40560 94351 97077 gene locus_tag LOCUS_40570 94351 97077 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_40570 98074 97082 gene locus_tag LOCUS_40580 98074 97082 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057210.1 protein_id gnl|my_center|LOCUS_40580 99728 98226 gene locus_tag LOCUS_40590 99728 98226 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742165.1 protein_id gnl|my_center|LOCUS_40590 100113 99772 gene locus_tag LOCUS_40600 100113 99772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 100204 100446 gene locus_tag LOCUS_40610 100204 100446 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284335.1 protein_id gnl|my_center|LOCUS_40610 101466 100447 gene locus_tag LOCUS_40620 101466 100447 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081895.1 protein_id gnl|my_center|LOCUS_40620 101810 103504 gene locus_tag LOCUS_40630 101810 103504 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089243049.1 protein_id gnl|my_center|LOCUS_40630 103811 103605 gene locus_tag LOCUS_40640 103811 103605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894140.1 protein_id gnl|my_center|LOCUS_40640 103971 105329 gene locus_tag LOCUS_40650 103971 105329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 106035 105394 gene locus_tag LOCUS_40660 106035 105394 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973620.1 protein_id gnl|my_center|LOCUS_40660 107252 106032 gene locus_tag LOCUS_40670 107252 106032 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804225.1 protein_id gnl|my_center|LOCUS_40670 107386 107937 gene locus_tag LOCUS_40680 107386 107937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100682.1 protein_id gnl|my_center|LOCUS_40680 109380 108004 gene locus_tag LOCUS_40690 109380 108004 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728563.1 protein_id gnl|my_center|LOCUS_40690 110359 109541 gene locus_tag LOCUS_40700 110359 109541 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081930.1 protein_id gnl|my_center|LOCUS_40700 110596 111444 gene locus_tag LOCUS_40710 110596 111444 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093703.1 protein_id gnl|my_center|LOCUS_40710 112149 111463 gene locus_tag LOCUS_40720 gene cei 112149 111463 CDS product envelope integrity protein Cei inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894145.1 protein_id gnl|my_center|LOCUS_40720 112524 112823 gene locus_tag LOCUS_40730 112524 112823 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057245.1 protein_id gnl|my_center|LOCUS_40730 113424 112942 gene locus_tag LOCUS_40740 113424 112942 CDS product DUF3093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413931.1 protein_id gnl|my_center|LOCUS_40740 113480 113965 gene locus_tag LOCUS_40750 gene dut 113480 113965 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413930.1 protein_id gnl|my_center|LOCUS_40750 113971 114852 gene locus_tag LOCUS_40760 113971 114852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 115612 114881 gene locus_tag LOCUS_40770 115612 114881 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090213.1 protein_id gnl|my_center|LOCUS_40770 115716 116090 gene locus_tag LOCUS_40780 115716 116090 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057265.1 protein_id gnl|my_center|LOCUS_40780 116080 116820 gene locus_tag LOCUS_40790 116080 116820 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224482.1 protein_id gnl|my_center|LOCUS_40790 117469 116810 gene locus_tag LOCUS_40800 117469 116810 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894154.1 protein_id gnl|my_center|LOCUS_40800 118178 117516 gene locus_tag LOCUS_40810 118178 117516 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005102352.1 protein_id gnl|my_center|LOCUS_40810 118268 120337 gene locus_tag LOCUS_40820 118268 120337 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093687.1 protein_id gnl|my_center|LOCUS_40820 120418 121692 gene locus_tag LOCUS_40830 120418 121692 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900550.1 protein_id gnl|my_center|LOCUS_40830 121724 123679 gene locus_tag LOCUS_40840 gene dxs 121724 123679 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081956.1 protein_id gnl|my_center|LOCUS_40840 125021 123696 gene locus_tag LOCUS_40850 125021 123696 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111512.1 protein_id gnl|my_center|LOCUS_40850 125569 125033 gene locus_tag LOCUS_40860 125569 125033 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413879.1 protein_id gnl|my_center|LOCUS_40860 125760 126818 gene locus_tag LOCUS_40870 gene hemE 125760 126818 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224512.1 protein_id gnl|my_center|LOCUS_40870 126815 128275 gene locus_tag LOCUS_40880 126815 128275 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728580.1 protein_id gnl|my_center|LOCUS_40880 128272 128967 gene locus_tag LOCUS_40890 128272 128967 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894166.1 protein_id gnl|my_center|LOCUS_40890 129435 128998 gene locus_tag LOCUS_40900 gene msrB 129435 128998 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296621.1 protein_id gnl|my_center|LOCUS_40900 130643 129432 gene locus_tag LOCUS_40910 gene aftC 130643 129432 CDS product arabinofuranan 3-O-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728581.1 protein_id gnl|my_center|LOCUS_40910 132340 130730 gene locus_tag LOCUS_40920 132340 130730 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296620.1 protein_id gnl|my_center|LOCUS_40920 133104 132355 gene locus_tag LOCUS_40930 133104 132355 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728583.1 protein_id gnl|my_center|LOCUS_40930 133139 134152 gene locus_tag LOCUS_40940 gene zapE 133139 134152 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069211.1 protein_id gnl|my_center|LOCUS_40940 134723 134163 gene locus_tag LOCUS_40950 134723 134163 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894176.1 protein_id gnl|my_center|LOCUS_40950 134849 135313 gene locus_tag LOCUS_40960 134849 135313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 135753 135457 gene locus_tag LOCUS_40970 135753 135457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225627.1 protein_id gnl|my_center|LOCUS_40970 137061 137579 gene locus_tag LOCUS_40980 137061 137579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 137732 137586 gene locus_tag LOCUS_40990 137732 137586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 138376 138128 gene locus_tag LOCUS_41000 138376 138128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 139449 138373 gene locus_tag LOCUS_41010 139449 138373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 139700 139446 gene locus_tag LOCUS_41020 139700 139446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 141171 140014 gene locus_tag LOCUS_41030 141171 140014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 142229 141168 gene locus_tag LOCUS_41040 142229 141168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 142543 142343 gene locus_tag LOCUS_41050 142543 142343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 143039 144268 gene locus_tag LOCUS_41060 143039 144268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 144482 144408 gene locus_tag LOCUS_t00420 144482 144408 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 144580 144507 gene locus_tag LOCUS_t00430 144580 144507 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 144677 144604 gene locus_tag LOCUS_t00440 144677 144604 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 144919 144993 gene locus_tag LOCUS_t00450 144919 144993 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 145110 146000 gene locus_tag LOCUS_41070 145110 146000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 146083 147318 gene locus_tag LOCUS_41080 146083 147318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 147786 147959 gene locus_tag LOCUS_41090 147786 147959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 148000 148272 gene locus_tag LOCUS_41100 148000 148272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 148335 149822 gene locus_tag LOCUS_41110 148335 149822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 149819 150229 gene locus_tag LOCUS_41120 149819 150229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 150785 150231 gene locus_tag LOCUS_41130 150785 150231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 151626 150934 gene locus_tag LOCUS_41140 151626 150934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 151910 151650 gene locus_tag LOCUS_41150 151910 151650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 152618 152139 gene locus_tag LOCUS_41160 152618 152139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 153091 152615 gene locus_tag LOCUS_41170 153091 152615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 155941 153374 gene locus_tag LOCUS_41180 155941 153374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 156236 156033 gene locus_tag LOCUS_41190 156236 156033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 156627 156397 gene locus_tag LOCUS_41200 156627 156397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 158083 156833 gene locus_tag LOCUS_41210 158083 156833 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899420.1 protein_id gnl|my_center|LOCUS_41210 158303 158785 gene locus_tag LOCUS_41220 158303 158785 CDS product TIGR02611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728698.1 protein_id gnl|my_center|LOCUS_41220 158882 160954 gene locus_tag LOCUS_41230 gene thrS 158882 160954 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082399.1 protein_id gnl|my_center|LOCUS_41230 160951 161508 gene locus_tag LOCUS_41240 160951 161508 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057529.1 protein_id gnl|my_center|LOCUS_41240 161510 162202 gene locus_tag LOCUS_41250 161510 162202 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057532.1 protein_id gnl|my_center|LOCUS_41250 162199 163113 gene locus_tag LOCUS_41260 162199 163113 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728702.1 protein_id gnl|my_center|LOCUS_41260 163142 164254 gene locus_tag LOCUS_41270 163142 164254 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090090.1 protein_id gnl|my_center|LOCUS_41270 164309 164812 gene locus_tag LOCUS_41280 164309 164812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 164993 165910 gene locus_tag LOCUS_41290 gene pdxS 164993 165910 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070939476.1 protein_id gnl|my_center|LOCUS_41290 165975 166775 gene locus_tag LOCUS_41300 165975 166775 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776167.1 protein_id gnl|my_center|LOCUS_41300 166775 167623 gene locus_tag LOCUS_41310 166775 167623 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068926.1 protein_id gnl|my_center|LOCUS_41310 167620 168237 gene locus_tag LOCUS_41320 gene pdxT 167620 168237 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227127.1 protein_id gnl|my_center|LOCUS_41320 168341 169096 gene locus_tag LOCUS_41330 168341 169096 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894318.1 protein_id gnl|my_center|LOCUS_41330 169712 169098 gene locus_tag LOCUS_41340 169712 169098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 169811 170407 gene locus_tag LOCUS_41350 gene ruvC 169811 170407 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413426.1 protein_id gnl|my_center|LOCUS_41350 170404 171006 gene locus_tag LOCUS_41360 gene ruvA 170404 171006 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728708.1 protein_id gnl|my_center|LOCUS_41360 171003 172115 gene locus_tag LOCUS_41370 gene ruvB 171003 172115 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413416.1 protein_id gnl|my_center|LOCUS_41370 172333 172719 gene locus_tag LOCUS_41380 172333 172719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 172814 174394 gene locus_tag LOCUS_41390 172814 174394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 174394 175551 gene locus_tag LOCUS_41400 174394 175551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 175548 176096 gene locus_tag LOCUS_41410 175548 176096 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082386.1 protein_id gnl|my_center|LOCUS_41410 176167 178527 gene locus_tag LOCUS_41420 176167 178527 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068903.1 protein_id gnl|my_center|LOCUS_41420 179643 178579 gene locus_tag LOCUS_41430 179643 178579 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728734.1 protein_id gnl|my_center|LOCUS_41430 179873 180595 gene locus_tag LOCUS_41440 179873 180595 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068898.1 protein_id gnl|my_center|LOCUS_41440 180592 181857 gene locus_tag LOCUS_41450 gene hisS 180592 181857 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413365.1 protein_id gnl|my_center|LOCUS_41450 183532 181865 gene locus_tag LOCUS_41460 183532 181865 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728748.1 protein_id gnl|my_center|LOCUS_41460 184671 183796 gene locus_tag LOCUS_41470 184671 183796 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728749.1 protein_id gnl|my_center|LOCUS_41470 184791 186593 gene locus_tag LOCUS_41480 gene aspS 184791 186593 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082377.1 protein_id gnl|my_center|LOCUS_41480 186608 187543 gene locus_tag LOCUS_41490 186608 187543 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082376.1 protein_id gnl|my_center|LOCUS_41490 187608 191168 gene locus_tag LOCUS_41500 187608 191168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 191222 193882 gene locus_tag LOCUS_41510 191222 193882 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413330.1 protein_id gnl|my_center|LOCUS_41510 193879 194841 gene locus_tag LOCUS_41520 193879 194841 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728762.1 protein_id gnl|my_center|LOCUS_41520 194920 196053 gene locus_tag LOCUS_41530 194920 196053 CDS product kae1-associated kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093587.1 protein_id gnl|my_center|LOCUS_41530 196079 197503 gene locus_tag LOCUS_41540 196079 197503 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894402.1 protein_id gnl|my_center|LOCUS_41540 197599 200277 gene locus_tag LOCUS_41550 gene alaS 197599 200277 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728764.1 protein_id gnl|my_center|LOCUS_41550 200274 200726 gene locus_tag LOCUS_41560 200274 200726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 >Feature sequence49 667 233 gene locus_tag LOCUS_41570 667 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 2176 737 gene locus_tag LOCUS_41580 2176 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 3909 2173 gene locus_tag LOCUS_41590 3909 2173 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225878.1 protein_id gnl|my_center|LOCUS_41590 4039 4608 gene locus_tag LOCUS_41600 4039 4608 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095569.1 protein_id gnl|my_center|LOCUS_41600 4706 5065 gene locus_tag LOCUS_41610 4706 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 5180 5716 gene locus_tag LOCUS_41620 gene idi 5180 5716 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804097.1 protein_id gnl|my_center|LOCUS_41620 5819 6022 gene locus_tag LOCUS_41630 5819 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 6171 6662 gene locus_tag LOCUS_41640 6171 6662 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079914.1 protein_id gnl|my_center|LOCUS_41640 6717 7913 gene locus_tag LOCUS_41650 6717 7913 CDS product flavin-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338972.1 protein_id gnl|my_center|LOCUS_41650 7943 8377 gene locus_tag LOCUS_41660 7943 8377 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111466.1 protein_id gnl|my_center|LOCUS_41660 9045 8398 gene locus_tag LOCUS_41670 9045 8398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 9858 9103 gene locus_tag LOCUS_41680 9858 9103 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407374.1 protein_id gnl|my_center|LOCUS_41680 10451 9963 gene locus_tag LOCUS_41690 10451 9963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 10869 10492 gene locus_tag LOCUS_41700 10869 10492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 11474 11857 gene locus_tag LOCUS_41710 11474 11857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41710 12159 11833 gene locus_tag LOCUS_41720 12159 11833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 12935 12153 gene locus_tag LOCUS_41730 12935 12153 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027419.1 protein_id gnl|my_center|LOCUS_41730 13074 13436 gene locus_tag LOCUS_41740 13074 13436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41740 13600 13788 gene locus_tag LOCUS_41750 13600 13788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 14347 17874 gene locus_tag LOCUS_41760 14347 17874 CDS product thioester reductase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728718.1 protein_id gnl|my_center|LOCUS_41760 18938 17949 gene locus_tag LOCUS_41770 18938 17949 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228291.1 protein_id gnl|my_center|LOCUS_41770 19102 19941 gene locus_tag LOCUS_41780 19102 19941 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 protein_id gnl|my_center|LOCUS_41780 19928 20974 gene locus_tag LOCUS_41790 19928 20974 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256418.1 protein_id gnl|my_center|LOCUS_41790 21411 20914 gene locus_tag LOCUS_41800 21411 20914 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728364.1 protein_id gnl|my_center|LOCUS_41800 21669 23078 gene locus_tag LOCUS_41810 21669 23078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41810 23103 24005 gene locus_tag LOCUS_41820 23103 24005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41820 24036 25085 gene locus_tag LOCUS_41830 24036 25085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 25215 25847 gene locus_tag LOCUS_41840 25215 25847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 26036 26317 gene locus_tag LOCUS_41850 26036 26317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 26669 26358 gene locus_tag LOCUS_41860 26669 26358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 26986 27255 gene locus_tag LOCUS_41870 26986 27255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 27296 27496 gene locus_tag LOCUS_41880 27296 27496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 27654 27526 gene locus_tag LOCUS_41890 27654 27526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 28286 27807 gene locus_tag LOCUS_41900 28286 27807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 28602 29780 gene locus_tag LOCUS_41910 28602 29780 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731403.1 protein_id gnl|my_center|LOCUS_41910 30669 29803 gene locus_tag LOCUS_41920 30669 29803 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978631.1 protein_id gnl|my_center|LOCUS_41920 30814 31686 gene locus_tag LOCUS_41930 30814 31686 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978567.1 protein_id gnl|my_center|LOCUS_41930 34633 32096 gene locus_tag LOCUS_41940 34633 32096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 35722 34700 gene locus_tag LOCUS_41950 35722 34700 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742140.1 protein_id gnl|my_center|LOCUS_41950 35799 36449 gene locus_tag LOCUS_41960 35799 36449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 37221 36481 gene locus_tag LOCUS_41970 37221 36481 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227890.1 protein_id gnl|my_center|LOCUS_41970 37575 38402 gene locus_tag LOCUS_41980 37575 38402 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030868.1 protein_id gnl|my_center|LOCUS_41980 38460 39428 gene locus_tag LOCUS_41990 38460 39428 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030868.1 protein_id gnl|my_center|LOCUS_41990 39496 40884 gene locus_tag LOCUS_42000 39496 40884 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086851586.1 protein_id gnl|my_center|LOCUS_42000 41577 40906 gene locus_tag LOCUS_42010 41577 40906 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 protein_id gnl|my_center|LOCUS_42010 42463 41627 gene locus_tag LOCUS_42020 42463 41627 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972097.1 protein_id gnl|my_center|LOCUS_42020 43868 42561 gene locus_tag LOCUS_42030 43868 42561 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225012.1 protein_id gnl|my_center|LOCUS_42030 43994 45256 gene locus_tag LOCUS_42040 43994 45256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 45698 45285 gene locus_tag LOCUS_42050 45698 45285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 46895 45897 gene locus_tag LOCUS_42060 46895 45897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 47304 46876 gene locus_tag LOCUS_42070 47304 46876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 47526 47840 gene locus_tag LOCUS_42080 47526 47840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 47952 48887 gene locus_tag LOCUS_42090 47952 48887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095418.1 protein_id gnl|my_center|LOCUS_42090 48890 49963 gene locus_tag LOCUS_42100 48890 49963 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730993.1 protein_id gnl|my_center|LOCUS_42100 51113 49971 gene locus_tag LOCUS_42110 51113 49971 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112106.1 protein_id gnl|my_center|LOCUS_42110 51708 51235 gene locus_tag LOCUS_42120 gene kdpF 51708 51235 CDS product K(+)-transporting ATPase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089904.1 protein_id gnl|my_center|LOCUS_42120 52168 51752 gene locus_tag LOCUS_42130 52168 51752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 52488 52150 gene locus_tag LOCUS_42140 52488 52150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42140 52541 53320 gene locus_tag LOCUS_42150 52541 53320 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877881.1 protein_id gnl|my_center|LOCUS_42150 54792 53287 gene locus_tag LOCUS_42160 54792 53287 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466576.1 protein_id gnl|my_center|LOCUS_42160 55390 54905 gene locus_tag LOCUS_42170 55390 54905 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728364.1 protein_id gnl|my_center|LOCUS_42170 55522 57846 gene locus_tag LOCUS_42180 55522 57846 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510635.1 protein_id gnl|my_center|LOCUS_42180 58518 57940 gene locus_tag LOCUS_42190 58518 57940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 60076 58613 gene locus_tag LOCUS_42200 60076 58613 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965744.1 protein_id gnl|my_center|LOCUS_42200 60224 60892 gene locus_tag LOCUS_42210 60224 60892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 61566 60850 gene locus_tag LOCUS_42220 61566 60850 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191850760.1 protein_id gnl|my_center|LOCUS_42220 62376 61675 gene locus_tag LOCUS_42230 62376 61675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 63260 62796 gene locus_tag LOCUS_42240 63260 62796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 64768 63257 gene locus_tag LOCUS_42250 64768 63257 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876933.1 protein_id gnl|my_center|LOCUS_42250 64885 65091 gene locus_tag LOCUS_42260 64885 65091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 65550 65125 gene locus_tag LOCUS_42270 gene arr 65550 65125 CDS product NAD(+)--rifampin ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727512.1 protein_id gnl|my_center|LOCUS_42270 65764 66615 gene locus_tag LOCUS_42280 65764 66615 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230733.1 protein_id gnl|my_center|LOCUS_42280 67424 66603 gene locus_tag LOCUS_42290 67424 66603 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106196.1 protein_id gnl|my_center|LOCUS_42290 68604 67432 gene locus_tag LOCUS_42300 68604 67432 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727796.1 protein_id gnl|my_center|LOCUS_42300 69185 68607 gene locus_tag LOCUS_42310 69185 68607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 70302 69349 gene locus_tag LOCUS_42320 70302 69349 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028540.1 protein_id gnl|my_center|LOCUS_42320 72833 70299 gene locus_tag LOCUS_42330 72833 70299 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484949.1 protein_id gnl|my_center|LOCUS_42330 72964 73593 gene locus_tag LOCUS_42340 72964 73593 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030490.1 protein_id gnl|my_center|LOCUS_42340 73770 75254 gene locus_tag LOCUS_42350 73770 75254 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844627.1 protein_id gnl|my_center|LOCUS_42350 75308 76225 gene locus_tag LOCUS_42360 75308 76225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 76229 77212 gene locus_tag LOCUS_42370 76229 77212 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255183.1 protein_id gnl|my_center|LOCUS_42370 78674 77226 gene locus_tag LOCUS_42380 78674 77226 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225330.1 protein_id gnl|my_center|LOCUS_42380 78748 79407 gene locus_tag LOCUS_42390 78748 79407 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228785.1 protein_id gnl|my_center|LOCUS_42390 80440 79397 gene locus_tag LOCUS_42400 80440 79397 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267673.1 protein_id gnl|my_center|LOCUS_42400 81397 80540 gene locus_tag LOCUS_42410 81397 80540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891983.1 protein_id gnl|my_center|LOCUS_42410 81653 81402 gene locus_tag LOCUS_42420 81653 81402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 82404 81697 gene locus_tag LOCUS_42430 82404 81697 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719935.1 protein_id gnl|my_center|LOCUS_42430 82565 82401 gene locus_tag LOCUS_42440 82565 82401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 82897 82727 gene locus_tag LOCUS_42450 82897 82727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 83853 82993 gene locus_tag LOCUS_42460 83853 82993 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228326.1 protein_id gnl|my_center|LOCUS_42460 84335 83850 gene locus_tag LOCUS_42470 84335 83850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 84898 84332 gene locus_tag LOCUS_42480 84898 84332 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092923.1 protein_id gnl|my_center|LOCUS_42480 85107 85346 gene locus_tag LOCUS_42490 85107 85346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 85767 85357 gene locus_tag LOCUS_42500 85767 85357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42500 86520 85798 gene locus_tag LOCUS_42510 86520 85798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42510 86981 86574 gene locus_tag LOCUS_42520 86981 86574 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974528.1 protein_id gnl|my_center|LOCUS_42520 87380 87102 gene locus_tag LOCUS_42530 87380 87102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 87504 88736 gene locus_tag LOCUS_42540 87504 88736 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223726.1 protein_id gnl|my_center|LOCUS_42540 88948 90564 gene locus_tag LOCUS_42550 88948 90564 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906341.1 protein_id gnl|my_center|LOCUS_42550 90638 91432 gene locus_tag LOCUS_42560 90638 91432 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031819.1 protein_id gnl|my_center|LOCUS_42560 91967 91422 gene locus_tag LOCUS_42570 91967 91422 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878038.1 protein_id gnl|my_center|LOCUS_42570 92050 92976 gene locus_tag LOCUS_42580 92050 92976 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895799.1 protein_id gnl|my_center|LOCUS_42580 93284 93928 gene locus_tag LOCUS_42590 93284 93928 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728695.1 protein_id gnl|my_center|LOCUS_42590 93925 95142 gene locus_tag LOCUS_42600 93925 95142 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110021.1 protein_id gnl|my_center|LOCUS_42600 95139 95876 gene locus_tag LOCUS_42610 95139 95876 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975878.1 protein_id gnl|my_center|LOCUS_42610 95873 96880 gene locus_tag LOCUS_42620 95873 96880 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728692.1 protein_id gnl|my_center|LOCUS_42620 98110 96956 gene locus_tag LOCUS_42630 98110 96956 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222909.1 protein_id gnl|my_center|LOCUS_42630 99530 98352 gene locus_tag LOCUS_42640 99530 98352 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027680.1 protein_id gnl|my_center|LOCUS_42640 99718 101049 gene locus_tag LOCUS_42650 99718 101049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 101078 101614 gene locus_tag LOCUS_42660 101078 101614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 102063 101617 gene locus_tag LOCUS_42670 102063 101617 CDS product DUF5313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728533.1 protein_id gnl|my_center|LOCUS_42670 102530 102060 gene locus_tag LOCUS_42680 102530 102060 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727022.1 protein_id gnl|my_center|LOCUS_42680 102932 102657 gene locus_tag LOCUS_42690 102932 102657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 104523 102943 gene locus_tag LOCUS_42700 104523 102943 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032668362.1 protein_id gnl|my_center|LOCUS_42700 105461 104523 gene locus_tag LOCUS_42710 105461 104523 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225257.1 protein_id gnl|my_center|LOCUS_42710 107097 105694 gene locus_tag LOCUS_42720 107097 105694 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731572.1 protein_id gnl|my_center|LOCUS_42720 108283 107186 gene locus_tag LOCUS_42730 108283 107186 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007771538.1 protein_id gnl|my_center|LOCUS_42730 108652 110145 gene locus_tag LOCUS_42740 108652 110145 CDS product bifunctional phosphatase PAP2/diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727081.1 protein_id gnl|my_center|LOCUS_42740 110138 110914 gene locus_tag LOCUS_42750 110138 110914 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030552.1 protein_id gnl|my_center|LOCUS_42750 111868 110939 gene locus_tag LOCUS_42760 111868 110939 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030485.1 protein_id gnl|my_center|LOCUS_42760 113082 111865 gene locus_tag LOCUS_42770 113082 111865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 113349 113095 gene locus_tag LOCUS_42780 113349 113095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 113533 114075 gene locus_tag LOCUS_42790 113533 114075 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223605.1 protein_id gnl|my_center|LOCUS_42790 114149 115756 gene locus_tag LOCUS_42800 114149 115756 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142818.1 protein_id gnl|my_center|LOCUS_42800 116887 115766 gene locus_tag LOCUS_42810 116887 115766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029784.1 protein_id gnl|my_center|LOCUS_42810 117015 117665 gene locus_tag LOCUS_42820 117015 117665 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226843.1 protein_id gnl|my_center|LOCUS_42820 117859 117602 gene locus_tag LOCUS_42830 117859 117602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 117919 118881 gene locus_tag LOCUS_42840 117919 118881 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092179.1 protein_id gnl|my_center|LOCUS_42840 119440 118901 gene locus_tag LOCUS_42850 119440 118901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 119588 120211 gene locus_tag LOCUS_42860 119588 120211 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189739317.1 protein_id gnl|my_center|LOCUS_42860 120217 120909 gene locus_tag LOCUS_42870 120217 120909 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109033475.1 protein_id gnl|my_center|LOCUS_42870 120920 121669 gene locus_tag LOCUS_42880 120920 121669 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973591.1 protein_id gnl|my_center|LOCUS_42880 121852 122148 gene locus_tag LOCUS_42890 121852 122148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 122166 122417 gene locus_tag LOCUS_42900 122166 122417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 122804 122433 gene locus_tag LOCUS_42910 gene crcB 122804 122433 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079419.1 protein_id gnl|my_center|LOCUS_42910 123235 122801 gene locus_tag LOCUS_42920 123235 122801 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296550.1 protein_id gnl|my_center|LOCUS_42920 123708 123277 gene locus_tag LOCUS_42930 123708 123277 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083560.1 protein_id gnl|my_center|LOCUS_42930 125302 123827 gene locus_tag LOCUS_42940 125302 123827 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083610.1 protein_id gnl|my_center|LOCUS_42940 125626 126651 gene locus_tag LOCUS_42950 125626 126651 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139593.1 protein_id gnl|my_center|LOCUS_42950 126648 127949 gene locus_tag LOCUS_42960 126648 127949 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890213.1 protein_id gnl|my_center|LOCUS_42960 128599 127961 gene locus_tag LOCUS_42970 128599 127961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 129647 128625 gene locus_tag LOCUS_42980 129647 128625 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087033.1 protein_id gnl|my_center|LOCUS_42980 130946 129681 gene locus_tag LOCUS_42990 130946 129681 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063166.1 protein_id gnl|my_center|LOCUS_42990 131085 132437 gene locus_tag LOCUS_43000 131085 132437 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977073.1 protein_id gnl|my_center|LOCUS_43000 132847 132467 gene locus_tag LOCUS_43010 132847 132467 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942959.1 protein_id gnl|my_center|LOCUS_43010 133216 132956 gene locus_tag LOCUS_43020 133216 132956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 134018 133290 gene locus_tag LOCUS_43030 134018 133290 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069122.1 protein_id gnl|my_center|LOCUS_43030 134172 135689 gene locus_tag LOCUS_43040 134172 135689 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111479.1 protein_id gnl|my_center|LOCUS_43040 135689 136288 gene locus_tag LOCUS_43050 135689 136288 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897680.1 protein_id gnl|my_center|LOCUS_43050 136285 137907 gene locus_tag LOCUS_43060 136285 137907 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091849.1 protein_id gnl|my_center|LOCUS_43060 138094 139956 gene locus_tag LOCUS_43070 gene leuA 138094 139956 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731169.1 protein_id gnl|my_center|LOCUS_43070 140812 140012 gene locus_tag LOCUS_43080 140812 140012 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743809.1 protein_id gnl|my_center|LOCUS_43080 140915 141241 gene locus_tag LOCUS_43090 140915 141241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 141312 142811 gene locus_tag LOCUS_43100 141312 142811 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079636.1 protein_id gnl|my_center|LOCUS_43100 143757 142867 gene locus_tag LOCUS_43110 143757 142867 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085592.1 protein_id gnl|my_center|LOCUS_43110 143831 144856 gene locus_tag LOCUS_43120 143831 144856 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113950.1 protein_id gnl|my_center|LOCUS_43120 144853 146019 gene locus_tag LOCUS_43130 144853 146019 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169592731.1 protein_id gnl|my_center|LOCUS_43130 146048 146737 gene locus_tag LOCUS_43140 146048 146737 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731174.1 protein_id gnl|my_center|LOCUS_43140 147293 146772 gene locus_tag LOCUS_43150 147293 146772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 147994 147332 gene locus_tag LOCUS_43160 gene recR 147994 147332 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897699.1 protein_id gnl|my_center|LOCUS_43160 148334 147951 gene locus_tag LOCUS_43170 148334 147951 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083655.1 protein_id gnl|my_center|LOCUS_43170 148671 148336 gene locus_tag LOCUS_43180 148671 148336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 149345 148668 gene locus_tag LOCUS_43190 gene aztA 149345 148668 CDS product zinc ABC transporter ATP-binding protein AztA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027147.1 protein_id gnl|my_center|LOCUS_43190 149427 150284 gene locus_tag LOCUS_43200 gene aztB 149427 150284 CDS product zinc ABC transporter permease AztB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978391.1 protein_id gnl|my_center|LOCUS_43200 150281 151450 gene locus_tag LOCUS_43210 150281 151450 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027146.1 protein_id gnl|my_center|LOCUS_43210 151447 152361 gene locus_tag LOCUS_43220 gene aztC 151447 152361 CDS product zinc ABC transporter substrate-binding protein AztC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027145.1 protein_id gnl|my_center|LOCUS_43220 152386 153567 gene locus_tag LOCUS_43230 gene aztD 152386 153567 CDS product zinc metallochaperone AztD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027144.1 protein_id gnl|my_center|LOCUS_43230 154495 153581 gene locus_tag LOCUS_43240 154495 153581 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977201.1 protein_id gnl|my_center|LOCUS_43240 154939 154502 gene locus_tag LOCUS_43250 154939 154502 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083660.1 protein_id gnl|my_center|LOCUS_43250 155510 155007 gene locus_tag LOCUS_43260 155510 155007 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227724.1 protein_id gnl|my_center|LOCUS_43260 155692 157113 gene locus_tag LOCUS_43270 155692 157113 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731176.1 protein_id gnl|my_center|LOCUS_43270 157173 158438 gene locus_tag LOCUS_43280 157173 158438 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083673.1 protein_id gnl|my_center|LOCUS_43280 160811 158640 gene locus_tag LOCUS_43290 160811 158640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 162208 160832 gene locus_tag LOCUS_43300 162208 160832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 163532 162252 gene locus_tag LOCUS_43310 163532 162252 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112957.1 protein_id gnl|my_center|LOCUS_43310 164829 163534 gene locus_tag LOCUS_43320 164829 163534 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_43320 165081 165169 gene locus_tag LOCUS_t00460 165081 165169 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 165609 165205 gene locus_tag LOCUS_43330 165609 165205 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078330934.1 protein_id gnl|my_center|LOCUS_43330 165679 167091 gene locus_tag LOCUS_43340 165679 167091 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042159660.1 protein_id gnl|my_center|LOCUS_43340 167088 168236 gene locus_tag LOCUS_43350 167088 168236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43350 168233 168592 gene locus_tag LOCUS_43360 168233 168592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43360 168636 168902 gene locus_tag LOCUS_43370 168636 168902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 169216 168926 gene locus_tag LOCUS_43380 169216 168926 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090473.1 protein_id gnl|my_center|LOCUS_43380 169757 169458 gene locus_tag LOCUS_43390 169757 169458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 169650 169943 gene locus_tag LOCUS_43400 169650 169943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 170035 170571 gene locus_tag LOCUS_43410 170035 170571 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111272.1 protein_id gnl|my_center|LOCUS_43410 171163 170558 gene locus_tag LOCUS_43420 171163 170558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 171178 172053 gene locus_tag LOCUS_43430 171178 172053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 173354 172104 gene locus_tag LOCUS_43440 173354 172104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 173409 175253 gene locus_tag LOCUS_43450 173409 175253 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230961.1 protein_id gnl|my_center|LOCUS_43450 175250 176695 gene locus_tag LOCUS_43460 175250 176695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 176755 178566 gene locus_tag LOCUS_43470 176755 178566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 178605 178958 gene locus_tag LOCUS_43480 178605 178958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 178962 179531 gene locus_tag LOCUS_43490 178962 179531 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_43490 179673 180185 gene locus_tag LOCUS_43500 179673 180185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 180288 181913 gene locus_tag LOCUS_43510 180288 181913 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079806.1 protein_id gnl|my_center|LOCUS_43510 181918 183966 gene locus_tag LOCUS_43520 181918 183966 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878115.1 protein_id gnl|my_center|LOCUS_43520 183963 185138 gene locus_tag LOCUS_43530 183963 185138 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896109.1 protein_id gnl|my_center|LOCUS_43530 185223 186008 gene locus_tag LOCUS_43540 185223 186008 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079937.1 protein_id gnl|my_center|LOCUS_43540 186173 187201 gene locus_tag LOCUS_43550 186173 187201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 187229 188527 gene locus_tag LOCUS_43560 187229 188527 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728278.1 protein_id gnl|my_center|LOCUS_43560 188617 189213 gene locus_tag LOCUS_43570 188617 189213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 190301 189222 gene locus_tag LOCUS_43580 gene ligD 190301 189222 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 protein_id gnl|my_center|LOCUS_43580 191344 190301 gene locus_tag LOCUS_43590 191344 190301 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104330.1 protein_id gnl|my_center|LOCUS_43590 191695 193206 gene locus_tag LOCUS_43600 191695 193206 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110870.1 protein_id gnl|my_center|LOCUS_43600 >Feature sequence50 <1 1945 gene locus_tag LOCUS_43610 <1 1945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005080127.1:CocE/NonD family hydrolase 2533 2030 gene locus_tag LOCUS_43620 2533 2030 CDS product TIGR04338 family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401120.1 protein_id gnl|my_center|LOCUS_43620 3351 2530 gene locus_tag LOCUS_43630 3351 2530 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726753.1 protein_id gnl|my_center|LOCUS_43630 4180 3458 gene locus_tag LOCUS_43640 gene rplA 4180 3458 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061480.1 protein_id gnl|my_center|LOCUS_43640 4736 4305 gene locus_tag LOCUS_43650 gene rplK 4736 4305 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222525.1 protein_id gnl|my_center|LOCUS_43650 5663 4839 gene locus_tag LOCUS_43660 gene nusG 5663 4839 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727616.1 protein_id gnl|my_center|LOCUS_43660 6218 5766 gene locus_tag LOCUS_43670 gene secE 6218 5766 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061491.1 protein_id gnl|my_center|LOCUS_43670 6382 6308 gene locus_tag LOCUS_t00470 6382 6308 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 7695 6610 gene locus_tag LOCUS_43680 7695 6610 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731510.1 protein_id gnl|my_center|LOCUS_43680 8028 7861 gene locus_tag LOCUS_43690 gene rpmG 8028 7861 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003881823.1 protein_id gnl|my_center|LOCUS_43690 8185 8111 gene locus_tag LOCUS_t00480 8185 8111 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8296 8223 gene locus_tag LOCUS_t00490 8296 8223 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8533 8450 gene locus_tag LOCUS_t00500 8533 8450 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 9760 8825 gene locus_tag LOCUS_43700 9760 8825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148043383.1 protein_id gnl|my_center|LOCUS_43700 9950 10420 gene locus_tag LOCUS_43710 9950 10420 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077736.1 protein_id gnl|my_center|LOCUS_43710 11290 10424 gene locus_tag LOCUS_43720 gene htpX 11290 10424 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094627.1 protein_id gnl|my_center|LOCUS_43720 12391 11375 gene locus_tag LOCUS_43730 12391 11375 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519569.1 protein_id gnl|my_center|LOCUS_43730 12522 13796 gene locus_tag LOCUS_43740 12522 13796 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112101.1 protein_id gnl|my_center|LOCUS_43740 14685 14008 gene locus_tag LOCUS_43750 14685 14008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 16584 15895 gene locus_tag LOCUS_43760 16584 15895 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061581.1 protein_id gnl|my_center|LOCUS_43760 17790 16660 gene locus_tag LOCUS_43770 17790 16660 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080341.1 protein_id gnl|my_center|LOCUS_43770 18370 17888 gene locus_tag LOCUS_43780 18370 17888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061585.1 protein_id gnl|my_center|LOCUS_43780 20071 18428 gene locus_tag LOCUS_43790 gene menD 20071 18428 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080340.1 protein_id gnl|my_center|LOCUS_43790 20845 20207 gene locus_tag LOCUS_43800 20845 20207 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095316.1 protein_id gnl|my_center|LOCUS_43800 21548 20817 gene locus_tag LOCUS_43810 21548 20817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 21717 21526 gene locus_tag LOCUS_43820 21717 21526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 22232 21795 gene locus_tag LOCUS_43830 22232 21795 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893095.1 protein_id gnl|my_center|LOCUS_43830 22311 23471 gene locus_tag LOCUS_43840 22311 23471 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893096.1 protein_id gnl|my_center|LOCUS_43840 23468 24724 gene locus_tag LOCUS_43850 23468 24724 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064064.1 protein_id gnl|my_center|LOCUS_43850 26242 24740 gene locus_tag LOCUS_43860 26242 24740 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049744721.1 protein_id gnl|my_center|LOCUS_43860 27051 26377 gene locus_tag LOCUS_43870 27051 26377 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082403.1 protein_id gnl|my_center|LOCUS_43870 26977 28011 gene locus_tag LOCUS_43880 26977 28011 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860502.1 protein_id gnl|my_center|LOCUS_43880 28030 28221 gene locus_tag LOCUS_43890 28030 28221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 28854 28336 gene locus_tag LOCUS_43900 28854 28336 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013585.1 protein_id gnl|my_center|LOCUS_43900 30412 28883 gene locus_tag LOCUS_43910 30412 28883 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049744721.1 protein_id gnl|my_center|LOCUS_43910 31354 30509 gene locus_tag LOCUS_43920 31354 30509 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227726.1 protein_id gnl|my_center|LOCUS_43920 32337 31351 gene locus_tag LOCUS_43930 32337 31351 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_43930 32409 32927 gene locus_tag LOCUS_43940 32409 32927 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104303.1 protein_id gnl|my_center|LOCUS_43940 34732 32948 gene locus_tag LOCUS_43950 34732 32948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 52626 34729 gene locus_tag LOCUS_43960 52626 34729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 54014 52638 gene locus_tag LOCUS_43970 54014 52638 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 protein_id gnl|my_center|LOCUS_43970 55350 54109 gene locus_tag LOCUS_43980 55350 54109 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929836.1 protein_id gnl|my_center|LOCUS_43980 57669 56749 gene locus_tag LOCUS_43990 57669 56749 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143639.1 protein_id gnl|my_center|LOCUS_43990 59692 59078 gene locus_tag LOCUS_44000 59692 59078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 61244 60369 gene locus_tag LOCUS_44010 61244 60369 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228270.1 protein_id gnl|my_center|LOCUS_44010 61768 61289 gene locus_tag LOCUS_44020 61768 61289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 63096 61990 gene locus_tag LOCUS_44030 63096 61990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 64279 63101 gene locus_tag LOCUS_44040 64279 63101 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803945.1 protein_id gnl|my_center|LOCUS_44040 65104 66075 gene locus_tag LOCUS_44050 65104 66075 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407642.1 protein_id gnl|my_center|LOCUS_44050 67509 66082 gene locus_tag LOCUS_44060 67509 66082 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257984.1 protein_id gnl|my_center|LOCUS_44060 68381 67506 gene locus_tag LOCUS_44070 68381 67506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 69931 68378 gene locus_tag LOCUS_44080 69931 68378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 70776 69928 gene locus_tag LOCUS_44090 70776 69928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 70939 72201 gene locus_tag LOCUS_44100 70939 72201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 72185 73276 gene locus_tag LOCUS_44110 72185 73276 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_44110 73310 74683 gene locus_tag LOCUS_44120 gene wzx 73310 74683 CDS product O157 family O-antigen flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033576.1 protein_id gnl|my_center|LOCUS_44120 74680 75228 gene locus_tag LOCUS_44130 74680 75228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 75271 76431 gene locus_tag LOCUS_44140 75271 76431 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729107.1 protein_id gnl|my_center|LOCUS_44140 76428 77360 gene locus_tag LOCUS_44150 76428 77360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 78570 77368 gene locus_tag LOCUS_44160 78570 77368 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456721.1 protein_id gnl|my_center|LOCUS_44160 79511 78570 gene locus_tag LOCUS_44170 79511 78570 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937860.1 protein_id gnl|my_center|LOCUS_44170 79690 80466 gene locus_tag LOCUS_44180 79690 80466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 81391 80477 gene locus_tag LOCUS_44190 81391 80477 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921816.1 protein_id gnl|my_center|LOCUS_44190 82478 81426 gene locus_tag LOCUS_44200 82478 81426 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224840.1 protein_id gnl|my_center|LOCUS_44200 82620 83021 gene locus_tag LOCUS_44210 82620 83021 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402907.1 protein_id gnl|my_center|LOCUS_44210 83163 84383 gene locus_tag LOCUS_44220 83163 84383 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267490.1 protein_id gnl|my_center|LOCUS_44220 85340 84420 gene locus_tag LOCUS_44230 85340 84420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 85740 86984 gene locus_tag LOCUS_44240 85740 86984 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098430.1 protein_id gnl|my_center|LOCUS_44240 87018 87302 gene locus_tag LOCUS_44250 87018 87302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077815.1 protein_id gnl|my_center|LOCUS_44250 87310 87615 gene locus_tag LOCUS_44260 87310 87615 CDS product DUF3349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727386.1 protein_id gnl|my_center|LOCUS_44260 87718 88053 gene locus_tag LOCUS_44270 87718 88053 CDS product DUF3349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094656.1 protein_id gnl|my_center|LOCUS_44270 88074 89207 gene locus_tag LOCUS_44280 gene menE 88074 89207 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098433.1 protein_id gnl|my_center|LOCUS_44280 89446 89222 gene locus_tag LOCUS_44290 89446 89222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 89551 89823 gene locus_tag LOCUS_44300 89551 89823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 89916 90503 gene locus_tag LOCUS_44310 89916 90503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 91157 90510 gene locus_tag LOCUS_44320 91157 90510 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222235.1 protein_id gnl|my_center|LOCUS_44320 91477 92154 gene locus_tag LOCUS_44330 91477 92154 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077716.1 protein_id gnl|my_center|LOCUS_44330 92121 93344 gene locus_tag LOCUS_44340 92121 93344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 93341 94414 gene locus_tag LOCUS_44350 93341 94414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 94548 94814 gene locus_tag LOCUS_44360 94548 94814 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892560.1 protein_id gnl|my_center|LOCUS_44360 95984 94818 gene locus_tag LOCUS_44370 95984 94818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 96568 97842 gene locus_tag LOCUS_44380 96568 97842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 97983 98987 gene locus_tag LOCUS_44390 97983 98987 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230441.1 protein_id gnl|my_center|LOCUS_44390 98984 99808 gene locus_tag LOCUS_44400 98984 99808 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975109.1 protein_id gnl|my_center|LOCUS_44400 103080 99805 gene locus_tag LOCUS_44410 103080 99805 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230443.1 protein_id gnl|my_center|LOCUS_44410 103269 104138 gene locus_tag LOCUS_44420 103269 104138 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727336.1 protein_id gnl|my_center|LOCUS_44420 105026 104199 gene locus_tag LOCUS_44430 105026 104199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 105302 105063 gene locus_tag LOCUS_44440 105302 105063 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895203.1 protein_id gnl|my_center|LOCUS_44440 107942 105375 gene locus_tag LOCUS_44450 107942 105375 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404082.1 protein_id gnl|my_center|LOCUS_44450 108632 107943 gene locus_tag LOCUS_44460 108632 107943 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897077.1 protein_id gnl|my_center|LOCUS_44460 109747 108620 gene locus_tag LOCUS_44470 109747 108620 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731115.1 protein_id gnl|my_center|LOCUS_44470 110124 109744 gene locus_tag LOCUS_44480 110124 109744 CDS product DUF4229 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088828.1 protein_id gnl|my_center|LOCUS_44480 110337 110579 gene locus_tag LOCUS_44490 110337 110579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 110748 111026 gene locus_tag LOCUS_44500 110748 111026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 111182 111613 gene locus_tag LOCUS_44510 111182 111613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 112700 111702 gene locus_tag LOCUS_44520 gene ccsB 112700 111702 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892400.1 protein_id gnl|my_center|LOCUS_44520 114409 112706 gene locus_tag LOCUS_44530 114409 112706 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496094.1 protein_id gnl|my_center|LOCUS_44530 115212 114406 gene locus_tag LOCUS_44540 115212 114406 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080301.1 protein_id gnl|my_center|LOCUS_44540 115823 115209 gene locus_tag LOCUS_44550 115823 115209 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727323.1 protein_id gnl|my_center|LOCUS_44550 116476 115847 gene locus_tag LOCUS_44560 116476 115847 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222430.1 protein_id gnl|my_center|LOCUS_44560 117660 116476 gene locus_tag LOCUS_44570 gene hemL 117660 116476 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222429.1 protein_id gnl|my_center|LOCUS_44570 117638 118045 gene locus_tag LOCUS_44580 117638 118045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 118042 119310 gene locus_tag LOCUS_44590 118042 119310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 119819 119316 gene locus_tag LOCUS_44600 119819 119316 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078090.1 protein_id gnl|my_center|LOCUS_44600 120792 119821 gene locus_tag LOCUS_44610 120792 119821 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086423.1 protein_id gnl|my_center|LOCUS_44610 121632 120832 gene locus_tag LOCUS_44620 121632 120832 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086424.1 protein_id gnl|my_center|LOCUS_44620 122477 121629 gene locus_tag LOCUS_44630 122477 121629 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085761.1 protein_id gnl|my_center|LOCUS_44630 123514 122927 gene locus_tag LOCUS_44640 123514 122927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44640 124893 123589 gene locus_tag LOCUS_44650 124893 123589 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227654.1 protein_id gnl|my_center|LOCUS_44650 125554 125096 gene locus_tag LOCUS_44660 125554 125096 CDS product histidine triad (HIT) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043777713.1 protein_id gnl|my_center|LOCUS_44660 126395 125661 gene locus_tag LOCUS_44670 126395 125661 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466913.1 protein_id gnl|my_center|LOCUS_44670 127992 126460 gene locus_tag LOCUS_44680 127992 126460 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085815.1 protein_id gnl|my_center|LOCUS_44680 128152 129555 gene locus_tag LOCUS_44690 128152 129555 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085813.1 protein_id gnl|my_center|LOCUS_44690 129636 131567 gene locus_tag LOCUS_44700 129636 131567 CDS product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729366.1 protein_id gnl|my_center|LOCUS_44700 132197 131589 gene locus_tag LOCUS_44710 132197 131589 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891760.1 protein_id gnl|my_center|LOCUS_44710 133293 132259 gene locus_tag LOCUS_44720 133293 132259 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467337.1 protein_id gnl|my_center|LOCUS_44720 133610 133290 gene locus_tag LOCUS_44730 133610 133290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 134026 133607 gene locus_tag LOCUS_44740 134026 133607 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227573.1 protein_id gnl|my_center|LOCUS_44740 134761 134078 gene locus_tag LOCUS_44750 134761 134078 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091620766.1 protein_id gnl|my_center|LOCUS_44750 134964 134758 gene locus_tag LOCUS_44760 134964 134758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 136205 134865 gene locus_tag LOCUS_44770 136205 134865 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538286.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44770 136347 137231 gene locus_tag LOCUS_44780 136347 137231 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225417.1 protein_id gnl|my_center|LOCUS_44780 137289 138167 gene locus_tag LOCUS_44790 137289 138167 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227571.1 protein_id gnl|my_center|LOCUS_44790 138370 139377 gene locus_tag LOCUS_44800 138370 139377 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138444.1 protein_id gnl|my_center|LOCUS_44800 139394 140416 gene locus_tag LOCUS_44810 139394 140416 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812440.1 protein_id gnl|my_center|LOCUS_44810 140413 142494 gene locus_tag LOCUS_44820 140413 142494 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 protein_id gnl|my_center|LOCUS_44820 142534 144207 gene locus_tag LOCUS_44830 142534 144207 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947105.1 protein_id gnl|my_center|LOCUS_44830 144335 145288 gene locus_tag LOCUS_44840 144335 145288 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079494.1 protein_id gnl|my_center|LOCUS_44840 145285 146328 gene locus_tag LOCUS_44850 145285 146328 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726948.1 protein_id gnl|my_center|LOCUS_44850 146817 146371 gene locus_tag LOCUS_44860 146817 146371 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730654.1 protein_id gnl|my_center|LOCUS_44860 147101 149116 gene locus_tag LOCUS_44870 147101 149116 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088450.1 protein_id gnl|my_center|LOCUS_44870 149396 149094 gene locus_tag LOCUS_44880 149396 149094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 149980 149393 gene locus_tag LOCUS_44890 149980 149393 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727315.1 protein_id gnl|my_center|LOCUS_44890 150365 149973 gene locus_tag LOCUS_44900 150365 149973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900