>Feature sequence1 969 2213 gene locus_tag LOCUS_00010 969 2213 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064787.1 protein_id gnl|my_center|LOCUS_00010 2828 3430 gene locus_tag LOCUS_00020 2828 3430 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024528.1 protein_id gnl|my_center|LOCUS_00020 3549 4028 gene locus_tag LOCUS_00030 3549 4028 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066042.1 protein_id gnl|my_center|LOCUS_00030 4185 4958 gene locus_tag LOCUS_00040 4185 4958 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024526.1 protein_id gnl|my_center|LOCUS_00040 5913 5074 gene locus_tag LOCUS_00050 5913 5074 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279230.1 protein_id gnl|my_center|LOCUS_00050 6620 6138 gene locus_tag LOCUS_00060 6620 6138 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066618.1 protein_id gnl|my_center|LOCUS_00060 7794 6742 gene locus_tag LOCUS_00070 7794 6742 CDS product translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024522.1 protein_id gnl|my_center|LOCUS_00070 8923 10650 gene locus_tag LOCUS_00080 8923 10650 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085439.1 protein_id gnl|my_center|LOCUS_00080 12164 10992 gene locus_tag LOCUS_00090 12164 10992 CDS product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024521.1 protein_id gnl|my_center|LOCUS_00090 12346 13137 gene locus_tag LOCUS_00100 12346 13137 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024520.1 protein_id gnl|my_center|LOCUS_00100 14107 13331 gene locus_tag LOCUS_00110 14107 13331 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589511.1 protein_id gnl|my_center|LOCUS_00110 15312 14467 gene locus_tag LOCUS_00120 15312 14467 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024518.1 protein_id gnl|my_center|LOCUS_00120 16843 15947 gene locus_tag LOCUS_00130 16843 15947 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048168954.1 protein_id gnl|my_center|LOCUS_00130 17051 16854 gene locus_tag LOCUS_00140 17051 16854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 18022 17228 gene locus_tag LOCUS_00150 18022 17228 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024516.1 protein_id gnl|my_center|LOCUS_00150 18834 18121 gene locus_tag LOCUS_00160 18834 18121 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024515.1 protein_id gnl|my_center|LOCUS_00160 21295 19841 gene locus_tag LOCUS_00170 21295 19841 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024513.1 protein_id gnl|my_center|LOCUS_00170 22648 23196 gene locus_tag LOCUS_00180 22648 23196 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024506.1 protein_id gnl|my_center|LOCUS_00180 24351 23290 gene locus_tag LOCUS_00190 gene rtcA 24351 23290 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024505.1 protein_id gnl|my_center|LOCUS_00190 26020 24521 gene locus_tag LOCUS_00200 26020 24521 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024504.1 protein_id gnl|my_center|LOCUS_00200 27427 28995 gene locus_tag LOCUS_00210 gene dnaG 27427 28995 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024503.1 protein_id gnl|my_center|LOCUS_00210 29379 29657 gene locus_tag LOCUS_00220 29379 29657 CDS product UPF0058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024502.1 protein_id gnl|my_center|LOCUS_00220 30195 29641 gene locus_tag LOCUS_00230 gene rimI 30195 29641 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066037.1 protein_id gnl|my_center|LOCUS_00230 32119 30242 gene locus_tag LOCUS_00240 gene arcS 32119 30242 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024500.1 protein_id gnl|my_center|LOCUS_00240 32395 33765 gene locus_tag LOCUS_00250 32395 33765 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066616.1 protein_id gnl|my_center|LOCUS_00250 33762 34937 gene locus_tag LOCUS_00260 33762 34937 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066036.1 protein_id gnl|my_center|LOCUS_00260 35310 35567 gene locus_tag LOCUS_00270 35310 35567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066034.1 protein_id gnl|my_center|LOCUS_00270 35610 35891 gene locus_tag LOCUS_00280 35610 35891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048168986.1 protein_id gnl|my_center|LOCUS_00280 36020 36217 gene locus_tag LOCUS_00290 36020 36217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 37039 37515 gene locus_tag LOCUS_00300 37039 37515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 39897 37675 gene locus_tag LOCUS_00310 39897 37675 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024488.1 protein_id gnl|my_center|LOCUS_00310 40684 40043 gene locus_tag LOCUS_00320 40684 40043 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024487.1 protein_id gnl|my_center|LOCUS_00320 41563 40790 gene locus_tag LOCUS_00330 41563 40790 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066032.1 protein_id gnl|my_center|LOCUS_00330 43295 41745 gene locus_tag LOCUS_00340 43295 41745 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024485.1 protein_id gnl|my_center|LOCUS_00340 44008 45476 gene locus_tag LOCUS_r00010 44008 45476 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 45718 48605 gene locus_tag LOCUS_r00020 45718 48605 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 48695 48811 gene locus_tag LOCUS_r00030 48695 48811 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 49582 49112 gene locus_tag LOCUS_00350 gene bfr 49582 49112 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677991.1 protein_id gnl|my_center|LOCUS_00350 50106 49687 gene locus_tag LOCUS_00360 gene bfr 50106 49687 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677991.1 protein_id gnl|my_center|LOCUS_00360 50389 50682 gene locus_tag LOCUS_00370 50389 50682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 50696 51220 gene locus_tag LOCUS_00380 50696 51220 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066031.1 protein_id gnl|my_center|LOCUS_00380 51362 51433 gene locus_tag LOCUS_t00010 51362 51433 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 51504 51575 gene locus_tag LOCUS_t00020 51504 51575 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 51752 52369 gene locus_tag LOCUS_00390 51752 52369 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066030.1 protein_id gnl|my_center|LOCUS_00390 52633 53811 gene locus_tag LOCUS_00400 52633 53811 CDS product bifunctional 5,6,7,8-tetrahydromethanopterin hydro-lyase/3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024481.1 protein_id gnl|my_center|LOCUS_00400 54003 54671 gene locus_tag LOCUS_00410 gene tpiA 54003 54671 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024480.1 protein_id gnl|my_center|LOCUS_00410 55281 55934 gene locus_tag LOCUS_00420 55281 55934 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024475.1 protein_id gnl|my_center|LOCUS_00420 55937 57688 gene locus_tag LOCUS_00430 55937 57688 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860413.1 protein_id gnl|my_center|LOCUS_00430 57831 58703 gene locus_tag LOCUS_00440 57831 58703 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024473.1 protein_id gnl|my_center|LOCUS_00440 58706 59530 gene locus_tag LOCUS_00450 58706 59530 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066027.1 protein_id gnl|my_center|LOCUS_00450 59530 60483 gene locus_tag LOCUS_00460 59530 60483 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066026.1 protein_id gnl|my_center|LOCUS_00460 60486 61313 gene locus_tag LOCUS_00470 60486 61313 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024470.1 protein_id gnl|my_center|LOCUS_00470 63085 61451 gene locus_tag LOCUS_00480 63085 61451 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990706.1 protein_id gnl|my_center|LOCUS_00480 64599 63082 gene locus_tag LOCUS_00490 64599 63082 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024468.1 protein_id gnl|my_center|LOCUS_00490 65435 64596 gene locus_tag LOCUS_00500 65435 64596 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024467.1 protein_id gnl|my_center|LOCUS_00500 66160 65432 gene locus_tag LOCUS_00510 gene aroD 66160 65432 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024466.1 protein_id gnl|my_center|LOCUS_00510 67402 66260 gene locus_tag LOCUS_00520 67402 66260 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024465.1 protein_id gnl|my_center|LOCUS_00520 68345 67548 gene locus_tag LOCUS_00530 68345 67548 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024464.1 protein_id gnl|my_center|LOCUS_00530 68814 69383 gene locus_tag LOCUS_00540 68814 69383 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024463.1 protein_id gnl|my_center|LOCUS_00540 70798 69467 gene locus_tag LOCUS_00550 70798 69467 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024460.1 protein_id gnl|my_center|LOCUS_00550 71224 71148 gene locus_tag LOCUS_t00030 71224 71148 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 71368 71291 gene locus_tag LOCUS_t00040 71368 71291 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 71630 71821 gene locus_tag LOCUS_00560 71630 71821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066610.1 protein_id gnl|my_center|LOCUS_00560 72782 71931 gene locus_tag LOCUS_00570 72782 71931 CDS product protease inhibitor I42 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024458.1 protein_id gnl|my_center|LOCUS_00570 73886 73158 gene locus_tag LOCUS_00580 73886 73158 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024455.1 protein_id gnl|my_center|LOCUS_00580 74321 74995 gene locus_tag LOCUS_00590 74321 74995 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048174238.1 protein_id gnl|my_center|LOCUS_00590 75349 75807 gene locus_tag LOCUS_00600 75349 75807 CDS product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066022.1 protein_id gnl|my_center|LOCUS_00600 76070 76777 gene locus_tag LOCUS_00610 76070 76777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 76912 77451 gene locus_tag LOCUS_00620 76912 77451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066021.1 protein_id gnl|my_center|LOCUS_00620 77926 78618 gene locus_tag LOCUS_00630 77926 78618 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024449.1 protein_id gnl|my_center|LOCUS_00630 78615 80879 gene locus_tag LOCUS_00640 78615 80879 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024448.1 protein_id gnl|my_center|LOCUS_00640 81020 81544 gene locus_tag LOCUS_00650 81020 81544 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024447.1 protein_id gnl|my_center|LOCUS_00650 81577 82074 gene locus_tag LOCUS_00660 81577 82074 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024446.1 protein_id gnl|my_center|LOCUS_00660 83430 85610 gene locus_tag LOCUS_00670 83430 85610 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024445.1 protein_id gnl|my_center|LOCUS_00670 85610 86065 gene locus_tag LOCUS_00680 85610 86065 CDS product monovalent cation/H+ antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024444.1 protein_id gnl|my_center|LOCUS_00680 86058 86483 gene locus_tag LOCUS_00690 86058 86483 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024443.1 protein_id gnl|my_center|LOCUS_00690 86480 88048 gene locus_tag LOCUS_00700 86480 88048 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066018.1 protein_id gnl|my_center|LOCUS_00700 88045 88542 gene locus_tag LOCUS_00710 88045 88542 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024441.1 protein_id gnl|my_center|LOCUS_00710 88539 88814 gene locus_tag LOCUS_00720 88539 88814 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024440.1 protein_id gnl|my_center|LOCUS_00720 88814 89185 gene locus_tag LOCUS_00730 gene mnhG 88814 89185 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024439.1 protein_id gnl|my_center|LOCUS_00730 89559 90326 gene locus_tag LOCUS_00740 89559 90326 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990915.1 protein_id gnl|my_center|LOCUS_00740 90617 92575 gene locus_tag LOCUS_00750 90617 92575 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024436.1 protein_id gnl|my_center|LOCUS_00750 92844 93638 gene locus_tag LOCUS_00760 92844 93638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00760 93569 93940 gene locus_tag LOCUS_00770 93569 93940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00770 94080 95366 gene locus_tag LOCUS_00780 gene rbcL 94080 95366 CDS product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024428.1 protein_id gnl|my_center|LOCUS_00780 95478 96569 gene locus_tag LOCUS_00790 95478 96569 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024427.1 protein_id gnl|my_center|LOCUS_00790 96713 96925 gene locus_tag LOCUS_00800 96713 96925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066014.1 protein_id gnl|my_center|LOCUS_00800 96962 100414 gene locus_tag LOCUS_00810 96962 100414 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024425.1 protein_id gnl|my_center|LOCUS_00810 102012 100777 gene locus_tag LOCUS_00820 gene mmp10 102012 100777 CDS product methyl coenzyme M reductase-arginine methyltransferase Mmp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024424.1 protein_id gnl|my_center|LOCUS_00820 102433 103737 gene locus_tag LOCUS_00830 gene mcrB 102433 103737 CDS product coenzyme-B sulfoethylthiotransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024423.1 protein_id gnl|my_center|LOCUS_00830 103762 104274 gene locus_tag LOCUS_00840 gene mcrD 103762 104274 CDS product methyl-coenzyme M reductase operon protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024422.1 protein_id gnl|my_center|LOCUS_00840 104281 104901 gene locus_tag LOCUS_00850 gene mcrC 104281 104901 CDS product methyl-coenzyme M reductase I operon protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024421.1 protein_id gnl|my_center|LOCUS_00850 104903 105649 gene locus_tag LOCUS_00860 gene mcrG 104903 105649 CDS product coenzyme-B sulfoethylthiotransferase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024420.1 protein_id gnl|my_center|LOCUS_00860 105660 107372 gene locus_tag LOCUS_00870 gene mcrA 105660 107372 CDS product coenzyme-B sulfoethylthiotransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024419.1 protein_id gnl|my_center|LOCUS_00870 108722 107742 gene locus_tag LOCUS_00880 108722 107742 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024418.1 protein_id gnl|my_center|LOCUS_00880 110259 108967 gene locus_tag LOCUS_00890 gene aroA 110259 108967 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024417.1 protein_id gnl|my_center|LOCUS_00890 111029 110376 gene locus_tag LOCUS_00900 111029 110376 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066013.1 protein_id gnl|my_center|LOCUS_00900 112392 111532 gene locus_tag LOCUS_00910 gene htpX 112392 111532 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024415.1 protein_id gnl|my_center|LOCUS_00910 113474 112929 gene locus_tag LOCUS_00920 113474 112929 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024413.1 protein_id gnl|my_center|LOCUS_00920 113876 114877 gene locus_tag LOCUS_00930 113876 114877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066604.1 protein_id gnl|my_center|LOCUS_00930 115384 116496 gene locus_tag LOCUS_00940 115384 116496 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066011.1 protein_id gnl|my_center|LOCUS_00940 116499 117122 gene locus_tag LOCUS_00950 116499 117122 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024409.1 protein_id gnl|my_center|LOCUS_00950 117137 118909 gene locus_tag LOCUS_00960 117137 118909 CDS product 4Fe-4S cluster-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024408.1 protein_id gnl|my_center|LOCUS_00960 118902 119921 gene locus_tag LOCUS_00970 118902 119921 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024407.1 protein_id gnl|my_center|LOCUS_00970 119912 120721 gene locus_tag LOCUS_00980 119912 120721 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066010.1 protein_id gnl|my_center|LOCUS_00980 120848 122134 gene locus_tag LOCUS_00990 120848 122134 CDS product S-layer protein domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279223.1 protein_id gnl|my_center|LOCUS_00990 123569 123036 gene locus_tag LOCUS_01000 123569 123036 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024403.1 protein_id gnl|my_center|LOCUS_01000 123914 124732 gene locus_tag LOCUS_01010 123914 124732 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066008.1 protein_id gnl|my_center|LOCUS_01010 126534 125047 gene locus_tag LOCUS_01020 gene gatB 126534 125047 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024400.1 protein_id gnl|my_center|LOCUS_01020 127962 126535 gene locus_tag LOCUS_01030 gene gatA 127962 126535 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066007.1 protein_id gnl|my_center|LOCUS_01030 128256 127975 gene locus_tag LOCUS_01040 gene gatC 128256 127975 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024398.1 protein_id gnl|my_center|LOCUS_01040 128682 129230 gene locus_tag LOCUS_01050 128682 129230 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024397.1 protein_id gnl|my_center|LOCUS_01050 130736 129573 gene locus_tag LOCUS_01060 130736 129573 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024396.1 protein_id gnl|my_center|LOCUS_01060 131511 132944 gene locus_tag LOCUS_01070 131511 132944 CDS product methanogenesis marker 14 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024395.1 protein_id gnl|my_center|LOCUS_01070 133418 133092 gene locus_tag LOCUS_01080 133418 133092 CDS product DUF2098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066006.1 protein_id gnl|my_center|LOCUS_01080 134651 133695 gene locus_tag LOCUS_01090 gene mptA 134651 133695 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066005.1 protein_id gnl|my_center|LOCUS_01090 135060 135344 gene locus_tag LOCUS_01100 135060 135344 CDS product non-histone chromosomal MC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024392.1 protein_id gnl|my_center|LOCUS_01100 135571 136470 gene locus_tag LOCUS_01110 gene argB 135571 136470 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024391.1 protein_id gnl|my_center|LOCUS_01110 136534 136692 gene locus_tag LOCUS_01120 136534 136692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01120 136692 136988 gene locus_tag LOCUS_01130 136692 136988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01130 138112 137072 gene locus_tag LOCUS_01140 138112 137072 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066004.1 protein_id gnl|my_center|LOCUS_01140 139214 138297 gene locus_tag LOCUS_01150 gene guaA 139214 138297 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024387.1 protein_id gnl|my_center|LOCUS_01150 139614 139892 gene locus_tag LOCUS_01160 139614 139892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066003.1 protein_id gnl|my_center|LOCUS_01160 141558 144257 gene locus_tag LOCUS_01170 gene recQ 141558 144257 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066602.1 protein_id gnl|my_center|LOCUS_01170 144749 144249 gene locus_tag LOCUS_01180 144749 144249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 145575 144880 gene locus_tag LOCUS_01190 145575 144880 CDS product A24 family peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024381.1 protein_id gnl|my_center|LOCUS_01190 147110 145881 gene locus_tag LOCUS_01200 147110 145881 CDS product bifunctional hexulose-6-phosphate synthase/ribonuclease regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860554.1 protein_id gnl|my_center|LOCUS_01200 147507 147986 gene locus_tag LOCUS_01210 147507 147986 CDS product DUF5788 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024379.1 protein_id gnl|my_center|LOCUS_01210 148032 149015 gene locus_tag LOCUS_01220 gene pyrB 148032 149015 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024378.1 protein_id gnl|my_center|LOCUS_01220 149012 149482 gene locus_tag LOCUS_01230 gene pyrI 149012 149482 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024377.1 protein_id gnl|my_center|LOCUS_01230 149731 150204 gene locus_tag LOCUS_01240 149731 150204 CDS product DUF5788 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024376.1 protein_id gnl|my_center|LOCUS_01240 151064 150297 gene locus_tag LOCUS_01250 151064 150297 CDS product DUF1673 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860405.1 protein_id gnl|my_center|LOCUS_01250 152211 151984 gene locus_tag LOCUS_01260 152211 151984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 153450 152731 gene locus_tag LOCUS_01270 153450 152731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066001.1 protein_id gnl|my_center|LOCUS_01270 153963 153463 gene locus_tag LOCUS_01280 153963 153463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 154544 153927 gene locus_tag LOCUS_01290 154544 153927 CDS product DUF1673 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024369.1 protein_id gnl|my_center|LOCUS_01290 155173 154541 gene locus_tag LOCUS_01300 155173 154541 CDS product DUF1673 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990703.1 protein_id gnl|my_center|LOCUS_01300 155811 155170 gene locus_tag LOCUS_01310 155811 155170 CDS product DUF1673 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990703.1 protein_id gnl|my_center|LOCUS_01310 156991 156371 gene locus_tag LOCUS_01320 156991 156371 CDS product DUF1673 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066000.1 protein_id gnl|my_center|LOCUS_01320 158766 158422 gene locus_tag LOCUS_01330 158766 158422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 159256 158801 gene locus_tag LOCUS_01340 159256 158801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024361.1 protein_id gnl|my_center|LOCUS_01340 159509 159949 gene locus_tag LOCUS_01350 159509 159949 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048174324.1 protein_id gnl|my_center|LOCUS_01350 159942 160460 gene locus_tag LOCUS_01360 159942 160460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 161012 162718 gene locus_tag LOCUS_01370 161012 162718 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024357.1 protein_id gnl|my_center|LOCUS_01370 162736 164235 gene locus_tag LOCUS_01380 162736 164235 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024356.1 protein_id gnl|my_center|LOCUS_01380 164266 164511 gene locus_tag LOCUS_01390 164266 164511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 165916 165125 gene locus_tag LOCUS_01400 gene dapB 165916 165125 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024350.1 protein_id gnl|my_center|LOCUS_01400 166788 165913 gene locus_tag LOCUS_01410 gene dapA 166788 165913 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024349.1 protein_id gnl|my_center|LOCUS_01410 167039 166845 gene locus_tag LOCUS_01420 167039 166845 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024348.1 protein_id gnl|my_center|LOCUS_01420 167718 167371 gene locus_tag LOCUS_01430 167718 167371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065999.1 protein_id gnl|my_center|LOCUS_01430 168428 168015 gene locus_tag LOCUS_01440 168428 168015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 169285 168521 gene locus_tag LOCUS_01450 169285 168521 CDS product heparan-alpha-glucosaminide N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065998.1 protein_id gnl|my_center|LOCUS_01450 170358 169396 gene locus_tag LOCUS_01460 170358 169396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 171334 170462 gene locus_tag LOCUS_01470 171334 170462 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065997.1 protein_id gnl|my_center|LOCUS_01470 172227 171340 gene locus_tag LOCUS_01480 172227 171340 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065996.1 protein_id gnl|my_center|LOCUS_01480 172834 173730 gene locus_tag LOCUS_01490 172834 173730 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_01490 175935 174004 gene locus_tag LOCUS_01500 175935 174004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 176893 176009 gene locus_tag LOCUS_01510 176893 176009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 177505 177753 gene locus_tag LOCUS_01520 177505 177753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 178290 178454 gene locus_tag LOCUS_01530 178290 178454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 178729 178977 gene locus_tag LOCUS_01540 178729 178977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 179428 179676 gene locus_tag LOCUS_01550 179428 179676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 181153 179945 gene locus_tag LOCUS_01560 181153 179945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 182628 181741 gene locus_tag LOCUS_01570 182628 181741 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065996.1 protein_id gnl|my_center|LOCUS_01570 183473 184444 gene locus_tag LOCUS_01580 183473 184444 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022154.1 protein_id gnl|my_center|LOCUS_01580 184677 185648 gene locus_tag LOCUS_01590 184677 185648 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022154.1 protein_id gnl|my_center|LOCUS_01590 185679 186782 gene locus_tag LOCUS_01600 185679 186782 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289085.1 protein_id gnl|my_center|LOCUS_01600 186783 187847 gene locus_tag LOCUS_01610 186783 187847 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990845.1 protein_id gnl|my_center|LOCUS_01610 187896 189002 gene locus_tag LOCUS_01620 187896 189002 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250274.1 protein_id gnl|my_center|LOCUS_01620 189040 190170 gene locus_tag LOCUS_01630 189040 190170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 191646 192248 gene locus_tag LOCUS_01640 191646 192248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 192250 193443 gene locus_tag LOCUS_01650 192250 193443 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024330.1 protein_id gnl|my_center|LOCUS_01650 194353 194159 gene locus_tag LOCUS_01660 194353 194159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 194724 195473 gene locus_tag LOCUS_01670 194724 195473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 195492 196628 gene locus_tag LOCUS_01680 195492 196628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 196658 197281 gene locus_tag LOCUS_01690 196658 197281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 197275 198516 gene locus_tag LOCUS_01700 197275 198516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 198664 198876 gene locus_tag LOCUS_01710 198664 198876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 199802 200707 gene locus_tag LOCUS_01720 199802 200707 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022154.1 protein_id gnl|my_center|LOCUS_01720 200925 202337 gene locus_tag LOCUS_01730 200925 202337 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 protein_id gnl|my_center|LOCUS_01730 202334 203518 gene locus_tag LOCUS_01740 202334 203518 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289085.1 protein_id gnl|my_center|LOCUS_01740 203524 203997 gene locus_tag LOCUS_01750 203524 203997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 204007 205113 gene locus_tag LOCUS_01760 204007 205113 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250274.1 protein_id gnl|my_center|LOCUS_01760 205655 205371 gene locus_tag LOCUS_01770 205655 205371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 205612 206310 gene locus_tag LOCUS_01780 205612 206310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 206393 208252 gene locus_tag LOCUS_01790 206393 208252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 208301 209533 gene locus_tag LOCUS_01800 208301 209533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 209530 211362 gene locus_tag LOCUS_01810 209530 211362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 211561 212070 gene locus_tag LOCUS_01820 211561 212070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 213660 212374 gene locus_tag LOCUS_01830 213660 212374 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975609.1 protein_id gnl|my_center|LOCUS_01830 215204 214170 gene locus_tag LOCUS_01840 215204 214170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 216330 215401 gene locus_tag LOCUS_01850 216330 215401 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_01850 218110 216335 gene locus_tag LOCUS_01860 218110 216335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 218738 218875 gene locus_tag LOCUS_01870 218738 218875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 219681 220571 gene locus_tag LOCUS_01880 219681 220571 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022154.1 protein_id gnl|my_center|LOCUS_01880 220595 221524 gene locus_tag LOCUS_01890 220595 221524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 221525 222976 gene locus_tag LOCUS_01900 gene hpnJ 221525 222976 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941811.1 protein_id gnl|my_center|LOCUS_01900 223077 224270 gene locus_tag LOCUS_01910 223077 224270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 224284 225426 gene locus_tag LOCUS_01920 224284 225426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 225450 226589 gene locus_tag LOCUS_01930 225450 226589 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875974.1 protein_id gnl|my_center|LOCUS_01930 226916 226644 gene locus_tag LOCUS_01940 226916 226644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 227689 228801 gene locus_tag LOCUS_01950 227689 228801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 229237 228818 gene locus_tag LOCUS_01960 229237 228818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 229605 229841 gene locus_tag LOCUS_01970 229605 229841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 231322 231714 gene locus_tag LOCUS_01980 231322 231714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01980 232134 233105 gene locus_tag LOCUS_01990 232134 233105 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022154.1 protein_id gnl|my_center|LOCUS_01990 233310 234326 gene locus_tag LOCUS_02000 233310 234326 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868308.1 protein_id gnl|my_center|LOCUS_02000 234377 235249 gene locus_tag LOCUS_02010 234377 235249 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024331.1 protein_id gnl|my_center|LOCUS_02010 235311 237119 gene locus_tag LOCUS_02020 235311 237119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065327.1 protein_id gnl|my_center|LOCUS_02020 237088 238296 gene locus_tag LOCUS_02030 237088 238296 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022163.1 protein_id gnl|my_center|LOCUS_02030 239756 238503 gene locus_tag LOCUS_02040 239756 238503 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869927.1 protein_id gnl|my_center|LOCUS_02040 240794 239865 gene locus_tag LOCUS_02050 240794 239865 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022166.1 protein_id gnl|my_center|LOCUS_02050 242213 240855 gene locus_tag LOCUS_02060 242213 240855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 243518 242370 gene locus_tag LOCUS_02070 gene csaB 243518 242370 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391759.1 protein_id gnl|my_center|LOCUS_02070 244745 243660 gene locus_tag LOCUS_02080 gene wecB 244745 243660 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_02080 246209 245094 gene locus_tag LOCUS_02090 246209 245094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 246645 247325 gene locus_tag LOCUS_02100 246645 247325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 249046 247613 gene locus_tag LOCUS_02110 249046 247613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 249946 249254 gene locus_tag LOCUS_02120 249946 249254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 251964 250435 gene locus_tag LOCUS_02130 251964 250435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 253071 252493 gene locus_tag LOCUS_02140 253071 252493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 253267 253019 gene locus_tag LOCUS_02150 253267 253019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 254758 253331 gene locus_tag LOCUS_02160 254758 253331 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867672.1 protein_id gnl|my_center|LOCUS_02160 255789 254851 gene locus_tag LOCUS_02170 255789 254851 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024326.1 protein_id gnl|my_center|LOCUS_02170 256916 255834 gene locus_tag LOCUS_02180 256916 255834 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_02180 257646 256978 gene locus_tag LOCUS_02190 257646 256978 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763299.1 protein_id gnl|my_center|LOCUS_02190 258482 258207 gene locus_tag LOCUS_02200 258482 258207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 260027 258912 gene locus_tag LOCUS_02210 gene tnpB 260027 258912 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_02210 261035 260169 gene locus_tag LOCUS_02220 261035 260169 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065997.1 protein_id gnl|my_center|LOCUS_02220 261925 261038 gene locus_tag LOCUS_02230 261925 261038 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065996.1 protein_id gnl|my_center|LOCUS_02230 262830 263726 gene locus_tag LOCUS_02240 262830 263726 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022154.1 protein_id gnl|my_center|LOCUS_02240 263752 264765 gene locus_tag LOCUS_02250 263752 264765 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963936.1 protein_id gnl|my_center|LOCUS_02250 266308 267204 gene locus_tag LOCUS_02260 266308 267204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 268416 267226 gene locus_tag LOCUS_02270 268416 267226 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485734.1 protein_id gnl|my_center|LOCUS_02270 268616 269800 gene locus_tag LOCUS_02280 268616 269800 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024330.1 protein_id gnl|my_center|LOCUS_02280 270635 273391 gene locus_tag LOCUS_02290 270635 273391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 274010 274168 gene locus_tag LOCUS_02300 274010 274168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 274217 275689 gene locus_tag LOCUS_02310 274217 275689 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024339.1 protein_id gnl|my_center|LOCUS_02310 276884 275928 gene locus_tag LOCUS_02320 276884 275928 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_02320 277067 277960 gene locus_tag LOCUS_02330 gene galU 277067 277960 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065994.1 protein_id gnl|my_center|LOCUS_02330 278078 277929 gene locus_tag LOCUS_02340 278078 277929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 279380 278097 gene locus_tag LOCUS_02350 279380 278097 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024335.1 protein_id gnl|my_center|LOCUS_02350 279618 279908 gene locus_tag LOCUS_02360 279618 279908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990914.1 protein_id gnl|my_center|LOCUS_02360 280040 279840 gene locus_tag LOCUS_02370 280040 279840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 280535 281620 gene locus_tag LOCUS_02380 280535 281620 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024333.1 protein_id gnl|my_center|LOCUS_02380 281613 282659 gene locus_tag LOCUS_02390 281613 282659 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024332.1 protein_id gnl|my_center|LOCUS_02390 282643 283569 gene locus_tag LOCUS_02400 282643 283569 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024331.1 protein_id gnl|my_center|LOCUS_02400 283614 284825 gene locus_tag LOCUS_02410 283614 284825 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024330.1 protein_id gnl|my_center|LOCUS_02410 284923 285930 gene locus_tag LOCUS_02420 284923 285930 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020371.1 protein_id gnl|my_center|LOCUS_02420 287516 286056 gene locus_tag LOCUS_02430 287516 286056 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066597.1 protein_id gnl|my_center|LOCUS_02430 289546 287606 gene locus_tag LOCUS_02440 289546 287606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065991.1 protein_id gnl|my_center|LOCUS_02440 290812 289769 gene locus_tag LOCUS_02450 290812 289769 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020209.1 protein_id gnl|my_center|LOCUS_02450 291876 290941 gene locus_tag LOCUS_02460 291876 290941 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024326.1 protein_id gnl|my_center|LOCUS_02460 293142 294737 gene locus_tag LOCUS_02470 293142 294737 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024324.1 protein_id gnl|my_center|LOCUS_02470 296912 294801 gene locus_tag LOCUS_02480 296912 294801 CDS product disaggregatase related repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065989.1 protein_id gnl|my_center|LOCUS_02480 298907 297297 gene locus_tag LOCUS_02490 298907 297297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 301046 299355 gene locus_tag LOCUS_02500 301046 299355 CDS product disaggregatase related repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065988.1 protein_id gnl|my_center|LOCUS_02500 303028 303933 gene locus_tag LOCUS_02510 303028 303933 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024318.1 protein_id gnl|my_center|LOCUS_02510 305831 306340 gene locus_tag LOCUS_02520 305831 306340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 307287 306721 gene locus_tag LOCUS_02530 307287 306721 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024315.1 protein_id gnl|my_center|LOCUS_02530 308097 307393 gene locus_tag LOCUS_02540 308097 307393 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024314.1 protein_id gnl|my_center|LOCUS_02540 308232 308951 gene locus_tag LOCUS_02550 308232 308951 CDS product HisA/HisF-related TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024313.1 protein_id gnl|my_center|LOCUS_02550 309102 309374 gene locus_tag LOCUS_02560 309102 309374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024312.1 protein_id gnl|my_center|LOCUS_02560 310096 309479 gene locus_tag LOCUS_02570 gene tmk 310096 309479 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024311.1 protein_id gnl|my_center|LOCUS_02570 310252 310914 gene locus_tag LOCUS_02580 310252 310914 CDS product DUF166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024310.1 protein_id gnl|my_center|LOCUS_02580 310972 311418 gene locus_tag LOCUS_02590 310972 311418 CDS product DUF2111 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589540.1 protein_id gnl|my_center|LOCUS_02590 312453 311623 gene locus_tag LOCUS_02600 312453 311623 CDS product F420-dependent methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065986.1 protein_id gnl|my_center|LOCUS_02600 312857 313564 gene locus_tag LOCUS_02610 gene serB 312857 313564 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024307.1 protein_id gnl|my_center|LOCUS_02610 313605 314462 gene locus_tag LOCUS_02620 313605 314462 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024306.1 protein_id gnl|my_center|LOCUS_02620 315946 314807 gene locus_tag LOCUS_02630 315946 314807 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024301.1 protein_id gnl|my_center|LOCUS_02630 317257 316100 gene locus_tag LOCUS_02640 317257 316100 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024300.1 protein_id gnl|my_center|LOCUS_02640 318216 317275 gene locus_tag LOCUS_02650 318216 317275 CDS product UbiA prenyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065984.1 protein_id gnl|my_center|LOCUS_02650 319980 318508 gene locus_tag LOCUS_02660 gene tgtA 319980 318508 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024298.1 protein_id gnl|my_center|LOCUS_02660 320197 320640 gene locus_tag LOCUS_02670 320197 320640 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065983.1 protein_id gnl|my_center|LOCUS_02670 320637 321059 gene locus_tag LOCUS_02680 320637 321059 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021853.1 protein_id gnl|my_center|LOCUS_02680 321974 321387 gene locus_tag LOCUS_02690 321974 321387 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024295.1 protein_id gnl|my_center|LOCUS_02690 322528 323277 gene locus_tag LOCUS_02700 322528 323277 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066594.1 protein_id gnl|my_center|LOCUS_02700 323282 323671 gene locus_tag LOCUS_02710 323282 323671 CDS product DUF473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024293.1 protein_id gnl|my_center|LOCUS_02710 325533 323905 gene locus_tag LOCUS_02720 gene thsB 325533 323905 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024292.1 protein_id gnl|my_center|LOCUS_02720 329147 326097 gene locus_tag LOCUS_02730 329147 326097 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024289.1 protein_id gnl|my_center|LOCUS_02730 329868 329251 gene locus_tag LOCUS_02740 329868 329251 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589510.1 protein_id gnl|my_center|LOCUS_02740 330230 329874 gene locus_tag LOCUS_02750 330230 329874 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065981.1 protein_id gnl|my_center|LOCUS_02750 330794 330564 gene locus_tag LOCUS_02760 330794 330564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 333262 330800 gene locus_tag LOCUS_02770 333262 330800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 333673 333305 gene locus_tag LOCUS_02780 333673 333305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 334020 333679 gene locus_tag LOCUS_02790 334020 333679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 334613 334104 gene locus_tag LOCUS_02800 334613 334104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 336344 334632 gene locus_tag LOCUS_02810 gene kaiC 336344 334632 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331300.1 protein_id gnl|my_center|LOCUS_02810 338319 337096 gene locus_tag LOCUS_02820 338319 337096 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024286.1 protein_id gnl|my_center|LOCUS_02820 339044 338301 gene locus_tag LOCUS_02830 339044 338301 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024285.1 protein_id gnl|my_center|LOCUS_02830 340147 339479 gene locus_tag LOCUS_02840 340147 339479 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024284.1 protein_id gnl|my_center|LOCUS_02840 341174 340203 gene locus_tag LOCUS_02850 341174 340203 CDS product DUF128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065980.1 protein_id gnl|my_center|LOCUS_02850 342311 341778 gene locus_tag LOCUS_02860 342311 341778 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024282.1 protein_id gnl|my_center|LOCUS_02860 342992 342318 gene locus_tag LOCUS_02870 342992 342318 CDS product undecaprenyl diphosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024281.1 protein_id gnl|my_center|LOCUS_02870 344287 343103 gene locus_tag LOCUS_02880 344287 343103 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024280.1 protein_id gnl|my_center|LOCUS_02880 344459 344532 gene locus_tag LOCUS_t00050 344459 344532 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 344656 345063 gene locus_tag LOCUS_02890 344656 345063 CDS product cell surface lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065979.1 protein_id gnl|my_center|LOCUS_02890 346032 345244 gene locus_tag LOCUS_02900 346032 345244 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024277.1 protein_id gnl|my_center|LOCUS_02900 347171 346386 gene locus_tag LOCUS_02910 347171 346386 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024276.1 protein_id gnl|my_center|LOCUS_02910 349247 347319 gene locus_tag LOCUS_02920 349247 347319 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065978.1 protein_id gnl|my_center|LOCUS_02920 351417 349402 gene locus_tag LOCUS_02930 351417 349402 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024274.1 protein_id gnl|my_center|LOCUS_02930 352747 351782 gene locus_tag LOCUS_02940 352747 351782 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065977.1 protein_id gnl|my_center|LOCUS_02940 353702 353118 gene locus_tag LOCUS_02950 353702 353118 CDS product acetate uptake transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024272.1 protein_id gnl|my_center|LOCUS_02950 355142 353757 gene locus_tag LOCUS_02960 gene mtaB 355142 353757 CDS product methanol--corrinoid protein co-methyltransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024271.1 protein_id gnl|my_center|LOCUS_02960 355933 355157 gene locus_tag LOCUS_02970 gene mtaC 355933 355157 CDS product methanol--corrinoid protein MtaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024270.1 protein_id gnl|my_center|LOCUS_02970 358124 357033 gene locus_tag LOCUS_02980 358124 357033 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024268.1 protein_id gnl|my_center|LOCUS_02980 359388 358711 gene locus_tag LOCUS_02990 359388 358711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02990 359620 359372 gene locus_tag LOCUS_03000 359620 359372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03000 360319 359627 gene locus_tag LOCUS_03010 360319 359627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03010 360925 360599 gene locus_tag LOCUS_03020 360925 360599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024264.1 protein_id gnl|my_center|LOCUS_03020 363127 361232 gene locus_tag LOCUS_03030 363127 361232 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024263.1 protein_id gnl|my_center|LOCUS_03030 364238 365011 gene locus_tag LOCUS_03040 364238 365011 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990699.1 protein_id gnl|my_center|LOCUS_03040 366320 365172 gene locus_tag LOCUS_03050 366320 365172 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066591.1 protein_id gnl|my_center|LOCUS_03050 368176 366833 gene locus_tag LOCUS_03060 368176 366833 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024260.1 protein_id gnl|my_center|LOCUS_03060 368623 368438 gene locus_tag LOCUS_03070 368623 368438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 370549 368930 gene locus_tag LOCUS_03080 370549 368930 CDS product methylamine methyltransferase corrinoid protein reductive activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024259.1 protein_id gnl|my_center|LOCUS_03080 371903 370848 gene locus_tag LOCUS_03090 gene mtaA 371903 370848 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589539.1 protein_id gnl|my_center|LOCUS_03090 372402 375272 gene locus_tag LOCUS_03100 372402 375272 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024257.1 protein_id gnl|my_center|LOCUS_03100 375641 378724 gene locus_tag LOCUS_03110 375641 378724 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024256.1 protein_id gnl|my_center|LOCUS_03110 378696 379061 gene locus_tag LOCUS_03120 378696 379061 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065974.1 protein_id gnl|my_center|LOCUS_03120 380073 379288 gene locus_tag LOCUS_03130 380073 379288 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024254.1 protein_id gnl|my_center|LOCUS_03130 381436 380924 gene locus_tag LOCUS_03140 381436 380924 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024252.1 protein_id gnl|my_center|LOCUS_03140 383108 381474 gene locus_tag LOCUS_03150 383108 381474 CDS product hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024251.1 protein_id gnl|my_center|LOCUS_03150 384677 383121 gene locus_tag LOCUS_03160 384677 383121 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024250.1 protein_id gnl|my_center|LOCUS_03160 385360 384674 gene locus_tag LOCUS_03170 385360 384674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024249.1 protein_id gnl|my_center|LOCUS_03170 386298 385357 gene locus_tag LOCUS_03180 386298 385357 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024248.1 protein_id gnl|my_center|LOCUS_03180 388226 386295 gene locus_tag LOCUS_03190 388226 386295 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024247.1 protein_id gnl|my_center|LOCUS_03190 389197 388805 gene locus_tag LOCUS_03200 389197 388805 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066321.1 protein_id gnl|my_center|LOCUS_03200 391879 389657 gene locus_tag LOCUS_03210 391879 389657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 393067 392246 gene locus_tag LOCUS_03220 393067 392246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 393420 393118 gene locus_tag LOCUS_03230 393420 393118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03230 393693 393902 gene locus_tag LOCUS_03240 393693 393902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03240 394278 394568 gene locus_tag LOCUS_03250 394278 394568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03250 395336 394785 gene locus_tag LOCUS_03260 395336 394785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 396124 395453 gene locus_tag LOCUS_03270 396124 395453 CDS product RibD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024246.1 protein_id gnl|my_center|LOCUS_03270 396250 397161 gene locus_tag LOCUS_03280 396250 397161 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024245.1 protein_id gnl|my_center|LOCUS_03280 397235 398407 gene locus_tag LOCUS_03290 397235 398407 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990698.1 protein_id gnl|my_center|LOCUS_03290 398702 398439 gene locus_tag LOCUS_03300 398702 398439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 400504 399815 gene locus_tag LOCUS_03310 400504 399815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03310 400745 400527 gene locus_tag LOCUS_03320 400745 400527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03320 401230 400964 gene locus_tag LOCUS_03330 401230 400964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 401520 401302 gene locus_tag LOCUS_03340 401520 401302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03340 401982 401803 gene locus_tag LOCUS_03350 401982 401803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 403923 402397 gene locus_tag LOCUS_03360 403923 402397 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024241.1 protein_id gnl|my_center|LOCUS_03360 404327 405559 gene locus_tag LOCUS_03370 404327 405559 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065972.1 protein_id gnl|my_center|LOCUS_03370 405562 406464 gene locus_tag LOCUS_03380 405562 406464 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024239.1 protein_id gnl|my_center|LOCUS_03380 406465 407520 gene locus_tag LOCUS_03390 406465 407520 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024238.1 protein_id gnl|my_center|LOCUS_03390 407534 407767 gene locus_tag LOCUS_03400 407534 407767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 407775 408416 gene locus_tag LOCUS_03410 407775 408416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024237.1 protein_id gnl|my_center|LOCUS_03410 408632 408483 gene locus_tag LOCUS_03420 408632 408483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 408616 409116 gene locus_tag LOCUS_03430 408616 409116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 409143 409589 gene locus_tag LOCUS_03440 409143 409589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 409564 409845 gene locus_tag LOCUS_03450 409564 409845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 411316 409952 gene locus_tag LOCUS_03460 411316 409952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 411780 411708 gene locus_tag LOCUS_t00060 411780 411708 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 412537 412791 gene locus_tag LOCUS_03470 412537 412791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 414240 413113 gene locus_tag LOCUS_03480 414240 413113 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085095815.1 protein_id gnl|my_center|LOCUS_03480 414371 414511 gene locus_tag LOCUS_03490 414371 414511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 415807 415568 gene locus_tag LOCUS_03500 415807 415568 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022341.1 protein_id gnl|my_center|LOCUS_03500 416102 417214 gene locus_tag LOCUS_03510 416102 417214 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024234.1 protein_id gnl|my_center|LOCUS_03510 417669 418502 gene locus_tag LOCUS_03520 417669 418502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 419118 418972 gene locus_tag LOCUS_03530 419118 418972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 419075 420790 gene locus_tag LOCUS_03540 419075 420790 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024233.1 protein_id gnl|my_center|LOCUS_03540 421139 422272 gene locus_tag LOCUS_03550 421139 422272 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020830.1 protein_id gnl|my_center|LOCUS_03550 422464 424569 gene locus_tag LOCUS_03560 422464 424569 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024232.1 protein_id gnl|my_center|LOCUS_03560 424960 426813 gene locus_tag LOCUS_03570 424960 426813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 428302 427208 gene locus_tag LOCUS_03580 428302 427208 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024231.1 protein_id gnl|my_center|LOCUS_03580 429056 428865 gene locus_tag LOCUS_03590 429056 428865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 429440 429141 gene locus_tag LOCUS_03600 429440 429141 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065930.1 protein_id gnl|my_center|LOCUS_03600 431741 429795 gene locus_tag LOCUS_03610 431741 429795 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024230.1 protein_id gnl|my_center|LOCUS_03610 432934 432056 gene locus_tag LOCUS_03620 gene ilvE 432934 432056 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065968.1 protein_id gnl|my_center|LOCUS_03620 433284 433359 gene locus_tag LOCUS_t00070 433284 433359 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 433958 433488 gene locus_tag LOCUS_03630 433958 433488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 434235 433960 gene locus_tag LOCUS_03640 434235 433960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 435133 434237 gene locus_tag LOCUS_03650 435133 434237 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048143027.1 protein_id gnl|my_center|LOCUS_03650 435773 435150 gene locus_tag LOCUS_03660 435773 435150 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460086.1 protein_id gnl|my_center|LOCUS_03660 436377 436700 gene locus_tag LOCUS_03670 436377 436700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 436851 437336 gene locus_tag LOCUS_03680 436851 437336 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224535.1 protein_id gnl|my_center|LOCUS_03680 437557 437366 gene locus_tag LOCUS_03690 437557 437366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 437569 437934 gene locus_tag LOCUS_03700 437569 437934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 438568 438053 gene locus_tag LOCUS_03710 438568 438053 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024226.1 protein_id gnl|my_center|LOCUS_03710 439935 438670 gene locus_tag LOCUS_03720 439935 438670 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024225.1 protein_id gnl|my_center|LOCUS_03720 440231 439932 gene locus_tag LOCUS_03730 440231 439932 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024224.1 protein_id gnl|my_center|LOCUS_03730 441231 440458 gene locus_tag LOCUS_03740 441231 440458 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024223.1 protein_id gnl|my_center|LOCUS_03740 442144 441290 gene locus_tag LOCUS_03750 442144 441290 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024222.1 protein_id gnl|my_center|LOCUS_03750 442944 442120 gene locus_tag LOCUS_03760 442944 442120 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024221.1 protein_id gnl|my_center|LOCUS_03760 443602 443039 gene locus_tag LOCUS_03770 443602 443039 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024220.1 protein_id gnl|my_center|LOCUS_03770 444072 444147 gene locus_tag LOCUS_t00080 444072 444147 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 444400 444855 gene locus_tag LOCUS_03780 444400 444855 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024219.1 protein_id gnl|my_center|LOCUS_03780 445096 445761 gene locus_tag LOCUS_03790 445096 445761 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065966.1 protein_id gnl|my_center|LOCUS_03790 445811 447808 gene locus_tag LOCUS_03800 gene feoB 445811 447808 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024217.1 protein_id gnl|my_center|LOCUS_03800 448061 448240 gene locus_tag LOCUS_03810 448061 448240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 449038 450012 gene locus_tag LOCUS_03820 449038 450012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065963.1 protein_id gnl|my_center|LOCUS_03820 450059 453586 gene locus_tag LOCUS_03830 gene smc 450059 453586 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024214.1 protein_id gnl|my_center|LOCUS_03830 453579 454583 gene locus_tag LOCUS_03840 453579 454583 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024213.1 protein_id gnl|my_center|LOCUS_03840 454629 455744 gene locus_tag LOCUS_03850 gene scpB 454629 455744 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065962.1 protein_id gnl|my_center|LOCUS_03850 455939 456490 gene locus_tag LOCUS_03860 455939 456490 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024211.1 protein_id gnl|my_center|LOCUS_03860 456625 457584 gene locus_tag LOCUS_03870 gene aglJ 456625 457584 CDS product S-layer glycoprotein N-glycosyltransferase AglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024210.1 protein_id gnl|my_center|LOCUS_03870 458223 457699 gene locus_tag LOCUS_03880 458223 457699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 458515 458213 gene locus_tag LOCUS_03890 458515 458213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 458926 460212 gene locus_tag LOCUS_03900 gene thiC 458926 460212 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024209.1 protein_id gnl|my_center|LOCUS_03900 461363 460236 gene locus_tag LOCUS_03910 461363 460236 CDS product DUF4367 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990693.1 protein_id gnl|my_center|LOCUS_03910 462514 461408 gene locus_tag LOCUS_03920 462514 461408 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024205.1 protein_id gnl|my_center|LOCUS_03920 463234 465273 gene locus_tag LOCUS_03930 463234 465273 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021871.1 protein_id gnl|my_center|LOCUS_03930 465505 465329 gene locus_tag LOCUS_03940 465505 465329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 465494 465964 gene locus_tag LOCUS_03950 465494 465964 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_03950 466307 467107 gene locus_tag LOCUS_03960 466307 467107 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990692.1 protein_id gnl|my_center|LOCUS_03960 467097 468140 gene locus_tag LOCUS_03970 467097 468140 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024201.1 protein_id gnl|my_center|LOCUS_03970 468251 468994 gene locus_tag LOCUS_03980 468251 468994 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024200.1 protein_id gnl|my_center|LOCUS_03980 469727 469212 gene locus_tag LOCUS_03990 469727 469212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 469938 470171 gene locus_tag LOCUS_04000 469938 470171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04000 470185 470361 gene locus_tag LOCUS_04010 470185 470361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04010 471688 470573 gene locus_tag LOCUS_04020 471688 470573 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024205.1 protein_id gnl|my_center|LOCUS_04020 471809 472597 gene locus_tag LOCUS_04030 471809 472597 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024199.1 protein_id gnl|my_center|LOCUS_04030 472773 474260 gene locus_tag LOCUS_04040 472773 474260 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860393.1 protein_id gnl|my_center|LOCUS_04040 475320 474349 gene locus_tag LOCUS_04050 475320 474349 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021352.1 protein_id gnl|my_center|LOCUS_04050 475508 475320 gene locus_tag LOCUS_04060 475508 475320 CDS product YHS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755969.1 protein_id gnl|my_center|LOCUS_04060 476148 478814 gene locus_tag LOCUS_04070 476148 478814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 480038 479046 gene locus_tag LOCUS_04080 480038 479046 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024160.1 protein_id gnl|my_center|LOCUS_04080 480222 480094 gene locus_tag LOCUS_04090 480222 480094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 481884 481567 gene locus_tag LOCUS_04100 gene rpl12p 481884 481567 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024158.1 protein_id gnl|my_center|LOCUS_04100 482964 481924 gene locus_tag LOCUS_04110 482964 481924 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024157.1 protein_id gnl|my_center|LOCUS_04110 483606 482965 gene locus_tag LOCUS_04120 483606 482965 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024156.1 protein_id gnl|my_center|LOCUS_04120 484331 483846 gene locus_tag LOCUS_04130 484331 483846 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024155.1 protein_id gnl|my_center|LOCUS_04130 484909 484451 gene locus_tag LOCUS_04140 484909 484451 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065945.1 protein_id gnl|my_center|LOCUS_04140 485121 484906 gene locus_tag LOCUS_04150 485121 484906 CDS product protein translocase SEC61 complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024153.1 protein_id gnl|my_center|LOCUS_04150 486672 485548 gene locus_tag LOCUS_04160 gene ftsZ 486672 485548 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024152.1 protein_id gnl|my_center|LOCUS_04160 487751 487161 gene locus_tag LOCUS_04170 487751 487161 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024150.1 protein_id gnl|my_center|LOCUS_04170 489158 487896 gene locus_tag LOCUS_04180 489158 487896 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048136943.1 protein_id gnl|my_center|LOCUS_04180 489249 489734 gene locus_tag LOCUS_04190 489249 489734 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065943.1 protein_id gnl|my_center|LOCUS_04190 490964 490026 gene locus_tag LOCUS_04200 490964 490026 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024147.1 protein_id gnl|my_center|LOCUS_04200 491168 492196 gene locus_tag LOCUS_04210 491168 492196 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024146.1 protein_id gnl|my_center|LOCUS_04210 493690 492368 gene locus_tag LOCUS_04220 493690 492368 CDS product isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024145.1 protein_id gnl|my_center|LOCUS_04220 494503 495057 gene locus_tag LOCUS_04230 gene cbiT 494503 495057 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024144.1 protein_id gnl|my_center|LOCUS_04230 495146 495754 gene locus_tag LOCUS_04240 495146 495754 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024143.1 protein_id gnl|my_center|LOCUS_04240 495897 496625 gene locus_tag LOCUS_04250 495897 496625 CDS product cobalt-precorrin-4/precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024142.1 protein_id gnl|my_center|LOCUS_04250 496766 497161 gene locus_tag LOCUS_04260 496766 497161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 497255 497608 gene locus_tag LOCUS_04270 497255 497608 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990686.1 protein_id gnl|my_center|LOCUS_04270 497577 498374 gene locus_tag LOCUS_04280 gene cobJ 497577 498374 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024141.1 protein_id gnl|my_center|LOCUS_04280 498364 499095 gene locus_tag LOCUS_04290 498364 499095 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024140.1 protein_id gnl|my_center|LOCUS_04290 499295 499723 gene locus_tag LOCUS_04300 499295 499723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024138.1 protein_id gnl|my_center|LOCUS_04300 500442 499792 gene locus_tag LOCUS_04310 500442 499792 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024137.1 protein_id gnl|my_center|LOCUS_04310 501121 500591 gene locus_tag LOCUS_04320 501121 500591 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024136.1 protein_id gnl|my_center|LOCUS_04320 502311 501469 gene locus_tag LOCUS_04330 502311 501469 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024128.1 protein_id gnl|my_center|LOCUS_04330 502710 502372 gene locus_tag LOCUS_04340 502710 502372 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024127.1 protein_id gnl|my_center|LOCUS_04340 502919 503290 gene locus_tag LOCUS_04350 502919 503290 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024126.1 protein_id gnl|my_center|LOCUS_04350 503405 503770 gene locus_tag LOCUS_04360 503405 503770 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065940.1 protein_id gnl|my_center|LOCUS_04360 503812 504666 gene locus_tag LOCUS_04370 503812 504666 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024124.1 protein_id gnl|my_center|LOCUS_04370 504663 505595 gene locus_tag LOCUS_04380 504663 505595 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024123.1 protein_id gnl|my_center|LOCUS_04380 505800 506495 gene locus_tag LOCUS_04390 505800 506495 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024122.1 protein_id gnl|my_center|LOCUS_04390 506687 507220 gene locus_tag LOCUS_04400 506687 507220 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024121.1 protein_id gnl|my_center|LOCUS_04400 507270 507722 gene locus_tag LOCUS_04410 507270 507722 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024120.1 protein_id gnl|my_center|LOCUS_04410 508685 507783 gene locus_tag LOCUS_04420 gene hdrB 508685 507783 CDS product CoB--CoM heterodisulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024119.1 protein_id gnl|my_center|LOCUS_04420 509184 508699 gene locus_tag LOCUS_04430 gene hdrC 509184 508699 CDS product CoB--CoM heterodisulfide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024118.1 protein_id gnl|my_center|LOCUS_04430 510533 509826 gene locus_tag LOCUS_04440 gene npdG 510533 509826 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279215.1 protein_id gnl|my_center|LOCUS_04440 510969 512732 gene locus_tag LOCUS_04450 510969 512732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 513366 512827 gene locus_tag LOCUS_04460 513366 512827 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024115.1 protein_id gnl|my_center|LOCUS_04460 514570 513884 gene locus_tag LOCUS_04470 514570 513884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 514901 516103 gene locus_tag LOCUS_04480 514901 516103 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065939.1 protein_id gnl|my_center|LOCUS_04480 516993 516268 gene locus_tag LOCUS_04490 516993 516268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 517234 517019 gene locus_tag LOCUS_04500 517234 517019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021546.1 protein_id gnl|my_center|LOCUS_04500 517480 517340 gene locus_tag LOCUS_04510 517480 517340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 517864 519015 gene locus_tag LOCUS_04520 517864 519015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 519389 521743 gene locus_tag LOCUS_04530 519389 521743 CDS product DUF3160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990739.1 protein_id gnl|my_center|LOCUS_04530 521839 522231 gene locus_tag LOCUS_04540 521839 522231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04540 522228 523016 gene locus_tag LOCUS_04550 522228 523016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04550 523616 524923 gene locus_tag LOCUS_04560 523616 524923 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065539.1 protein_id gnl|my_center|LOCUS_04560 524940 526163 gene locus_tag LOCUS_04570 524940 526163 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023495.1 protein_id gnl|my_center|LOCUS_04570 526165 526875 gene locus_tag LOCUS_04580 526165 526875 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066512.1 protein_id gnl|my_center|LOCUS_04580 527067 527273 gene locus_tag LOCUS_04590 527067 527273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 527264 527818 gene locus_tag LOCUS_04600 527264 527818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 528921 527884 gene locus_tag LOCUS_04610 528921 527884 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024104.1 protein_id gnl|my_center|LOCUS_04610 529671 528928 gene locus_tag LOCUS_04620 529671 528928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024103.1 protein_id gnl|my_center|LOCUS_04620 531185 529674 gene locus_tag LOCUS_04630 531185 529674 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024102.1 protein_id gnl|my_center|LOCUS_04630 532234 531182 gene locus_tag LOCUS_04640 532234 531182 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065933.1 protein_id gnl|my_center|LOCUS_04640 534372 533029 gene locus_tag LOCUS_04650 gene glnA 534372 533029 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024100.1 protein_id gnl|my_center|LOCUS_04650 535420 535193 gene locus_tag LOCUS_04660 535420 535193 CDS product DUF1059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024097.1 protein_id gnl|my_center|LOCUS_04660 535860 535552 gene locus_tag LOCUS_04670 535860 535552 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065931.1 protein_id gnl|my_center|LOCUS_04670 536224 535925 gene locus_tag LOCUS_04680 536224 535925 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065930.1 protein_id gnl|my_center|LOCUS_04680 536867 536436 gene locus_tag LOCUS_04690 536867 536436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024094.1 protein_id gnl|my_center|LOCUS_04690 537291 536944 gene locus_tag LOCUS_04700 537291 536944 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024093.1 protein_id gnl|my_center|LOCUS_04700 538702 537293 gene locus_tag LOCUS_04710 538702 537293 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024092.1 protein_id gnl|my_center|LOCUS_04710 539367 540158 gene locus_tag LOCUS_04720 539367 540158 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187151961.1 protein_id gnl|my_center|LOCUS_04720 540319 541575 gene locus_tag LOCUS_04730 540319 541575 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065858.1 protein_id gnl|my_center|LOCUS_04730 542945 541716 gene locus_tag LOCUS_04740 542945 541716 CDS product MEDS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990901.1 protein_id gnl|my_center|LOCUS_04740 543864 543697 gene locus_tag LOCUS_04750 543864 543697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 544064 544261 gene locus_tag LOCUS_04760 544064 544261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04760 544607 545215 gene locus_tag LOCUS_04770 544607 545215 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023860.1 protein_id gnl|my_center|LOCUS_04770 545346 546083 gene locus_tag LOCUS_04780 545346 546083 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023861.1 protein_id gnl|my_center|LOCUS_04780 547962 546226 gene locus_tag LOCUS_04790 547962 546226 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065860.1 protein_id gnl|my_center|LOCUS_04790 548543 548304 gene locus_tag LOCUS_04800 548543 548304 CDS product MTH865 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023863.1 protein_id gnl|my_center|LOCUS_04800 549568 548825 gene locus_tag LOCUS_04810 549568 548825 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023864.1 protein_id gnl|my_center|LOCUS_04810 549724 549575 gene locus_tag LOCUS_04820 549724 549575 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065861.1 protein_id gnl|my_center|LOCUS_04820 550274 551620 gene locus_tag LOCUS_04830 gene purB 550274 551620 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066555.1 protein_id gnl|my_center|LOCUS_04830 554565 552937 gene locus_tag LOCUS_04840 554565 552937 CDS product methylamine methyltransferase corrinoid protein reductive activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065863.1 protein_id gnl|my_center|LOCUS_04840 555357 555443 gene locus_tag LOCUS_t00090 555357 555443 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 555638 556336 gene locus_tag LOCUS_04850 555638 556336 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023868.1 protein_id gnl|my_center|LOCUS_04850 556799 559318 gene locus_tag LOCUS_04860 556799 559318 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990674.1 protein_id gnl|my_center|LOCUS_04860 559331 561280 gene locus_tag LOCUS_04870 559331 561280 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065864.1 protein_id gnl|my_center|LOCUS_04870 561395 562012 gene locus_tag LOCUS_04880 561395 562012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860363.1 protein_id gnl|my_center|LOCUS_04880 563044 562205 gene locus_tag LOCUS_04890 gene ablB 563044 562205 CDS product putative beta-lysine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023872.1 protein_id gnl|my_center|LOCUS_04890 564509 563250 gene locus_tag LOCUS_04900 gene ablA 564509 563250 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023873.1 protein_id gnl|my_center|LOCUS_04900 565086 567077 gene locus_tag LOCUS_04910 565086 567077 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023875.1 protein_id gnl|my_center|LOCUS_04910 567394 568089 gene locus_tag LOCUS_04920 567394 568089 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296409.1 protein_id gnl|my_center|LOCUS_04920 568086 568820 gene locus_tag LOCUS_04930 568086 568820 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296408.1 protein_id gnl|my_center|LOCUS_04930 568810 569175 gene locus_tag LOCUS_04940 568810 569175 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295200.1 protein_id gnl|my_center|LOCUS_04940 569328 569525 gene locus_tag LOCUS_04950 569328 569525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065699.1 protein_id gnl|my_center|LOCUS_04950 569541 569798 gene locus_tag LOCUS_04960 569541 569798 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048126569.1 protein_id gnl|my_center|LOCUS_04960 570876 571604 gene locus_tag LOCUS_04970 570876 571604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 571606 572703 gene locus_tag LOCUS_04980 571606 572703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 573001 573396 gene locus_tag LOCUS_04990 573001 573396 CDS product DUF2178 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023877.1 protein_id gnl|my_center|LOCUS_04990 573386 573589 gene locus_tag LOCUS_05000 573386 573589 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023878.1 protein_id gnl|my_center|LOCUS_05000 573999 574178 gene locus_tag LOCUS_05010 573999 574178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065866.1 protein_id gnl|my_center|LOCUS_05010 574421 574597 gene locus_tag LOCUS_05020 574421 574597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065867.1 protein_id gnl|my_center|LOCUS_05020 575667 574792 gene locus_tag LOCUS_05030 gene speB 575667 574792 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023880.1 protein_id gnl|my_center|LOCUS_05030 576131 575745 gene locus_tag LOCUS_05040 576131 575745 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023881.1 protein_id gnl|my_center|LOCUS_05040 578318 576597 gene locus_tag LOCUS_05050 578318 576597 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023883.1 protein_id gnl|my_center|LOCUS_05050 578483 578920 gene locus_tag LOCUS_05060 578483 578920 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023884.1 protein_id gnl|my_center|LOCUS_05060 579684 579052 gene locus_tag LOCUS_05070 579684 579052 CDS product matrixin family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066558.1 protein_id gnl|my_center|LOCUS_05070 580596 580102 gene locus_tag LOCUS_05080 580596 580102 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065868.1 protein_id gnl|my_center|LOCUS_05080 581675 580740 gene locus_tag LOCUS_05090 581675 580740 CDS product methanogenesis marker 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023887.1 protein_id gnl|my_center|LOCUS_05090 582276 581677 gene locus_tag LOCUS_05100 582276 581677 CDS product methanogenesis marker 17 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023888.1 protein_id gnl|my_center|LOCUS_05100 583531 582284 gene locus_tag LOCUS_05110 583531 582284 CDS product methanogenesis marker 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023889.1 protein_id gnl|my_center|LOCUS_05110 584031 583528 gene locus_tag LOCUS_05120 584031 583528 CDS product methanogenesis marker 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066559.1 protein_id gnl|my_center|LOCUS_05120 584480 584037 gene locus_tag LOCUS_05130 584480 584037 CDS product methanogenesis marker 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065869.1 protein_id gnl|my_center|LOCUS_05130 586227 584635 gene locus_tag LOCUS_05140 586227 584635 CDS product methanogenesis marker 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023892.1 protein_id gnl|my_center|LOCUS_05140 587882 586269 gene locus_tag LOCUS_05150 gene atwA 587882 586269 CDS product methyl coenzyme M reductase system, component A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023893.1 protein_id gnl|my_center|LOCUS_05150 588931 588131 gene locus_tag LOCUS_05160 588931 588131 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023894.1 protein_id gnl|my_center|LOCUS_05160 589943 589050 gene locus_tag LOCUS_05170 589943 589050 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065870.1 protein_id gnl|my_center|LOCUS_05170 590462 590797 gene locus_tag LOCUS_05180 590462 590797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065871.1 protein_id gnl|my_center|LOCUS_05180 591791 592093 gene locus_tag LOCUS_05190 591791 592093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023897.1 protein_id gnl|my_center|LOCUS_05190 592657 593673 gene locus_tag LOCUS_05200 gene fen 592657 593673 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023899.1 protein_id gnl|my_center|LOCUS_05200 593786 594793 gene locus_tag LOCUS_05210 593786 594793 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023900.1 protein_id gnl|my_center|LOCUS_05210 595803 594841 gene locus_tag LOCUS_05220 595803 594841 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065872.1 protein_id gnl|my_center|LOCUS_05220 597646 596099 gene locus_tag LOCUS_05230 gene gpmI 597646 596099 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065873.1 protein_id gnl|my_center|LOCUS_05230 597920 598528 gene locus_tag LOCUS_05240 597920 598528 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023903.1 protein_id gnl|my_center|LOCUS_05240 598767 599606 gene locus_tag LOCUS_05250 598767 599606 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021378.1 protein_id gnl|my_center|LOCUS_05250 602462 599628 gene locus_tag LOCUS_05260 602462 599628 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169981.1 protein_id gnl|my_center|LOCUS_05260 603431 604354 gene locus_tag LOCUS_05270 603431 604354 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023905.1 protein_id gnl|my_center|LOCUS_05270 605217 604597 gene locus_tag LOCUS_05280 605217 604597 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048173813.1 protein_id gnl|my_center|LOCUS_05280 607707 606091 gene locus_tag LOCUS_05290 gene purH 607707 606091 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023907.1 protein_id gnl|my_center|LOCUS_05290 608104 609456 gene locus_tag LOCUS_05300 608104 609456 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023908.1 protein_id gnl|my_center|LOCUS_05300 609597 610301 gene locus_tag LOCUS_05310 gene nth 609597 610301 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065874.1 protein_id gnl|my_center|LOCUS_05310 610767 610462 gene locus_tag LOCUS_05320 610767 610462 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065875.1 protein_id gnl|my_center|LOCUS_05320 611429 610764 gene locus_tag LOCUS_05330 gene cbiM 611429 610764 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065876.1 protein_id gnl|my_center|LOCUS_05330 612149 614311 gene locus_tag LOCUS_05340 612149 614311 CDS product MEDS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860366.1 protein_id gnl|my_center|LOCUS_05340 615349 614543 gene locus_tag LOCUS_05350 gene cbiQ 615349 614543 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023913.1 protein_id gnl|my_center|LOCUS_05350 616386 615403 gene locus_tag LOCUS_05360 616386 615403 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023914.1 protein_id gnl|my_center|LOCUS_05360 616714 617811 gene locus_tag LOCUS_05370 gene dinB 616714 617811 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066563.1 protein_id gnl|my_center|LOCUS_05370 618263 618517 gene locus_tag LOCUS_05380 618263 618517 CDS product protease inhibitor I42 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023922.1 protein_id gnl|my_center|LOCUS_05380 620602 618698 gene locus_tag LOCUS_05390 620602 618698 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250266.1 protein_id gnl|my_center|LOCUS_05390 621952 621506 gene locus_tag LOCUS_05400 621952 621506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 622823 622026 gene locus_tag LOCUS_05410 622823 622026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 623512 623327 gene locus_tag LOCUS_05420 623512 623327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 624303 623755 gene locus_tag LOCUS_05430 624303 623755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 624694 624494 gene locus_tag LOCUS_05440 624694 624494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 625627 624818 gene locus_tag LOCUS_05450 625627 624818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 626252 626043 gene locus_tag LOCUS_05460 626252 626043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 627353 626616 gene locus_tag LOCUS_05470 627353 626616 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990678.1 protein_id gnl|my_center|LOCUS_05470 628674 628297 gene locus_tag LOCUS_05480 628674 628297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023931.1 protein_id gnl|my_center|LOCUS_05480 629581 628832 gene locus_tag LOCUS_05490 629581 628832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 630745 630557 gene locus_tag LOCUS_05500 630745 630557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 631736 630915 gene locus_tag LOCUS_05510 631736 630915 CDS product Dna2/Cas4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065883.1 protein_id gnl|my_center|LOCUS_05510 631875 632615 gene locus_tag LOCUS_05520 631875 632615 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023933.1 protein_id gnl|my_center|LOCUS_05520 632612 633706 gene locus_tag LOCUS_05530 632612 633706 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023934.1 protein_id gnl|my_center|LOCUS_05530 633723 634895 gene locus_tag LOCUS_05540 633723 634895 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_05540 634902 635300 gene locus_tag LOCUS_05550 634902 635300 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023936.1 protein_id gnl|my_center|LOCUS_05550 635385 635915 gene locus_tag LOCUS_05560 gene cyaB 635385 635915 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023937.1 protein_id gnl|my_center|LOCUS_05560 636116 636580 gene locus_tag LOCUS_05570 636116 636580 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020282.1 protein_id gnl|my_center|LOCUS_05570 638828 636693 gene locus_tag LOCUS_05580 gene metG 638828 636693 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065884.1 protein_id gnl|my_center|LOCUS_05580 639098 640390 gene locus_tag LOCUS_05590 gene sppA 639098 640390 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065885.1 protein_id gnl|my_center|LOCUS_05590 640516 641778 gene locus_tag LOCUS_05600 gene serS 640516 641778 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023941.1 protein_id gnl|my_center|LOCUS_05600 642881 642318 gene locus_tag LOCUS_05610 642881 642318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 643906 644370 gene locus_tag LOCUS_05620 gene tnpA 643906 644370 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979974.1 protein_id gnl|my_center|LOCUS_05620 646443 644467 gene locus_tag LOCUS_05630 646443 644467 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065886.1 protein_id gnl|my_center|LOCUS_05630 647246 646440 gene locus_tag LOCUS_05640 647246 646440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065887.1 protein_id gnl|my_center|LOCUS_05640 648495 647299 gene locus_tag LOCUS_05650 648495 647299 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_05650 649538 648492 gene locus_tag LOCUS_05660 649538 648492 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990904.1 protein_id gnl|my_center|LOCUS_05660 652161 650014 gene locus_tag LOCUS_05670 gene purL 652161 650014 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023948.1 protein_id gnl|my_center|LOCUS_05670 652872 652633 gene locus_tag LOCUS_05680 652872 652633 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023950.1 protein_id gnl|my_center|LOCUS_05680 653414 653722 gene locus_tag LOCUS_05690 gene yciH 653414 653722 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023951.1 protein_id gnl|my_center|LOCUS_05690 653928 654293 gene locus_tag LOCUS_05700 653928 654293 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023952.1 protein_id gnl|my_center|LOCUS_05700 654290 655516 gene locus_tag LOCUS_05710 654290 655516 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023953.1 protein_id gnl|my_center|LOCUS_05710 656416 655703 gene locus_tag LOCUS_05720 656416 655703 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065889.1 protein_id gnl|my_center|LOCUS_05720 656896 658182 gene locus_tag LOCUS_05730 656896 658182 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023956.1 protein_id gnl|my_center|LOCUS_05730 658179 658919 gene locus_tag LOCUS_05740 658179 658919 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023957.1 protein_id gnl|my_center|LOCUS_05740 659066 660190 gene locus_tag LOCUS_05750 gene tnpB 659066 660190 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_05750 660627 660334 gene locus_tag LOCUS_05760 660627 660334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 660721 661086 gene locus_tag LOCUS_05770 660721 661086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065890.1 protein_id gnl|my_center|LOCUS_05770 661399 661632 gene locus_tag LOCUS_05780 661399 661632 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065891.1 protein_id gnl|my_center|LOCUS_05780 662372 661890 gene locus_tag LOCUS_05790 662372 661890 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023960.1 protein_id gnl|my_center|LOCUS_05790 663545 662565 gene locus_tag LOCUS_05800 663545 662565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990679.1 protein_id gnl|my_center|LOCUS_05800 663748 664077 gene locus_tag LOCUS_05810 663748 664077 CDS product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065892.1 protein_id gnl|my_center|LOCUS_05810 664723 664088 gene locus_tag LOCUS_05820 664723 664088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 665010 664723 gene locus_tag LOCUS_05830 665010 664723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 665774 665238 gene locus_tag LOCUS_05840 665774 665238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 666127 666723 gene locus_tag LOCUS_05850 666127 666723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022824.1 protein_id gnl|my_center|LOCUS_05850 666760 667089 gene locus_tag LOCUS_05860 666760 667089 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022825.1 protein_id gnl|my_center|LOCUS_05860 667108 667506 gene locus_tag LOCUS_05870 667108 667506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048124573.1 protein_id gnl|my_center|LOCUS_05870 667738 669096 gene locus_tag LOCUS_05880 gene ftsA 667738 669096 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755965.1 protein_id gnl|my_center|LOCUS_05880 669422 669844 gene locus_tag LOCUS_05890 gene nikR 669422 669844 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023967.1 protein_id gnl|my_center|LOCUS_05890 670310 669945 gene locus_tag LOCUS_05900 670310 669945 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065894.1 protein_id gnl|my_center|LOCUS_05900 672007 670553 gene locus_tag LOCUS_05910 672007 670553 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065895.1 protein_id gnl|my_center|LOCUS_05910 673604 672591 gene locus_tag LOCUS_05920 673604 672591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 674058 674318 gene locus_tag LOCUS_05930 674058 674318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 675293 676732 gene locus_tag LOCUS_05940 675293 676732 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589538.1 protein_id gnl|my_center|LOCUS_05940 677233 676964 gene locus_tag LOCUS_05950 677233 676964 CDS product DUF3303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065897.1 protein_id gnl|my_center|LOCUS_05950 679074 677755 gene locus_tag LOCUS_05960 679074 677755 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023973.1 protein_id gnl|my_center|LOCUS_05960 679335 682064 gene locus_tag LOCUS_05970 679335 682064 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023974.1 protein_id gnl|my_center|LOCUS_05970 683161 682160 gene locus_tag LOCUS_05980 683161 682160 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023975.1 protein_id gnl|my_center|LOCUS_05980 684165 683494 gene locus_tag LOCUS_05990 684165 683494 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023976.1 protein_id gnl|my_center|LOCUS_05990 685846 684260 gene locus_tag LOCUS_06000 685846 684260 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023977.1 protein_id gnl|my_center|LOCUS_06000 685925 686218 gene locus_tag LOCUS_06010 685925 686218 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023978.1 protein_id gnl|my_center|LOCUS_06010 686238 687431 gene locus_tag LOCUS_06020 686238 687431 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023979.1 protein_id gnl|my_center|LOCUS_06020 687665 687967 gene locus_tag LOCUS_06030 gene crcB 687665 687967 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066568.1 protein_id gnl|my_center|LOCUS_06030 687971 688339 gene locus_tag LOCUS_06040 gene crcB 687971 688339 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065899.1 protein_id gnl|my_center|LOCUS_06040 688698 688525 gene locus_tag LOCUS_06050 688698 688525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 689114 689836 gene locus_tag LOCUS_06060 689114 689836 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023983.1 protein_id gnl|my_center|LOCUS_06060 690133 690552 gene locus_tag LOCUS_06070 690133 690552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095642884.1 protein_id gnl|my_center|LOCUS_06070 691385 690687 gene locus_tag LOCUS_06080 691385 690687 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023984.1 protein_id gnl|my_center|LOCUS_06080 692389 691538 gene locus_tag LOCUS_06090 692389 691538 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023985.1 protein_id gnl|my_center|LOCUS_06090 692929 692471 gene locus_tag LOCUS_06100 692929 692471 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023986.1 protein_id gnl|my_center|LOCUS_06100 694058 692949 gene locus_tag LOCUS_06110 694058 692949 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023987.1 protein_id gnl|my_center|LOCUS_06110 694734 695051 gene locus_tag LOCUS_06120 694734 695051 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066569.1 protein_id gnl|my_center|LOCUS_06120 695134 695586 gene locus_tag LOCUS_06130 695134 695586 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023990.1 protein_id gnl|my_center|LOCUS_06130 696202 695786 gene locus_tag LOCUS_06140 696202 695786 CDS product DUF356 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023991.1 protein_id gnl|my_center|LOCUS_06140 696403 696612 gene locus_tag LOCUS_06150 696403 696612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 697098 698441 gene locus_tag LOCUS_06160 697098 698441 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023992.1 protein_id gnl|my_center|LOCUS_06160 698596 699753 gene locus_tag LOCUS_06170 gene proB 698596 699753 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023993.1 protein_id gnl|my_center|LOCUS_06170 700013 700825 gene locus_tag LOCUS_06180 gene proC 700013 700825 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_06180 702132 701446 gene locus_tag LOCUS_06190 702132 701446 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_06190 702511 703416 gene locus_tag LOCUS_06200 702511 703416 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023996.1 protein_id gnl|my_center|LOCUS_06200 703443 704543 gene locus_tag LOCUS_06210 703443 704543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990681.1 protein_id gnl|my_center|LOCUS_06210 704749 704928 gene locus_tag LOCUS_06220 704749 704928 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023998.1 protein_id gnl|my_center|LOCUS_06220 706418 705153 gene locus_tag LOCUS_06230 gene ftsY 706418 705153 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024000.1 protein_id gnl|my_center|LOCUS_06230 707032 706604 gene locus_tag LOCUS_06240 gene pfdA 707032 706604 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024001.1 protein_id gnl|my_center|LOCUS_06240 707217 707038 gene locus_tag LOCUS_06250 gene rpl18a 707217 707038 CDS product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024002.1 protein_id gnl|my_center|LOCUS_06250 707923 707264 gene locus_tag LOCUS_06260 707923 707264 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024003.1 protein_id gnl|my_center|LOCUS_06260 708224 707955 gene locus_tag LOCUS_06270 708224 707955 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024004.1 protein_id gnl|my_center|LOCUS_06270 709275 708631 gene locus_tag LOCUS_06280 709275 708631 CDS product alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024006.1 protein_id gnl|my_center|LOCUS_06280 709637 709281 gene locus_tag LOCUS_06290 709637 709281 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024007.1 protein_id gnl|my_center|LOCUS_06290 710176 709727 gene locus_tag LOCUS_06300 710176 709727 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024008.1 protein_id gnl|my_center|LOCUS_06300 711741 710464 gene locus_tag LOCUS_06310 711741 710464 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024009.1 protein_id gnl|my_center|LOCUS_06310 712345 711983 gene locus_tag LOCUS_06320 712345 711983 CDS product TIGR00304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024010.1 protein_id gnl|my_center|LOCUS_06320 712587 712342 gene locus_tag LOCUS_06330 712587 712342 CDS product DUF131 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024011.1 protein_id gnl|my_center|LOCUS_06330 713352 714593 gene locus_tag LOCUS_06340 713352 714593 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289167.1 protein_id gnl|my_center|LOCUS_06340 714807 714882 gene locus_tag LOCUS_t00100 714807 714882 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 715221 716168 gene locus_tag LOCUS_06350 715221 716168 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065910.1 protein_id gnl|my_center|LOCUS_06350 716215 716667 gene locus_tag LOCUS_06360 716215 716667 CDS product DUF123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990683.1 protein_id gnl|my_center|LOCUS_06360 716833 718362 gene locus_tag LOCUS_06370 716833 718362 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065911.1 protein_id gnl|my_center|LOCUS_06370 719024 718710 gene locus_tag LOCUS_06380 719024 718710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 719916 719596 gene locus_tag LOCUS_06390 719916 719596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 720203 720117 gene locus_tag LOCUS_t00110 720203 720117 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 720363 720290 gene locus_tag LOCUS_t00120 720363 720290 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 720577 720377 gene locus_tag LOCUS_06400 720577 720377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 721229 721609 gene locus_tag LOCUS_06410 721229 721609 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024037.1 protein_id gnl|my_center|LOCUS_06410 721615 722472 gene locus_tag LOCUS_06420 721615 722472 CDS product geranylfarnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024038.1 protein_id gnl|my_center|LOCUS_06420 722606 723787 gene locus_tag LOCUS_06430 722606 723787 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065913.1 protein_id gnl|my_center|LOCUS_06430 724801 725130 gene locus_tag LOCUS_06440 gene ahaH 724801 725130 CDS product ATP synthase archaeal subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024040.1 protein_id gnl|my_center|LOCUS_06440 725123 727069 gene locus_tag LOCUS_06450 725123 727069 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589509.1 protein_id gnl|my_center|LOCUS_06450 727074 727322 gene locus_tag LOCUS_06460 727074 727322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024042.1 protein_id gnl|my_center|LOCUS_06460 727523 728074 gene locus_tag LOCUS_06470 727523 728074 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024043.1 protein_id gnl|my_center|LOCUS_06470 728081 729163 gene locus_tag LOCUS_06480 728081 729163 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024044.1 protein_id gnl|my_center|LOCUS_06480 729163 729468 gene locus_tag LOCUS_06490 729163 729468 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024045.1 protein_id gnl|my_center|LOCUS_06490 729459 731195 gene locus_tag LOCUS_06500 729459 731195 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024046.1 protein_id gnl|my_center|LOCUS_06500 731198 732580 gene locus_tag LOCUS_06510 731198 732580 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024047.1 protein_id gnl|my_center|LOCUS_06510 732577 733215 gene locus_tag LOCUS_06520 732577 733215 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024048.1 protein_id gnl|my_center|LOCUS_06520 733614 735893 gene locus_tag LOCUS_06530 gene hypF 733614 735893 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024049.1 protein_id gnl|my_center|LOCUS_06530 736053 736508 gene locus_tag LOCUS_06540 736053 736508 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024050.1 protein_id gnl|my_center|LOCUS_06540 738225 736570 gene locus_tag LOCUS_06550 738225 736570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024051.1 protein_id gnl|my_center|LOCUS_06550 738677 738871 gene locus_tag LOCUS_06560 738677 738871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 739799 739990 gene locus_tag LOCUS_06570 739799 739990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024056.1 protein_id gnl|my_center|LOCUS_06570 740989 741396 gene locus_tag LOCUS_06580 740989 741396 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024057.1 protein_id gnl|my_center|LOCUS_06580 744000 741991 gene locus_tag LOCUS_06590 744000 741991 CDS product MASE3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020667.1 protein_id gnl|my_center|LOCUS_06590 744190 743963 gene locus_tag LOCUS_06600 744190 743963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 744341 744613 gene locus_tag LOCUS_06610 744341 744613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 745057 744827 gene locus_tag LOCUS_06620 gene chaB 745057 744827 CDS product putative cation transport regulator ChaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146392.1 protein_id gnl|my_center|LOCUS_06620 747482 745644 gene locus_tag LOCUS_06630 747482 745644 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023330.1 protein_id gnl|my_center|LOCUS_06630 748687 748109 gene locus_tag LOCUS_06640 748687 748109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 749527 749120 gene locus_tag LOCUS_06650 749527 749120 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066574.1 protein_id gnl|my_center|LOCUS_06650 750851 749958 gene locus_tag LOCUS_06660 750851 749958 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024060.1 protein_id gnl|my_center|LOCUS_06660 751103 751999 gene locus_tag LOCUS_06670 gene tnpB 751103 751999 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06670 752565 753680 gene locus_tag LOCUS_06680 gene tnpB 752565 753680 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_06680 754151 754822 gene locus_tag LOCUS_06690 754151 754822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990583.1 protein_id gnl|my_center|LOCUS_06690 756662 757180 gene locus_tag LOCUS_06700 756662 757180 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022769.1 protein_id gnl|my_center|LOCUS_06700 758416 757403 gene locus_tag LOCUS_06710 758416 757403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 760391 761656 gene locus_tag LOCUS_06720 760391 761656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 762342 762175 gene locus_tag LOCUS_06730 762342 762175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 762562 762491 gene locus_tag LOCUS_t00130 762562 762491 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 763158 762748 gene locus_tag LOCUS_06740 763158 762748 CDS product chorismate pyruvate-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024074.1 protein_id gnl|my_center|LOCUS_06740 763655 763341 gene locus_tag LOCUS_06750 763655 763341 CDS product DUF5611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065922.1 protein_id gnl|my_center|LOCUS_06750 764172 764573 gene locus_tag LOCUS_06760 764172 764573 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024076.1 protein_id gnl|my_center|LOCUS_06760 766089 764686 gene locus_tag LOCUS_06770 766089 764686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 766666 766097 gene locus_tag LOCUS_06780 766666 766097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 767160 766762 gene locus_tag LOCUS_06790 gene rsbT 767160 766762 CDS product serine/threonine-protein kinase RsbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246640.1 protein_id gnl|my_center|LOCUS_06790 767730 767347 gene locus_tag LOCUS_06800 767730 767347 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883996.1 protein_id gnl|my_center|LOCUS_06800 768550 767735 gene locus_tag LOCUS_06810 768550 767735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 768961 769263 gene locus_tag LOCUS_06820 768961 769263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065924.1 protein_id gnl|my_center|LOCUS_06820 770398 769418 gene locus_tag LOCUS_06830 770398 769418 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024078.1 protein_id gnl|my_center|LOCUS_06830 770884 771060 gene locus_tag LOCUS_06840 770884 771060 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024079.1 protein_id gnl|my_center|LOCUS_06840 772150 771179 gene locus_tag LOCUS_06850 gene nifB 772150 771179 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024080.1 protein_id gnl|my_center|LOCUS_06850 772891 772529 gene locus_tag LOCUS_06860 gene queD 772891 772529 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065925.1 protein_id gnl|my_center|LOCUS_06860 773820 773053 gene locus_tag LOCUS_06870 773820 773053 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024082.1 protein_id gnl|my_center|LOCUS_06870 774381 773821 gene locus_tag LOCUS_06880 774381 773821 CDS product DUF366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024083.1 protein_id gnl|my_center|LOCUS_06880 775161 774466 gene locus_tag LOCUS_06890 gene queC 775161 774466 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024084.1 protein_id gnl|my_center|LOCUS_06890 775380 775880 gene locus_tag LOCUS_06900 775380 775880 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024085.1 protein_id gnl|my_center|LOCUS_06900 776352 776507 gene locus_tag LOCUS_06910 776352 776507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06910 776745 780047 gene locus_tag LOCUS_06920 776745 780047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 780906 780205 gene locus_tag LOCUS_06930 780906 780205 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024087.1 protein_id gnl|my_center|LOCUS_06930 783053 781125 gene locus_tag LOCUS_06940 783053 781125 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024088.1 protein_id gnl|my_center|LOCUS_06940 783965 784174 gene locus_tag LOCUS_06950 783965 784174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06950 784304 784555 gene locus_tag LOCUS_06960 784304 784555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06960 784666 785094 gene locus_tag LOCUS_06970 784666 785094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06970 785819 787111 gene locus_tag LOCUS_06980 785819 787111 CDS product glutathione-independent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020470.1 protein_id gnl|my_center|LOCUS_06980 787419 788120 gene locus_tag LOCUS_06990 787419 788120 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024089.1 protein_id gnl|my_center|LOCUS_06990 788369 788635 gene locus_tag LOCUS_07000 788369 788635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 788623 788847 gene locus_tag LOCUS_07010 788623 788847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 788938 789174 gene locus_tag LOCUS_07020 788938 789174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 791455 789698 gene locus_tag LOCUS_07030 791455 789698 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015951.1 protein_id gnl|my_center|LOCUS_07030 792405 791974 gene locus_tag LOCUS_07040 792405 791974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065853.1 protein_id gnl|my_center|LOCUS_07040 792688 793227 gene locus_tag LOCUS_07050 792688 793227 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065852.1 protein_id gnl|my_center|LOCUS_07050 793406 793558 gene locus_tag LOCUS_07060 793406 793558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 793635 793976 gene locus_tag LOCUS_07070 793635 793976 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023849.1 protein_id gnl|my_center|LOCUS_07070 794605 794246 gene locus_tag LOCUS_07080 794605 794246 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023848.1 protein_id gnl|my_center|LOCUS_07080 794963 795661 gene locus_tag LOCUS_07090 794963 795661 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023847.1 protein_id gnl|my_center|LOCUS_07090 796217 797500 gene locus_tag LOCUS_07100 796217 797500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990673.1 protein_id gnl|my_center|LOCUS_07100 797673 798038 gene locus_tag LOCUS_07110 797673 798038 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990672.1 protein_id gnl|my_center|LOCUS_07110 799192 798140 gene locus_tag LOCUS_07120 gene arsB 799192 798140 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860358.1 protein_id gnl|my_center|LOCUS_07120 800072 799185 gene locus_tag LOCUS_07130 800072 799185 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066553.1 protein_id gnl|my_center|LOCUS_07130 800655 800272 gene locus_tag LOCUS_07140 800655 800272 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065848.1 protein_id gnl|my_center|LOCUS_07140 800960 800727 gene locus_tag LOCUS_07150 800960 800727 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 protein_id gnl|my_center|LOCUS_07150 802136 801084 gene locus_tag LOCUS_07160 802136 801084 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023833.1 protein_id gnl|my_center|LOCUS_07160 802308 802126 gene locus_tag LOCUS_07170 802308 802126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 802429 802701 gene locus_tag LOCUS_07180 802429 802701 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461986.1 protein_id gnl|my_center|LOCUS_07180 802698 803042 gene locus_tag LOCUS_07190 802698 803042 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461986.1 protein_id gnl|my_center|LOCUS_07190 803336 804271 gene locus_tag LOCUS_07200 803336 804271 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430615.1 protein_id gnl|my_center|LOCUS_07200 804661 804377 gene locus_tag LOCUS_07210 804661 804377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023825.1 protein_id gnl|my_center|LOCUS_07210 805008 804712 gene locus_tag LOCUS_07220 gene tusB 805008 804712 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023824.1 protein_id gnl|my_center|LOCUS_07220 805367 805023 gene locus_tag LOCUS_07230 805367 805023 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023823.1 protein_id gnl|my_center|LOCUS_07230 805782 805408 gene locus_tag LOCUS_07240 805782 805408 CDS product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755961.1 protein_id gnl|my_center|LOCUS_07240 806648 805851 gene locus_tag LOCUS_07250 806648 805851 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066548.1 protein_id gnl|my_center|LOCUS_07250 808211 806994 gene locus_tag LOCUS_07260 808211 806994 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023814.1 protein_id gnl|my_center|LOCUS_07260 810020 808806 gene locus_tag LOCUS_07270 810020 808806 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023814.1 protein_id gnl|my_center|LOCUS_07270 811531 810338 gene locus_tag LOCUS_07280 811531 810338 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065844.1 protein_id gnl|my_center|LOCUS_07280 811887 811543 gene locus_tag LOCUS_07290 811887 811543 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065843.1 protein_id gnl|my_center|LOCUS_07290 812052 812981 gene locus_tag LOCUS_07300 812052 812981 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023811.1 protein_id gnl|my_center|LOCUS_07300 813468 813280 gene locus_tag LOCUS_07310 813468 813280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 814576 813866 gene locus_tag LOCUS_07320 814576 813866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065842.1 protein_id gnl|my_center|LOCUS_07320 814707 814841 gene locus_tag LOCUS_07330 814707 814841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 815847 814924 gene locus_tag LOCUS_07340 815847 814924 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279211.1 protein_id gnl|my_center|LOCUS_07340 816799 815834 gene locus_tag LOCUS_07350 816799 815834 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023804.1 protein_id gnl|my_center|LOCUS_07350 817713 816814 gene locus_tag LOCUS_07360 817713 816814 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048173735.1 protein_id gnl|my_center|LOCUS_07360 818665 817706 gene locus_tag LOCUS_07370 818665 817706 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023802.1 protein_id gnl|my_center|LOCUS_07370 820247 818676 gene locus_tag LOCUS_07380 820247 818676 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065840.1 protein_id gnl|my_center|LOCUS_07380 821071 820250 gene locus_tag LOCUS_07390 821071 820250 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023800.1 protein_id gnl|my_center|LOCUS_07390 822942 821812 gene locus_tag LOCUS_07400 822942 821812 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023799.1 protein_id gnl|my_center|LOCUS_07400 823627 822962 gene locus_tag LOCUS_07410 gene modB 823627 822962 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065838.1 protein_id gnl|my_center|LOCUS_07410 824466 823669 gene locus_tag LOCUS_07420 gene modA 824466 823669 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022259.1 protein_id gnl|my_center|LOCUS_07420 826049 824463 gene locus_tag LOCUS_07430 826049 824463 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023797.1 protein_id gnl|my_center|LOCUS_07430 827624 826062 gene locus_tag LOCUS_07440 gene nifE 827624 826062 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023796.1 protein_id gnl|my_center|LOCUS_07440 829131 827761 gene locus_tag LOCUS_07450 gene nifK 829131 827761 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023795.1 protein_id gnl|my_center|LOCUS_07450 830743 829145 gene locus_tag LOCUS_07460 gene nifD 830743 829145 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023794.1 protein_id gnl|my_center|LOCUS_07460 831123 830746 gene locus_tag LOCUS_07470 831123 830746 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023793.1 protein_id gnl|my_center|LOCUS_07470 831474 831148 gene locus_tag LOCUS_07480 831474 831148 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065837.1 protein_id gnl|my_center|LOCUS_07480 832329 831508 gene locus_tag LOCUS_07490 gene nifH 832329 831508 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023791.1 protein_id gnl|my_center|LOCUS_07490 832674 833864 gene locus_tag LOCUS_07500 832674 833864 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023790.1 protein_id gnl|my_center|LOCUS_07500 834336 834016 gene locus_tag LOCUS_07510 834336 834016 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023788.1 protein_id gnl|my_center|LOCUS_07510 834827 834504 gene locus_tag LOCUS_07520 834827 834504 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023788.1 protein_id gnl|my_center|LOCUS_07520 836057 835143 gene locus_tag LOCUS_07530 836057 835143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023787.1 protein_id gnl|my_center|LOCUS_07530 837668 836235 gene locus_tag LOCUS_07540 gene pyk 837668 836235 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066546.1 protein_id gnl|my_center|LOCUS_07540 838704 837781 gene locus_tag LOCUS_07550 838704 837781 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065835.1 protein_id gnl|my_center|LOCUS_07550 839241 839169 gene locus_tag LOCUS_t00140 839241 839169 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 839398 839324 gene locus_tag LOCUS_t00150 839398 839324 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 839580 839508 gene locus_tag LOCUS_t00160 839580 839508 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 842185 841136 gene locus_tag LOCUS_07560 842185 841136 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023783.1 protein_id gnl|my_center|LOCUS_07560 844138 842696 gene locus_tag LOCUS_07570 gene proS 844138 842696 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023782.1 protein_id gnl|my_center|LOCUS_07570 845113 844544 gene locus_tag LOCUS_07580 845113 844544 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023781.1 protein_id gnl|my_center|LOCUS_07580 845565 845185 gene locus_tag LOCUS_07590 gene sepF 845565 845185 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023780.1 protein_id gnl|my_center|LOCUS_07590 846223 845738 gene locus_tag LOCUS_07600 846223 845738 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023779.1 protein_id gnl|my_center|LOCUS_07600 847503 846340 gene locus_tag LOCUS_07610 847503 846340 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066545.1 protein_id gnl|my_center|LOCUS_07610 848785 847652 gene locus_tag LOCUS_07620 848785 847652 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065833.1 protein_id gnl|my_center|LOCUS_07620 849486 849316 gene locus_tag LOCUS_07630 849486 849316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 851845 849830 gene locus_tag LOCUS_07640 851845 849830 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023776.1 protein_id gnl|my_center|LOCUS_07640 852833 854863 gene locus_tag LOCUS_07650 852833 854863 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066544.1 protein_id gnl|my_center|LOCUS_07650 856035 855577 gene locus_tag LOCUS_07660 856035 855577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023774.1 protein_id gnl|my_center|LOCUS_07660 857553 856072 gene locus_tag LOCUS_07670 857553 856072 CDS product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023773.1 protein_id gnl|my_center|LOCUS_07670 858938 857757 gene locus_tag LOCUS_07680 gene ftsZ 858938 857757 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023772.1 protein_id gnl|my_center|LOCUS_07680 860004 859810 gene locus_tag LOCUS_07690 860004 859810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 859955 860632 gene locus_tag LOCUS_07700 859955 860632 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065832.1 protein_id gnl|my_center|LOCUS_07700 862669 860756 gene locus_tag LOCUS_07710 862669 860756 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023770.1 protein_id gnl|my_center|LOCUS_07710 863412 862780 gene locus_tag LOCUS_07720 gene psmB 863412 862780 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023769.1 protein_id gnl|my_center|LOCUS_07720 864197 863685 gene locus_tag LOCUS_07730 864197 863685 CDS product TIGR00295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023768.1 protein_id gnl|my_center|LOCUS_07730 864702 864208 gene locus_tag LOCUS_07740 864702 864208 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066543.1 protein_id gnl|my_center|LOCUS_07740 866022 864823 gene locus_tag LOCUS_07750 866022 864823 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023766.1 protein_id gnl|my_center|LOCUS_07750 867109 866045 gene locus_tag LOCUS_07760 867109 866045 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023765.1 protein_id gnl|my_center|LOCUS_07760 867814 867473 gene locus_tag LOCUS_07770 867814 867473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 868717 868181 gene locus_tag LOCUS_07780 868717 868181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 870850 869441 gene locus_tag LOCUS_07790 gene acsC 870850 869441 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021046.1 protein_id gnl|my_center|LOCUS_07790 872167 870854 gene locus_tag LOCUS_07800 gene cdhD 872167 870854 CDS product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023762.1 protein_id gnl|my_center|LOCUS_07800 873178 872417 gene locus_tag LOCUS_07810 873178 872417 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023761.1 protein_id gnl|my_center|LOCUS_07810 874643 873234 gene locus_tag LOCUS_07820 gene cdhC 874643 873234 CDS product CO dehydrogenase/CO-methylating acetyl-CoA synthase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023760.1 protein_id gnl|my_center|LOCUS_07820 875180 874668 gene locus_tag LOCUS_07830 gene cdhB 875180 874668 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023759.1 protein_id gnl|my_center|LOCUS_07830 877600 875183 gene locus_tag LOCUS_07840 gene cdhA 877600 875183 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023758.1 protein_id gnl|my_center|LOCUS_07840 879243 879100 gene locus_tag LOCUS_07850 879243 879100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 879230 879775 gene locus_tag LOCUS_07860 879230 879775 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990667.1 protein_id gnl|my_center|LOCUS_07860 879769 880200 gene locus_tag LOCUS_07870 879769 880200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023756.1 protein_id gnl|my_center|LOCUS_07870 880640 881221 gene locus_tag LOCUS_07880 880640 881221 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065830.1 protein_id gnl|my_center|LOCUS_07880 882242 881265 gene locus_tag LOCUS_07890 882242 881265 CDS product methanogenesis marker 12 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023754.1 protein_id gnl|my_center|LOCUS_07890 882670 882266 gene locus_tag LOCUS_07900 882670 882266 CDS product DUF2103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065829.1 protein_id gnl|my_center|LOCUS_07900 883426 882977 gene locus_tag LOCUS_07910 883426 882977 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023752.1 protein_id gnl|my_center|LOCUS_07910 885081 883777 gene locus_tag LOCUS_07920 885081 883777 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023751.1 protein_id gnl|my_center|LOCUS_07920 886518 885514 gene locus_tag LOCUS_07930 886518 885514 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023750.1 protein_id gnl|my_center|LOCUS_07930 886994 886641 gene locus_tag LOCUS_07940 886994 886641 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023749.1 protein_id gnl|my_center|LOCUS_07940 887339 888424 gene locus_tag LOCUS_07950 887339 888424 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065828.1 protein_id gnl|my_center|LOCUS_07950 888925 890064 gene locus_tag LOCUS_07960 888925 890064 CDS product lipid II:glycine glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023745.1 protein_id gnl|my_center|LOCUS_07960 890835 892286 gene locus_tag LOCUS_07970 890835 892286 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589535.1 protein_id gnl|my_center|LOCUS_07970 892597 894288 gene locus_tag LOCUS_07980 892597 894288 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_07980 894288 894773 gene locus_tag LOCUS_07990 gene ilvN 894288 894773 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_07990 895146 896153 gene locus_tag LOCUS_08000 gene ilvC 895146 896153 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023690.1 protein_id gnl|my_center|LOCUS_08000 896904 898298 gene locus_tag LOCUS_08010 896904 898298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 898565 899860 gene locus_tag LOCUS_08020 898565 899860 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390217.1 protein_id gnl|my_center|LOCUS_08020 900454 900996 gene locus_tag LOCUS_08030 900454 900996 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023689.1 protein_id gnl|my_center|LOCUS_08030 902927 901680 gene locus_tag LOCUS_08040 gene tnpB 902927 901680 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054297574.1 protein_id gnl|my_center|LOCUS_08040 903150 903223 gene locus_tag LOCUS_t00170 903150 903223 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 905270 903789 gene locus_tag LOCUS_08050 gene nlpM 905270 903789 CDS product nif11-like peptide radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942576.1 protein_id gnl|my_center|LOCUS_08050 905904 905605 gene locus_tag LOCUS_08060 905904 905605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 909343 907934 gene locus_tag LOCUS_08070 gene gltA 909343 907934 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023687.1 protein_id gnl|my_center|LOCUS_08070 910205 909360 gene locus_tag LOCUS_08080 910205 909360 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065799.1 protein_id gnl|my_center|LOCUS_08080 910851 910991 gene locus_tag LOCUS_08090 910851 910991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 911117 911335 gene locus_tag LOCUS_08100 911117 911335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065798.1 protein_id gnl|my_center|LOCUS_08100 911785 912546 gene locus_tag LOCUS_08110 gene arsM 911785 912546 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023683.1 protein_id gnl|my_center|LOCUS_08110 912885 913964 gene locus_tag LOCUS_08120 912885 913964 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023682.1 protein_id gnl|my_center|LOCUS_08120 914392 915699 gene locus_tag LOCUS_08130 914392 915699 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860339.1 protein_id gnl|my_center|LOCUS_08130 915855 917339 gene locus_tag LOCUS_08140 915855 917339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 917726 917514 gene locus_tag LOCUS_08150 917726 917514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 917785 918624 gene locus_tag LOCUS_08160 917785 918624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 919019 919954 gene locus_tag LOCUS_08170 919019 919954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 921341 920394 gene locus_tag LOCUS_08180 921341 920394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 922352 922903 gene locus_tag LOCUS_08190 gene rfbC 922352 922903 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023680.1 protein_id gnl|my_center|LOCUS_08190 923030 923929 gene locus_tag LOCUS_08200 gene rfbB 923030 923929 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023679.1 protein_id gnl|my_center|LOCUS_08200 923908 924711 gene locus_tag LOCUS_08210 gene rfbD 923908 924711 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023678.1 protein_id gnl|my_center|LOCUS_08210 924708 925430 gene locus_tag LOCUS_08220 924708 925430 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023677.1 protein_id gnl|my_center|LOCUS_08220 925437 926864 gene locus_tag LOCUS_08230 925437 926864 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060802.1 protein_id gnl|my_center|LOCUS_08230 927140 927934 gene locus_tag LOCUS_08240 927140 927934 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750438.1 protein_id gnl|my_center|LOCUS_08240 928253 929365 gene locus_tag LOCUS_08250 928253 929365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 929362 930270 gene locus_tag LOCUS_08260 929362 930270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 930270 931163 gene locus_tag LOCUS_08270 930270 931163 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_08270 932275 931181 gene locus_tag LOCUS_08280 932275 931181 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023660.1 protein_id gnl|my_center|LOCUS_08280 932365 933519 gene locus_tag LOCUS_08290 932365 933519 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023659.1 protein_id gnl|my_center|LOCUS_08290 933811 936102 gene locus_tag LOCUS_08300 933811 936102 CDS product oligosaccharyl transferase, archaeosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065792.1 protein_id gnl|my_center|LOCUS_08300 936574 939099 gene locus_tag LOCUS_08310 936574 939099 CDS product oligosaccharyl transferase, archaeosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065792.1 protein_id gnl|my_center|LOCUS_08310 939463 941985 gene locus_tag LOCUS_08320 939463 941985 CDS product oligosaccharyl transferase, archaeosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065792.1 protein_id gnl|my_center|LOCUS_08320 942149 942655 gene locus_tag LOCUS_08330 gene hacB 942149 942655 CDS product homoaconitase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065791.1 protein_id gnl|my_center|LOCUS_08330 942763 943638 gene locus_tag LOCUS_08340 942763 943638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023654.1 protein_id gnl|my_center|LOCUS_08340 943716 944276 gene locus_tag LOCUS_08350 943716 944276 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023653.1 protein_id gnl|my_center|LOCUS_08350 944343 945341 gene locus_tag LOCUS_08360 944343 945341 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023652.1 protein_id gnl|my_center|LOCUS_08360 945637 945464 gene locus_tag LOCUS_08370 945637 945464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 945770 946618 gene locus_tag LOCUS_08380 945770 946618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 947154 947011 gene locus_tag LOCUS_08390 947154 947011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 948109 947603 gene locus_tag LOCUS_08400 948109 947603 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023647.1 protein_id gnl|my_center|LOCUS_08400 948798 948154 gene locus_tag LOCUS_08410 gene afpA 948798 948154 CDS product archaeoflavoprotein AfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023646.1 protein_id gnl|my_center|LOCUS_08410 949597 948908 gene locus_tag LOCUS_08420 949597 948908 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065789.1 protein_id gnl|my_center|LOCUS_08420 951147 949771 gene locus_tag LOCUS_08430 951147 949771 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279209.1 protein_id gnl|my_center|LOCUS_08430 951708 951199 gene locus_tag LOCUS_08440 951708 951199 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279208.1 protein_id gnl|my_center|LOCUS_08440 952223 951876 gene locus_tag LOCUS_08450 952223 951876 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023641.1 protein_id gnl|my_center|LOCUS_08450 952633 952412 gene locus_tag LOCUS_08460 952633 952412 CDS product DUF2180 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065787.1 protein_id gnl|my_center|LOCUS_08460 952875 952645 gene locus_tag LOCUS_08470 952875 952645 CDS product DUF2180 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023639.1 protein_id gnl|my_center|LOCUS_08470 953106 952981 gene locus_tag LOCUS_08480 953106 952981 CDS product desulfoferrodoxin FeS4 iron-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023638.1 protein_id gnl|my_center|LOCUS_08480 953826 954812 gene locus_tag LOCUS_08490 gene mer 953826 954812 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023637.1 protein_id gnl|my_center|LOCUS_08490 954913 955953 gene locus_tag LOCUS_08500 gene fpoF 954913 955953 CDS product F420H2 dehydrogenase subunit FpoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023636.1 protein_id gnl|my_center|LOCUS_08500 956027 956548 gene locus_tag LOCUS_08510 956027 956548 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065785.1 protein_id gnl|my_center|LOCUS_08510 957185 956625 gene locus_tag LOCUS_08520 957185 956625 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023634.1 protein_id gnl|my_center|LOCUS_08520 958099 957869 gene locus_tag LOCUS_08530 958099 957869 CDS product cytochrome b5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023631.1 protein_id gnl|my_center|LOCUS_08530 960215 958200 gene locus_tag LOCUS_08540 960215 958200 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_08540 961726 960785 gene locus_tag LOCUS_08550 gene uppS 961726 960785 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990666.1 protein_id gnl|my_center|LOCUS_08550 962682 962413 gene locus_tag LOCUS_08560 962682 962413 CDS product DUF2551 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023626.1 protein_id gnl|my_center|LOCUS_08560 963241 963918 gene locus_tag LOCUS_08570 963241 963918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860333.1 protein_id gnl|my_center|LOCUS_08570 963975 964862 gene locus_tag LOCUS_08580 963975 964862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 965134 965379 gene locus_tag LOCUS_08590 965134 965379 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023623.1 protein_id gnl|my_center|LOCUS_08590 965385 966863 gene locus_tag LOCUS_08600 965385 966863 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065781.1 protein_id gnl|my_center|LOCUS_08600 966844 967854 gene locus_tag LOCUS_08610 966844 967854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023621.1 protein_id gnl|my_center|LOCUS_08610 968052 969119 gene locus_tag LOCUS_08620 gene nadE 968052 969119 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065780.1 protein_id gnl|my_center|LOCUS_08620 969363 969896 gene locus_tag LOCUS_08630 969363 969896 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990665.1 protein_id gnl|my_center|LOCUS_08630 970607 970020 gene locus_tag LOCUS_08640 970607 970020 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990773.1 protein_id gnl|my_center|LOCUS_08640 971796 970819 gene locus_tag LOCUS_08650 971796 970819 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023617.1 protein_id gnl|my_center|LOCUS_08650 972027 972212 gene locus_tag LOCUS_08660 972027 972212 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066529.1 protein_id gnl|my_center|LOCUS_08660 972339 973070 gene locus_tag LOCUS_08670 972339 973070 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023615.1 protein_id gnl|my_center|LOCUS_08670 973762 973163 gene locus_tag LOCUS_08680 973762 973163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023614.1 protein_id gnl|my_center|LOCUS_08680 974112 974498 gene locus_tag LOCUS_08690 974112 974498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065779.1 protein_id gnl|my_center|LOCUS_08690 975140 974586 gene locus_tag LOCUS_08700 975140 974586 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023613.1 protein_id gnl|my_center|LOCUS_08700 976776 975133 gene locus_tag LOCUS_08710 976776 975133 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023612.1 protein_id gnl|my_center|LOCUS_08710 979992 976930 gene locus_tag LOCUS_08720 979992 976930 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065778.1 protein_id gnl|my_center|LOCUS_08720 980495 980325 gene locus_tag LOCUS_08730 980495 980325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 980637 980497 gene locus_tag LOCUS_08740 980637 980497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065772.1 protein_id gnl|my_center|LOCUS_08740 981177 981028 gene locus_tag LOCUS_08750 981177 981028 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011032551.1 protein_id gnl|my_center|LOCUS_08750 981504 981199 gene locus_tag LOCUS_08760 981504 981199 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023602.1 protein_id gnl|my_center|LOCUS_08760 982072 981485 gene locus_tag LOCUS_08770 982072 981485 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023601.1 protein_id gnl|my_center|LOCUS_08770 982259 982074 gene locus_tag LOCUS_08780 982259 982074 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023600.1 protein_id gnl|my_center|LOCUS_08780 982875 982291 gene locus_tag LOCUS_08790 982875 982291 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023599.1 protein_id gnl|my_center|LOCUS_08790 983301 982936 gene locus_tag LOCUS_08800 983301 982936 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023598.1 protein_id gnl|my_center|LOCUS_08800 984524 983298 gene locus_tag LOCUS_08810 984524 983298 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066527.1 protein_id gnl|my_center|LOCUS_08810 986069 984906 gene locus_tag LOCUS_08820 986069 984906 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023596.1 protein_id gnl|my_center|LOCUS_08820 987088 986348 gene locus_tag LOCUS_08830 987088 986348 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066526.1 protein_id gnl|my_center|LOCUS_08830 988014 987157 gene locus_tag LOCUS_08840 988014 987157 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066525.1 protein_id gnl|my_center|LOCUS_08840 988811 989881 gene locus_tag LOCUS_08850 988811 989881 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023593.1 protein_id gnl|my_center|LOCUS_08850 990194 990643 gene locus_tag LOCUS_08860 990194 990643 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023592.1 protein_id gnl|my_center|LOCUS_08860 990719 991354 gene locus_tag LOCUS_08870 990719 991354 CDS product DUF2150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023591.1 protein_id gnl|my_center|LOCUS_08870 992655 991492 gene locus_tag LOCUS_08880 992655 991492 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065771.1 protein_id gnl|my_center|LOCUS_08880 994041 993049 gene locus_tag LOCUS_08890 994041 993049 CDS product DUF4921 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023587.1 protein_id gnl|my_center|LOCUS_08890 995963 994140 gene locus_tag LOCUS_08900 995963 994140 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023586.1 protein_id gnl|my_center|LOCUS_08900 997044 996238 gene locus_tag LOCUS_08910 997044 996238 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065770.1 protein_id gnl|my_center|LOCUS_08910 997890 997498 gene locus_tag LOCUS_08920 997890 997498 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534951.1 protein_id gnl|my_center|LOCUS_08920 999002 998184 gene locus_tag LOCUS_08930 999002 998184 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065769.1 protein_id gnl|my_center|LOCUS_08930 999660 1000016 gene locus_tag LOCUS_08940 999660 1000016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023582.1 protein_id gnl|my_center|LOCUS_08940 1000652 1000158 gene locus_tag LOCUS_08950 1000652 1000158 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023581.1 protein_id gnl|my_center|LOCUS_08950 1000784 1001515 gene locus_tag LOCUS_08960 1000784 1001515 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023580.1 protein_id gnl|my_center|LOCUS_08960 1002677 1002075 gene locus_tag LOCUS_08970 1002677 1002075 CDS product CRISPR-associated transcriptional regulator Csa3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061223.1 protein_id gnl|my_center|LOCUS_08970 1002894 1004762 gene locus_tag LOCUS_08980 1002894 1004762 CDS product TIGR02556 family CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582997.1 protein_id gnl|my_center|LOCUS_08980 1004755 1005732 gene locus_tag LOCUS_08990 gene cas7b 1004755 1005732 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582996.1 protein_id gnl|my_center|LOCUS_08990 1005742 1006443 gene locus_tag LOCUS_09000 gene cas5b 1005742 1006443 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582995.1 protein_id gnl|my_center|LOCUS_09000 1006418 1008853 gene locus_tag LOCUS_09010 1006418 1008853 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582994.1 protein_id gnl|my_center|LOCUS_09010 1008855 1009514 gene locus_tag LOCUS_09020 1008855 1009514 CDS product CRISPR-associated endonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065262.1 protein_id gnl|my_center|LOCUS_09020 1009502 1010473 gene locus_tag LOCUS_09030 gene cas1 1009502 1010473 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879371.1 protein_id gnl|my_center|LOCUS_09030 1010575 1010865 gene locus_tag LOCUS_09040 gene cas2 1010575 1010865 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846123.1 protein_id gnl|my_center|LOCUS_09040 1010882 1011589 gene locus_tag LOCUS_09050 gene cas4 1010882 1011589 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879370.1 protein_id gnl|my_center|LOCUS_09050 1011703 1015295 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attcgagagcaagatccattaaaacaaggattgaaac 1015371 1015622 gene locus_tag LOCUS_09060 1015371 1015622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 1015603 1016010 gene locus_tag LOCUS_09070 1015603 1016010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 1016262 1016486 gene locus_tag LOCUS_09080 1016262 1016486 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024015.1 protein_id gnl|my_center|LOCUS_09080 1016483 1016722 gene locus_tag LOCUS_09090 1016483 1016722 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024016.1 protein_id gnl|my_center|LOCUS_09090 1017153 1016803 gene locus_tag LOCUS_09100 1017153 1016803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020567.1 protein_id gnl|my_center|LOCUS_09100 1017446 1017168 gene locus_tag LOCUS_09110 1017446 1017168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020566.1 protein_id gnl|my_center|LOCUS_09110 1018417 1018268 gene locus_tag LOCUS_09120 1018417 1018268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 1018538 1018789 gene locus_tag LOCUS_09130 1018538 1018789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 1018770 1019177 gene locus_tag LOCUS_09140 1018770 1019177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 1019453 1020124 gene locus_tag LOCUS_09150 1019453 1020124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09150 1020377 1020877 gene locus_tag LOCUS_09160 1020377 1020877 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279106.1 protein_id gnl|my_center|LOCUS_09160 1021241 1020969 gene locus_tag LOCUS_09170 1021241 1020969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 1021600 1022364 gene locus_tag LOCUS_09180 1021600 1022364 CDS product ZIP family zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225190.1 protein_id gnl|my_center|LOCUS_09180 1022724 1023131 gene locus_tag LOCUS_09190 1022724 1023131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1023150 1023788 gene locus_tag LOCUS_09200 1023150 1023788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 1024464 1025504 gene locus_tag LOCUS_09210 1024464 1025504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1025581 1025847 gene locus_tag LOCUS_09220 1025581 1025847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 1026041 1026559 gene locus_tag LOCUS_09230 1026041 1026559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1027519 1027310 gene locus_tag LOCUS_09240 1027519 1027310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064872.1 protein_id gnl|my_center|LOCUS_09240 1028915 1027977 gene locus_tag LOCUS_09250 1028915 1027977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020555.1 protein_id gnl|my_center|LOCUS_09250 1029688 1028930 gene locus_tag LOCUS_09260 1029688 1028930 CDS product DUF6345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064899.1 protein_id gnl|my_center|LOCUS_09260 1030233 1029826 gene locus_tag LOCUS_09270 1030233 1029826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 1031966 1030842 gene locus_tag LOCUS_09280 1031966 1030842 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990661.1 protein_id gnl|my_center|LOCUS_09280 1032303 1032728 gene locus_tag LOCUS_09290 1032303 1032728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09290 1034676 1032901 gene locus_tag LOCUS_09300 1034676 1032901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 1035068 1036042 gene locus_tag LOCUS_09310 1035068 1036042 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965886.1 protein_id gnl|my_center|LOCUS_09310 1036612 1037151 gene locus_tag LOCUS_09320 1036612 1037151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 1037730 1037332 gene locus_tag LOCUS_09330 1037730 1037332 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023551.1 protein_id gnl|my_center|LOCUS_09330 1037943 1038389 gene locus_tag LOCUS_09340 1037943 1038389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 1038645 1038932 gene locus_tag LOCUS_09350 1038645 1038932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023552.1 protein_id gnl|my_center|LOCUS_09350 1041052 1041405 gene locus_tag LOCUS_09360 1041052 1041405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023545.1 protein_id gnl|my_center|LOCUS_09360 1042339 1042689 gene locus_tag LOCUS_09370 1042339 1042689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065758.1 protein_id gnl|my_center|LOCUS_09370 1043052 1043408 gene locus_tag LOCUS_09380 1043052 1043408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065758.1 protein_id gnl|my_center|LOCUS_09380 1044076 1044243 gene locus_tag LOCUS_09390 1044076 1044243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 1044260 1046497 gene locus_tag LOCUS_09400 1044260 1046497 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404984.1 protein_id gnl|my_center|LOCUS_09400 1046615 1046782 gene locus_tag LOCUS_09410 1046615 1046782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 1047168 1047422 gene locus_tag LOCUS_09420 1047168 1047422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065757.1 protein_id gnl|my_center|LOCUS_09420 1047741 1048574 gene locus_tag LOCUS_09430 1047741 1048574 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990660.1 protein_id gnl|my_center|LOCUS_09430 1048823 1049284 gene locus_tag LOCUS_09440 1048823 1049284 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065756.1 protein_id gnl|my_center|LOCUS_09440 1050077 1050397 gene locus_tag LOCUS_09450 1050077 1050397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1050551 1051159 gene locus_tag LOCUS_09460 1050551 1051159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 1051087 1051542 gene locus_tag LOCUS_09470 1051087 1051542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1051921 1052928 gene locus_tag LOCUS_09480 1051921 1052928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020533.1 protein_id gnl|my_center|LOCUS_09480 1053431 1053201 gene locus_tag LOCUS_09490 1053431 1053201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09490 1053598 1053422 gene locus_tag LOCUS_09500 1053598 1053422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09500 1054938 1055330 gene locus_tag LOCUS_09510 gene cfbA 1054938 1055330 CDS product sirohydrochlorin nickelochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023539.1 protein_id gnl|my_center|LOCUS_09510 1055358 1056788 gene locus_tag LOCUS_09520 gene cfbE 1055358 1056788 CDS product coenzyme F430 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023538.1 protein_id gnl|my_center|LOCUS_09520 1057131 1058243 gene locus_tag LOCUS_09530 gene cfbD 1057131 1058243 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023536.1 protein_id gnl|my_center|LOCUS_09530 1058356 1059153 gene locus_tag LOCUS_09540 gene cfbC 1058356 1059153 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase ATP-dependent reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023535.1 protein_id gnl|my_center|LOCUS_09540 1059280 1060776 gene locus_tag LOCUS_09550 gene cfbB 1059280 1060776 CDS product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023534.1 protein_id gnl|my_center|LOCUS_09550 1061097 1062149 gene locus_tag LOCUS_09560 gene endA 1061097 1062149 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023532.1 protein_id gnl|my_center|LOCUS_09560 1062379 1062774 gene locus_tag LOCUS_09570 1062379 1062774 CDS product DUF2209 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023531.1 protein_id gnl|my_center|LOCUS_09570 1062996 1064057 gene locus_tag LOCUS_09580 gene hflX 1062996 1064057 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755955.1 protein_id gnl|my_center|LOCUS_09580 1064826 1065500 gene locus_tag LOCUS_09590 1064826 1065500 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_09590 1065673 1066185 gene locus_tag LOCUS_09600 1065673 1066185 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065754.1 protein_id gnl|my_center|LOCUS_09600 1066502 1067155 gene locus_tag LOCUS_09610 1066502 1067155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990659.1 protein_id gnl|my_center|LOCUS_09610 1067197 1067562 gene locus_tag LOCUS_09620 1067197 1067562 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023525.1 protein_id gnl|my_center|LOCUS_09620 1068481 1067699 gene locus_tag LOCUS_09630 1068481 1067699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 1069328 1069870 gene locus_tag LOCUS_09640 1069328 1069870 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065753.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09640 1071213 1070116 gene locus_tag LOCUS_09650 1071213 1070116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023522.1 protein_id gnl|my_center|LOCUS_09650 1072378 1073265 gene locus_tag LOCUS_09660 1072378 1073265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 1074723 1073686 gene locus_tag LOCUS_09670 gene mtaA 1074723 1073686 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023521.1 protein_id gnl|my_center|LOCUS_09670 1078192 1074827 gene locus_tag LOCUS_09680 1078192 1074827 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023520.1 protein_id gnl|my_center|LOCUS_09680 1079127 1078309 gene locus_tag LOCUS_09690 1079127 1078309 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969623.1 protein_id gnl|my_center|LOCUS_09690 1079889 1080518 gene locus_tag LOCUS_09700 1079889 1080518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09700 1080487 1080999 gene locus_tag LOCUS_09710 1080487 1080999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09710 1081734 1081474 gene locus_tag LOCUS_09720 1081734 1081474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1082078 1081758 gene locus_tag LOCUS_09730 1082078 1081758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1083357 1082350 gene locus_tag LOCUS_09740 1083357 1082350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09740 1084305 1083385 gene locus_tag LOCUS_09750 1084305 1083385 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022440.1 protein_id gnl|my_center|LOCUS_09750 1085074 1084592 gene locus_tag LOCUS_09760 1085074 1084592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09760 1084967 1085209 gene locus_tag LOCUS_09770 1084967 1085209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1085451 1085206 gene locus_tag LOCUS_09780 1085451 1085206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09780 1086228 1085512 gene locus_tag LOCUS_09790 1086228 1085512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1087038 1086664 gene locus_tag LOCUS_09800 1087038 1086664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 1087301 1087486 gene locus_tag LOCUS_09810 1087301 1087486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1088425 1087907 gene locus_tag LOCUS_09820 1088425 1087907 CDS product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088555.1 protein_id gnl|my_center|LOCUS_09820 1088683 1089423 gene locus_tag LOCUS_09830 1088683 1089423 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223645.1 protein_id gnl|my_center|LOCUS_09830 1090463 1089906 gene locus_tag LOCUS_09840 1090463 1089906 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880118.1 protein_id gnl|my_center|LOCUS_09840 1091825 1090944 gene locus_tag LOCUS_09850 1091825 1090944 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967904.1 protein_id gnl|my_center|LOCUS_09850 1092450 1091947 gene locus_tag LOCUS_09860 1092450 1091947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1092702 1092487 gene locus_tag LOCUS_09870 1092702 1092487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 1094130 1093519 gene locus_tag LOCUS_09880 1094130 1093519 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877781.1 protein_id gnl|my_center|LOCUS_09880 1094923 1094603 gene locus_tag LOCUS_09890 1094923 1094603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 1094841 1095203 gene locus_tag LOCUS_09900 1094841 1095203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1096644 1095571 gene locus_tag LOCUS_09910 1096644 1095571 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763966.1 protein_id gnl|my_center|LOCUS_09910 1097186 1096776 gene locus_tag LOCUS_09920 1097186 1096776 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729322.1 protein_id gnl|my_center|LOCUS_09920 1097728 1097195 gene locus_tag LOCUS_09930 1097728 1097195 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948144.1 protein_id gnl|my_center|LOCUS_09930 1098452 1097832 gene locus_tag LOCUS_09940 1098452 1097832 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069765.1 protein_id gnl|my_center|LOCUS_09940 1098783 1098502 gene locus_tag LOCUS_09950 1098783 1098502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1099709 1099137 gene locus_tag LOCUS_09960 1099709 1099137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09960 1100275 1099709 gene locus_tag LOCUS_09970 1100275 1099709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09970 1101189 1100716 gene locus_tag LOCUS_09980 1101189 1100716 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525695.1 protein_id gnl|my_center|LOCUS_09980 1101495 1101226 gene locus_tag LOCUS_09990 1101495 1101226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 1103685 1101916 gene locus_tag LOCUS_10000 1103685 1101916 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065752.1 protein_id gnl|my_center|LOCUS_10000 1104444 1103929 gene locus_tag LOCUS_10010 1104444 1103929 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023516.1 protein_id gnl|my_center|LOCUS_10010 1104755 1105756 gene locus_tag LOCUS_10020 gene pta 1104755 1105756 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023515.1 protein_id gnl|my_center|LOCUS_10020 1105862 1107091 gene locus_tag LOCUS_10030 1105862 1107091 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_10030 1107795 1109021 gene locus_tag LOCUS_10040 1107795 1109021 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_10040 1109327 1110079 gene locus_tag LOCUS_10050 1109327 1110079 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990658.1 protein_id gnl|my_center|LOCUS_10050 1110497 1111153 gene locus_tag LOCUS_10060 1110497 1111153 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023510.1 protein_id gnl|my_center|LOCUS_10060 1111155 1112003 gene locus_tag LOCUS_10070 1111155 1112003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023509.1 protein_id gnl|my_center|LOCUS_10070 1112000 1113460 gene locus_tag LOCUS_10080 1112000 1113460 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023508.1 protein_id gnl|my_center|LOCUS_10080 1113713 1115173 gene locus_tag LOCUS_10090 1113713 1115173 CDS product S-layer protein domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023507.1 protein_id gnl|my_center|LOCUS_10090 1115227 1115787 gene locus_tag LOCUS_10100 1115227 1115787 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279205.1 protein_id gnl|my_center|LOCUS_10100 1115892 1115668 gene locus_tag LOCUS_10110 1115892 1115668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1116152 1115934 gene locus_tag LOCUS_10120 1116152 1115934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1116602 1116189 gene locus_tag LOCUS_10130 1116602 1116189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10130 1117043 1116849 gene locus_tag LOCUS_10140 1117043 1116849 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065750.1 protein_id gnl|my_center|LOCUS_10140 1117356 1117162 gene locus_tag LOCUS_10150 1117356 1117162 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023504.1 protein_id gnl|my_center|LOCUS_10150 1117814 1117515 gene locus_tag LOCUS_10160 1117814 1117515 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755954.1 protein_id gnl|my_center|LOCUS_10160 1118638 1118045 gene locus_tag LOCUS_10170 1118638 1118045 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023502.1 protein_id gnl|my_center|LOCUS_10170 1118968 1120206 gene locus_tag LOCUS_10180 gene pgk 1118968 1120206 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023501.1 protein_id gnl|my_center|LOCUS_10180 1120617 1121243 gene locus_tag LOCUS_10190 1120617 1121243 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023500.1 protein_id gnl|my_center|LOCUS_10190 1121481 1122716 gene locus_tag LOCUS_10200 1121481 1122716 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023499.1 protein_id gnl|my_center|LOCUS_10200 1123750 1123292 gene locus_tag LOCUS_10210 1123750 1123292 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023498.1 protein_id gnl|my_center|LOCUS_10210 1124608 1124787 gene locus_tag LOCUS_10220 1124608 1124787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1126357 1124840 gene locus_tag LOCUS_10230 1126357 1124840 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_10230 1127496 1126351 gene locus_tag LOCUS_10240 1127496 1126351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1127867 1127493 gene locus_tag LOCUS_10250 1127867 1127493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 1128909 1128022 gene locus_tag LOCUS_10260 1128909 1128022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1131802 1129043 gene locus_tag LOCUS_10270 1131802 1129043 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065303.1 protein_id gnl|my_center|LOCUS_10270 1133938 1134321 gene locus_tag LOCUS_10280 1133938 1134321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1135783 1135379 gene locus_tag LOCUS_10290 1135783 1135379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 1136449 1135991 gene locus_tag LOCUS_10300 1136449 1135991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 1137786 1136689 gene locus_tag LOCUS_10310 1137786 1136689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023486.1 protein_id gnl|my_center|LOCUS_10310 1138353 1137922 gene locus_tag LOCUS_10320 1138353 1137922 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990656.1 protein_id gnl|my_center|LOCUS_10320 1138769 1138602 gene locus_tag LOCUS_10330 1138769 1138602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1139606 1139184 gene locus_tag LOCUS_10340 1139606 1139184 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023482.1 protein_id gnl|my_center|LOCUS_10340 1139859 1140323 gene locus_tag LOCUS_10350 1139859 1140323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 1140450 1141463 gene locus_tag LOCUS_10360 gene argC 1140450 1141463 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065747.1 protein_id gnl|my_center|LOCUS_10360 1141566 1142030 gene locus_tag LOCUS_10370 1141566 1142030 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065746.1 protein_id gnl|my_center|LOCUS_10370 1142048 1143235 gene locus_tag LOCUS_10380 gene argJ 1142048 1143235 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023478.1 protein_id gnl|my_center|LOCUS_10380 1143566 1145041 gene locus_tag LOCUS_10390 gene pfkC 1143566 1145041 CDS product ADP-specific phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023477.1 protein_id gnl|my_center|LOCUS_10390 1145090 1146580 gene locus_tag LOCUS_10400 1145090 1146580 CDS product ADP-dependent glucokinase/phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023476.1 protein_id gnl|my_center|LOCUS_10400 1146567 1147415 gene locus_tag LOCUS_10410 1146567 1147415 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_10410 1148522 1147872 gene locus_tag LOCUS_10420 1148522 1147872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1149382 1149834 gene locus_tag LOCUS_10430 1149382 1149834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 1150294 1150049 gene locus_tag LOCUS_10440 1150294 1150049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1153486 1152122 gene locus_tag LOCUS_10450 gene cca 1153486 1152122 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023473.1 protein_id gnl|my_center|LOCUS_10450 1153978 1154697 gene locus_tag LOCUS_10460 1153978 1154697 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015968.1 protein_id gnl|my_center|LOCUS_10460 1155074 1157680 gene locus_tag LOCUS_10470 1155074 1157680 CDS product S-layer protein domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023471.1 protein_id gnl|my_center|LOCUS_10470 1159407 1157941 gene locus_tag LOCUS_10480 1159407 1157941 CDS product PGF-pre-PGF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066190.1 protein_id gnl|my_center|LOCUS_10480 1159644 1161164 gene locus_tag LOCUS_10490 1159644 1161164 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021220.1 protein_id gnl|my_center|LOCUS_10490 1162363 1161446 gene locus_tag LOCUS_10500 1162363 1161446 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021265.1 protein_id gnl|my_center|LOCUS_10500 1163294 1162356 gene locus_tag LOCUS_10510 1163294 1162356 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755881.1 protein_id gnl|my_center|LOCUS_10510 1164135 1163296 gene locus_tag LOCUS_10520 1164135 1163296 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065067.1 protein_id gnl|my_center|LOCUS_10520 1165069 1164119 gene locus_tag LOCUS_10530 1165069 1164119 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021268.1 protein_id gnl|my_center|LOCUS_10530 1165804 1165112 gene locus_tag LOCUS_10540 1165804 1165112 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021269.1 protein_id gnl|my_center|LOCUS_10540 1167487 1165916 gene locus_tag LOCUS_10550 1167487 1165916 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065068.1 protein_id gnl|my_center|LOCUS_10550 1167959 1168675 gene locus_tag LOCUS_10560 1167959 1168675 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021272.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10560 1168748 1168957 gene locus_tag LOCUS_10570 1168748 1168957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10570 1169115 1170347 gene locus_tag LOCUS_10580 1169115 1170347 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769084.1 protein_id gnl|my_center|LOCUS_10580 1173245 1170690 gene locus_tag LOCUS_10590 1173245 1170690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1174103 1173639 gene locus_tag LOCUS_10600 1174103 1173639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 1175326 1174196 gene locus_tag LOCUS_10610 1175326 1174196 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021256.1 protein_id gnl|my_center|LOCUS_10610 1176006 1175329 gene locus_tag LOCUS_10620 gene modB 1176006 1175329 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021257.1 protein_id gnl|my_center|LOCUS_10620 1176852 1176025 gene locus_tag LOCUS_10630 gene modA 1176852 1176025 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022259.1 protein_id gnl|my_center|LOCUS_10630 1177197 1177460 gene locus_tag LOCUS_10640 1177197 1177460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1177829 1179418 gene locus_tag LOCUS_10650 1177829 1179418 CDS product MAST domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021579.1 protein_id gnl|my_center|LOCUS_10650 1180390 1179797 gene locus_tag LOCUS_10660 1180390 1179797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10660 1180925 1180359 gene locus_tag LOCUS_10670 1180925 1180359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10670 1181808 1183232 gene locus_tag LOCUS_10680 1181808 1183232 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021220.1 protein_id gnl|my_center|LOCUS_10680 1183694 1183843 gene locus_tag LOCUS_10690 1183694 1183843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1184055 1184384 gene locus_tag LOCUS_10700 1184055 1184384 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023849.1 protein_id gnl|my_center|LOCUS_10700 1184709 1185092 gene locus_tag LOCUS_10710 1184709 1185092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1185360 1185710 gene locus_tag LOCUS_10720 1185360 1185710 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023836.1 protein_id gnl|my_center|LOCUS_10720 1186073 1187044 gene locus_tag LOCUS_10730 1186073 1187044 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023837.1 protein_id gnl|my_center|LOCUS_10730 1187235 1187816 gene locus_tag LOCUS_10740 1187235 1187816 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065830.1 protein_id gnl|my_center|LOCUS_10740 1188218 1189267 gene locus_tag LOCUS_10750 gene arsB 1188218 1189267 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860358.1 protein_id gnl|my_center|LOCUS_10750 1189456 1189776 gene locus_tag LOCUS_10760 1189456 1189776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023845.1 protein_id gnl|my_center|LOCUS_10760 1190336 1189773 gene locus_tag LOCUS_10770 1190336 1189773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1190906 1190610 gene locus_tag LOCUS_10780 gene tusB 1190906 1190610 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023824.1 protein_id gnl|my_center|LOCUS_10780 1191265 1190921 gene locus_tag LOCUS_10790 1191265 1190921 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023823.1 protein_id gnl|my_center|LOCUS_10790 1191685 1191305 gene locus_tag LOCUS_10800 1191685 1191305 CDS product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755961.1 protein_id gnl|my_center|LOCUS_10800 1192520 1191723 gene locus_tag LOCUS_10810 1192520 1191723 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860357.1 protein_id gnl|my_center|LOCUS_10810 1193461 1192664 gene locus_tag LOCUS_10820 1193461 1192664 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066548.1 protein_id gnl|my_center|LOCUS_10820 1195109 1193970 gene locus_tag LOCUS_10830 1195109 1193970 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876950.1 protein_id gnl|my_center|LOCUS_10830 1195975 1195667 gene locus_tag LOCUS_10840 gene rpsJ 1195975 1195667 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021276.1 protein_id gnl|my_center|LOCUS_10840 1197282 1196014 gene locus_tag LOCUS_10850 gene tuf 1197282 1196014 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021277.1 protein_id gnl|my_center|LOCUS_10850 1199829 1197637 gene locus_tag LOCUS_10860 1199829 1197637 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021278.1 protein_id gnl|my_center|LOCUS_10860 1200467 1199907 gene locus_tag LOCUS_10870 1200467 1199907 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021279.1 protein_id gnl|my_center|LOCUS_10870 1200901 1200473 gene locus_tag LOCUS_10880 1200901 1200473 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021280.1 protein_id gnl|my_center|LOCUS_10880 1201437 1201012 gene locus_tag LOCUS_10890 1201437 1201012 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021281.1 protein_id gnl|my_center|LOCUS_10890 1201748 1201458 gene locus_tag LOCUS_10900 1201748 1201458 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065070.1 protein_id gnl|my_center|LOCUS_10900 1203236 1202010 gene locus_tag LOCUS_10910 gene rpoA2 1203236 1202010 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066196.1 protein_id gnl|my_center|LOCUS_10910 1205875 1203233 gene locus_tag LOCUS_10920 1205875 1203233 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021284.1 protein_id gnl|my_center|LOCUS_10920 1207704 1205890 gene locus_tag LOCUS_10930 gene rpoB 1207704 1205890 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021285.1 protein_id gnl|my_center|LOCUS_10930 1209314 1207719 gene locus_tag LOCUS_10940 1209314 1207719 CDS product DNA-directed RNA polymerase subunit B'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755883.1 protein_id gnl|my_center|LOCUS_10940 1209761 1209525 gene locus_tag LOCUS_10950 1209761 1209525 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021287.1 protein_id gnl|my_center|LOCUS_10950 1209923 1209847 gene locus_tag LOCUS_t00180 1209923 1209847 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1211121 1210894 gene locus_tag LOCUS_10960 1211121 1210894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1211513 1212241 gene locus_tag LOCUS_10970 1211513 1212241 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020781.1 protein_id gnl|my_center|LOCUS_10970 1215643 1212428 gene locus_tag LOCUS_10980 1215643 1212428 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021984.1 protein_id gnl|my_center|LOCUS_10980 1216177 1218105 gene locus_tag LOCUS_10990 1216177 1218105 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279200.1 protein_id gnl|my_center|LOCUS_10990 1221443 1218222 gene locus_tag LOCUS_11000 1221443 1218222 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860097.1 protein_id gnl|my_center|LOCUS_11000 1222398 1222655 gene locus_tag LOCUS_11010 1222398 1222655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1224303 1222828 gene locus_tag LOCUS_11020 1224303 1222828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1224778 1224335 gene locus_tag LOCUS_11030 1224778 1224335 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 protein_id gnl|my_center|LOCUS_11030 1230817 1224983 gene locus_tag LOCUS_11040 1230817 1224983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1234903 1231601 gene locus_tag LOCUS_11050 1234903 1231601 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022738.1 protein_id gnl|my_center|LOCUS_11050 1235812 1237047 gene locus_tag LOCUS_11060 1235812 1237047 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021292.1 protein_id gnl|my_center|LOCUS_11060 1237044 1237775 gene locus_tag LOCUS_11070 1237044 1237775 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021293.1 protein_id gnl|my_center|LOCUS_11070 1237777 1238790 gene locus_tag LOCUS_11080 1237777 1238790 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860116.1 protein_id gnl|my_center|LOCUS_11080 1240203 1238968 gene locus_tag LOCUS_11090 1240203 1238968 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021296.1 protein_id gnl|my_center|LOCUS_11090 1241719 1240421 gene locus_tag LOCUS_11100 1241719 1240421 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_11100 1242767 1242114 gene locus_tag LOCUS_11110 1242767 1242114 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021298.1 protein_id gnl|my_center|LOCUS_11110 1243580 1242819 gene locus_tag LOCUS_11120 1243580 1242819 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021299.1 protein_id gnl|my_center|LOCUS_11120 1244848 1243946 gene locus_tag LOCUS_11130 1244848 1243946 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066198.1 protein_id gnl|my_center|LOCUS_11130 1246347 1245034 gene locus_tag LOCUS_11140 gene coaBC 1246347 1245034 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065075.1 protein_id gnl|my_center|LOCUS_11140 1246796 1247839 gene locus_tag LOCUS_11150 1246796 1247839 CDS product eukaryotic peptide chain release factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021302.1 protein_id gnl|my_center|LOCUS_11150 1248497 1249741 gene locus_tag LOCUS_11160 1248497 1249741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 1250171 1249887 gene locus_tag LOCUS_11170 1250171 1249887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1250356 1250580 gene locus_tag LOCUS_11180 1250356 1250580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1250973 1251290 gene locus_tag LOCUS_11190 1250973 1251290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11190 1251535 1252122 gene locus_tag LOCUS_11200 gene istB 1251535 1252122 CDS product IS21-like element ISMac3 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021079.1 protein_id gnl|my_center|LOCUS_11200 1252264 1252866 gene locus_tag LOCUS_11210 1252264 1252866 CDS product UPF0228 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065161.1 protein_id gnl|my_center|LOCUS_11210 1253794 1254411 gene locus_tag LOCUS_11220 1253794 1254411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024352.1 protein_id gnl|my_center|LOCUS_11220 1254796 1255335 gene locus_tag LOCUS_11230 1254796 1255335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11230 1255268 1255525 gene locus_tag LOCUS_11240 1255268 1255525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11240 1255662 1256489 gene locus_tag LOCUS_11250 1255662 1256489 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021309.1 protein_id gnl|my_center|LOCUS_11250 1256653 1257300 gene locus_tag LOCUS_11260 1256653 1257300 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065077.1 protein_id gnl|my_center|LOCUS_11260 1258200 1258664 gene locus_tag LOCUS_11270 1258200 1258664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11270 1259196 1262435 gene locus_tag LOCUS_11280 1259196 1262435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1263228 1262512 gene locus_tag LOCUS_11290 1263228 1262512 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_11290 1263875 1263228 gene locus_tag LOCUS_11300 1263875 1263228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1266355 1263941 gene locus_tag LOCUS_11310 1266355 1263941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11310 1267029 1266352 gene locus_tag LOCUS_11320 1267029 1266352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1267877 1267026 gene locus_tag LOCUS_11330 1267877 1267026 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_11330 1270202 1267995 gene locus_tag LOCUS_11340 1270202 1267995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11340 1271302 1272336 gene locus_tag LOCUS_11350 1271302 1272336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11350 1272448 1272278 gene locus_tag LOCUS_11360 1272448 1272278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1273006 1275093 gene locus_tag LOCUS_11370 1273006 1275093 CDS product PKD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021314.1 protein_id gnl|my_center|LOCUS_11370 1275929 1275276 gene locus_tag LOCUS_11380 1275929 1275276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11380 1276097 1275945 gene locus_tag LOCUS_11390 1276097 1275945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11390 1276531 1276097 gene locus_tag LOCUS_11400 1276531 1276097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11400 1278805 1276868 gene locus_tag LOCUS_11410 1278805 1276868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021319.1 protein_id gnl|my_center|LOCUS_11410 1281643 1278818 gene locus_tag LOCUS_11420 1281643 1278818 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990782.1 protein_id gnl|my_center|LOCUS_11420 1284449 1283013 gene locus_tag LOCUS_11430 1284449 1283013 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023126.1 protein_id gnl|my_center|LOCUS_11430 1284864 1284454 gene locus_tag LOCUS_11440 1284864 1284454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1285367 1284909 gene locus_tag LOCUS_11450 1285367 1284909 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065631.1 protein_id gnl|my_center|LOCUS_11450 1287668 1286196 gene locus_tag LOCUS_11460 1287668 1286196 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066453.1 protein_id gnl|my_center|LOCUS_11460 1287930 1288115 gene locus_tag LOCUS_11470 1287930 1288115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 1289267 1288278 gene locus_tag LOCUS_11480 1289267 1288278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1290134 1289406 gene locus_tag LOCUS_11490 1290134 1289406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1290820 1291239 gene locus_tag LOCUS_11500 1290820 1291239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11500 1292786 1291353 gene locus_tag LOCUS_11510 1292786 1291353 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023126.1 protein_id gnl|my_center|LOCUS_11510 1294239 1293520 gene locus_tag LOCUS_11520 1294239 1293520 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990633.1 protein_id gnl|my_center|LOCUS_11520 1296054 1294687 gene locus_tag LOCUS_11530 1296054 1294687 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023105.1 protein_id gnl|my_center|LOCUS_11530 1296663 1296307 gene locus_tag LOCUS_11540 1296663 1296307 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065626.1 protein_id gnl|my_center|LOCUS_11540 1296944 1297606 gene locus_tag LOCUS_11550 1296944 1297606 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066452.1 protein_id gnl|my_center|LOCUS_11550 1297860 1298198 gene locus_tag LOCUS_11560 1297860 1298198 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023100.1 protein_id gnl|my_center|LOCUS_11560 1298215 1298580 gene locus_tag LOCUS_11570 1298215 1298580 CDS product CGGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065624.1 protein_id gnl|my_center|LOCUS_11570 1298656 1299084 gene locus_tag LOCUS_11580 1298656 1299084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1299176 1299631 gene locus_tag LOCUS_11590 1299176 1299631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065623.1 protein_id gnl|my_center|LOCUS_11590 1299692 1300060 gene locus_tag LOCUS_11600 1299692 1300060 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023097.1 protein_id gnl|my_center|LOCUS_11600 1300319 1300681 gene locus_tag LOCUS_11610 1300319 1300681 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023090.1 protein_id gnl|my_center|LOCUS_11610 1300866 1301720 gene locus_tag LOCUS_11620 1300866 1301720 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023089.1 protein_id gnl|my_center|LOCUS_11620 1301803 1302801 gene locus_tag LOCUS_11630 gene pheA 1301803 1302801 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066451.1 protein_id gnl|my_center|LOCUS_11630 1303119 1304009 gene locus_tag LOCUS_11640 1303119 1304009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860288.1 protein_id gnl|my_center|LOCUS_11640 1304277 1305251 gene locus_tag LOCUS_11650 1304277 1305251 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023086.1 protein_id gnl|my_center|LOCUS_11650 1305433 1306314 gene locus_tag LOCUS_11660 1305433 1306314 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023085.1 protein_id gnl|my_center|LOCUS_11660 1306317 1308194 gene locus_tag LOCUS_11670 1306317 1308194 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023084.1 protein_id gnl|my_center|LOCUS_11670 1308191 1310686 gene locus_tag LOCUS_11680 1308191 1310686 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023083.1 protein_id gnl|my_center|LOCUS_11680 1311554 1310958 gene locus_tag LOCUS_11690 1311554 1310958 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023081.1 protein_id gnl|my_center|LOCUS_11690 1312714 1311659 gene locus_tag LOCUS_11700 1312714 1311659 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023080.1 protein_id gnl|my_center|LOCUS_11700 1314432 1313269 gene locus_tag LOCUS_11710 1314432 1313269 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023078.1 protein_id gnl|my_center|LOCUS_11710 1314981 1314583 gene locus_tag LOCUS_11720 1314981 1314583 CDS product tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065620.1 protein_id gnl|my_center|LOCUS_11720 1315624 1315142 gene locus_tag LOCUS_11730 1315624 1315142 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023076.1 protein_id gnl|my_center|LOCUS_11730 1316314 1315760 gene locus_tag LOCUS_11740 1316314 1315760 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023075.1 protein_id gnl|my_center|LOCUS_11740 1316810 1316319 gene locus_tag LOCUS_11750 1316810 1316319 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023074.1 protein_id gnl|my_center|LOCUS_11750 1317594 1317013 gene locus_tag LOCUS_11760 1317594 1317013 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065619.1 protein_id gnl|my_center|LOCUS_11760 1318394 1317834 gene locus_tag LOCUS_11770 1318394 1317834 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065618.1 protein_id gnl|my_center|LOCUS_11770 1319028 1320929 gene locus_tag LOCUS_11780 1319028 1320929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 1321463 1321390 gene locus_tag LOCUS_t00190 1321463 1321390 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1321689 1321765 gene locus_tag LOCUS_t00200 1321689 1321765 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1321828 1321901 gene locus_tag LOCUS_t00210 1321828 1321901 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1322434 1323702 gene locus_tag LOCUS_11790 gene aprE 1322434 1323702 CDS product subtilisin AprE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233171.1 protein_id gnl|my_center|LOCUS_11790 1324048 1323767 gene locus_tag LOCUS_11800 1324048 1323767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 1324753 1324340 gene locus_tag LOCUS_11810 1324753 1324340 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023068.1 protein_id gnl|my_center|LOCUS_11810 1325918 1326097 gene locus_tag LOCUS_11820 1325918 1326097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1326847 1326446 gene locus_tag LOCUS_11830 1326847 1326446 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023067.1 protein_id gnl|my_center|LOCUS_11830 1327478 1329895 gene locus_tag LOCUS_11840 1327478 1329895 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065616.1 protein_id gnl|my_center|LOCUS_11840 1329892 1330602 gene locus_tag LOCUS_11850 1329892 1330602 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023065.1 protein_id gnl|my_center|LOCUS_11850 1330610 1331500 gene locus_tag LOCUS_11860 1330610 1331500 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023064.1 protein_id gnl|my_center|LOCUS_11860 1332426 1332016 gene locus_tag LOCUS_11870 1332426 1332016 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023052.1 protein_id gnl|my_center|LOCUS_11870 1332722 1333915 gene locus_tag LOCUS_11880 gene tnpB 1332722 1333915 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_11880 1334092 1334517 gene locus_tag LOCUS_11890 1334092 1334517 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020956.1 protein_id gnl|my_center|LOCUS_11890 1335445 1335026 gene locus_tag LOCUS_11900 1335445 1335026 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023052.1 protein_id gnl|my_center|LOCUS_11900 1335957 1335817 gene locus_tag LOCUS_11910 1335957 1335817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1336689 1336294 gene locus_tag LOCUS_11920 1336689 1336294 CDS product DUF6326 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021642.1 protein_id gnl|my_center|LOCUS_11920 1337390 1337869 gene locus_tag LOCUS_11930 1337390 1337869 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023053.1 protein_id gnl|my_center|LOCUS_11930 1338707 1338219 gene locus_tag LOCUS_11940 1338707 1338219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 1339569 1339336 gene locus_tag LOCUS_11950 1339569 1339336 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065613.1 protein_id gnl|my_center|LOCUS_11950 1339787 1339602 gene locus_tag LOCUS_11960 1339787 1339602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1340588 1341013 gene locus_tag LOCUS_11970 1340588 1341013 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022813.1 protein_id gnl|my_center|LOCUS_11970 1342466 1341162 gene locus_tag LOCUS_11980 1342466 1341162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1343277 1344401 gene locus_tag LOCUS_11990 gene tnpB 1343277 1344401 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_11990 1344715 1345956 gene locus_tag LOCUS_12000 gene hacA 1344715 1345956 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066440.1 protein_id gnl|my_center|LOCUS_12000 1347307 1346441 gene locus_tag LOCUS_12010 1347307 1346441 CDS product YadA family autotransporter adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065604.1 protein_id gnl|my_center|LOCUS_12010 1348976 1347414 gene locus_tag LOCUS_12020 gene flaJ 1348976 1347414 CDS product archaellar assembly protein FlaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023022.1 protein_id gnl|my_center|LOCUS_12020 1350808 1348973 gene locus_tag LOCUS_12030 1350808 1348973 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023021.1 protein_id gnl|my_center|LOCUS_12030 1351649 1350861 gene locus_tag LOCUS_12040 1351649 1350861 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065603.1 protein_id gnl|my_center|LOCUS_12040 1352305 1351790 gene locus_tag LOCUS_12050 1352305 1351790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023019.1 protein_id gnl|my_center|LOCUS_12050 1352799 1352305 gene locus_tag LOCUS_12060 1352799 1352305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023018.1 protein_id gnl|my_center|LOCUS_12060 1353774 1353040 gene locus_tag LOCUS_12070 1353774 1353040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023017.1 protein_id gnl|my_center|LOCUS_12070 1354446 1353853 gene locus_tag LOCUS_12080 1354446 1353853 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023016.1 protein_id gnl|my_center|LOCUS_12080 1355698 1354847 gene locus_tag LOCUS_12090 1355698 1354847 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023015.1 protein_id gnl|my_center|LOCUS_12090 1357295 1355685 gene locus_tag LOCUS_12100 1357295 1355685 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065602.1 protein_id gnl|my_center|LOCUS_12100 1357937 1358170 gene locus_tag LOCUS_12110 1357937 1358170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065601.1 protein_id gnl|my_center|LOCUS_12110 1359643 1358387 gene locus_tag LOCUS_12120 gene hmgA 1359643 1358387 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065600.1 protein_id gnl|my_center|LOCUS_12120 1360583 1360215 gene locus_tag LOCUS_12130 1360583 1360215 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065599.1 protein_id gnl|my_center|LOCUS_12130 1361151 1363169 gene locus_tag LOCUS_12140 1361151 1363169 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065598.1 protein_id gnl|my_center|LOCUS_12140 1363568 1365571 gene locus_tag LOCUS_12150 1363568 1365571 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065598.1 protein_id gnl|my_center|LOCUS_12150 1365657 1366136 gene locus_tag LOCUS_12160 1365657 1366136 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066438.1 protein_id gnl|my_center|LOCUS_12160 1366133 1366936 gene locus_tag LOCUS_12170 1366133 1366936 CDS product CheF family chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023008.1 protein_id gnl|my_center|LOCUS_12170 1366951 1367313 gene locus_tag LOCUS_12180 1366951 1367313 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023007.1 protein_id gnl|my_center|LOCUS_12180 1367326 1368378 gene locus_tag LOCUS_12190 1367326 1368378 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065597.1 protein_id gnl|my_center|LOCUS_12190 1368368 1371277 gene locus_tag LOCUS_12200 1368368 1371277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1371270 1371872 gene locus_tag LOCUS_12210 1371270 1371872 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065596.1 protein_id gnl|my_center|LOCUS_12210 1372049 1372531 gene locus_tag LOCUS_12220 1372049 1372531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1372522 1373334 gene locus_tag LOCUS_12230 1372522 1373334 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023002.1 protein_id gnl|my_center|LOCUS_12230 1373593 1373892 gene locus_tag LOCUS_12240 1373593 1373892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12240 1374187 1374774 gene locus_tag LOCUS_12250 1374187 1374774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12250 1375107 1375895 gene locus_tag LOCUS_12260 1375107 1375895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1377018 1377608 gene locus_tag LOCUS_12270 1377018 1377608 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023001.1 protein_id gnl|my_center|LOCUS_12270 1377620 1378249 gene locus_tag LOCUS_12280 1377620 1378249 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023000.1 protein_id gnl|my_center|LOCUS_12280 1378333 1378989 gene locus_tag LOCUS_12290 1378333 1378989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990630.1 protein_id gnl|my_center|LOCUS_12290 1379005 1379484 gene locus_tag LOCUS_12300 1379005 1379484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022998.1 protein_id gnl|my_center|LOCUS_12300 1379489 1379962 gene locus_tag LOCUS_12310 1379489 1379962 CDS product flagellar protein FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065594.1 protein_id gnl|my_center|LOCUS_12310 1379964 1380680 gene locus_tag LOCUS_12320 1379964 1380680 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022996.1 protein_id gnl|my_center|LOCUS_12320 1380718 1382571 gene locus_tag LOCUS_12330 1380718 1382571 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022995.1 protein_id gnl|my_center|LOCUS_12330 1382584 1384209 gene locus_tag LOCUS_12340 gene flaJ 1382584 1384209 CDS product archaellar assembly protein FlaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065593.1 protein_id gnl|my_center|LOCUS_12340 1384211 1385182 gene locus_tag LOCUS_12350 1384211 1385182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022993.1 protein_id gnl|my_center|LOCUS_12350 1385286 1385465 gene locus_tag LOCUS_12360 1385286 1385465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 1388301 1385692 gene locus_tag LOCUS_12370 1388301 1385692 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022991.1 protein_id gnl|my_center|LOCUS_12370 1389223 1388828 gene locus_tag LOCUS_12380 1389223 1388828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1389938 1389576 gene locus_tag LOCUS_12390 1389938 1389576 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064788.1 protein_id gnl|my_center|LOCUS_12390 1390621 1389968 gene locus_tag LOCUS_12400 1390621 1389968 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022990.1 protein_id gnl|my_center|LOCUS_12400 1391909 1391031 gene locus_tag LOCUS_12410 1391909 1391031 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065592.1 protein_id gnl|my_center|LOCUS_12410 1392849 1391911 gene locus_tag LOCUS_12420 1392849 1391911 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066436.1 protein_id gnl|my_center|LOCUS_12420 1394453 1392903 gene locus_tag LOCUS_12430 1394453 1392903 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022987.1 protein_id gnl|my_center|LOCUS_12430 1395502 1394591 gene locus_tag LOCUS_12440 1395502 1394591 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065591.1 protein_id gnl|my_center|LOCUS_12440 1396439 1395495 gene locus_tag LOCUS_12450 1396439 1395495 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990629.1 protein_id gnl|my_center|LOCUS_12450 1396596 1397402 gene locus_tag LOCUS_12460 1396596 1397402 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022984.1 protein_id gnl|my_center|LOCUS_12460 1397384 1398271 gene locus_tag LOCUS_12470 1397384 1398271 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022983.1 protein_id gnl|my_center|LOCUS_12470 1399144 1398380 gene locus_tag LOCUS_12480 1399144 1398380 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022982.1 protein_id gnl|my_center|LOCUS_12480 1400165 1399215 gene locus_tag LOCUS_12490 1400165 1399215 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022981.1 protein_id gnl|my_center|LOCUS_12490 1401147 1400470 gene locus_tag LOCUS_12500 1401147 1400470 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022978.1 protein_id gnl|my_center|LOCUS_12500 1403099 1401831 gene locus_tag LOCUS_12510 gene ahbC 1403099 1401831 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022974.1 protein_id gnl|my_center|LOCUS_12510 1403891 1403100 gene locus_tag LOCUS_12520 1403891 1403100 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022973.1 protein_id gnl|my_center|LOCUS_12520 1404684 1403917 gene locus_tag LOCUS_12530 gene cobA 1404684 1403917 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022972.1 protein_id gnl|my_center|LOCUS_12530 1405098 1406015 gene locus_tag LOCUS_12540 gene rnz 1405098 1406015 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_12540 1406394 1406134 gene locus_tag LOCUS_12550 1406394 1406134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065588.1 protein_id gnl|my_center|LOCUS_12550 1407845 1406727 gene locus_tag LOCUS_12560 1407845 1406727 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022968.1 protein_id gnl|my_center|LOCUS_12560 1408464 1408661 gene locus_tag LOCUS_12570 1408464 1408661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162197611.1 protein_id gnl|my_center|LOCUS_12570 1408851 1409306 gene locus_tag LOCUS_12580 1408851 1409306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 1409532 1409978 gene locus_tag LOCUS_12590 1409532 1409978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065584.1 protein_id gnl|my_center|LOCUS_12590 1411332 1410139 gene locus_tag LOCUS_12600 1411332 1410139 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022964.1 protein_id gnl|my_center|LOCUS_12600 1412633 1411329 gene locus_tag LOCUS_12610 gene glmM 1412633 1411329 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065583.1 protein_id gnl|my_center|LOCUS_12610 1414596 1412740 gene locus_tag LOCUS_12620 gene glmS 1414596 1412740 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022962.1 protein_id gnl|my_center|LOCUS_12620 1415853 1414621 gene locus_tag LOCUS_12630 1415853 1414621 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022961.1 protein_id gnl|my_center|LOCUS_12630 1417028 1416060 gene locus_tag LOCUS_12640 1417028 1416060 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022960.1 protein_id gnl|my_center|LOCUS_12640 1417216 1418136 gene locus_tag LOCUS_12650 1417216 1418136 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878482.1 protein_id gnl|my_center|LOCUS_12650 1418164 1419291 gene locus_tag LOCUS_12660 1418164 1419291 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878481.1 protein_id gnl|my_center|LOCUS_12660 1419528 1420184 gene locus_tag LOCUS_12670 1419528 1420184 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878480.1 protein_id gnl|my_center|LOCUS_12670 1420178 1420792 gene locus_tag LOCUS_12680 1420178 1420792 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878479.1 protein_id gnl|my_center|LOCUS_12680 1421213 1421794 gene locus_tag LOCUS_12690 1421213 1421794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12690 1421719 1423050 gene locus_tag LOCUS_12700 1421719 1423050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12700 1423840 1425105 gene locus_tag LOCUS_12710 1423840 1425105 CDS product replication protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022958.1 protein_id gnl|my_center|LOCUS_12710 1425106 1425675 gene locus_tag LOCUS_12720 1425106 1425675 CDS product RPA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022957.1 protein_id gnl|my_center|LOCUS_12720 1426045 1426266 gene locus_tag LOCUS_12730 1426045 1426266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022956.1 protein_id gnl|my_center|LOCUS_12730 1426977 1426429 gene locus_tag LOCUS_12740 1426977 1426429 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022955.1 protein_id gnl|my_center|LOCUS_12740 1427977 1427186 gene locus_tag LOCUS_12750 1427977 1427186 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589532.1 protein_id gnl|my_center|LOCUS_12750 1428495 1427974 gene locus_tag LOCUS_12760 1428495 1427974 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022953.1 protein_id gnl|my_center|LOCUS_12760 1429597 1428560 gene locus_tag LOCUS_12770 1429597 1428560 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022952.1 protein_id gnl|my_center|LOCUS_12770 1430518 1430021 gene locus_tag LOCUS_12780 1430518 1430021 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022951.1 protein_id gnl|my_center|LOCUS_12780 1431054 1431779 gene locus_tag LOCUS_12790 1431054 1431779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022949.1 protein_id gnl|my_center|LOCUS_12790 1431858 1432769 gene locus_tag LOCUS_12800 1431858 1432769 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022948.1 protein_id gnl|my_center|LOCUS_12800 1432921 1433550 gene locus_tag LOCUS_12810 1432921 1433550 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065582.1 protein_id gnl|my_center|LOCUS_12810 1434504 1433563 gene locus_tag LOCUS_12820 1434504 1433563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065581.1 protein_id gnl|my_center|LOCUS_12820 1437699 1434799 gene locus_tag LOCUS_12830 gene leuS 1437699 1434799 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021621.1 protein_id gnl|my_center|LOCUS_12830 1439220 1438003 gene locus_tag LOCUS_12840 gene thrC 1439220 1438003 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021620.1 protein_id gnl|my_center|LOCUS_12840 1440161 1439829 gene locus_tag LOCUS_12850 1440161 1439829 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021617.1 protein_id gnl|my_center|LOCUS_12850 1440522 1440184 gene locus_tag LOCUS_12860 1440522 1440184 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021616.1 protein_id gnl|my_center|LOCUS_12860 1443764 1440912 gene locus_tag LOCUS_12870 1443764 1440912 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021615.1 protein_id gnl|my_center|LOCUS_12870 1446743 1443924 gene locus_tag LOCUS_12880 1446743 1443924 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948376.1 protein_id gnl|my_center|LOCUS_12880 1447233 1446835 gene locus_tag LOCUS_12890 1447233 1446835 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021612.1 protein_id gnl|my_center|LOCUS_12890 1447665 1447462 gene locus_tag LOCUS_12900 1447665 1447462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 1447953 1448243 gene locus_tag LOCUS_12910 1447953 1448243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021611.1 protein_id gnl|my_center|LOCUS_12910 1448571 1448717 gene locus_tag LOCUS_12920 1448571 1448717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1448720 1449265 gene locus_tag LOCUS_12930 1448720 1449265 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982260.1 protein_id gnl|my_center|LOCUS_12930 1449973 1450212 gene locus_tag LOCUS_12940 1449973 1450212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 1450225 1450467 gene locus_tag LOCUS_12950 1450225 1450467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1451502 1450546 gene locus_tag LOCUS_12960 1451502 1450546 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_12960 1452566 1454179 gene locus_tag LOCUS_12970 gene cntA 1452566 1454179 CDS product staphylopine-dependent metal ABC transporter substrate-binding protein CntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229087.1 protein_id gnl|my_center|LOCUS_12970 1454240 1455169 gene locus_tag LOCUS_12980 1454240 1455169 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485504.1 protein_id gnl|my_center|LOCUS_12980 1455174 1456037 gene locus_tag LOCUS_12990 1455174 1456037 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437750.1 protein_id gnl|my_center|LOCUS_12990 1456034 1456852 gene locus_tag LOCUS_13000 1456034 1456852 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173871.1 protein_id gnl|my_center|LOCUS_13000 1456846 1457628 gene locus_tag LOCUS_13010 1456846 1457628 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598772.1 protein_id gnl|my_center|LOCUS_13010 1457618 1459132 gene locus_tag LOCUS_13020 1457618 1459132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1459155 1459682 gene locus_tag LOCUS_13030 1459155 1459682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13030 1459710 1459901 gene locus_tag LOCUS_13040 1459710 1459901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1460339 1460581 gene locus_tag LOCUS_13050 1460339 1460581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1461263 1461631 gene locus_tag LOCUS_13060 1461263 1461631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1462169 1461612 gene locus_tag LOCUS_13070 1462169 1461612 CDS product protease inhibitor I42 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021603.1 protein_id gnl|my_center|LOCUS_13070 1462981 1463229 gene locus_tag LOCUS_13080 1462981 1463229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022937.1 protein_id gnl|my_center|LOCUS_13080 1463506 1463796 gene locus_tag LOCUS_13090 1463506 1463796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022939.1 protein_id gnl|my_center|LOCUS_13090 1464486 1463965 gene locus_tag LOCUS_13100 1464486 1463965 CDS product DUF5698 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722254.1 protein_id gnl|my_center|LOCUS_13100 1465028 1465822 gene locus_tag LOCUS_13110 1465028 1465822 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022940.1 protein_id gnl|my_center|LOCUS_13110 1465973 1466263 gene locus_tag LOCUS_13120 1465973 1466263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022943.1 protein_id gnl|my_center|LOCUS_13120 1467117 1468232 gene locus_tag LOCUS_13130 gene tnpB 1467117 1468232 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_13130 1468985 1468464 gene locus_tag LOCUS_13140 1468985 1468464 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020819.1 protein_id gnl|my_center|LOCUS_13140 1469644 1469174 gene locus_tag LOCUS_13150 1469644 1469174 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990748.1 protein_id gnl|my_center|LOCUS_13150 1469925 1470638 gene locus_tag LOCUS_13160 1469925 1470638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1471530 1470880 gene locus_tag LOCUS_13170 1471530 1470880 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022192.1 protein_id gnl|my_center|LOCUS_13170 1473143 1471665 gene locus_tag LOCUS_13180 1473143 1471665 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022191.1 protein_id gnl|my_center|LOCUS_13180 1473708 1474115 gene locus_tag LOCUS_13190 1473708 1474115 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065220.1 protein_id gnl|my_center|LOCUS_13190 1474594 1475391 gene locus_tag LOCUS_13200 1474594 1475391 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021800.1 protein_id gnl|my_center|LOCUS_13200 1476091 1475627 gene locus_tag LOCUS_13210 1476091 1475627 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021802.1 protein_id gnl|my_center|LOCUS_13210 1478061 1476295 gene locus_tag LOCUS_13220 1478061 1476295 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021803.1 protein_id gnl|my_center|LOCUS_13220 1479629 1481290 gene locus_tag LOCUS_13230 gene ilvD 1479629 1481290 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021805.1 protein_id gnl|my_center|LOCUS_13230 1481580 1481759 gene locus_tag LOCUS_13240 1481580 1481759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084630540.1 protein_id gnl|my_center|LOCUS_13240 1482243 1481887 gene locus_tag LOCUS_13250 1482243 1481887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065221.1 protein_id gnl|my_center|LOCUS_13250 1483410 1482478 gene locus_tag LOCUS_13260 gene mtrH 1483410 1482478 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021807.1 protein_id gnl|my_center|LOCUS_13260 1483973 1483581 gene locus_tag LOCUS_13270 1483973 1483581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 1485034 1484171 gene locus_tag LOCUS_13280 gene mtxX 1485034 1484171 CDS product methanogenesis marker protein Mmp4/MtxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065223.1 protein_id gnl|my_center|LOCUS_13280 1485340 1487136 gene locus_tag LOCUS_13290 1485340 1487136 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065226.1 protein_id gnl|my_center|LOCUS_13290 1488718 1488792 gene locus_tag LOCUS_t00220 1488718 1488792 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1489056 1489283 gene locus_tag LOCUS_13300 1489056 1489283 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011032206.1 protein_id gnl|my_center|LOCUS_13300 1489461 1490117 gene locus_tag LOCUS_13310 1489461 1490117 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990853.1 protein_id gnl|my_center|LOCUS_13310 1490214 1492508 gene locus_tag LOCUS_13320 1490214 1492508 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021816.1 protein_id gnl|my_center|LOCUS_13320 1493087 1493650 gene locus_tag LOCUS_13330 1493087 1493650 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021817.1 protein_id gnl|my_center|LOCUS_13330 1493976 1495127 gene locus_tag LOCUS_13340 1493976 1495127 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065228.1 protein_id gnl|my_center|LOCUS_13340 1495229 1495693 gene locus_tag LOCUS_13350 gene ribC 1495229 1495693 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021819.1 protein_id gnl|my_center|LOCUS_13350 1495742 1496146 gene locus_tag LOCUS_13360 gene ribH 1495742 1496146 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021820.1 protein_id gnl|my_center|LOCUS_13360 1496201 1497343 gene locus_tag LOCUS_13370 1496201 1497343 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021821.1 protein_id gnl|my_center|LOCUS_13370 1497788 1497369 gene locus_tag LOCUS_13380 1497788 1497369 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021822.1 protein_id gnl|my_center|LOCUS_13380 1498154 1499656 gene locus_tag LOCUS_13390 1498154 1499656 CDS product L-aspartate semialdehyde sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021823.1 protein_id gnl|my_center|LOCUS_13390 1499659 1500045 gene locus_tag LOCUS_13400 1499659 1500045 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065229.1 protein_id gnl|my_center|LOCUS_13400 1500719 1501531 gene locus_tag LOCUS_13410 1500719 1501531 CDS product DUF166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021826.1 protein_id gnl|my_center|LOCUS_13410 1502330 1501605 gene locus_tag LOCUS_13420 1502330 1501605 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021827.1 protein_id gnl|my_center|LOCUS_13420 1502553 1502915 gene locus_tag LOCUS_13430 1502553 1502915 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065230.1 protein_id gnl|my_center|LOCUS_13430 1503994 1503137 gene locus_tag LOCUS_13440 1503994 1503137 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065231.1 protein_id gnl|my_center|LOCUS_13440 1505588 1508560 gene locus_tag LOCUS_13450 1505588 1508560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1509049 1510326 gene locus_tag LOCUS_13460 1509049 1510326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065283.1 protein_id gnl|my_center|LOCUS_13460 1510950 1512704 gene locus_tag LOCUS_13470 1510950 1512704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13470 1512776 1513939 gene locus_tag LOCUS_13480 1512776 1513939 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476549.1 protein_id gnl|my_center|LOCUS_13480 1513971 1514360 gene locus_tag LOCUS_13490 1513971 1514360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1514551 1515288 gene locus_tag LOCUS_13500 gene alaXM 1514551 1515288 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022008.1 protein_id gnl|my_center|LOCUS_13500 1515570 1518617 gene locus_tag LOCUS_13510 1515570 1518617 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022007.1 protein_id gnl|my_center|LOCUS_13510 1518661 1519038 gene locus_tag LOCUS_13520 1518661 1519038 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022006.1 protein_id gnl|my_center|LOCUS_13520 1519278 1519060 gene locus_tag LOCUS_13530 1519278 1519060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1520025 1519654 gene locus_tag LOCUS_13540 1520025 1519654 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022005.1 protein_id gnl|my_center|LOCUS_13540 1520356 1521027 gene locus_tag LOCUS_13550 1520356 1521027 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022004.1 protein_id gnl|my_center|LOCUS_13550 1522624 1521584 gene locus_tag LOCUS_13560 1522624 1521584 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022002.1 protein_id gnl|my_center|LOCUS_13560 1523257 1523523 gene locus_tag LOCUS_13570 1523257 1523523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 1523704 1523940 gene locus_tag LOCUS_13580 1523704 1523940 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065544.1 protein_id gnl|my_center|LOCUS_13580 1523958 1524167 gene locus_tag LOCUS_13590 1523958 1524167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13590 1524241 1524450 gene locus_tag LOCUS_13600 1524241 1524450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1524527 1524715 gene locus_tag LOCUS_13610 1524527 1524715 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065544.1 protein_id gnl|my_center|LOCUS_13610 1524739 1524927 gene locus_tag LOCUS_13620 1524739 1524927 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065544.1 protein_id gnl|my_center|LOCUS_13620 1525577 1525789 gene locus_tag LOCUS_13630 1525577 1525789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1526366 1525953 gene locus_tag LOCUS_13640 1526366 1525953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022807.1 protein_id gnl|my_center|LOCUS_13640 1526975 1526415 gene locus_tag LOCUS_13650 1526975 1526415 CDS product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022806.1 protein_id gnl|my_center|LOCUS_13650 1526968 1527237 gene locus_tag LOCUS_13660 1526968 1527237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1527498 1527289 gene locus_tag LOCUS_13670 1527498 1527289 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021259.1 protein_id gnl|my_center|LOCUS_13670 1527863 1528540 gene locus_tag LOCUS_13680 1527863 1528540 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990618.1 protein_id gnl|my_center|LOCUS_13680 1528825 1528601 gene locus_tag LOCUS_13690 1528825 1528601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1529220 1529044 gene locus_tag LOCUS_13700 1529220 1529044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13700 1529512 1529270 gene locus_tag LOCUS_13710 1529512 1529270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13710 1530200 1529592 gene locus_tag LOCUS_13720 1530200 1529592 CDS product sarcinarray family MAST domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065049.1 protein_id gnl|my_center|LOCUS_13720 1531012 1530197 gene locus_tag LOCUS_13730 1531012 1530197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1531699 1531091 gene locus_tag LOCUS_13740 1531699 1531091 CDS product sarcinarray family MAST domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065049.1 protein_id gnl|my_center|LOCUS_13740 1535866 1531706 gene locus_tag LOCUS_13750 1535866 1531706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021179.1 protein_id gnl|my_center|LOCUS_13750 1536710 1536087 gene locus_tag LOCUS_13760 1536710 1536087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 1537163 1537945 gene locus_tag LOCUS_13770 1537163 1537945 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022803.1 protein_id gnl|my_center|LOCUS_13770 1538120 1538193 gene locus_tag LOCUS_t00230 1538120 1538193 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1538371 1540098 gene locus_tag LOCUS_13780 1538371 1540098 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022802.1 protein_id gnl|my_center|LOCUS_13780 1540404 1540664 gene locus_tag LOCUS_13790 1540404 1540664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860264.1 protein_id gnl|my_center|LOCUS_13790 1543227 1540702 gene locus_tag LOCUS_13800 gene mgtA 1543227 1540702 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402038.1 protein_id gnl|my_center|LOCUS_13800 1544394 1543252 gene locus_tag LOCUS_13810 1544394 1543252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022800.1 protein_id gnl|my_center|LOCUS_13810 1544608 1545525 gene locus_tag LOCUS_13820 1544608 1545525 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082089262.1 protein_id gnl|my_center|LOCUS_13820 1546056 1545985 gene locus_tag LOCUS_t00240 1546056 1545985 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1546513 1546878 gene locus_tag LOCUS_13830 1546513 1546878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1547296 1546979 gene locus_tag LOCUS_13840 1547296 1546979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 1547441 1547289 gene locus_tag LOCUS_13850 1547441 1547289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 1548528 1549865 gene locus_tag LOCUS_13860 1548528 1549865 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023357.1 protein_id gnl|my_center|LOCUS_13860 1550030 1550269 gene locus_tag LOCUS_13870 1550030 1550269 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023356.1 protein_id gnl|my_center|LOCUS_13870 1552562 1550355 gene locus_tag LOCUS_13880 1552562 1550355 CDS product lectin like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066491.1 protein_id gnl|my_center|LOCUS_13880 1553119 1553436 gene locus_tag LOCUS_13890 1553119 1553436 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066490.1 protein_id gnl|my_center|LOCUS_13890 1553749 1553513 gene locus_tag LOCUS_13900 1553749 1553513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 1553642 1554100 gene locus_tag LOCUS_13910 1553642 1554100 CDS product DNA polymerase ligase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023353.1 protein_id gnl|my_center|LOCUS_13910 1554395 1554766 gene locus_tag LOCUS_13920 1554395 1554766 CDS product STAS-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023352.1 protein_id gnl|my_center|LOCUS_13920 1554759 1555382 gene locus_tag LOCUS_13930 1554759 1555382 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023351.1 protein_id gnl|my_center|LOCUS_13930 1555656 1555901 gene locus_tag LOCUS_13940 1555656 1555901 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022341.1 protein_id gnl|my_center|LOCUS_13940 1555870 1556064 gene locus_tag LOCUS_13950 1555870 1556064 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755925.1 protein_id gnl|my_center|LOCUS_13950 1556534 1556163 gene locus_tag LOCUS_13960 1556534 1556163 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870296.1 protein_id gnl|my_center|LOCUS_13960 1557249 1556623 gene locus_tag LOCUS_13970 1557249 1556623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13970 1557510 1557256 gene locus_tag LOCUS_13980 1557510 1557256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13980 1558749 1558063 gene locus_tag LOCUS_13990 1558749 1558063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1559005 1559211 gene locus_tag LOCUS_14000 1559005 1559211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1559204 1559419 gene locus_tag LOCUS_14010 1559204 1559419 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250461.1 protein_id gnl|my_center|LOCUS_14010 1559833 1560177 gene locus_tag LOCUS_14020 1559833 1560177 CDS product DUF6326 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021642.1 protein_id gnl|my_center|LOCUS_14020 1560505 1560804 gene locus_tag LOCUS_14030 1560505 1560804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065705.1 protein_id gnl|my_center|LOCUS_14030 1561927 1561094 gene locus_tag LOCUS_14040 1561927 1561094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 1562638 1562384 gene locus_tag LOCUS_14050 1562638 1562384 CDS product type II toxin-antitoxin system MqsA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065704.1 protein_id gnl|my_center|LOCUS_14050 1563159 1562782 gene locus_tag LOCUS_14060 1563159 1562782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1563397 1563134 gene locus_tag LOCUS_14070 1563397 1563134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 1563671 1563369 gene locus_tag LOCUS_14080 1563671 1563369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1564159 1563758 gene locus_tag LOCUS_14090 1564159 1563758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1564586 1564221 gene locus_tag LOCUS_14100 1564586 1564221 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020159.1 protein_id gnl|my_center|LOCUS_14100 1564891 1566399 gene locus_tag LOCUS_14110 gene serS 1564891 1566399 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876746.1 protein_id gnl|my_center|LOCUS_14110 1566917 1567528 gene locus_tag LOCUS_14120 1566917 1567528 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023341.1 protein_id gnl|my_center|LOCUS_14120 1570397 1567899 gene locus_tag LOCUS_14130 1570397 1567899 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021792.1 protein_id gnl|my_center|LOCUS_14130 1571061 1572347 gene locus_tag LOCUS_14140 gene thiC 1571061 1572347 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021793.1 protein_id gnl|my_center|LOCUS_14140 1573502 1572576 gene locus_tag LOCUS_14150 1573502 1572576 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065217.1 protein_id gnl|my_center|LOCUS_14150 1573811 1574308 gene locus_tag LOCUS_14160 1573811 1574308 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021795.1 protein_id gnl|my_center|LOCUS_14160 1574763 1574359 gene locus_tag LOCUS_14170 1574763 1574359 CDS product DUF3303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021796.1 protein_id gnl|my_center|LOCUS_14170 1576297 1575071 gene locus_tag LOCUS_14180 1576297 1575071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1577509 1577042 gene locus_tag LOCUS_14190 1577509 1577042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 1577973 1577785 gene locus_tag LOCUS_14200 1577973 1577785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 1578863 1578258 gene locus_tag LOCUS_14210 1578863 1578258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14210 1579201 1578872 gene locus_tag LOCUS_14220 1579201 1578872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14220 1579327 1579461 gene locus_tag LOCUS_14230 1579327 1579461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1585331 1580145 gene locus_tag LOCUS_14240 1585331 1580145 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021623.1 protein_id gnl|my_center|LOCUS_14240 1586773 1586249 gene locus_tag LOCUS_14250 1586773 1586249 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065167.1 protein_id gnl|my_center|LOCUS_14250 1587149 1587313 gene locus_tag LOCUS_14260 1587149 1587313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 1588049 1587513 gene locus_tag LOCUS_14270 1588049 1587513 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982260.1 protein_id gnl|my_center|LOCUS_14270 1588198 1588052 gene locus_tag LOCUS_14280 1588198 1588052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1590010 1588643 gene locus_tag LOCUS_14290 1590010 1588643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 1590800 1590498 gene locus_tag LOCUS_14300 1590800 1590498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 1592243 1591077 gene locus_tag LOCUS_14310 1592243 1591077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1593001 1592735 gene locus_tag LOCUS_14320 1593001 1592735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1593626 1594645 gene locus_tag LOCUS_14330 gene mtaA 1593626 1594645 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021625.1 protein_id gnl|my_center|LOCUS_14330 1596512 1595127 gene locus_tag LOCUS_14340 gene mtaB 1596512 1595127 CDS product methanol--corrinoid protein co-methyltransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021626.1 protein_id gnl|my_center|LOCUS_14340 1597293 1596526 gene locus_tag LOCUS_14350 gene mtaC 1597293 1596526 CDS product methanol--corrinoid protein MtaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021627.1 protein_id gnl|my_center|LOCUS_14350 1598537 1600005 gene locus_tag LOCUS_r00040 1598537 1600005 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1600088 1600160 gene locus_tag LOCUS_t00250 1600088 1600160 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1600288 1603174 gene locus_tag LOCUS_r00050 1600288 1603174 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1603264 1603380 gene locus_tag LOCUS_r00060 1603264 1603380 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1603904 1604482 gene locus_tag LOCUS_14360 1603904 1604482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1605316 1604711 gene locus_tag LOCUS_14370 1605316 1604711 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021630.1 protein_id gnl|my_center|LOCUS_14370 1606413 1605463 gene locus_tag LOCUS_14380 1606413 1605463 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022320.1 protein_id gnl|my_center|LOCUS_14380 1606628 1607182 gene locus_tag LOCUS_14390 1606628 1607182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14390 1607272 1607751 gene locus_tag LOCUS_14400 1607272 1607751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14400 1609178 1609558 gene locus_tag LOCUS_14410 1609178 1609558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1609717 1610145 gene locus_tag LOCUS_14420 1609717 1610145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1610426 1611421 gene locus_tag LOCUS_14430 gene fgd 1610426 1611421 CDS product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892203.1 protein_id gnl|my_center|LOCUS_14430 1613116 1611668 gene locus_tag LOCUS_14440 1613116 1611668 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066243.1 protein_id gnl|my_center|LOCUS_14440 1613424 1613339 gene locus_tag LOCUS_t00260 1613424 1613339 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1615223 1613637 gene locus_tag LOCUS_14450 1615223 1613637 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767909.1 protein_id gnl|my_center|LOCUS_14450 1617025 1616198 gene locus_tag LOCUS_14460 1617025 1616198 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921011.1 protein_id gnl|my_center|LOCUS_14460 1618657 1617050 gene locus_tag LOCUS_14470 1618657 1617050 CDS product multidrug efflux ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898775.1 protein_id gnl|my_center|LOCUS_14470 1619562 1618660 gene locus_tag LOCUS_14480 1619562 1618660 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048143027.1 protein_id gnl|my_center|LOCUS_14480 1619707 1620294 gene locus_tag LOCUS_14490 1619707 1620294 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263281.1 protein_id gnl|my_center|LOCUS_14490 1620741 1621124 gene locus_tag LOCUS_14500 1620741 1621124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 1621811 1621314 gene locus_tag LOCUS_14510 1621811 1621314 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799620.1 protein_id gnl|my_center|LOCUS_14510 1623321 1626113 gene locus_tag LOCUS_14520 1623321 1626113 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021650.1 protein_id gnl|my_center|LOCUS_14520 1626444 1626241 gene locus_tag LOCUS_14530 1626444 1626241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 1626990 1626502 gene locus_tag LOCUS_14540 1626990 1626502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1627361 1627044 gene locus_tag LOCUS_14550 gene sugE 1627361 1627044 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941368.1 protein_id gnl|my_center|LOCUS_14550 1627811 1628926 gene locus_tag LOCUS_14560 1627811 1628926 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135390550.1 protein_id gnl|my_center|LOCUS_14560 1630286 1629036 gene locus_tag LOCUS_14570 1630286 1629036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 1630685 1630849 gene locus_tag LOCUS_14580 1630685 1630849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1630928 1631098 gene locus_tag LOCUS_14590 1630928 1631098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 1631099 1634179 gene locus_tag LOCUS_14600 1631099 1634179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 1634298 1634582 gene locus_tag LOCUS_14610 1634298 1634582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 1634737 1635057 gene locus_tag LOCUS_14620 1634737 1635057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 1635294 1635503 gene locus_tag LOCUS_14630 1635294 1635503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 1635485 1635973 gene locus_tag LOCUS_14640 1635485 1635973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 1641099 1636507 gene locus_tag LOCUS_14650 1641099 1636507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1641483 1641229 gene locus_tag LOCUS_14660 1641483 1641229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1645161 1641679 gene locus_tag LOCUS_14670 1645161 1641679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1645603 1650702 gene locus_tag LOCUS_14680 1645603 1650702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 1650727 1652550 gene locus_tag LOCUS_14690 1650727 1652550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1652551 1656924 gene locus_tag LOCUS_14700 1652551 1656924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1658181 1658095 gene locus_tag LOCUS_t00270 1658181 1658095 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1659248 1658340 gene locus_tag LOCUS_14710 gene argF 1659248 1658340 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023243.1 protein_id gnl|my_center|LOCUS_14710 1660674 1659373 gene locus_tag LOCUS_14720 gene purD 1660674 1659373 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065667.1 protein_id gnl|my_center|LOCUS_14720 1661142 1661453 gene locus_tag LOCUS_14730 1661142 1661453 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989541.1 protein_id gnl|my_center|LOCUS_14730 1662092 1661529 gene locus_tag LOCUS_14740 gene pyrE 1662092 1661529 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023240.1 protein_id gnl|my_center|LOCUS_14740 1662710 1662183 gene locus_tag LOCUS_14750 1662710 1662183 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023239.1 protein_id gnl|my_center|LOCUS_14750 1662995 1664032 gene locus_tag LOCUS_14760 1662995 1664032 CDS product cytochrome c-type biogenesis CcmF C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065666.1 protein_id gnl|my_center|LOCUS_14760 1664056 1665117 gene locus_tag LOCUS_14770 gene ccsA 1664056 1665117 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023237.1 protein_id gnl|my_center|LOCUS_14770 1666065 1666460 gene locus_tag LOCUS_14780 1666065 1666460 CDS product transcriptional regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065665.1 protein_id gnl|my_center|LOCUS_14780 1666722 1667186 gene locus_tag LOCUS_14790 gene tnpA 1666722 1667186 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979974.1 protein_id gnl|my_center|LOCUS_14790 1667864 1667652 gene locus_tag LOCUS_14800 1667864 1667652 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023233.1 protein_id gnl|my_center|LOCUS_14800 1667989 1667861 gene locus_tag LOCUS_14810 1667989 1667861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 1668570 1668499 gene locus_tag LOCUS_t00280 1668570 1668499 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1668661 1668587 gene locus_tag LOCUS_t00290 1668661 1668587 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1668814 1668740 gene locus_tag LOCUS_t00300 1668814 1668740 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1668952 1668881 gene locus_tag LOCUS_t00310 1668952 1668881 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1669039 1668965 gene locus_tag LOCUS_t00320 1669039 1668965 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1669251 1669177 gene locus_tag LOCUS_t00330 1669251 1669177 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1669616 1670932 gene locus_tag LOCUS_14820 1669616 1670932 CDS product methanogenesis marker 16 metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023232.1 protein_id gnl|my_center|LOCUS_14820 1672488 1671331 gene locus_tag LOCUS_14830 gene comE 1672488 1671331 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023231.1 protein_id gnl|my_center|LOCUS_14830 1673866 1672607 gene locus_tag LOCUS_14840 1673866 1672607 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_14840 1674597 1674139 gene locus_tag LOCUS_14850 1674597 1674139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023229.1 protein_id gnl|my_center|LOCUS_14850 1674895 1674740 gene locus_tag LOCUS_14860 1674895 1674740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 1675961 1675191 gene locus_tag LOCUS_14870 1675961 1675191 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065662.1 protein_id gnl|my_center|LOCUS_14870 1676169 1676609 gene locus_tag LOCUS_14880 1676169 1676609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023224.1 protein_id gnl|my_center|LOCUS_14880 1677418 1676654 gene locus_tag LOCUS_14890 1677418 1676654 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023223.1 protein_id gnl|my_center|LOCUS_14890 1677921 1679990 gene locus_tag LOCUS_14900 gene lonB 1677921 1679990 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023222.1 protein_id gnl|my_center|LOCUS_14900 1679993 1681333 gene locus_tag LOCUS_14910 1679993 1681333 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990640.1 protein_id gnl|my_center|LOCUS_14910 1681336 1682646 gene locus_tag LOCUS_14920 1681336 1682646 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065661.1 protein_id gnl|my_center|LOCUS_14920 1683244 1682795 gene locus_tag LOCUS_14930 1683244 1682795 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023219.1 protein_id gnl|my_center|LOCUS_14930 1684981 1684043 gene locus_tag LOCUS_14940 1684981 1684043 CDS product nucleoside recognition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023218.1 protein_id gnl|my_center|LOCUS_14940 1685644 1685186 gene locus_tag LOCUS_14950 1685644 1685186 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023217.1 protein_id gnl|my_center|LOCUS_14950 1686164 1685751 gene locus_tag LOCUS_14960 1686164 1685751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1687126 1689318 gene locus_tag LOCUS_14970 1687126 1689318 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022840.1 protein_id gnl|my_center|LOCUS_14970 1689907 1691619 gene locus_tag LOCUS_14980 1689907 1691619 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022839.1 protein_id gnl|my_center|LOCUS_14980 1691616 1693322 gene locus_tag LOCUS_14990 1691616 1693322 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022838.1 protein_id gnl|my_center|LOCUS_14990 1694718 1693432 gene locus_tag LOCUS_15000 1694718 1693432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1695698 1698688 gene locus_tag LOCUS_15010 1695698 1698688 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022836.1 protein_id gnl|my_center|LOCUS_15010 1699330 1701342 gene locus_tag LOCUS_15020 1699330 1701342 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860269.1 protein_id gnl|my_center|LOCUS_15020 1702322 1703413 gene locus_tag LOCUS_15030 1702322 1703413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 1703798 1704232 gene locus_tag LOCUS_15040 1703798 1704232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1704551 1704928 gene locus_tag LOCUS_15050 1704551 1704928 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065974.1 protein_id gnl|my_center|LOCUS_15050 1704932 1708381 gene locus_tag LOCUS_15060 1704932 1708381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 1708836 1708519 gene locus_tag LOCUS_15070 1708836 1708519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066421.1 protein_id gnl|my_center|LOCUS_15070 1709343 1708945 gene locus_tag LOCUS_15080 1709343 1708945 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065550.1 protein_id gnl|my_center|LOCUS_15080 1710587 1709343 gene locus_tag LOCUS_15090 1710587 1709343 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065549.1 protein_id gnl|my_center|LOCUS_15090 1711061 1710597 gene locus_tag LOCUS_15100 1711061 1710597 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022827.1 protein_id gnl|my_center|LOCUS_15100 1711086 1711262 gene locus_tag LOCUS_15110 1711086 1711262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1711803 1711522 gene locus_tag LOCUS_15120 1711803 1711522 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022822.1 protein_id gnl|my_center|LOCUS_15120 1712863 1715244 gene locus_tag LOCUS_15130 gene hdrA2 1712863 1715244 CDS product CoB-CoM heterodisulfide reductase HdrA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022820.1 protein_id gnl|my_center|LOCUS_15130 1715241 1716713 gene locus_tag LOCUS_15140 1715241 1716713 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022819.1 protein_id gnl|my_center|LOCUS_15140 1717438 1716986 gene locus_tag LOCUS_15150 1717438 1716986 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022818.1 protein_id gnl|my_center|LOCUS_15150 1717579 1718235 gene locus_tag LOCUS_15160 1717579 1718235 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065547.1 protein_id gnl|my_center|LOCUS_15160 1719833 1718424 gene locus_tag LOCUS_15170 1719833 1718424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 1720171 1719971 gene locus_tag LOCUS_15180 1720171 1719971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1720149 1720604 gene locus_tag LOCUS_15190 1720149 1720604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 1720850 1721974 gene locus_tag LOCUS_15200 gene tnpB 1720850 1721974 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_15200 1722893 1725313 gene locus_tag LOCUS_15210 1722893 1725313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15210 1725419 1726171 gene locus_tag LOCUS_15220 1725419 1726171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15220 1727144 1726983 gene locus_tag LOCUS_15230 1727144 1726983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15230 1727697 1728221 gene locus_tag LOCUS_15240 1727697 1728221 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065297.1 protein_id gnl|my_center|LOCUS_15240 1728850 1729974 gene locus_tag LOCUS_15250 1728850 1729974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1731075 1730725 gene locus_tag LOCUS_15260 1731075 1730725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1731290 1731481 gene locus_tag LOCUS_15270 1731290 1731481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065302.1 protein_id gnl|my_center|LOCUS_15270 1731531 1731734 gene locus_tag LOCUS_15280 1731531 1731734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1732115 1731891 gene locus_tag LOCUS_15290 1732115 1731891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022084.1 protein_id gnl|my_center|LOCUS_15290 1733299 1732523 gene locus_tag LOCUS_15300 1733299 1732523 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022068.1 protein_id gnl|my_center|LOCUS_15300 1733688 1734704 gene locus_tag LOCUS_15310 1733688 1734704 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022067.1 protein_id gnl|my_center|LOCUS_15310 1735063 1736187 gene locus_tag LOCUS_15320 gene tnpB 1735063 1736187 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_15320 1736332 1736742 gene locus_tag LOCUS_15330 1736332 1736742 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990834.1 protein_id gnl|my_center|LOCUS_15330 1738520 1737669 gene locus_tag LOCUS_15340 1738520 1737669 CDS product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022201.1 protein_id gnl|my_center|LOCUS_15340 1738937 1738698 gene locus_tag LOCUS_15350 1738937 1738698 CDS product MTH865 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022202.1 protein_id gnl|my_center|LOCUS_15350 1739062 1738934 gene locus_tag LOCUS_15360 1739062 1738934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 1740138 1739266 gene locus_tag LOCUS_15370 1740138 1739266 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020795.1 protein_id gnl|my_center|LOCUS_15370 1740496 1741629 gene locus_tag LOCUS_15380 1740496 1741629 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023694.1 protein_id gnl|my_center|LOCUS_15380 1742399 1741626 gene locus_tag LOCUS_15390 1742399 1741626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1742997 1742413 gene locus_tag LOCUS_15400 1742997 1742413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 1744836 1743007 gene locus_tag LOCUS_15410 1744836 1743007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1744909 1745202 gene locus_tag LOCUS_15420 1744909 1745202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1746327 1745203 gene locus_tag LOCUS_15430 1746327 1745203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1746524 1746324 gene locus_tag LOCUS_15440 1746524 1746324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1747015 1746533 gene locus_tag LOCUS_15450 1747015 1746533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1747929 1747012 gene locus_tag LOCUS_15460 1747929 1747012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1748376 1747939 gene locus_tag LOCUS_15470 1748376 1747939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 1749052 1748630 gene locus_tag LOCUS_15480 1749052 1748630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 1749309 1749049 gene locus_tag LOCUS_15490 1749309 1749049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1749623 1749306 gene locus_tag LOCUS_15500 1749623 1749306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 1750128 1749901 gene locus_tag LOCUS_15510 1750128 1749901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 1750404 1750222 gene locus_tag LOCUS_15520 1750404 1750222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1750982 1750584 gene locus_tag LOCUS_15530 1750982 1750584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1752002 1750986 gene locus_tag LOCUS_15540 1752002 1750986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 1754007 1752037 gene locus_tag LOCUS_15550 1754007 1752037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 1754570 1754004 gene locus_tag LOCUS_15560 1754570 1754004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 1754916 1754560 gene locus_tag LOCUS_15570 1754916 1754560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1755885 1754953 gene locus_tag LOCUS_15580 1755885 1754953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 1756289 1755885 gene locus_tag LOCUS_15590 1756289 1755885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 1757206 1756286 gene locus_tag LOCUS_15600 1757206 1756286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1757269 1757475 gene locus_tag LOCUS_15610 1757269 1757475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 1757555 1758823 gene locus_tag LOCUS_15620 1757555 1758823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1758825 1759511 gene locus_tag LOCUS_15630 1758825 1759511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1759998 1759774 gene locus_tag LOCUS_15640 1759998 1759774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065814.1 protein_id gnl|my_center|LOCUS_15640 1761404 1759992 gene locus_tag LOCUS_15650 1761404 1759992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1763121 1761394 gene locus_tag LOCUS_15660 1763121 1761394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1764782 1763412 gene locus_tag LOCUS_15670 gene terL 1764782 1763412 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023725.1 protein_id gnl|my_center|LOCUS_15670 1765236 1764751 gene locus_tag LOCUS_15680 1765236 1764751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1768399 1765439 gene locus_tag LOCUS_15690 1768399 1765439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 1768559 1768401 gene locus_tag LOCUS_15700 1768559 1768401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 1768914 1768540 gene locus_tag LOCUS_15710 1768914 1768540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1768991 1769287 gene locus_tag LOCUS_15720 1768991 1769287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1769643 1769179 gene locus_tag LOCUS_15730 1769643 1769179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 1770083 1769643 gene locus_tag LOCUS_15740 1770083 1769643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 1770837 1770202 gene locus_tag LOCUS_15750 1770837 1770202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1770988 1770830 gene locus_tag LOCUS_15760 1770988 1770830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 1772364 1770985 gene locus_tag LOCUS_15770 1772364 1770985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 1772684 1772361 gene locus_tag LOCUS_15780 1772684 1772361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 1772808 1772674 gene locus_tag LOCUS_15790 1772808 1772674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 1773272 1772805 gene locus_tag LOCUS_15800 1773272 1772805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 1773571 1773269 gene locus_tag LOCUS_15810 1773571 1773269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 1774237 1773887 gene locus_tag LOCUS_15820 1774237 1773887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 1774591 1774415 gene locus_tag LOCUS_15830 1774591 1774415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1774871 1774584 gene locus_tag LOCUS_15840 1774871 1774584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065821.1 protein_id gnl|my_center|LOCUS_15840 1775403 1776080 gene locus_tag LOCUS_15850 1775403 1776080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 1776702 1776217 gene locus_tag LOCUS_15860 1776702 1776217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 1776950 1777270 gene locus_tag LOCUS_15870 1776950 1777270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023742.1 protein_id gnl|my_center|LOCUS_15870 1778521 1777349 gene locus_tag LOCUS_15880 1778521 1777349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022204.1 protein_id gnl|my_center|LOCUS_15880 1779606 1778758 gene locus_tag LOCUS_15890 1779606 1778758 CDS product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022219.1 protein_id gnl|my_center|LOCUS_15890 1781259 1779988 gene locus_tag LOCUS_15900 1781259 1779988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1781624 1781782 gene locus_tag LOCUS_15910 1781624 1781782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 1782798 1781812 gene locus_tag LOCUS_15920 1782798 1781812 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022224.1 protein_id gnl|my_center|LOCUS_15920 1784367 1785308 gene locus_tag LOCUS_15930 1784367 1785308 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020317.1 protein_id gnl|my_center|LOCUS_15930 1786053 1787567 gene locus_tag LOCUS_15940 1786053 1787567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022222.1 protein_id gnl|my_center|LOCUS_15940 1788180 1789706 gene locus_tag LOCUS_15950 1788180 1789706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022222.1 protein_id gnl|my_center|LOCUS_15950 1791350 1790049 gene locus_tag LOCUS_15960 1791350 1790049 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022225.1 protein_id gnl|my_center|LOCUS_15960 1792553 1791801 gene locus_tag LOCUS_15970 1792553 1791801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 1794013 1792889 gene locus_tag LOCUS_15980 1794013 1792889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1795510 1794293 gene locus_tag LOCUS_15990 1795510 1794293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 1796412 1795507 gene locus_tag LOCUS_16000 1796412 1795507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1796518 1796658 gene locus_tag LOCUS_16010 1796518 1796658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1796655 1797293 gene locus_tag LOCUS_16020 1796655 1797293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1797411 1797638 gene locus_tag LOCUS_16030 1797411 1797638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 1797631 1800330 gene locus_tag LOCUS_16040 1797631 1800330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1800712 1801356 gene locus_tag LOCUS_16050 1800712 1801356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1801392 1801532 gene locus_tag LOCUS_16060 1801392 1801532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1801504 1801653 gene locus_tag LOCUS_16070 1801504 1801653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 1801827 1801952 gene locus_tag LOCUS_16080 1801827 1801952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 1802692 1805637 gene locus_tag LOCUS_16090 1802692 1805637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1806399 1805881 gene locus_tag LOCUS_16100 1806399 1805881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 1807044 1807472 gene locus_tag LOCUS_16110 1807044 1807472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 1808207 1807971 gene locus_tag LOCUS_16120 1808207 1807971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 1808752 1808495 gene locus_tag LOCUS_16130 1808752 1808495 CDS product pro-sigmaK processing inhibitor BofA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020585.1 protein_id gnl|my_center|LOCUS_16130 1809682 1808915 gene locus_tag LOCUS_16140 1809682 1808915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022686.1 protein_id gnl|my_center|LOCUS_16140 1811314 1810196 gene locus_tag LOCUS_16150 1811314 1810196 CDS product STARP antigen inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021732.1 protein_id gnl|my_center|LOCUS_16150 1812623 1811811 gene locus_tag LOCUS_16160 1812623 1811811 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022181.1 protein_id gnl|my_center|LOCUS_16160 1814113 1813262 gene locus_tag LOCUS_16170 gene ilvE 1814113 1813262 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_16170 1814471 1814722 gene locus_tag LOCUS_16180 1814471 1814722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 1814715 1814957 gene locus_tag LOCUS_16190 1814715 1814957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1817880 1815007 gene locus_tag LOCUS_16200 1817880 1815007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 1820125 1819061 gene locus_tag LOCUS_16210 1820125 1819061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1821255 1820392 gene locus_tag LOCUS_16220 1821255 1820392 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021030.1 protein_id gnl|my_center|LOCUS_16220 1823238 1821553 gene locus_tag LOCUS_16230 1823238 1821553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 1823859 1823347 gene locus_tag LOCUS_16240 1823859 1823347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16240 1825291 1826025 gene locus_tag LOCUS_16250 1825291 1826025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 1826408 1826145 gene locus_tag LOCUS_16260 1826408 1826145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 1826727 1826455 gene locus_tag LOCUS_16270 1826727 1826455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1827155 1826901 gene locus_tag LOCUS_16280 1827155 1826901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 1827614 1827279 gene locus_tag LOCUS_16290 1827614 1827279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 1827947 1827780 gene locus_tag LOCUS_16300 1827947 1827780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 1827877 1828551 gene locus_tag LOCUS_16310 1827877 1828551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 1829262 1828714 gene locus_tag LOCUS_16320 1829262 1828714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16320 1830530 1831162 gene locus_tag LOCUS_16330 1830530 1831162 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022229.1 protein_id gnl|my_center|LOCUS_16330 1831345 1831743 gene locus_tag LOCUS_16340 1831345 1831743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022230.1 protein_id gnl|my_center|LOCUS_16340 1832872 1831799 gene locus_tag LOCUS_16350 1832872 1831799 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022231.1 protein_id gnl|my_center|LOCUS_16350 1834601 1833474 gene locus_tag LOCUS_16360 1834601 1833474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16360 1835203 1834841 gene locus_tag LOCUS_16370 1835203 1834841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16370 1835162 1835371 gene locus_tag LOCUS_16380 1835162 1835371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 1835618 1835463 gene locus_tag LOCUS_16390 1835618 1835463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1836092 1835940 gene locus_tag LOCUS_16400 1836092 1835940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1836347 1837309 gene locus_tag LOCUS_16410 1836347 1837309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1837595 1837867 gene locus_tag LOCUS_16420 1837595 1837867 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022232.1 protein_id gnl|my_center|LOCUS_16420 1838241 1839347 gene locus_tag LOCUS_16430 1838241 1839347 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065345.1 protein_id gnl|my_center|LOCUS_16430 1839692 1839411 gene locus_tag LOCUS_16440 1839692 1839411 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545162.1 protein_id gnl|my_center|LOCUS_16440 1841015 1839864 gene locus_tag LOCUS_16450 1841015 1839864 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_16450 1841399 1841034 gene locus_tag LOCUS_16460 1841399 1841034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 1842150 1841941 gene locus_tag LOCUS_16470 1842150 1841941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1842450 1842250 gene locus_tag LOCUS_16480 1842450 1842250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1842758 1843864 gene locus_tag LOCUS_16490 gene dinB 1842758 1843864 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172312.1 protein_id gnl|my_center|LOCUS_16490 1844209 1844961 gene locus_tag LOCUS_16500 1844209 1844961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16500 1847255 1845060 gene locus_tag LOCUS_16510 1847255 1845060 CDS product CHASE4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022324.1 protein_id gnl|my_center|LOCUS_16510 1848409 1847393 gene locus_tag LOCUS_16520 1848409 1847393 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022325.1 protein_id gnl|my_center|LOCUS_16520 1848783 1849694 gene locus_tag LOCUS_16530 1848783 1849694 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250632.1 protein_id gnl|my_center|LOCUS_16530 1850611 1849802 gene locus_tag LOCUS_16540 1850611 1849802 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020249.1 protein_id gnl|my_center|LOCUS_16540 1852144 1851272 gene locus_tag LOCUS_16550 1852144 1851272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 1852481 1852708 gene locus_tag LOCUS_16560 1852481 1852708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1853173 1853823 gene locus_tag LOCUS_16570 1853173 1853823 CDS product methyltransferase cognate corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065003.1 protein_id gnl|my_center|LOCUS_16570 1853830 1855233 gene locus_tag LOCUS_16580 gene mtbB 1853830 1855233 CDS product dimethylamine methyltransferase MtbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:P58970 transl_except (pos:1854895..1854897,aa:Pyl) note codon on position 356 is pyrrolysine amber codon. protein_id gnl|my_center|LOCUS_16580 1855561 1857006 gene locus_tag LOCUS_16590 1855561 1857006 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065402.1 protein_id gnl|my_center|LOCUS_16590 1857262 1859769 gene locus_tag LOCUS_16600 1857262 1859769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 1859900 1861081 gene locus_tag LOCUS_16610 1859900 1861081 CDS product PGF-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020536.1 protein_id gnl|my_center|LOCUS_16610 1861621 1861346 gene locus_tag LOCUS_16620 1861621 1861346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16620 1862372 1861752 gene locus_tag LOCUS_16630 1862372 1861752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16630 1862857 1863984 gene locus_tag LOCUS_16640 1862857 1863984 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085095815.1 protein_id gnl|my_center|LOCUS_16640 1864521 1864105 gene locus_tag LOCUS_16650 1864521 1864105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 1865423 1867324 gene locus_tag LOCUS_16660 gene gatE 1865423 1867324 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022814.1 protein_id gnl|my_center|LOCUS_16660 1867997 1868380 gene locus_tag LOCUS_16670 1867997 1868380 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022813.1 protein_id gnl|my_center|LOCUS_16670 1868620 1870098 gene locus_tag LOCUS_16680 1868620 1870098 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065546.1 protein_id gnl|my_center|LOCUS_16680 1870194 1871531 gene locus_tag LOCUS_16690 1870194 1871531 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022811.1 protein_id gnl|my_center|LOCUS_16690 1872106 1871651 gene locus_tag LOCUS_16700 1872106 1871651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 1872222 1872037 gene locus_tag LOCUS_16710 1872222 1872037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 1872515 1872369 gene locus_tag LOCUS_16720 1872515 1872369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 1872670 1872924 gene locus_tag LOCUS_16730 1872670 1872924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1873098 1873370 gene locus_tag LOCUS_16740 1873098 1873370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 1873770 1873345 gene locus_tag LOCUS_16750 1873770 1873345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 1875325 1874141 gene locus_tag LOCUS_16760 1875325 1874141 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022128.1 protein_id gnl|my_center|LOCUS_16760 1879012 1875734 gene locus_tag LOCUS_16770 gene carB 1879012 1875734 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022129.1 protein_id gnl|my_center|LOCUS_16770 1880118 1879012 gene locus_tag LOCUS_16780 gene carA 1880118 1879012 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022130.1 protein_id gnl|my_center|LOCUS_16780 1880342 1880485 gene locus_tag LOCUS_16790 1880342 1880485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 1880544 1880741 gene locus_tag LOCUS_16800 1880544 1880741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 1881186 1880746 gene locus_tag LOCUS_16810 1881186 1880746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 1881410 1882444 gene locus_tag LOCUS_16820 gene mtaA 1881410 1882444 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022148.1 protein_id gnl|my_center|LOCUS_16820 1882696 1883541 gene locus_tag LOCUS_16830 1882696 1883541 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022176.1 protein_id gnl|my_center|LOCUS_16830 1884121 1884633 gene locus_tag LOCUS_16840 1884121 1884633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065545.1 protein_id gnl|my_center|LOCUS_16840 1885033 1886496 gene locus_tag LOCUS_16850 1885033 1886496 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023184.1 protein_id gnl|my_center|LOCUS_16850 1886939 1886589 gene locus_tag LOCUS_16860 1886939 1886589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16860 1888429 1888214 gene locus_tag LOCUS_16870 1888429 1888214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 1888883 1889518 gene locus_tag LOCUS_16880 1888883 1889518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 1889616 1890116 gene locus_tag LOCUS_16890 1889616 1890116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 1890473 1890763 gene locus_tag LOCUS_16900 1890473 1890763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 1891054 1890833 gene locus_tag LOCUS_16910 1891054 1890833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 1891490 1891711 gene locus_tag LOCUS_16920 1891490 1891711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 1891720 1892043 gene locus_tag LOCUS_16930 1891720 1892043 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023310.1 protein_id gnl|my_center|LOCUS_16930 1893838 1892318 gene locus_tag LOCUS_16940 1893838 1892318 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023309.1 protein_id gnl|my_center|LOCUS_16940 1894276 1895457 gene locus_tag LOCUS_16950 1894276 1895457 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065687.1 protein_id gnl|my_center|LOCUS_16950 1896335 1896024 gene locus_tag LOCUS_16960 1896335 1896024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16960 1896759 1898045 gene locus_tag LOCUS_16970 1896759 1898045 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023306.1 protein_id gnl|my_center|LOCUS_16970 1898692 1899864 gene locus_tag LOCUS_16980 1898692 1899864 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022687.1 protein_id gnl|my_center|LOCUS_16980 1902738 1901638 gene locus_tag LOCUS_16990 1902738 1901638 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990623.1 protein_id gnl|my_center|LOCUS_16990 1906099 1904648 gene locus_tag LOCUS_17000 1906099 1904648 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066425.1 protein_id gnl|my_center|LOCUS_17000 1907151 1906096 gene locus_tag LOCUS_17010 1907151 1906096 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022859.1 protein_id gnl|my_center|LOCUS_17010 1907422 1907174 gene locus_tag LOCUS_17020 1907422 1907174 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022860.1 protein_id gnl|my_center|LOCUS_17020 1909402 1907738 gene locus_tag LOCUS_17030 1909402 1907738 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_17030 1910165 1909611 gene locus_tag LOCUS_17040 1910165 1909611 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022863.1 protein_id gnl|my_center|LOCUS_17040 1910770 1912422 gene locus_tag LOCUS_17050 1910770 1912422 CDS product PKD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022864.1 protein_id gnl|my_center|LOCUS_17050 1913271 1912453 gene locus_tag LOCUS_17060 1913271 1912453 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022865.1 protein_id gnl|my_center|LOCUS_17060 1913784 1914473 gene locus_tag LOCUS_17070 1913784 1914473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022866.1 protein_id gnl|my_center|LOCUS_17070 1914621 1915112 gene locus_tag LOCUS_17080 1914621 1915112 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065558.1 protein_id gnl|my_center|LOCUS_17080 1915331 1915546 gene locus_tag LOCUS_17090 1915331 1915546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065559.1 protein_id gnl|my_center|LOCUS_17090 1915621 1915914 gene locus_tag LOCUS_17100 1915621 1915914 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022869.1 protein_id gnl|my_center|LOCUS_17100 1916440 1917954 gene locus_tag LOCUS_17110 1916440 1917954 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021961.1 protein_id gnl|my_center|LOCUS_17110 1918468 1919706 gene locus_tag LOCUS_17120 1918468 1919706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 1920216 1920932 gene locus_tag LOCUS_17130 1920216 1920932 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082088944.1 protein_id gnl|my_center|LOCUS_17130 1922900 1921047 gene locus_tag LOCUS_17140 1922900 1921047 CDS product PGF-pre-PGF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990662.1 protein_id gnl|my_center|LOCUS_17140 1923102 1923458 gene locus_tag LOCUS_17150 1923102 1923458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 1923625 1923437 gene locus_tag LOCUS_17160 1923625 1923437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 1924539 1923910 gene locus_tag LOCUS_17170 1924539 1923910 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021963.1 protein_id gnl|my_center|LOCUS_17170 1926135 1924678 gene locus_tag LOCUS_17180 gene dacB 1926135 1924678 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279147.1 protein_id gnl|my_center|LOCUS_17180 1927803 1926637 gene locus_tag LOCUS_17190 1927803 1926637 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984844.1 protein_id gnl|my_center|LOCUS_17190 1928430 1927921 gene locus_tag LOCUS_17200 1928430 1927921 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021966.1 protein_id gnl|my_center|LOCUS_17200 1928812 1929531 gene locus_tag LOCUS_17210 1928812 1929531 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065272.1 protein_id gnl|my_center|LOCUS_17210 1931086 1929686 gene locus_tag LOCUS_17220 1931086 1929686 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021968.1 protein_id gnl|my_center|LOCUS_17220 1933575 1932841 gene locus_tag LOCUS_17230 1933575 1932841 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488956.1 protein_id gnl|my_center|LOCUS_17230 1933848 1934756 gene locus_tag LOCUS_17240 1933848 1934756 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021969.1 protein_id gnl|my_center|LOCUS_17240 1935746 1934841 gene locus_tag LOCUS_17250 1935746 1934841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021970.1 protein_id gnl|my_center|LOCUS_17250 1935948 1936511 gene locus_tag LOCUS_17260 1935948 1936511 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021971.1 protein_id gnl|my_center|LOCUS_17260 1937772 1937179 gene locus_tag LOCUS_17270 1937772 1937179 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021972.1 protein_id gnl|my_center|LOCUS_17270 1938815 1937979 gene locus_tag LOCUS_17280 1938815 1937979 CDS product molybdopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065273.1 protein_id gnl|my_center|LOCUS_17280 1939134 1939823 gene locus_tag LOCUS_17290 gene radC 1939134 1939823 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021974.1 protein_id gnl|my_center|LOCUS_17290 1940048 1940200 gene locus_tag LOCUS_17300 1940048 1940200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17300 1940251 1940427 gene locus_tag LOCUS_17310 1940251 1940427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17310 1940695 1940462 gene locus_tag LOCUS_17320 1940695 1940462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 1941929 1941285 gene locus_tag LOCUS_17330 1941929 1941285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024352.1 protein_id gnl|my_center|LOCUS_17330 1942203 1941943 gene locus_tag LOCUS_17340 1942203 1941943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 1943243 1942647 gene locus_tag LOCUS_17350 1943243 1942647 CDS product UPF0228 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023925.1 protein_id gnl|my_center|LOCUS_17350 1944033 1945073 gene locus_tag LOCUS_17360 1944033 1945073 CDS product DUF1743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021976.1 protein_id gnl|my_center|LOCUS_17360 1945147 1946706 gene locus_tag LOCUS_17370 1945147 1946706 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021977.1 protein_id gnl|my_center|LOCUS_17370 1947519 1949846 gene locus_tag LOCUS_17380 1947519 1949846 CDS product DUF3160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023262.1 protein_id gnl|my_center|LOCUS_17380 1950063 1950215 gene locus_tag LOCUS_17390 1950063 1950215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1950299 1950736 gene locus_tag LOCUS_17400 1950299 1950736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023265.1 protein_id gnl|my_center|LOCUS_17400 1951106 1953466 gene locus_tag LOCUS_17410 1951106 1953466 CDS product DUF3160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065672.1 protein_id gnl|my_center|LOCUS_17410 1953595 1954494 gene locus_tag LOCUS_17420 1953595 1954494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 1955787 1954570 gene locus_tag LOCUS_17430 1955787 1954570 CDS product homocitrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023272.1 protein_id gnl|my_center|LOCUS_17430 1957050 1956223 gene locus_tag LOCUS_17440 1957050 1956223 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023273.1 protein_id gnl|my_center|LOCUS_17440 1957855 1957052 gene locus_tag LOCUS_17450 1957855 1957052 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023274.1 protein_id gnl|my_center|LOCUS_17450 1959010 1958003 gene locus_tag LOCUS_17460 1959010 1958003 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021053.1 protein_id gnl|my_center|LOCUS_17460 1959709 1959981 gene locus_tag LOCUS_17470 1959709 1959981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 1960171 1959983 gene locus_tag LOCUS_17480 1960171 1959983 CDS product CooT family nickel-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065683.1 protein_id gnl|my_center|LOCUS_17480 1961850 1960354 gene locus_tag LOCUS_17490 1961850 1960354 CDS product C45 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022064.1 protein_id gnl|my_center|LOCUS_17490 1962920 1962039 gene locus_tag LOCUS_17500 1962920 1962039 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023289.1 protein_id gnl|my_center|LOCUS_17500 1963238 1964758 gene locus_tag LOCUS_17510 1963238 1964758 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065684.1 protein_id gnl|my_center|LOCUS_17510 1965439 1966449 gene locus_tag LOCUS_17520 1965439 1966449 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023294.1 protein_id gnl|my_center|LOCUS_17520 1966787 1966509 gene locus_tag LOCUS_17530 1966787 1966509 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023295.1 protein_id gnl|my_center|LOCUS_17530 1967574 1967359 gene locus_tag LOCUS_17540 1967574 1967359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 1968561 1967986 gene locus_tag LOCUS_17550 1968561 1967986 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257758.1 protein_id gnl|my_center|LOCUS_17550 1968853 1969260 gene locus_tag LOCUS_17560 1968853 1969260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 1969878 1972355 gene locus_tag LOCUS_17570 1969878 1972355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 1972698 1972991 gene locus_tag LOCUS_17580 1972698 1972991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 1973029 1973475 gene locus_tag LOCUS_17590 1973029 1973475 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 protein_id gnl|my_center|LOCUS_17590 1973508 1975037 gene locus_tag LOCUS_17600 1973508 1975037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 1976153 1975251 gene locus_tag LOCUS_17610 1976153 1975251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 1977073 1976591 gene locus_tag LOCUS_17620 1977073 1976591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990643.1 protein_id gnl|my_center|LOCUS_17620 1978702 1977326 gene locus_tag LOCUS_17630 1978702 1977326 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021144.1 protein_id gnl|my_center|LOCUS_17630 1979625 1978699 gene locus_tag LOCUS_17640 1979625 1978699 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021145.1 protein_id gnl|my_center|LOCUS_17640 1980330 1981796 gene locus_tag LOCUS_17650 1980330 1981796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 1982087 1982347 gene locus_tag LOCUS_17660 1982087 1982347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860217.1 protein_id gnl|my_center|LOCUS_17660 1983085 1982456 gene locus_tag LOCUS_17670 gene anfO 1983085 1982456 CDS product Fe-only nitrogenase accessory protein AnfO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023300.1 protein_id gnl|my_center|LOCUS_17670 1983759 1983487 gene locus_tag LOCUS_17680 1983759 1983487 CDS product archaellum operon transcriptional activator EarA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878956.1 protein_id gnl|my_center|LOCUS_17680 1986171 1984921 gene locus_tag LOCUS_17690 1986171 1984921 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021143.1 protein_id gnl|my_center|LOCUS_17690 1987533 1986205 gene locus_tag LOCUS_17700 1987533 1986205 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021144.1 protein_id gnl|my_center|LOCUS_17700 1988526 1987582 gene locus_tag LOCUS_17710 1988526 1987582 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022514.1 protein_id gnl|my_center|LOCUS_17710 1989292 1989477 gene locus_tag LOCUS_17720 1989292 1989477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17720 1990058 1989777 gene locus_tag LOCUS_17730 1990058 1989777 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065686.1 protein_id gnl|my_center|LOCUS_17730 1991367 1990348 gene locus_tag LOCUS_17740 1991367 1990348 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065537.1 protein_id gnl|my_center|LOCUS_17740 1993490 1991511 gene locus_tag LOCUS_17750 1993490 1991511 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022589.1 protein_id gnl|my_center|LOCUS_17750 1995752 1993773 gene locus_tag LOCUS_17760 1995752 1993773 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022589.1 protein_id gnl|my_center|LOCUS_17760 1996893 1995928 gene locus_tag LOCUS_17770 1996893 1995928 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022590.1 protein_id gnl|my_center|LOCUS_17770 1997784 1996975 gene locus_tag LOCUS_17780 1997784 1996975 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083398.1 protein_id gnl|my_center|LOCUS_17780 1998384 1999544 gene locus_tag LOCUS_17790 1998384 1999544 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065465.1 protein_id gnl|my_center|LOCUS_17790 1999561 2000139 gene locus_tag LOCUS_17800 1999561 2000139 CDS product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022592.1 protein_id gnl|my_center|LOCUS_17800 2000287 2001309 gene locus_tag LOCUS_17810 2000287 2001309 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066378.1 protein_id gnl|my_center|LOCUS_17810 2002067 2002489 gene locus_tag LOCUS_17820 2002067 2002489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 2002547 2003596 gene locus_tag LOCUS_17830 2002547 2003596 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066378.1 protein_id gnl|my_center|LOCUS_17830 2005728 2003875 gene locus_tag LOCUS_17840 2005728 2003875 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022302.1 protein_id gnl|my_center|LOCUS_17840 2006324 2007169 gene locus_tag LOCUS_17850 2006324 2007169 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066378.1 protein_id gnl|my_center|LOCUS_17850 2007591 2008148 gene locus_tag LOCUS_17860 2007591 2008148 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990599.1 protein_id gnl|my_center|LOCUS_17860 2009131 2009583 gene locus_tag LOCUS_17870 2009131 2009583 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022604.1 protein_id gnl|my_center|LOCUS_17870 2010060 2010203 gene locus_tag LOCUS_17880 2010060 2010203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 2010840 2011352 gene locus_tag LOCUS_17890 2010840 2011352 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022604.1 protein_id gnl|my_center|LOCUS_17890 2011440 2011868 gene locus_tag LOCUS_17900 2011440 2011868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 2011996 2012361 gene locus_tag LOCUS_17910 2011996 2012361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 2012638 2013828 gene locus_tag LOCUS_17920 2012638 2013828 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_17920 2013898 2015388 gene locus_tag LOCUS_17930 2013898 2015388 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065470.1 protein_id gnl|my_center|LOCUS_17930 2015918 2016835 gene locus_tag LOCUS_17940 2015918 2016835 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065472.1 protein_id gnl|my_center|LOCUS_17940 2017326 2017853 gene locus_tag LOCUS_17950 2017326 2017853 CDS product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022592.1 protein_id gnl|my_center|LOCUS_17950 2017874 2018785 gene locus_tag LOCUS_17960 2017874 2018785 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022593.1 protein_id gnl|my_center|LOCUS_17960 2018921 2020300 gene locus_tag LOCUS_17970 2018921 2020300 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096812.1 protein_id gnl|my_center|LOCUS_17970 2020728 2020871 gene locus_tag LOCUS_17980 2020728 2020871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 2021135 2021416 gene locus_tag LOCUS_17990 2021135 2021416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020432.1 protein_id gnl|my_center|LOCUS_17990 2021404 2021667 gene locus_tag LOCUS_18000 2021404 2021667 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020433.1 protein_id gnl|my_center|LOCUS_18000 2021822 2022118 gene locus_tag LOCUS_18010 2021822 2022118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18010 2022135 2022341 gene locus_tag LOCUS_18020 2022135 2022341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 2022463 2023380 gene locus_tag LOCUS_18030 2022463 2023380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 2024088 2024534 gene locus_tag LOCUS_18040 2024088 2024534 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022604.1 protein_id gnl|my_center|LOCUS_18040 2024858 2025409 gene locus_tag LOCUS_18050 2024858 2025409 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022611.1 protein_id gnl|my_center|LOCUS_18050 2027018 2025474 gene locus_tag LOCUS_18060 2027018 2025474 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022613.1 protein_id gnl|my_center|LOCUS_18060 2027455 2027081 gene locus_tag LOCUS_18070 2027455 2027081 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022615.1 protein_id gnl|my_center|LOCUS_18070 2029119 2027866 gene locus_tag LOCUS_18080 2029119 2027866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 2029601 2029410 gene locus_tag LOCUS_18090 2029601 2029410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 2029671 2030780 gene locus_tag LOCUS_18100 2029671 2030780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065474.1 protein_id gnl|my_center|LOCUS_18100 2031085 2032215 gene locus_tag LOCUS_18110 2031085 2032215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065474.1 protein_id gnl|my_center|LOCUS_18110 2032738 2032316 gene locus_tag LOCUS_18120 2032738 2032316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 2034778 2033612 gene locus_tag LOCUS_18130 2034778 2033612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 2035341 2035916 gene locus_tag LOCUS_18140 2035341 2035916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065703.1 protein_id gnl|my_center|LOCUS_18140 2036269 2036000 gene locus_tag LOCUS_18150 2036269 2036000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860308.1 protein_id gnl|my_center|LOCUS_18150 2036832 2036308 gene locus_tag LOCUS_18160 2036832 2036308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023338.1 protein_id gnl|my_center|LOCUS_18160 2037376 2037119 gene locus_tag LOCUS_18170 2037376 2037119 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048126569.1 protein_id gnl|my_center|LOCUS_18170 2037627 2037427 gene locus_tag LOCUS_18180 2037627 2037427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065699.1 protein_id gnl|my_center|LOCUS_18180 2037844 2037644 gene locus_tag LOCUS_18190 2037844 2037644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 2038060 2038698 gene locus_tag LOCUS_18200 2038060 2038698 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023336.1 protein_id gnl|my_center|LOCUS_18200 2040206 2038941 gene locus_tag LOCUS_18210 2040206 2038941 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066488.1 protein_id gnl|my_center|LOCUS_18210 2040993 2040799 gene locus_tag LOCUS_18220 2040993 2040799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065698.1 protein_id gnl|my_center|LOCUS_18220 2043632 2041215 gene locus_tag LOCUS_18230 gene ppsA 2043632 2041215 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023333.1 protein_id gnl|my_center|LOCUS_18230 2044461 2043988 gene locus_tag LOCUS_18240 2044461 2043988 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065697.1 protein_id gnl|my_center|LOCUS_18240 2044647 2044922 gene locus_tag LOCUS_18250 2044647 2044922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065696.1 protein_id gnl|my_center|LOCUS_18250 2046328 2045063 gene locus_tag LOCUS_18260 2046328 2045063 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_18260 2046675 2048903 gene locus_tag LOCUS_18270 2046675 2048903 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022843.1 protein_id gnl|my_center|LOCUS_18270 2049417 2050517 gene locus_tag LOCUS_18280 2049417 2050517 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022844.1 protein_id gnl|my_center|LOCUS_18280 2050788 2052695 gene locus_tag LOCUS_18290 2050788 2052695 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022845.1 protein_id gnl|my_center|LOCUS_18290 2053247 2055433 gene locus_tag LOCUS_18300 2053247 2055433 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022846.1 protein_id gnl|my_center|LOCUS_18300 2057399 2057127 gene locus_tag LOCUS_18310 2057399 2057127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 2057827 2057573 gene locus_tag LOCUS_18320 2057827 2057573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 2058041 2059306 gene locus_tag LOCUS_18330 2058041 2059306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 2061516 2059609 gene locus_tag LOCUS_18340 2061516 2059609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 2062219 2063373 gene locus_tag LOCUS_18350 2062219 2063373 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110188582.1 protein_id gnl|my_center|LOCUS_18350 2063379 2064536 gene locus_tag LOCUS_18360 2063379 2064536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 2064533 2066635 gene locus_tag LOCUS_18370 2064533 2066635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 2066990 2067313 gene locus_tag LOCUS_18380 2066990 2067313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022115.1 protein_id gnl|my_center|LOCUS_18380 2067688 2067446 gene locus_tag LOCUS_18390 2067688 2067446 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022122.1 protein_id gnl|my_center|LOCUS_18390 2067886 2067692 gene locus_tag LOCUS_18400 2067886 2067692 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_18400 2068191 2067955 gene locus_tag LOCUS_18410 2068191 2067955 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065315.1 protein_id gnl|my_center|LOCUS_18410 2068602 2069870 gene locus_tag LOCUS_18420 2068602 2069870 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023091.1 protein_id gnl|my_center|LOCUS_18420 2070914 2070468 gene locus_tag LOCUS_18430 2070914 2070468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 2071808 2071479 gene locus_tag LOCUS_18440 2071808 2071479 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020942.1 protein_id gnl|my_center|LOCUS_18440 2072446 2072204 gene locus_tag LOCUS_18450 2072446 2072204 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022122.1 protein_id gnl|my_center|LOCUS_18450 2072876 2072661 gene locus_tag LOCUS_18460 2072876 2072661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 2073184 2072873 gene locus_tag LOCUS_18470 2073184 2072873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022118.1 protein_id gnl|my_center|LOCUS_18470 2073584 2073402 gene locus_tag LOCUS_18480 2073584 2073402 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065315.1 protein_id gnl|my_center|LOCUS_18480 2073750 2074055 gene locus_tag LOCUS_18490 2073750 2074055 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022117.1 protein_id gnl|my_center|LOCUS_18490 2074042 2074404 gene locus_tag LOCUS_18500 2074042 2074404 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022116.1 protein_id gnl|my_center|LOCUS_18500 2077179 2074810 gene locus_tag LOCUS_18510 2077179 2074810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 2078215 2079036 gene locus_tag LOCUS_18520 2078215 2079036 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022309.1 protein_id gnl|my_center|LOCUS_18520 2079521 2080582 gene locus_tag LOCUS_18530 2079521 2080582 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065256.1 protein_id gnl|my_center|LOCUS_18530 2080917 2081849 gene locus_tag LOCUS_18540 2080917 2081849 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279153.1 protein_id gnl|my_center|LOCUS_18540 2082171 2081947 gene locus_tag LOCUS_18550 2082171 2081947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 2082415 2082164 gene locus_tag LOCUS_18560 2082415 2082164 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022120.1 protein_id gnl|my_center|LOCUS_18560 2083001 2082798 gene locus_tag LOCUS_18570 2083001 2082798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 2083273 2083602 gene locus_tag LOCUS_18580 2083273 2083602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 2084616 2083789 gene locus_tag LOCUS_18590 2084616 2083789 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021836.1 protein_id gnl|my_center|LOCUS_18590 2084855 2085565 gene locus_tag LOCUS_18600 2084855 2085565 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589527.1 protein_id gnl|my_center|LOCUS_18600 2086245 2087306 gene locus_tag LOCUS_18610 2086245 2087306 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065256.1 protein_id gnl|my_center|LOCUS_18610 2087926 2087765 gene locus_tag LOCUS_18620 2087926 2087765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 2088524 2088342 gene locus_tag LOCUS_18630 2088524 2088342 CDS product DNA-directed RNA polymerase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065235.1 protein_id gnl|my_center|LOCUS_18630 2089184 2088999 gene locus_tag LOCUS_18640 2089184 2088999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065234.1 protein_id gnl|my_center|LOCUS_18640 2089875 2090462 gene locus_tag LOCUS_18650 2089875 2090462 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990826.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18650 2091457 2090732 gene locus_tag LOCUS_18660 2091457 2090732 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065257.1 protein_id gnl|my_center|LOCUS_18660 2092815 2091970 gene locus_tag LOCUS_18670 2092815 2091970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 2092907 2093095 gene locus_tag LOCUS_18680 2092907 2093095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 2094146 2093739 gene locus_tag LOCUS_18690 2094146 2093739 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021903.1 protein_id gnl|my_center|LOCUS_18690 2094664 2095158 gene locus_tag LOCUS_18700 2094664 2095158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18700 2095734 2095579 gene locus_tag LOCUS_18710 2095734 2095579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 2096466 2095831 gene locus_tag LOCUS_18720 2096466 2095831 CDS product undecaprenyl diphosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095644908.1 protein_id gnl|my_center|LOCUS_18720 2097209 2096835 gene locus_tag LOCUS_18730 2097209 2096835 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812232.1 protein_id gnl|my_center|LOCUS_18730 2098072 2097503 gene locus_tag LOCUS_18740 2098072 2097503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 2098594 2098418 gene locus_tag LOCUS_18750 2098594 2098418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2098937 2099305 gene locus_tag LOCUS_18760 2098937 2099305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 2100779 2099652 gene locus_tag LOCUS_18770 2100779 2099652 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085095815.1 protein_id gnl|my_center|LOCUS_18770 2102172 2101048 gene locus_tag LOCUS_18780 gene tnpB 2102172 2101048 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_18780 2104068 2102314 gene locus_tag LOCUS_18790 2104068 2102314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 2106509 2104605 gene locus_tag LOCUS_18800 2106509 2104605 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023276.1 protein_id gnl|my_center|LOCUS_18800 2108364 2108212 gene locus_tag LOCUS_18810 2108364 2108212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 2109277 2108651 gene locus_tag LOCUS_18820 2109277 2108651 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065304.1 protein_id gnl|my_center|LOCUS_18820 2110218 2109466 gene locus_tag LOCUS_18830 2110218 2109466 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022096.1 protein_id gnl|my_center|LOCUS_18830 2111018 2110215 gene locus_tag LOCUS_18840 2111018 2110215 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022097.1 protein_id gnl|my_center|LOCUS_18840 2111777 2112664 gene locus_tag LOCUS_18850 gene htpX 2111777 2112664 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022098.1 protein_id gnl|my_center|LOCUS_18850 2112857 2113558 gene locus_tag LOCUS_18860 2112857 2113558 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022656.1 protein_id gnl|my_center|LOCUS_18860 2116149 2113573 gene locus_tag LOCUS_18870 gene mprF 2116149 2113573 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022655.1 protein_id gnl|my_center|LOCUS_18870 2117689 2116682 gene locus_tag LOCUS_18880 2117689 2116682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 2117748 2117966 gene locus_tag LOCUS_18890 2117748 2117966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 2119916 2118435 gene locus_tag LOCUS_18900 2119916 2118435 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022654.1 protein_id gnl|my_center|LOCUS_18900 2121418 2122257 gene locus_tag LOCUS_18910 2121418 2122257 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022650.1 protein_id gnl|my_center|LOCUS_18910 2125007 2122305 gene locus_tag LOCUS_18920 2125007 2122305 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860195.1 protein_id gnl|my_center|LOCUS_18920 2125256 2125056 gene locus_tag LOCUS_18930 2125256 2125056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18930 2125418 2125284 gene locus_tag LOCUS_18940 2125418 2125284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 2125910 2128504 gene locus_tag LOCUS_18950 2125910 2128504 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022651.1 protein_id gnl|my_center|LOCUS_18950 2130283 2128703 gene locus_tag LOCUS_18960 gene ppcA 2130283 2128703 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022649.1 protein_id gnl|my_center|LOCUS_18960 2130646 2130819 gene locus_tag LOCUS_18970 2130646 2130819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 2131104 2130937 gene locus_tag LOCUS_18980 2131104 2130937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 2131103 2132824 gene locus_tag LOCUS_18990 gene hcp 2131103 2132824 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272545.1 protein_id gnl|my_center|LOCUS_18990 2133863 2134309 gene locus_tag LOCUS_19000 2133863 2134309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 2135245 2134463 gene locus_tag LOCUS_19010 2135245 2134463 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990819.1 protein_id gnl|my_center|LOCUS_19010 2136816 2136478 gene locus_tag LOCUS_19020 2136816 2136478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048170416.1 protein_id gnl|my_center|LOCUS_19020 2138391 2137267 gene locus_tag LOCUS_19030 gene tnpB 2138391 2137267 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_19030 2138734 2141784 gene locus_tag LOCUS_19040 2138734 2141784 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021984.1 protein_id gnl|my_center|LOCUS_19040 2143235 2142504 gene locus_tag LOCUS_19050 2143235 2142504 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020781.1 protein_id gnl|my_center|LOCUS_19050 2143538 2143705 gene locus_tag LOCUS_19060 2143538 2143705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 2144039 2143740 gene locus_tag LOCUS_19070 2144039 2143740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065522.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19070 2144351 2144100 gene locus_tag LOCUS_19080 2144351 2144100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022743.1 protein_id gnl|my_center|LOCUS_19080 2147173 2144765 gene locus_tag LOCUS_19090 2147173 2144765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 2148661 2147714 gene locus_tag LOCUS_19100 2148661 2147714 CDS product DUF5996 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065279.1 protein_id gnl|my_center|LOCUS_19100 2150380 2149070 gene locus_tag LOCUS_19110 2150380 2149070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19110 2150804 2150355 gene locus_tag LOCUS_19120 2150804 2150355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19120 2150985 2151170 gene locus_tag LOCUS_19130 2150985 2151170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 2151630 2151268 gene locus_tag LOCUS_19140 2151630 2151268 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434678.1 protein_id gnl|my_center|LOCUS_19140 2152315 2153100 gene locus_tag LOCUS_19150 2152315 2153100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 2153295 2154566 gene locus_tag LOCUS_19160 2153295 2154566 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021990.1 protein_id gnl|my_center|LOCUS_19160 2154965 2155549 gene locus_tag LOCUS_19170 2154965 2155549 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021991.1 protein_id gnl|my_center|LOCUS_19170 2156048 2155686 gene locus_tag LOCUS_19180 2156048 2155686 CDS product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021993.1 protein_id gnl|my_center|LOCUS_19180 2156520 2157302 gene locus_tag LOCUS_19190 2156520 2157302 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984847.1 protein_id gnl|my_center|LOCUS_19190 2157306 2158142 gene locus_tag LOCUS_19200 2157306 2158142 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022647.1 protein_id gnl|my_center|LOCUS_19200 2158464 2159174 gene locus_tag LOCUS_19210 2158464 2159174 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065490.1 protein_id gnl|my_center|LOCUS_19210 2159346 2160056 gene locus_tag LOCUS_19220 2159346 2160056 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065489.1 protein_id gnl|my_center|LOCUS_19220 2160213 2160887 gene locus_tag LOCUS_19230 2160213 2160887 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022642.1 protein_id gnl|my_center|LOCUS_19230 2161309 2162337 gene locus_tag LOCUS_19240 2161309 2162337 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022880.1 protein_id gnl|my_center|LOCUS_19240 2162334 2163023 gene locus_tag LOCUS_19250 2162334 2163023 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022879.1 protein_id gnl|my_center|LOCUS_19250 2164260 2163358 gene locus_tag LOCUS_19260 2164260 2163358 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020824.1 protein_id gnl|my_center|LOCUS_19260 2164348 2165841 gene locus_tag LOCUS_19270 2164348 2165841 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022878.1 protein_id gnl|my_center|LOCUS_19270 2168388 2166010 gene locus_tag LOCUS_19280 2168388 2166010 CDS product DUF3160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065672.1 protein_id gnl|my_center|LOCUS_19280 2169456 2168884 gene locus_tag LOCUS_19290 2169456 2168884 CDS product GDYXXLXY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022045.1 protein_id gnl|my_center|LOCUS_19290 2170674 2169502 gene locus_tag LOCUS_19300 2170674 2169502 CDS product DUF2157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022044.1 protein_id gnl|my_center|LOCUS_19300 2170959 2171444 gene locus_tag LOCUS_19310 2170959 2171444 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022043.1 protein_id gnl|my_center|LOCUS_19310 2171447 2172853 gene locus_tag LOCUS_19320 2171447 2172853 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_19320 2174616 2173723 gene locus_tag LOCUS_19330 2174616 2173723 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022038.1 protein_id gnl|my_center|LOCUS_19330 2174863 2175225 gene locus_tag LOCUS_19340 2174863 2175225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 2175226 2175450 gene locus_tag LOCUS_19350 2175226 2175450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 2176200 2175850 gene locus_tag LOCUS_19360 2176200 2175850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19360 2178910 2177339 gene locus_tag LOCUS_19370 2178910 2177339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 2180130 2178901 gene locus_tag LOCUS_19380 2180130 2178901 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869498.1 protein_id gnl|my_center|LOCUS_19380 2180578 2180132 gene locus_tag LOCUS_19390 2180578 2180132 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876760.1 protein_id gnl|my_center|LOCUS_19390 2183622 2180578 gene locus_tag LOCUS_19400 2183622 2180578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 2184771 2183776 gene locus_tag LOCUS_19410 gene hdrB 2184771 2183776 CDS product CoB--CoM heterodisulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024119.1 protein_id gnl|my_center|LOCUS_19410 2185342 2184803 gene locus_tag LOCUS_19420 gene hdrC 2185342 2184803 CDS product CoB--CoM heterodisulfide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261191.1 protein_id gnl|my_center|LOCUS_19420 2190357 2187187 gene locus_tag LOCUS_19430 2190357 2187187 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022738.1 protein_id gnl|my_center|LOCUS_19430 2191265 2192434 gene locus_tag LOCUS_19440 2191265 2192434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990613.1 protein_id gnl|my_center|LOCUS_19440 2193129 2194025 gene locus_tag LOCUS_19450 2193129 2194025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 2194090 2194824 gene locus_tag LOCUS_19460 2194090 2194824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19460 2194817 2195173 gene locus_tag LOCUS_19470 2194817 2195173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19470 2196860 2195682 gene locus_tag LOCUS_19480 2196860 2195682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022487.1 protein_id gnl|my_center|LOCUS_19480 2197732 2201490 gene locus_tag LOCUS_19490 2197732 2201490 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082088923.1 protein_id gnl|my_center|LOCUS_19490 2202000 2206373 gene locus_tag LOCUS_19500 2202000 2206373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 2206987 2208540 gene locus_tag LOCUS_19510 2206987 2208540 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860275.1 protein_id gnl|my_center|LOCUS_19510 2208906 2209634 gene locus_tag LOCUS_19520 2208906 2209634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 2211455 2209692 gene locus_tag LOCUS_19530 2211455 2209692 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022903.1 protein_id gnl|my_center|LOCUS_19530 2211970 2211452 gene locus_tag LOCUS_19540 2211970 2211452 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022904.1 protein_id gnl|my_center|LOCUS_19540 2214545 2213841 gene locus_tag LOCUS_19550 2214545 2213841 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022907.1 protein_id gnl|my_center|LOCUS_19550 2215272 2214631 gene locus_tag LOCUS_19560 2215272 2214631 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066430.1 protein_id gnl|my_center|LOCUS_19560 2216648 2215599 gene locus_tag LOCUS_19570 2216648 2215599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 2217135 2218589 gene locus_tag LOCUS_19580 2217135 2218589 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022909.1 protein_id gnl|my_center|LOCUS_19580 2218967 2219257 gene locus_tag LOCUS_19590 2218967 2219257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 2219585 2220238 gene locus_tag LOCUS_19600 2219585 2220238 CDS product methyltransferase cognate corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022912.1 protein_id gnl|my_center|LOCUS_19600 2220258 2221634 gene locus_tag LOCUS_19610 gene mtmB 2220258 2221634 CDS product monomethylamine methyltransferase MtmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:P58866 transl_except (pos:2220861..2220863,aa:Pyl) note codon on position 202 is pyrrolysine amber codon. protein_id gnl|my_center|LOCUS_19610 2222009 2221764 gene locus_tag LOCUS_19620 2222009 2221764 CDS product DUF2769 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065575.1 protein_id gnl|my_center|LOCUS_19620 2222722 2223285 gene locus_tag LOCUS_19630 2222722 2223285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 2225892 2223823 gene locus_tag LOCUS_19640 2225892 2223823 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730677.1 protein_id gnl|my_center|LOCUS_19640 2226633 2227556 gene locus_tag LOCUS_19650 2226633 2227556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 2228542 2227559 gene locus_tag LOCUS_19660 2228542 2227559 CDS product TIGR03885 family FMN-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975020.1 protein_id gnl|my_center|LOCUS_19660 2228849 2229181 gene locus_tag LOCUS_19670 2228849 2229181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2229363 2229560 gene locus_tag LOCUS_19680 2229363 2229560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 2229557 2229691 gene locus_tag LOCUS_19690 2229557 2229691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 2230605 2229775 gene locus_tag LOCUS_19700 2230605 2229775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 2230856 2231659 gene locus_tag LOCUS_19710 2230856 2231659 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022932.1 protein_id gnl|my_center|LOCUS_19710 2231897 2233108 gene locus_tag LOCUS_19720 gene trpB 2231897 2233108 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022931.1 protein_id gnl|my_center|LOCUS_19720 2233110 2233928 gene locus_tag LOCUS_19730 gene trpA 2233110 2233928 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 protein_id gnl|my_center|LOCUS_19730 2233965 2235077 gene locus_tag LOCUS_19740 gene trpD 2233965 2235077 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022929.1 protein_id gnl|my_center|LOCUS_19740 2235074 2235778 gene locus_tag LOCUS_19750 2235074 2235778 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065580.1 protein_id gnl|my_center|LOCUS_19750 2235765 2237471 gene locus_tag LOCUS_19760 gene trpE 2235765 2237471 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022927.1 protein_id gnl|my_center|LOCUS_19760 2237505 2238107 gene locus_tag LOCUS_19770 2237505 2238107 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022926.1 protein_id gnl|my_center|LOCUS_19770 2238964 2238215 gene locus_tag LOCUS_19780 2238964 2238215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022925.1 protein_id gnl|my_center|LOCUS_19780 2240077 2239478 gene locus_tag LOCUS_19790 2240077 2239478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022924.1 protein_id gnl|my_center|LOCUS_19790 2241225 2240338 gene locus_tag LOCUS_19800 2241225 2240338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066431.1 protein_id gnl|my_center|LOCUS_19800 2242543 2241641 gene locus_tag LOCUS_19810 2242543 2241641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022917.1 protein_id gnl|my_center|LOCUS_19810 2243408 2242641 gene locus_tag LOCUS_19820 2243408 2242641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022916.1 protein_id gnl|my_center|LOCUS_19820 2244235 2244702 gene locus_tag LOCUS_19830 2244235 2244702 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065176.1 protein_id gnl|my_center|LOCUS_19830 2245035 2245298 gene locus_tag LOCUS_19840 2245035 2245298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 2245553 2245960 gene locus_tag LOCUS_19850 2245553 2245960 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021669.1 protein_id gnl|my_center|LOCUS_19850 2246291 2247958 gene locus_tag LOCUS_19860 2246291 2247958 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990800.1 protein_id gnl|my_center|LOCUS_19860 2248168 2249133 gene locus_tag LOCUS_19870 2248168 2249133 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021671.1 protein_id gnl|my_center|LOCUS_19870 2249393 2250163 gene locus_tag LOCUS_19880 2249393 2250163 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066245.1 protein_id gnl|my_center|LOCUS_19880 2250320 2251003 gene locus_tag LOCUS_19890 2250320 2251003 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021673.1 protein_id gnl|my_center|LOCUS_19890 2251013 2251468 gene locus_tag LOCUS_19900 2251013 2251468 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021674.1 protein_id gnl|my_center|LOCUS_19900 2252028 2251639 gene locus_tag LOCUS_19910 2252028 2251639 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021676.1 protein_id gnl|my_center|LOCUS_19910 2252711 2253997 gene locus_tag LOCUS_19920 gene eno 2252711 2253997 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065179.1 protein_id gnl|my_center|LOCUS_19920 2254710 2254588 gene locus_tag LOCUS_19930 2254710 2254588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 2255847 2255035 gene locus_tag LOCUS_19940 2255847 2255035 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066246.1 protein_id gnl|my_center|LOCUS_19940 2256457 2257110 gene locus_tag LOCUS_19950 2256457 2257110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021681.1 protein_id gnl|my_center|LOCUS_19950 2257456 2257223 gene locus_tag LOCUS_19960 2257456 2257223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 2257706 2258245 gene locus_tag LOCUS_19970 2257706 2258245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 2258438 2259775 gene locus_tag LOCUS_19980 2258438 2259775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 2260439 2260825 gene locus_tag LOCUS_19990 2260439 2260825 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021683.1 protein_id gnl|my_center|LOCUS_19990 2261092 2261910 gene locus_tag LOCUS_20000 2261092 2261910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022177.1 protein_id gnl|my_center|LOCUS_20000 2262061 2262429 gene locus_tag LOCUS_20010 2262061 2262429 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279154.1 protein_id gnl|my_center|LOCUS_20010 2263555 2263097 gene locus_tag LOCUS_20020 2263555 2263097 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022180.1 protein_id gnl|my_center|LOCUS_20020 2263908 2265629 gene locus_tag LOCUS_20030 gene ilvB 2263908 2265629 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149674780.1 protein_id gnl|my_center|LOCUS_20030 2267507 2266719 gene locus_tag LOCUS_20040 2267507 2266719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 2269307 2267655 gene locus_tag LOCUS_20050 2269307 2267655 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022182.1 protein_id gnl|my_center|LOCUS_20050 2270937 2269345 gene locus_tag LOCUS_20060 2270937 2269345 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022183.1 protein_id gnl|my_center|LOCUS_20060 2271809 2272294 gene locus_tag LOCUS_20070 2271809 2272294 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022188.1 protein_id gnl|my_center|LOCUS_20070 2272399 2272758 gene locus_tag LOCUS_20080 2272399 2272758 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022189.1 protein_id gnl|my_center|LOCUS_20080 2273086 2275434 gene locus_tag LOCUS_20090 2273086 2275434 CDS product hydrophobe/amphiphile efflux-3 (HAE3) family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022190.1 protein_id gnl|my_center|LOCUS_20090 2275923 2276399 gene locus_tag LOCUS_20100 2275923 2276399 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022193.1 protein_id gnl|my_center|LOCUS_20100 2276517 2276876 gene locus_tag LOCUS_20110 2276517 2276876 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066321.1 protein_id gnl|my_center|LOCUS_20110 2277114 2278166 gene locus_tag LOCUS_20120 2277114 2278166 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990832.1 protein_id gnl|my_center|LOCUS_20120 2278374 2279138 gene locus_tag LOCUS_20130 2278374 2279138 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022197.1 protein_id gnl|my_center|LOCUS_20130 2279427 2280842 gene locus_tag LOCUS_20140 2279427 2280842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990833.1 protein_id gnl|my_center|LOCUS_20140 2281059 2282174 gene locus_tag LOCUS_20150 gene tnpB 2281059 2282174 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_20150 2282287 2282574 gene locus_tag LOCUS_20160 2282287 2282574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20160 2282571 2283110 gene locus_tag LOCUS_20170 2282571 2283110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20170 2283202 2284242 gene locus_tag LOCUS_20180 2283202 2284242 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022056.1 protein_id gnl|my_center|LOCUS_20180 2284914 2284315 gene locus_tag LOCUS_20190 2284914 2284315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022055.1 protein_id gnl|my_center|LOCUS_20190 2285653 2285018 gene locus_tag LOCUS_20200 2285653 2285018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022055.1 protein_id gnl|my_center|LOCUS_20200 2286368 2285874 gene locus_tag LOCUS_20210 2286368 2285874 CDS product DUF6141 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990822.1 protein_id gnl|my_center|LOCUS_20210 2287458 2286913 gene locus_tag LOCUS_20220 2287458 2286913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2287976 2287659 gene locus_tag LOCUS_20230 2287976 2287659 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022051.1 protein_id gnl|my_center|LOCUS_20230 2288141 2289277 gene locus_tag LOCUS_20240 2288141 2289277 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022050.1 protein_id gnl|my_center|LOCUS_20240 2289679 2289350 gene locus_tag LOCUS_20250 2289679 2289350 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022049.1 protein_id gnl|my_center|LOCUS_20250 2292106 2289833 gene locus_tag LOCUS_20260 2292106 2289833 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022048.1 protein_id gnl|my_center|LOCUS_20260 2293059 2292571 gene locus_tag LOCUS_20270 2293059 2292571 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022047.1 protein_id gnl|my_center|LOCUS_20270 2293326 2293514 gene locus_tag LOCUS_20280 2293326 2293514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 2293940 2294722 gene locus_tag LOCUS_20290 2293940 2294722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 2295952 2295335 gene locus_tag LOCUS_20300 2295952 2295335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 2297091 2296015 gene locus_tag LOCUS_20310 2297091 2296015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 2298881 2297856 gene locus_tag LOCUS_20320 2298881 2297856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 2299606 2298935 gene locus_tag LOCUS_20330 2299606 2298935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 2299976 2299590 gene locus_tag LOCUS_20340 2299976 2299590 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879153.1 protein_id gnl|my_center|LOCUS_20340 2300998 2300333 gene locus_tag LOCUS_20350 2300998 2300333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2302131 2301592 gene locus_tag LOCUS_20360 2302131 2301592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005553844.1 protein_id gnl|my_center|LOCUS_20360 2302781 2303245 gene locus_tag LOCUS_20370 gene tnpA 2302781 2303245 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979974.1 protein_id gnl|my_center|LOCUS_20370 2303339 2303497 gene locus_tag LOCUS_20380 2303339 2303497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 2303765 2303568 gene locus_tag LOCUS_20390 2303765 2303568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 2303951 2303772 gene locus_tag LOCUS_20400 2303951 2303772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 2304311 2304138 gene locus_tag LOCUS_20410 2304311 2304138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 2304846 2305757 gene locus_tag LOCUS_20420 2304846 2305757 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082089305.1 protein_id gnl|my_center|LOCUS_20420 2306022 2306771 gene locus_tag LOCUS_20430 2306022 2306771 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990815.1 protein_id gnl|my_center|LOCUS_20430 2307995 2307279 gene locus_tag LOCUS_20440 2307995 2307279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 2308807 2308481 gene locus_tag LOCUS_20450 2308807 2308481 CDS product DUF2769 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023170.1 protein_id gnl|my_center|LOCUS_20450 2309062 2309760 gene locus_tag LOCUS_20460 2309062 2309760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 2312362 2310371 gene locus_tag LOCUS_20470 2312362 2310371 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 protein_id gnl|my_center|LOCUS_20470 2312873 2313643 gene locus_tag LOCUS_20480 2312873 2313643 CDS product inositol polyphosphate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020776.1 protein_id gnl|my_center|LOCUS_20480 2313846 2313691 gene locus_tag LOCUS_20490 2313846 2313691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20490 2313993 2313856 gene locus_tag LOCUS_20500 2313993 2313856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20500 2314121 2314984 gene locus_tag LOCUS_20510 2314121 2314984 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021026.1 protein_id gnl|my_center|LOCUS_20510 2315704 2317389 gene locus_tag LOCUS_20520 2315704 2317389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 2318301 2317432 gene locus_tag LOCUS_20530 2318301 2317432 CDS product nicotianamine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022871.1 protein_id gnl|my_center|LOCUS_20530 2319233 2319484 gene locus_tag LOCUS_20540 gene purS 2319233 2319484 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066286.1 protein_id gnl|my_center|LOCUS_20540 2319568 2320266 gene locus_tag LOCUS_20550 gene purQ 2319568 2320266 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021958.1 protein_id gnl|my_center|LOCUS_20550 2320704 2321729 gene locus_tag LOCUS_20560 2320704 2321729 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065269.1 protein_id gnl|my_center|LOCUS_20560 2322651 2321980 gene locus_tag LOCUS_20570 gene rnhB 2322651 2321980 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021954.1 protein_id gnl|my_center|LOCUS_20570 2323311 2323655 gene locus_tag LOCUS_20580 2323311 2323655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022057.1 protein_id gnl|my_center|LOCUS_20580 2323699 2325894 gene locus_tag LOCUS_20590 2323699 2325894 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941639.1 protein_id gnl|my_center|LOCUS_20590 2326027 2326629 gene locus_tag LOCUS_20600 2326027 2326629 CDS product DUF4255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941640.1 protein_id gnl|my_center|LOCUS_20600 2326630 2327241 gene locus_tag LOCUS_20610 2326630 2327241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 2327388 2329880 gene locus_tag LOCUS_20620 2327388 2329880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 2329988 2330422 gene locus_tag LOCUS_20630 2329988 2330422 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_20630 2330586 2330906 gene locus_tag LOCUS_20640 2330586 2330906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941644.1 protein_id gnl|my_center|LOCUS_20640 2330927 2331088 gene locus_tag LOCUS_20650 2330927 2331088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 2331131 2331574 gene locus_tag LOCUS_20660 2331131 2331574 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_20660 2331604 2332740 gene locus_tag LOCUS_20670 2331604 2332740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 2332785 2333432 gene locus_tag LOCUS_20680 2332785 2333432 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941648.1 protein_id gnl|my_center|LOCUS_20680 2333437 2334516 gene locus_tag LOCUS_20690 2333437 2334516 CDS product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941649.1 protein_id gnl|my_center|LOCUS_20690 2334513 2335169 gene locus_tag LOCUS_20700 2334513 2335169 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941650.1 protein_id gnl|my_center|LOCUS_20700 2335203 2335508 gene locus_tag LOCUS_20710 2335203 2335508 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941651.1 protein_id gnl|my_center|LOCUS_20710 2335630 2336019 gene locus_tag LOCUS_20720 2335630 2336019 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_20720 2336023 2339670 gene locus_tag LOCUS_20730 2336023 2339670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 2339854 2341473 gene locus_tag LOCUS_20740 2339854 2341473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 2341595 2343661 gene locus_tag LOCUS_20750 2341595 2343661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 2343835 2345406 gene locus_tag LOCUS_20760 2343835 2345406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 2346292 2347464 gene locus_tag LOCUS_20770 2346292 2347464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 2347442 2347831 gene locus_tag LOCUS_20780 2347442 2347831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 2348605 2350872 gene locus_tag LOCUS_20790 2348605 2350872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 2351401 2352747 gene locus_tag LOCUS_20800 2351401 2352747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 2352841 2353272 gene locus_tag LOCUS_20810 2352841 2353272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 2353467 2355104 gene locus_tag LOCUS_20820 gene pheT 2353467 2355104 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021951.1 protein_id gnl|my_center|LOCUS_20820 2355573 2356853 gene locus_tag LOCUS_20830 2355573 2356853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2357634 2357017 gene locus_tag LOCUS_20840 2357634 2357017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021950.1 protein_id gnl|my_center|LOCUS_20840 2358560 2357772 gene locus_tag LOCUS_20850 2358560 2357772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 2358562 2358828 gene locus_tag LOCUS_20860 2358562 2358828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2358904 2359056 gene locus_tag LOCUS_20870 2358904 2359056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2359093 2359335 gene locus_tag LOCUS_20880 2359093 2359335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2359531 2360403 gene locus_tag LOCUS_20890 2359531 2360403 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021949.1 protein_id gnl|my_center|LOCUS_20890 2361503 2362201 gene locus_tag LOCUS_20900 2361503 2362201 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990818.1 protein_id gnl|my_center|LOCUS_20900 2364126 2362720 gene locus_tag LOCUS_20910 2364126 2362720 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021944.1 protein_id gnl|my_center|LOCUS_20910 2364842 2365477 gene locus_tag LOCUS_20920 2364842 2365477 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021943.1 protein_id gnl|my_center|LOCUS_20920 2366743 2365763 gene locus_tag LOCUS_20930 2366743 2365763 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021942.1 protein_id gnl|my_center|LOCUS_20930 2367700 2366930 gene locus_tag LOCUS_20940 2367700 2366930 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279145.1 protein_id gnl|my_center|LOCUS_20940 2368312 2369517 gene locus_tag LOCUS_20950 2368312 2369517 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021939.1 protein_id gnl|my_center|LOCUS_20950 2370129 2369617 gene locus_tag LOCUS_20960 2370129 2369617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 2372008 2371193 gene locus_tag LOCUS_20970 gene proC 2372008 2371193 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476242.1 protein_id gnl|my_center|LOCUS_20970 2372686 2372192 gene locus_tag LOCUS_20980 2372686 2372192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021936.1 protein_id gnl|my_center|LOCUS_20980 2372860 2373684 gene locus_tag LOCUS_20990 2372860 2373684 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113611.1 protein_id gnl|my_center|LOCUS_20990 2374642 2373872 gene locus_tag LOCUS_21000 2374642 2373872 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227006.1 protein_id gnl|my_center|LOCUS_21000 2375491 2374835 gene locus_tag LOCUS_21010 2375491 2374835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 2376203 2375553 gene locus_tag LOCUS_21020 2376203 2375553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 2377132 2376563 gene locus_tag LOCUS_21030 2377132 2376563 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021922.1 protein_id gnl|my_center|LOCUS_21030 2377705 2377511 gene locus_tag LOCUS_21040 2377705 2377511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21040 2378109 2379731 gene locus_tag LOCUS_21050 2378109 2379731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 2380972 2380115 gene locus_tag LOCUS_21060 2380972 2380115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 2381286 2380996 gene locus_tag LOCUS_21070 gene crn3 2381286 2380996 CDS product CRISPR-associated ring nuclease Crn3/Csx3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582986.1 protein_id gnl|my_center|LOCUS_21070 2381974 2381363 gene locus_tag LOCUS_21080 2381974 2381363 CDS product CRISPR-associated endonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065262.1 protein_id gnl|my_center|LOCUS_21080 2383970 2382105 gene locus_tag LOCUS_21090 2383970 2382105 CDS product TIGR03986 family CRISPR-associated RAMP protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258140.1 protein_id gnl|my_center|LOCUS_21090 2384617 2383976 gene locus_tag LOCUS_21100 2384617 2383976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 2386101 2384614 gene locus_tag LOCUS_21110 2386101 2384614 CDS product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258138.1 protein_id gnl|my_center|LOCUS_21110 2387858 2386101 gene locus_tag LOCUS_21120 2387858 2386101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 2388525 2387860 gene locus_tag LOCUS_21130 2388525 2387860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 2390179 2388512 gene locus_tag LOCUS_21140 2390179 2388512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258135.1 protein_id gnl|my_center|LOCUS_21140 2391075 2390269 gene locus_tag LOCUS_21150 2391075 2390269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 2392416 2391283 gene locus_tag LOCUS_21160 gene ltrA 2392416 2391283 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561483.1 protein_id gnl|my_center|LOCUS_21160 2392664 2394112 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccttattttagtggaagctacttctcgac 2394773 2395729 gene locus_tag LOCUS_21170 gene cas1 2394773 2395729 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258803.1 protein_id gnl|my_center|LOCUS_21170 2395771 2396076 gene locus_tag LOCUS_21180 2395771 2396076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 2396215 2396994 gene locus_tag LOCUS_21190 2396215 2396994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 2397096 2397467 gene locus_tag LOCUS_21200 2397096 2397467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021920.1 protein_id gnl|my_center|LOCUS_21200 2398149 2397538 gene locus_tag LOCUS_21210 2398149 2397538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860480.1 protein_id gnl|my_center|LOCUS_21210 2398593 2399711 gene locus_tag LOCUS_21220 2398593 2399711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 2400229 2400023 gene locus_tag LOCUS_21230 2400229 2400023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 2400454 2400266 gene locus_tag LOCUS_21240 2400454 2400266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 2400559 2403809 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccttgttttagtggatcttgctctcgaat 2404604 2404092 gene locus_tag LOCUS_21250 2404604 2404092 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065261.1 protein_id gnl|my_center|LOCUS_21250 2405678 2405908 gene locus_tag LOCUS_21260 2405678 2405908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 2409289 2407694 gene locus_tag LOCUS_21270 2409289 2407694 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990604.1 protein_id gnl|my_center|LOCUS_21270 2409452 2409381 gene locus_tag LOCUS_t00340 2409452 2409381 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2410640 2409708 gene locus_tag LOCUS_21280 gene nadA 2410640 2409708 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066395.1 protein_id gnl|my_center|LOCUS_21280 2411146 2410757 gene locus_tag LOCUS_21290 gene nifU 2411146 2410757 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022677.1 protein_id gnl|my_center|LOCUS_21290 2412427 2411243 gene locus_tag LOCUS_21300 gene nifS 2412427 2411243 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066396.1 protein_id gnl|my_center|LOCUS_21300 2412863 2413213 gene locus_tag LOCUS_21310 2412863 2413213 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990605.1 protein_id gnl|my_center|LOCUS_21310 2413650 2414576 gene locus_tag LOCUS_21320 gene cysK 2413650 2414576 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022680.1 protein_id gnl|my_center|LOCUS_21320 2414619 2415581 gene locus_tag LOCUS_21330 gene cysE 2414619 2415581 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048171437.1 protein_id gnl|my_center|LOCUS_21330 2416625 2415909 gene locus_tag LOCUS_21340 gene thiE 2416625 2415909 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022682.1 protein_id gnl|my_center|LOCUS_21340 2417662 2416877 gene locus_tag LOCUS_21350 gene thiM 2417662 2416877 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022683.1 protein_id gnl|my_center|LOCUS_21350 2418648 2417836 gene locus_tag LOCUS_21360 gene fdhD 2418648 2417836 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851178.1 protein_id gnl|my_center|LOCUS_21360 2419883 2418687 gene locus_tag LOCUS_21370 2419883 2418687 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061297.1 protein_id gnl|my_center|LOCUS_21370 2421080 2420349 gene locus_tag LOCUS_21380 2421080 2420349 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496401.1 protein_id gnl|my_center|LOCUS_21380 2421784 2421080 gene locus_tag LOCUS_21390 2421784 2421080 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388822.1 protein_id gnl|my_center|LOCUS_21390 2422617 2421781 gene locus_tag LOCUS_21400 2422617 2421781 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869614.1 protein_id gnl|my_center|LOCUS_21400 2423912 2422917 gene locus_tag LOCUS_21410 2423912 2422917 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066092.1 protein_id gnl|my_center|LOCUS_21410 2425295 2424234 gene locus_tag LOCUS_21420 2425295 2424234 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060827.1 protein_id gnl|my_center|LOCUS_21420 2426012 2425323 gene locus_tag LOCUS_21430 2426012 2425323 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060828.1 protein_id gnl|my_center|LOCUS_21430 2427041 2426154 gene locus_tag LOCUS_21440 2427041 2426154 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876118.1 protein_id gnl|my_center|LOCUS_21440 2428454 2427777 gene locus_tag LOCUS_21450 2428454 2427777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 2428910 2428551 gene locus_tag LOCUS_21460 2428910 2428551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 2429285 2430460 gene locus_tag LOCUS_21470 2429285 2430460 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941993.1 protein_id gnl|my_center|LOCUS_21470 2430453 2431175 gene locus_tag LOCUS_21480 2430453 2431175 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187151961.1 protein_id gnl|my_center|LOCUS_21480 2431180 2431671 gene locus_tag LOCUS_21490 2431180 2431671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 2431853 2432617 gene locus_tag LOCUS_21500 2431853 2432617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 2432718 2432789 gene locus_tag LOCUS_t00350 2432718 2432789 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2432882 2434177 gene locus_tag LOCUS_21510 2432882 2434177 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022675.1 protein_id gnl|my_center|LOCUS_21510 2434501 2435202 gene locus_tag LOCUS_21520 2434501 2435202 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990768.1 protein_id gnl|my_center|LOCUS_21520 2435780 2436757 gene locus_tag LOCUS_21530 2435780 2436757 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016600.1 protein_id gnl|my_center|LOCUS_21530 2436921 2437175 gene locus_tag LOCUS_21540 2436921 2437175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 2437349 2437621 gene locus_tag LOCUS_21550 2437349 2437621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 2437862 2438338 gene locus_tag LOCUS_21560 2437862 2438338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 2438360 2438878 gene locus_tag LOCUS_21570 2438360 2438878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 2439778 2439548 gene locus_tag LOCUS_21580 2439778 2439548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 2440209 2439775 gene locus_tag LOCUS_21590 2440209 2439775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 2440813 2440577 gene locus_tag LOCUS_21600 2440813 2440577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 2441456 2441265 gene locus_tag LOCUS_21610 2441456 2441265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 2441684 2441496 gene locus_tag LOCUS_21620 2441684 2441496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 2442510 2442836 gene locus_tag LOCUS_21630 2442510 2442836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 2442841 2444007 gene locus_tag LOCUS_21640 gene ctpM 2442841 2444007 CDS product radical SAM/SPASM domain Clo7bot peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948312.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21640 2444544 2444837 gene locus_tag LOCUS_21650 2444544 2444837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2445154 2445318 gene locus_tag LOCUS_21660 2445154 2445318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 2446707 2448056 gene locus_tag LOCUS_21670 2446707 2448056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 2448637 2448990 gene locus_tag LOCUS_21680 2448637 2448990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 2449190 2449477 gene locus_tag LOCUS_21690 2449190 2449477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 2450208 2451251 gene locus_tag LOCUS_21700 2450208 2451251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022685.1 protein_id gnl|my_center|LOCUS_21700 2451738 2452004 gene locus_tag LOCUS_21710 2451738 2452004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 2452423 2453007 gene locus_tag LOCUS_21720 2452423 2453007 CDS product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876494.1 protein_id gnl|my_center|LOCUS_21720 2453409 2453960 gene locus_tag LOCUS_21730 2453409 2453960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022547.1 protein_id gnl|my_center|LOCUS_21730 2454418 2454056 gene locus_tag LOCUS_21740 2454418 2454056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023326.1 protein_id gnl|my_center|LOCUS_21740 2455052 2454555 gene locus_tag LOCUS_21750 2455052 2454555 CDS product Holliday junction resolvase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990645.1 protein_id gnl|my_center|LOCUS_21750 2455381 2456613 gene locus_tag LOCUS_21760 2455381 2456613 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970232.1 protein_id gnl|my_center|LOCUS_21760 2456793 2457860 gene locus_tag LOCUS_21770 2456793 2457860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023324.1 protein_id gnl|my_center|LOCUS_21770 2457861 2458811 gene locus_tag LOCUS_21780 2457861 2458811 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023323.1 protein_id gnl|my_center|LOCUS_21780 2459347 2458832 gene locus_tag LOCUS_21790 2459347 2458832 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140452.1 protein_id gnl|my_center|LOCUS_21790 2460510 2459629 gene locus_tag LOCUS_21800 2460510 2459629 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023359.1 protein_id gnl|my_center|LOCUS_21800 2460921 2461727 gene locus_tag LOCUS_21810 2460921 2461727 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065707.1 protein_id gnl|my_center|LOCUS_21810 2461727 2462065 gene locus_tag LOCUS_21820 2461727 2462065 CDS product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065708.1 protein_id gnl|my_center|LOCUS_21820 2462142 2463017 gene locus_tag LOCUS_21830 2462142 2463017 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065709.1 protein_id gnl|my_center|LOCUS_21830 2464034 2463810 gene locus_tag LOCUS_21840 2464034 2463810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 2465253 2464189 gene locus_tag LOCUS_21850 2465253 2464189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023363.1 protein_id gnl|my_center|LOCUS_21850 2465969 2465460 gene locus_tag LOCUS_21860 2465969 2465460 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990647.1 protein_id gnl|my_center|LOCUS_21860 2466710 2466186 gene locus_tag LOCUS_21870 2466710 2466186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 2467468 2466920 gene locus_tag LOCUS_21880 2467468 2466920 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065175.1 protein_id gnl|my_center|LOCUS_21880 2467786 2467481 gene locus_tag LOCUS_21890 2467786 2467481 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021663.1 protein_id gnl|my_center|LOCUS_21890 2469454 2467970 gene locus_tag LOCUS_21900 2469454 2467970 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_21900 2470883 2469948 gene locus_tag LOCUS_21910 2470883 2469948 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476549.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21910 2471180 2471010 gene locus_tag LOCUS_21920 2471180 2471010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 2471294 2471497 gene locus_tag LOCUS_21930 2471294 2471497 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755950.1 protein_id gnl|my_center|LOCUS_21930 2471937 2471530 gene locus_tag LOCUS_21940 2471937 2471530 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065668.1 protein_id gnl|my_center|LOCUS_21940 2472238 2473086 gene locus_tag LOCUS_21950 2472238 2473086 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021656.1 protein_id gnl|my_center|LOCUS_21950 2475023 2473572 gene locus_tag LOCUS_21960 2475023 2473572 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021657.1 protein_id gnl|my_center|LOCUS_21960 2475355 2476716 gene locus_tag LOCUS_21970 2475355 2476716 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021658.1 protein_id gnl|my_center|LOCUS_21970 2477144 2477686 gene locus_tag LOCUS_21980 2477144 2477686 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021659.1 protein_id gnl|my_center|LOCUS_21980 2477864 2479540 gene locus_tag LOCUS_21990 2477864 2479540 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021660.1 protein_id gnl|my_center|LOCUS_21990 2479754 2479963 gene locus_tag LOCUS_22000 2479754 2479963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22000 2480436 2481638 gene locus_tag LOCUS_22010 2480436 2481638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 2482006 2482260 gene locus_tag LOCUS_22020 2482006 2482260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 2482434 2482706 gene locus_tag LOCUS_22030 2482434 2482706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 2484772 2483462 gene locus_tag LOCUS_22040 2484772 2483462 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056829.1 protein_id gnl|my_center|LOCUS_22040 2486177 2485056 gene locus_tag LOCUS_22050 2486177 2485056 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021661.1 protein_id gnl|my_center|LOCUS_22050 2486598 2487737 gene locus_tag LOCUS_22060 2486598 2487737 CDS product TIGR04083 family peptide-modifying radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023249.1 protein_id gnl|my_center|LOCUS_22060 2488938 2490128 gene locus_tag LOCUS_22070 2488938 2490128 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966309.1 protein_id gnl|my_center|LOCUS_22070 2490228 2490599 gene locus_tag LOCUS_22080 2490228 2490599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023252.1 protein_id gnl|my_center|LOCUS_22080 2490743 2490988 gene locus_tag LOCUS_22090 2490743 2490988 CDS product DUF5683 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023253.1 protein_id gnl|my_center|LOCUS_22090 2491091 2491285 gene locus_tag LOCUS_22100 2491091 2491285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048139595.1 protein_id gnl|my_center|LOCUS_22100 2491676 2491963 gene locus_tag LOCUS_22110 2491676 2491963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 2492512 2493114 gene locus_tag LOCUS_22120 2492512 2493114 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023254.1 protein_id gnl|my_center|LOCUS_22120 2495291 2493279 gene locus_tag LOCUS_22130 gene uvrB 2495291 2493279 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023255.1 protein_id gnl|my_center|LOCUS_22130 2496915 2495365 gene locus_tag LOCUS_22140 gene uvrC 2496915 2495365 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023256.1 protein_id gnl|my_center|LOCUS_22140 2499980 2496999 gene locus_tag LOCUS_22150 gene uvrA 2499980 2496999 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023257.1 protein_id gnl|my_center|LOCUS_22150 2501109 2500831 gene locus_tag LOCUS_22160 2501109 2500831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065757.1 protein_id gnl|my_center|LOCUS_22160 2503443 2502487 gene locus_tag LOCUS_22170 2503443 2502487 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065281.1 protein_id gnl|my_center|LOCUS_22170 2503764 2504456 gene locus_tag LOCUS_22180 2503764 2504456 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021999.1 protein_id gnl|my_center|LOCUS_22180 2504473 2505126 gene locus_tag LOCUS_22190 2504473 2505126 CDS product DUF2119 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082089005.1 protein_id gnl|my_center|LOCUS_22190 2506235 2505231 gene locus_tag LOCUS_22200 2506235 2505231 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065282.1 protein_id gnl|my_center|LOCUS_22200 2508468 2506831 gene locus_tag LOCUS_22210 gene thsA 2508468 2506831 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021686.1 protein_id gnl|my_center|LOCUS_22210 2509590 2508886 gene locus_tag LOCUS_22220 gene rpiA 2509590 2508886 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021687.1 protein_id gnl|my_center|LOCUS_22220 2511045 2509711 gene locus_tag LOCUS_22230 gene aspS 2511045 2509711 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021688.1 protein_id gnl|my_center|LOCUS_22230 2511209 2511439 gene locus_tag LOCUS_22240 2511209 2511439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 2513290 2511542 gene locus_tag LOCUS_22250 2513290 2511542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 2514070 2513702 gene locus_tag LOCUS_22260 2514070 2513702 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870296.1 protein_id gnl|my_center|LOCUS_22260 2514377 2514063 gene locus_tag LOCUS_22270 2514377 2514063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 2515443 2514736 gene locus_tag LOCUS_22280 2515443 2514736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 2516133 2516543 gene locus_tag LOCUS_22290 2516133 2516543 CDS product cupredoxin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066247.1 protein_id gnl|my_center|LOCUS_22290 2516907 2517167 gene locus_tag LOCUS_22300 2516907 2517167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065182.1 protein_id gnl|my_center|LOCUS_22300 2517964 2518662 gene locus_tag LOCUS_22310 2517964 2518662 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860471.1 protein_id gnl|my_center|LOCUS_22310 2519163 2518669 gene locus_tag LOCUS_22320 2519163 2518669 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860472.1 protein_id gnl|my_center|LOCUS_22320 2520024 2519503 gene locus_tag LOCUS_22330 2520024 2519503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 2521559 2522455 gene locus_tag LOCUS_22340 2521559 2522455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021693.1 protein_id gnl|my_center|LOCUS_22340 2523895 2522534 gene locus_tag LOCUS_22350 2523895 2522534 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021695.1 protein_id gnl|my_center|LOCUS_22350 2524200 2523922 gene locus_tag LOCUS_22360 2524200 2523922 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023169.1 protein_id gnl|my_center|LOCUS_22360 2524546 2525256 gene locus_tag LOCUS_22370 2524546 2525256 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081428832.1 protein_id gnl|my_center|LOCUS_22370 2525481 2525870 gene locus_tag LOCUS_22380 2525481 2525870 CDS product DUF2769 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023170.1 protein_id gnl|my_center|LOCUS_22380 2526133 2526336 gene locus_tag LOCUS_22390 2526133 2526336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 2526688 2526404 gene locus_tag LOCUS_22400 2526688 2526404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 2527017 2527592 gene locus_tag LOCUS_22410 2527017 2527592 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022769.1 protein_id gnl|my_center|LOCUS_22410 2528089 2528829 gene locus_tag LOCUS_22420 2528089 2528829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22420 2528986 2529327 gene locus_tag LOCUS_22430 2528986 2529327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22430 2529337 2530614 gene locus_tag LOCUS_22440 2529337 2530614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22440 2532421 2531912 gene locus_tag LOCUS_22450 2532421 2531912 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_22450 2533106 2532690 gene locus_tag LOCUS_22460 2533106 2532690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023173.1 protein_id gnl|my_center|LOCUS_22460 2534069 2533536 gene locus_tag LOCUS_22470 2534069 2533536 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023175.1 protein_id gnl|my_center|LOCUS_22470 2535729 2534209 gene locus_tag LOCUS_22480 2535729 2534209 CDS product AMP phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023176.1 protein_id gnl|my_center|LOCUS_22480 2536949 2536074 gene locus_tag LOCUS_22490 2536949 2536074 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023177.1 protein_id gnl|my_center|LOCUS_22490 2537609 2537313 gene locus_tag LOCUS_22500 2537609 2537313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 2537946 2537740 gene locus_tag LOCUS_22510 2537946 2537740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023179.1 protein_id gnl|my_center|LOCUS_22510 2538368 2538532 gene locus_tag LOCUS_22520 2538368 2538532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 2538814 2538593 gene locus_tag LOCUS_22530 2538814 2538593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990638.1 protein_id gnl|my_center|LOCUS_22530 2540547 2539969 gene locus_tag LOCUS_22540 2540547 2539969 CDS product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990620.1 protein_id gnl|my_center|LOCUS_22540 2541186 2541827 gene locus_tag LOCUS_22550 2541186 2541827 CDS product UPF0228 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066446.1 protein_id gnl|my_center|LOCUS_22550 2541973 2542332 gene locus_tag LOCUS_22560 2541973 2542332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 2543212 2542556 gene locus_tag LOCUS_22570 2543212 2542556 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066429.1 protein_id gnl|my_center|LOCUS_22570 2543392 2544342 gene locus_tag LOCUS_22580 2543392 2544342 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279188.1 protein_id gnl|my_center|LOCUS_22580 2544456 2545550 gene locus_tag LOCUS_22590 2544456 2545550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 2545970 2545560 gene locus_tag LOCUS_22600 2545970 2545560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22600 2546309 2546004 gene locus_tag LOCUS_22610 2546309 2546004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 2546592 2547410 gene locus_tag LOCUS_22620 2546592 2547410 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065510.1 protein_id gnl|my_center|LOCUS_22620 2548065 2547436 gene locus_tag LOCUS_22630 2548065 2547436 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444585.1 protein_id gnl|my_center|LOCUS_22630 2548547 2548465 gene locus_tag LOCUS_t00360 2548547 2548465 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2549035 2548730 gene locus_tag LOCUS_22640 2549035 2548730 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022421.1 protein_id gnl|my_center|LOCUS_22640 2549685 2551511 gene locus_tag LOCUS_22650 2549685 2551511 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022420.1 protein_id gnl|my_center|LOCUS_22650 2551828 2552868 gene locus_tag LOCUS_22660 2551828 2552868 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990585.1 protein_id gnl|my_center|LOCUS_22660 2553049 2553726 gene locus_tag LOCUS_22670 2553049 2553726 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022418.1 protein_id gnl|my_center|LOCUS_22670 2554109 2554825 gene locus_tag LOCUS_22680 2554109 2554825 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022417.1 protein_id gnl|my_center|LOCUS_22680 2555898 2555044 gene locus_tag LOCUS_22690 2555898 2555044 CDS product methanogen output domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990584.1 protein_id gnl|my_center|LOCUS_22690 2556613 2555891 gene locus_tag LOCUS_22700 2556613 2555891 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022415.1 protein_id gnl|my_center|LOCUS_22700 2557108 2557446 gene locus_tag LOCUS_22710 2557108 2557446 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813646.1 protein_id gnl|my_center|LOCUS_22710 2557446 2558330 gene locus_tag LOCUS_22720 2557446 2558330 CDS product permease prefix domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387089.1 protein_id gnl|my_center|LOCUS_22720 2558371 2558859 gene locus_tag LOCUS_22730 2558371 2558859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 2559653 2559880 gene locus_tag LOCUS_22740 2559653 2559880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22740 2560379 2561812 gene locus_tag LOCUS_22750 gene atpD 2560379 2561812 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065404.1 protein_id gnl|my_center|LOCUS_22750 2561809 2562213 gene locus_tag LOCUS_22760 2561809 2562213 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022411.1 protein_id gnl|my_center|LOCUS_22760 2562206 2562547 gene locus_tag LOCUS_22770 2562206 2562547 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022410.1 protein_id gnl|my_center|LOCUS_22770 2562540 2562854 gene locus_tag LOCUS_22780 2562540 2562854 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022409.1 protein_id gnl|my_center|LOCUS_22780 2562844 2563533 gene locus_tag LOCUS_22790 2562844 2563533 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022408.1 protein_id gnl|my_center|LOCUS_22790 2563571 2563846 gene locus_tag LOCUS_22800 2563571 2563846 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022407.1 protein_id gnl|my_center|LOCUS_22800 2563866 2564948 gene locus_tag LOCUS_22810 2563866 2564948 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022406.1 protein_id gnl|my_center|LOCUS_22810 2565028 2566689 gene locus_tag LOCUS_22820 2565028 2566689 CDS product alternate F1F0 ATPase, F1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022405.1 protein_id gnl|my_center|LOCUS_22820 2566686 2567594 gene locus_tag LOCUS_22830 2566686 2567594 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022404.1 protein_id gnl|my_center|LOCUS_22830 2567810 2568976 gene locus_tag LOCUS_22840 2567810 2568976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022403.1 protein_id gnl|my_center|LOCUS_22840 2569230 2569427 gene locus_tag LOCUS_22850 2569230 2569427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 2570045 2569866 gene locus_tag LOCUS_22860 2570045 2569866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 2570645 2573821 gene locus_tag LOCUS_22870 gene ileS 2570645 2573821 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022402.1 protein_id gnl|my_center|LOCUS_22870 2573916 2574560 gene locus_tag LOCUS_22880 2573916 2574560 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022401.1 protein_id gnl|my_center|LOCUS_22880 2575025 2575240 gene locus_tag LOCUS_22890 2575025 2575240 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066352.1 protein_id gnl|my_center|LOCUS_22890 2576596 2576784 gene locus_tag LOCUS_22900 2576596 2576784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048139711.1 protein_id gnl|my_center|LOCUS_22900 2577344 2578588 gene locus_tag LOCUS_22910 2577344 2578588 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022398.1 protein_id gnl|my_center|LOCUS_22910 2580316 2578781 gene locus_tag LOCUS_22920 2580316 2578781 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065402.1 protein_id gnl|my_center|LOCUS_22920 2581745 2580342 gene locus_tag LOCUS_22930 gene mtbB 2581745 2580342 CDS product dimethylamine methyltransferase MtbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q8TN68 transl_except (pos:complement(2580678..2580680),aa:Pyl) note codon on position 356 is pyrrolysine amber codon. protein_id gnl|my_center|LOCUS_22930 2582500 2581856 gene locus_tag LOCUS_22940 2582500 2581856 CDS product methyltransferase cognate corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022395.1 protein_id gnl|my_center|LOCUS_22940 2583011 2582877 gene locus_tag LOCUS_22950 2583011 2582877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 2583543 2583211 gene locus_tag LOCUS_22960 2583543 2583211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065460.1 protein_id gnl|my_center|LOCUS_22960 2583995 2583630 gene locus_tag LOCUS_22970 2583995 2583630 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022573.1 protein_id gnl|my_center|LOCUS_22970 2584177 2584341 gene locus_tag LOCUS_22980 2584177 2584341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 2584806 2585201 gene locus_tag LOCUS_22990 2584806 2585201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 2585488 2585685 gene locus_tag LOCUS_23000 2585488 2585685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 2585682 2585903 gene locus_tag LOCUS_23010 2585682 2585903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 2585919 2586386 gene locus_tag LOCUS_23020 2585919 2586386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 2586383 2586775 gene locus_tag LOCUS_23030 2586383 2586775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065456.1 protein_id gnl|my_center|LOCUS_23030 2586772 2586948 gene locus_tag LOCUS_23040 2586772 2586948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 2586945 2587280 gene locus_tag LOCUS_23050 2586945 2587280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 2587869 2587522 gene locus_tag LOCUS_23060 2587869 2587522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 2587968 2589365 gene locus_tag LOCUS_23070 2587968 2589365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860231.1 protein_id gnl|my_center|LOCUS_23070 2589692 2589546 gene locus_tag LOCUS_23080 2589692 2589546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 2589754 2589873 gene locus_tag LOCUS_23090 2589754 2589873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 2589878 2590120 gene locus_tag LOCUS_23100 2589878 2590120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 2590127 2590489 gene locus_tag LOCUS_23110 2590127 2590489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 2590734 2591360 gene locus_tag LOCUS_23120 2590734 2591360 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100847.1 protein_id gnl|my_center|LOCUS_23120 2591374 2591661 gene locus_tag LOCUS_23130 2591374 2591661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 2591808 2592020 gene locus_tag LOCUS_23140 2591808 2592020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 2592087 2593367 gene locus_tag LOCUS_23150 2592087 2593367 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_23150 2593694 2593392 gene locus_tag LOCUS_23160 2593694 2593392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 2593855 2593706 gene locus_tag LOCUS_23170 2593855 2593706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 2594153 2594338 gene locus_tag LOCUS_23180 2594153 2594338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 2594351 2594590 gene locus_tag LOCUS_23190 2594351 2594590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 2594605 2594910 gene locus_tag LOCUS_23200 2594605 2594910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048139758.1 protein_id gnl|my_center|LOCUS_23200 2594924 2595412 gene locus_tag LOCUS_23210 2594924 2595412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065449.1 protein_id gnl|my_center|LOCUS_23210 2595427 2596089 gene locus_tag LOCUS_23220 2595427 2596089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 2596100 2596342 gene locus_tag LOCUS_23230 2596100 2596342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 2596837 2596460 gene locus_tag LOCUS_23240 2596837 2596460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 2597054 2597221 gene locus_tag LOCUS_23250 2597054 2597221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 2597231 2599252 gene locus_tag LOCUS_23260 2597231 2599252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 2599262 2599933 gene locus_tag LOCUS_23270 2599262 2599933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 2600249 2600611 gene locus_tag LOCUS_23280 2600249 2600611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022556.1 protein_id gnl|my_center|LOCUS_23280 2600625 2601509 gene locus_tag LOCUS_23290 2600625 2601509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022555.1 protein_id gnl|my_center|LOCUS_23290 2601510 2601743 gene locus_tag LOCUS_23300 2601510 2601743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022554.1 protein_id gnl|my_center|LOCUS_23300 2601748 2603568 gene locus_tag LOCUS_23310 2601748 2603568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 2603975 2604274 gene locus_tag LOCUS_23320 2603975 2604274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022551.1 protein_id gnl|my_center|LOCUS_23320 2604274 2604513 gene locus_tag LOCUS_23330 2604274 2604513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065446.1 protein_id gnl|my_center|LOCUS_23330 2604617 2605441 gene locus_tag LOCUS_23340 2604617 2605441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 2605452 2607332 gene locus_tag LOCUS_23350 2605452 2607332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860228.1 protein_id gnl|my_center|LOCUS_23350 2608714 2607467 gene locus_tag LOCUS_23360 2608714 2607467 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022546.1 protein_id gnl|my_center|LOCUS_23360 2609739 2608750 gene locus_tag LOCUS_23370 2609739 2608750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065399.1 protein_id gnl|my_center|LOCUS_23370 2610434 2609874 gene locus_tag LOCUS_23380 2610434 2609874 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065398.1 protein_id gnl|my_center|LOCUS_23380 2611098 2610838 gene locus_tag LOCUS_23390 2611098 2610838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 2611686 2611387 gene locus_tag LOCUS_23400 2611686 2611387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23400 2613314 2612277 gene locus_tag LOCUS_23410 2613314 2612277 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022381.1 protein_id gnl|my_center|LOCUS_23410 2614436 2613849 gene locus_tag LOCUS_23420 2614436 2613849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 2614664 2614876 gene locus_tag LOCUS_23430 2614664 2614876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 2615475 2615038 gene locus_tag LOCUS_23440 2615475 2615038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 2615910 2615710 gene locus_tag LOCUS_23450 2615910 2615710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 2616100 2616876 gene locus_tag LOCUS_23460 2616100 2616876 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020795.1 protein_id gnl|my_center|LOCUS_23460 2617264 2617145 gene locus_tag LOCUS_23470 2617264 2617145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 2617789 2619690 gene locus_tag LOCUS_23480 2617789 2619690 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990869.1 protein_id gnl|my_center|LOCUS_23480 2620718 2621068 gene locus_tag LOCUS_23490 2620718 2621068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23490 2621708 2622322 gene locus_tag LOCUS_23500 2621708 2622322 CDS product cohesin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065242.1 protein_id gnl|my_center|LOCUS_23500 2622319 2623668 gene locus_tag LOCUS_23510 2622319 2623668 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 protein_id gnl|my_center|LOCUS_23510 2623675 2624415 gene locus_tag LOCUS_23520 2623675 2624415 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021850.1 protein_id gnl|my_center|LOCUS_23520 2624424 2625056 gene locus_tag LOCUS_23530 2624424 2625056 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021849.1 protein_id gnl|my_center|LOCUS_23530 2625149 2626084 gene locus_tag LOCUS_23540 2625149 2626084 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021342.1 protein_id gnl|my_center|LOCUS_23540 2626123 2627199 gene locus_tag LOCUS_23550 2626123 2627199 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_23550 2627196 2627969 gene locus_tag LOCUS_23560 2627196 2627969 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_23560 2628246 2628635 gene locus_tag LOCUS_23570 2628246 2628635 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021844.1 protein_id gnl|my_center|LOCUS_23570 2630041 2628749 gene locus_tag LOCUS_23580 2630041 2628749 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021843.1 protein_id gnl|my_center|LOCUS_23580 2630408 2631337 gene locus_tag LOCUS_23590 2630408 2631337 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066267.1 protein_id gnl|my_center|LOCUS_23590 2632012 2631524 gene locus_tag LOCUS_23600 2632012 2631524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 2632671 2633564 gene locus_tag LOCUS_23610 2632671 2633564 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022101.1 protein_id gnl|my_center|LOCUS_23610 2633612 2633779 gene locus_tag LOCUS_23620 2633612 2633779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 2634573 2633902 gene locus_tag LOCUS_23630 2634573 2633902 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022100.1 protein_id gnl|my_center|LOCUS_23630 2635347 2634718 gene locus_tag LOCUS_23640 2635347 2634718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022099.1 protein_id gnl|my_center|LOCUS_23640 2636491 2635925 gene locus_tag LOCUS_23650 2636491 2635925 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021922.1 protein_id gnl|my_center|LOCUS_23650 2637356 2636733 gene locus_tag LOCUS_23660 2637356 2636733 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444207.1 protein_id gnl|my_center|LOCUS_23660 2638320 2637460 gene locus_tag LOCUS_23670 2638320 2637460 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023938.1 protein_id gnl|my_center|LOCUS_23670 2638772 2640415 gene locus_tag LOCUS_23680 2638772 2640415 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021912.1 protein_id gnl|my_center|LOCUS_23680 2640817 2642448 gene locus_tag LOCUS_23690 2640817 2642448 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021911.1 protein_id gnl|my_center|LOCUS_23690 2642715 2643707 gene locus_tag LOCUS_23700 2642715 2643707 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021910.1 protein_id gnl|my_center|LOCUS_23700 2643730 2644587 gene locus_tag LOCUS_23710 2643730 2644587 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021909.1 protein_id gnl|my_center|LOCUS_23710 2644623 2645600 gene locus_tag LOCUS_23720 2644623 2645600 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021908.1 protein_id gnl|my_center|LOCUS_23720 2645590 2646210 gene locus_tag LOCUS_23730 2645590 2646210 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021907.1 protein_id gnl|my_center|LOCUS_23730 2646981 2646463 gene locus_tag LOCUS_23740 2646981 2646463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23740 2647615 2647145 gene locus_tag LOCUS_23750 2647615 2647145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23750 2648544 2647924 gene locus_tag LOCUS_23760 2648544 2647924 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762040.1 protein_id gnl|my_center|LOCUS_23760 2649940 2650149 gene locus_tag LOCUS_23770 2649940 2650149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 2650523 2651650 gene locus_tag LOCUS_23780 2650523 2651650 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085095815.1 protein_id gnl|my_center|LOCUS_23780 2652504 2654654 gene locus_tag LOCUS_23790 gene katG 2652504 2654654 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021009.1 protein_id gnl|my_center|LOCUS_23790 2654990 2655274 gene locus_tag LOCUS_23800 2654990 2655274 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066490.1 protein_id gnl|my_center|LOCUS_23800 2655900 2656304 gene locus_tag LOCUS_23810 2655900 2656304 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022524.1 protein_id gnl|my_center|LOCUS_23810 2656572 2656781 gene locus_tag LOCUS_23820 2656572 2656781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 2656986 2657726 gene locus_tag LOCUS_23830 gene ribB 2656986 2657726 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020597.1 protein_id gnl|my_center|LOCUS_23830 2658278 2659294 gene locus_tag LOCUS_23840 2658278 2659294 CDS product 4Fe-4S double cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048139859.1 protein_id gnl|my_center|LOCUS_23840 2659326 2659955 gene locus_tag LOCUS_23850 2659326 2659955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 2660070 2660648 gene locus_tag LOCUS_23860 2660070 2660648 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066263.1 protein_id gnl|my_center|LOCUS_23860 2660761 2661561 gene locus_tag LOCUS_23870 2660761 2661561 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021773.1 protein_id gnl|my_center|LOCUS_23870 2661579 2662445 gene locus_tag LOCUS_23880 2661579 2662445 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860140.1 protein_id gnl|my_center|LOCUS_23880 2662968 2663312 gene locus_tag LOCUS_23890 2662968 2663312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 2663731 2663940 gene locus_tag LOCUS_23900 2663731 2663940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 2664913 2664476 gene locus_tag LOCUS_23910 2664913 2664476 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948287.1 protein_id gnl|my_center|LOCUS_23910 2665180 2666292 gene locus_tag LOCUS_23920 2665180 2666292 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022283.1 protein_id gnl|my_center|LOCUS_23920 2668147 2666963 gene locus_tag LOCUS_23930 2668147 2666963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728696.1 protein_id gnl|my_center|LOCUS_23930 2668331 2668185 gene locus_tag LOCUS_23940 2668331 2668185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 2669639 2669319 gene locus_tag LOCUS_23950 2669639 2669319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 2669893 2669660 gene locus_tag LOCUS_23960 2669893 2669660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23960 2670498 2670920 gene locus_tag LOCUS_23970 2670498 2670920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 2671668 2671201 gene locus_tag LOCUS_23980 2671668 2671201 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022818.1 protein_id gnl|my_center|LOCUS_23980 2672754 2672143 gene locus_tag LOCUS_23990 2672754 2672143 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022488.1 protein_id gnl|my_center|LOCUS_23990 2673318 2673998 gene locus_tag LOCUS_24000 2673318 2673998 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021131.1 protein_id gnl|my_center|LOCUS_24000 2674344 2674733 gene locus_tag LOCUS_24010 2674344 2674733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 2676503 2677288 gene locus_tag LOCUS_24020 2676503 2677288 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020906.1 protein_id gnl|my_center|LOCUS_24020 2677327 2679999 gene locus_tag LOCUS_24030 2677327 2679999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 2680003 2680407 gene locus_tag LOCUS_24040 2680003 2680407 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021483.1 protein_id gnl|my_center|LOCUS_24040 2681047 2681559 gene locus_tag LOCUS_24050 2681047 2681559 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021483.1 protein_id gnl|my_center|LOCUS_24050 2684035 2681777 gene locus_tag LOCUS_24060 2684035 2681777 CDS product DUF3160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065672.1 protein_id gnl|my_center|LOCUS_24060 2684233 2685414 gene locus_tag LOCUS_24070 2684233 2685414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 2687039 2685528 gene locus_tag LOCUS_24080 gene pap 2687039 2685528 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065389.1 protein_id gnl|my_center|LOCUS_24080 2690146 2689682 gene locus_tag LOCUS_24090 2690146 2689682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022361.1 protein_id gnl|my_center|LOCUS_24090 2690600 2691475 gene locus_tag LOCUS_24100 2690600 2691475 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268011.1 protein_id gnl|my_center|LOCUS_24100 2692384 2692716 gene locus_tag LOCUS_24110 2692384 2692716 CDS product DUF2551 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065388.1 protein_id gnl|my_center|LOCUS_24110 2692752 2693153 gene locus_tag LOCUS_24120 2692752 2693153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022359.1 protein_id gnl|my_center|LOCUS_24120 2693395 2693467 gene locus_tag LOCUS_t00370 2693395 2693467 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2695261 2693948 gene locus_tag LOCUS_24130 2695261 2693948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 2696947 2697870 gene locus_tag LOCUS_24140 2696947 2697870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 2698533 2698940 gene locus_tag LOCUS_24150 2698533 2698940 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065220.1 protein_id gnl|my_center|LOCUS_24150 2699831 2699307 gene locus_tag LOCUS_24160 2699831 2699307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066347.1 protein_id gnl|my_center|LOCUS_24160 2703145 2700248 gene locus_tag LOCUS_24170 2703145 2700248 CDS product disaggregatase related repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860211.1 protein_id gnl|my_center|LOCUS_24170 2704703 2707084 gene locus_tag LOCUS_24180 2704703 2707084 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022354.1 protein_id gnl|my_center|LOCUS_24180 2707085 2708101 gene locus_tag LOCUS_24190 2707085 2708101 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022353.1 protein_id gnl|my_center|LOCUS_24190 2708168 2709508 gene locus_tag LOCUS_24200 2708168 2709508 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022352.1 protein_id gnl|my_center|LOCUS_24200 2710071 2709727 gene locus_tag LOCUS_24210 2710071 2709727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065385.1 protein_id gnl|my_center|LOCUS_24210 2710563 2710219 gene locus_tag LOCUS_24220 2710563 2710219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 2710868 2710560 gene locus_tag LOCUS_24230 2710868 2710560 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022349.1 protein_id gnl|my_center|LOCUS_24230 2711968 2711213 gene locus_tag LOCUS_24240 2711968 2711213 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022348.1 protein_id gnl|my_center|LOCUS_24240 2712066 2712150 gene locus_tag LOCUS_t00380 2712066 2712150 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2712655 2713371 gene locus_tag LOCUS_24250 2712655 2713371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 2713864 2715426 gene locus_tag LOCUS_24260 2713864 2715426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 2719364 2715978 gene locus_tag LOCUS_24270 2719364 2715978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 2721033 2719807 gene locus_tag LOCUS_24280 gene cas1 2721033 2719807 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879371.1 protein_id gnl|my_center|LOCUS_24280 2722135 2721086 gene locus_tag LOCUS_24290 2722135 2721086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 2722371 2723009 gene locus_tag LOCUS_24300 2722371 2723009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 2723022 2723378 gene locus_tag LOCUS_24310 2723022 2723378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 2723347 2726001 gene locus_tag LOCUS_24320 2723347 2726001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 2726183 2731024 gene locus_tag LOCUS_24330 2726183 2731024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 2733281 2732460 gene locus_tag LOCUS_24340 2733281 2732460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2733646 2733287 gene locus_tag LOCUS_24350 2733646 2733287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 2734273 2733659 gene locus_tag LOCUS_24360 2734273 2733659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 2735650 2734610 gene locus_tag LOCUS_24370 2735650 2734610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 2736581 2736399 gene locus_tag LOCUS_24380 2736581 2736399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 2736795 2738039 gene locus_tag LOCUS_24390 2736795 2738039 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240264.1 protein_id gnl|my_center|LOCUS_24390 2738932 2738510 gene locus_tag LOCUS_24400 2738932 2738510 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990865.1 protein_id gnl|my_center|LOCUS_24400 2739681 2739061 gene locus_tag LOCUS_24410 2739681 2739061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 2739890 2741215 gene locus_tag LOCUS_24420 2739890 2741215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 2743904 2741670 gene locus_tag LOCUS_24430 2743904 2741670 CDS product PGF-pre-PGF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990840.1 protein_id gnl|my_center|LOCUS_24430 2747702 2744511 gene locus_tag LOCUS_24440 2747702 2744511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 2750488 2748533 gene locus_tag LOCUS_24450 2750488 2748533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 2751334 2751582 gene locus_tag LOCUS_24460 2751334 2751582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24460 2752258 2752767 gene locus_tag LOCUS_24470 2752258 2752767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 2753457 2753191 gene locus_tag LOCUS_24480 2753457 2753191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 2754549 2753611 gene locus_tag LOCUS_24490 2754549 2753611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065062.1 protein_id gnl|my_center|LOCUS_24490 2755279 2755698 gene locus_tag LOCUS_24500 2755279 2755698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065366.1 protein_id gnl|my_center|LOCUS_24500 2756132 2757334 gene locus_tag LOCUS_24510 2756132 2757334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064846.1 protein_id gnl|my_center|LOCUS_24510 2757986 2757456 gene locus_tag LOCUS_24520 2757986 2757456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022298.1 protein_id gnl|my_center|LOCUS_24520 2758997 2760367 gene locus_tag LOCUS_24530 2758997 2760367 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022297.1 protein_id gnl|my_center|LOCUS_24530 2760513 2761649 gene locus_tag LOCUS_24540 2760513 2761649 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_24540 2763602 2765455 gene locus_tag LOCUS_24550 2763602 2765455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 2766655 2767035 gene locus_tag LOCUS_24560 2766655 2767035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022293.1 protein_id gnl|my_center|LOCUS_24560 2767049 2768590 gene locus_tag LOCUS_24570 2767049 2768590 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022292.1 protein_id gnl|my_center|LOCUS_24570 2768838 2768963 gene locus_tag LOCUS_24580 2768838 2768963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 2768963 2770564 gene locus_tag LOCUS_24590 2768963 2770564 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021335.1 protein_id gnl|my_center|LOCUS_24590 2770937 2771227 gene locus_tag LOCUS_24600 2770937 2771227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 2771731 2772567 gene locus_tag LOCUS_24610 2771731 2772567 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022258.1 protein_id gnl|my_center|LOCUS_24610 2773098 2772793 gene locus_tag LOCUS_24620 2773098 2772793 CDS product MscL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022264.1 protein_id gnl|my_center|LOCUS_24620 2774106 2773357 gene locus_tag LOCUS_24630 2774106 2773357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 2774608 2774093 gene locus_tag LOCUS_24640 2774608 2774093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 2776035 2774746 gene locus_tag LOCUS_24650 2776035 2774746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065354.1 protein_id gnl|my_center|LOCUS_24650 2776227 2777189 gene locus_tag LOCUS_24660 2776227 2777189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 2777850 2777527 gene locus_tag LOCUS_24670 2777850 2777527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 2778297 2778836 gene locus_tag LOCUS_24680 2778297 2778836 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930581.1 protein_id gnl|my_center|LOCUS_24680 2779481 2779780 gene locus_tag LOCUS_24690 2779481 2779780 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022268.1 protein_id gnl|my_center|LOCUS_24690 2780373 2781575 gene locus_tag LOCUS_24700 2780373 2781575 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022270.1 protein_id gnl|my_center|LOCUS_24700 2781931 2782338 gene locus_tag LOCUS_24710 2781931 2782338 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023146.1 protein_id gnl|my_center|LOCUS_24710 2783177 2784358 gene locus_tag LOCUS_24720 2783177 2784358 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022271.1 protein_id gnl|my_center|LOCUS_24720 2784466 2785662 gene locus_tag LOCUS_24730 2784466 2785662 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022271.1 protein_id gnl|my_center|LOCUS_24730 2786260 2788317 gene locus_tag LOCUS_24740 2786260 2788317 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022273.1 protein_id gnl|my_center|LOCUS_24740 2788994 2788419 gene locus_tag LOCUS_24750 2788994 2788419 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022274.1 protein_id gnl|my_center|LOCUS_24750 2789533 2790621 gene locus_tag LOCUS_24760 2789533 2790621 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064942.1 protein_id gnl|my_center|LOCUS_24760 2791081 2790944 gene locus_tag LOCUS_24770 2791081 2790944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 2792340 2791600 gene locus_tag LOCUS_24780 gene ribB 2792340 2791600 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020597.1 protein_id gnl|my_center|LOCUS_24780 2793028 2792819 gene locus_tag LOCUS_24790 2793028 2792819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 2793775 2793359 gene locus_tag LOCUS_24800 2793775 2793359 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022524.1 protein_id gnl|my_center|LOCUS_24800 2794060 2794689 gene locus_tag LOCUS_24810 2794060 2794689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 2794733 2795359 gene locus_tag LOCUS_24820 2794733 2795359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24820 2795372 2795749 gene locus_tag LOCUS_24830 2795372 2795749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24830 2795808 2796452 gene locus_tag LOCUS_24840 2795808 2796452 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066263.1 protein_id gnl|my_center|LOCUS_24840 2796580 2797395 gene locus_tag LOCUS_24850 2796580 2797395 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021773.1 protein_id gnl|my_center|LOCUS_24850 2797431 2798288 gene locus_tag LOCUS_24860 2797431 2798288 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022522.1 protein_id gnl|my_center|LOCUS_24860 2798543 2801563 gene locus_tag LOCUS_24870 2798543 2801563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 2802278 2802466 gene locus_tag LOCUS_24880 2802278 2802466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172472.1 protein_id gnl|my_center|LOCUS_24880 2802736 2803056 gene locus_tag LOCUS_24890 2802736 2803056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 2803456 2804094 gene locus_tag LOCUS_24900 2803456 2804094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 2804118 2804630 gene locus_tag LOCUS_24910 2804118 2804630 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022278.1 protein_id gnl|my_center|LOCUS_24910 2804939 2806009 gene locus_tag LOCUS_24920 2804939 2806009 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064840.1 protein_id gnl|my_center|LOCUS_24920 2809864 2806166 gene locus_tag LOCUS_24930 2809864 2806166 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022279.1 protein_id gnl|my_center|LOCUS_24930 2810266 2811267 gene locus_tag LOCUS_24940 2810266 2811267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065359.1 protein_id gnl|my_center|LOCUS_24940 2811416 2813092 gene locus_tag LOCUS_24950 gene ade 2811416 2813092 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022289.1 protein_id gnl|my_center|LOCUS_24950 2813309 2813485 gene locus_tag LOCUS_24960 2813309 2813485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065363.1 protein_id gnl|my_center|LOCUS_24960 2814250 2813669 gene locus_tag LOCUS_24970 2814250 2813669 CDS product DUF2121 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022290.1 protein_id gnl|my_center|LOCUS_24970 2814636 2814412 gene locus_tag LOCUS_24980 2814636 2814412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 2814670 2815059 gene locus_tag LOCUS_24990 2814670 2815059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 2815201 2815440 gene locus_tag LOCUS_25000 2815201 2815440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066280.1 protein_id gnl|my_center|LOCUS_25000 2815441 2815596 gene locus_tag LOCUS_25010 2815441 2815596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 2816515 2816162 gene locus_tag LOCUS_25020 2816515 2816162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 2816857 2816600 gene locus_tag LOCUS_25030 2816857 2816600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 2817974 2817465 gene locus_tag LOCUS_25040 2817974 2817465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 2818593 2819909 gene locus_tag LOCUS_25050 2818593 2819909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 2820900 2821358 gene locus_tag LOCUS_25060 2820900 2821358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 2821371 2822012 gene locus_tag LOCUS_25070 2821371 2822012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 2822218 2822421 gene locus_tag LOCUS_25080 2822218 2822421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 2822463 2822756 gene locus_tag LOCUS_25090 2822463 2822756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25090 2822926 2822735 gene locus_tag LOCUS_25100 2822926 2822735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 2823497 2824417 gene locus_tag LOCUS_25110 2823497 2824417 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065352.1 protein_id gnl|my_center|LOCUS_25110 2824756 2825142 gene locus_tag LOCUS_25120 2824756 2825142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022256.1 protein_id gnl|my_center|LOCUS_25120 2825162 2825368 gene locus_tag LOCUS_25130 2825162 2825368 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066331.1 protein_id gnl|my_center|LOCUS_25130 2825678 2825869 gene locus_tag LOCUS_25140 2825678 2825869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 2826042 2826770 gene locus_tag LOCUS_25150 2826042 2826770 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022254.1 protein_id gnl|my_center|LOCUS_25150 2826926 2828281 gene locus_tag LOCUS_25160 2826926 2828281 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065351.1 protein_id gnl|my_center|LOCUS_25160 2828306 2829655 gene locus_tag LOCUS_25170 2828306 2829655 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065350.1 protein_id gnl|my_center|LOCUS_25170 2829784 2830272 gene locus_tag LOCUS_25180 2829784 2830272 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022249.1 protein_id gnl|my_center|LOCUS_25180 2830906 2831661 gene locus_tag LOCUS_25190 2830906 2831661 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022247.1 protein_id gnl|my_center|LOCUS_25190 2832196 2831984 gene locus_tag LOCUS_25200 2832196 2831984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022246.1 protein_id gnl|my_center|LOCUS_25200 2832711 2834747 gene locus_tag LOCUS_25210 2832711 2834747 CDS product histidine kinase dimerization/phosphoacceptor domain -containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066330.1 protein_id gnl|my_center|LOCUS_25210 2836223 2835612 gene locus_tag LOCUS_25220 2836223 2835612 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279161.1 protein_id gnl|my_center|LOCUS_25220 2837417 2837067 gene locus_tag LOCUS_25230 2837417 2837067 CDS product DUF2173 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022242.1 protein_id gnl|my_center|LOCUS_25230 2837863 2838066 gene locus_tag LOCUS_25240 2837863 2838066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 2838461 2838928 gene locus_tag LOCUS_25250 2838461 2838928 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022240.1 protein_id gnl|my_center|LOCUS_25250 2839063 2840109 gene locus_tag LOCUS_25260 2839063 2840109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065347.1 protein_id gnl|my_center|LOCUS_25260 2840231 2840914 gene locus_tag LOCUS_25270 2840231 2840914 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022238.1 protein_id gnl|my_center|LOCUS_25270 2841211 2842308 gene locus_tag LOCUS_25280 2841211 2842308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990836.1 protein_id gnl|my_center|LOCUS_25280 2843090 2842815 gene locus_tag LOCUS_25290 2843090 2842815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25290 2844850 2843087 gene locus_tag LOCUS_25300 2844850 2843087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25300 2845267 2844890 gene locus_tag LOCUS_25310 2845267 2844890 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066326.1 protein_id gnl|my_center|LOCUS_25310 2846293 2847636 gene locus_tag LOCUS_25320 2846293 2847636 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022234.1 protein_id gnl|my_center|LOCUS_25320 2847835 2848749 gene locus_tag LOCUS_25330 2847835 2848749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022380.1 protein_id gnl|my_center|LOCUS_25330 2849539 2849730 gene locus_tag LOCUS_25340 2849539 2849730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065397.1 protein_id gnl|my_center|LOCUS_25340 2850276 2851166 gene locus_tag LOCUS_25350 2850276 2851166 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022378.1 protein_id gnl|my_center|LOCUS_25350 2852994 2851195 gene locus_tag LOCUS_25360 2852994 2851195 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990580.1 protein_id gnl|my_center|LOCUS_25360 2854480 2852981 gene locus_tag LOCUS_25370 2854480 2852981 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022374.1 protein_id gnl|my_center|LOCUS_25370 2855129 2855371 gene locus_tag LOCUS_25380 2855129 2855371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 2855814 2855482 gene locus_tag LOCUS_25390 2855814 2855482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25390 2856003 2855815 gene locus_tag LOCUS_25400 2856003 2855815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25400 2857404 2858042 gene locus_tag LOCUS_25410 2857404 2858042 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065395.1 protein_id gnl|my_center|LOCUS_25410 2858140 2858865 gene locus_tag LOCUS_25420 2858140 2858865 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022371.1 protein_id gnl|my_center|LOCUS_25420 2860053 2859430 gene locus_tag LOCUS_25430 2860053 2859430 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022370.1 protein_id gnl|my_center|LOCUS_25430 2860888 2860424 gene locus_tag LOCUS_25440 gene tnpA 2860888 2860424 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979974.1 protein_id gnl|my_center|LOCUS_25440 2861835 2861419 gene locus_tag LOCUS_25450 2861835 2861419 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279139.1 protein_id gnl|my_center|LOCUS_25450 2861917 2862081 gene locus_tag LOCUS_25460 2861917 2862081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 2862222 2862509 gene locus_tag LOCUS_25470 2862222 2862509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 2862830 2864008 gene locus_tag LOCUS_25480 2862830 2864008 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065244.1 protein_id gnl|my_center|LOCUS_25480 2865371 2864130 gene locus_tag LOCUS_25490 2865371 2864130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 2866425 2865790 gene locus_tag LOCUS_25500 2866425 2865790 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021856.1 protein_id gnl|my_center|LOCUS_25500 2867283 2866498 gene locus_tag LOCUS_25510 2867283 2866498 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021858.1 protein_id gnl|my_center|LOCUS_25510 2867586 2868830 gene locus_tag LOCUS_25520 2867586 2868830 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990816.1 protein_id gnl|my_center|LOCUS_25520 2869378 2870316 gene locus_tag LOCUS_25530 2869378 2870316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021860.1 protein_id gnl|my_center|LOCUS_25530 2871484 2870816 gene locus_tag LOCUS_25540 2871484 2870816 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021861.1 protein_id gnl|my_center|LOCUS_25540 2874141 2871754 gene locus_tag LOCUS_25550 gene lon 2874141 2871754 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021863.1 protein_id gnl|my_center|LOCUS_25550 2874740 2874342 gene locus_tag LOCUS_25560 2874740 2874342 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021864.1 protein_id gnl|my_center|LOCUS_25560 2875281 2875775 gene locus_tag LOCUS_25570 2875281 2875775 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021868.1 protein_id gnl|my_center|LOCUS_25570 2877100 2875796 gene locus_tag LOCUS_25580 2877100 2875796 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065247.1 protein_id gnl|my_center|LOCUS_25580 2877570 2877364 gene locus_tag LOCUS_25590 2877570 2877364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021870.1 protein_id gnl|my_center|LOCUS_25590 2877875 2879734 gene locus_tag LOCUS_25600 2877875 2879734 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021871.1 protein_id gnl|my_center|LOCUS_25600 2880107 2879901 gene locus_tag LOCUS_25610 2880107 2879901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021873.1 protein_id gnl|my_center|LOCUS_25610 2880812 2882176 gene locus_tag LOCUS_25620 2880812 2882176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 2882491 2883675 gene locus_tag LOCUS_25630 2882491 2883675 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065248.1 protein_id gnl|my_center|LOCUS_25630 2885361 2883682 gene locus_tag LOCUS_25640 gene glgP 2885361 2883682 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021875.1 protein_id gnl|my_center|LOCUS_25640 2885775 2886992 gene locus_tag LOCUS_25650 2885775 2886992 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022528.1 protein_id gnl|my_center|LOCUS_25650 2887264 2888256 gene locus_tag LOCUS_25660 2887264 2888256 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022527.1 protein_id gnl|my_center|LOCUS_25660 2888671 2889111 gene locus_tag LOCUS_25670 2888671 2889111 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065436.1 protein_id gnl|my_center|LOCUS_25670 2889405 2889265 gene locus_tag LOCUS_25680 2889405 2889265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 2892098 2889840 gene locus_tag LOCUS_25690 2892098 2889840 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022481.1 protein_id gnl|my_center|LOCUS_25690 2892507 2892713 gene locus_tag LOCUS_25700 2892507 2892713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 2892771 2892980 gene locus_tag LOCUS_25710 2892771 2892980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25710 2894344 2893478 gene locus_tag LOCUS_25720 2894344 2893478 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860140.1 protein_id gnl|my_center|LOCUS_25720 2895157 2894357 gene locus_tag LOCUS_25730 2895157 2894357 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021773.1 protein_id gnl|my_center|LOCUS_25730 2895863 2895273 gene locus_tag LOCUS_25740 2895863 2895273 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066263.1 protein_id gnl|my_center|LOCUS_25740 2897375 2896182 gene locus_tag LOCUS_25750 2897375 2896182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 2897772 2897981 gene locus_tag LOCUS_25760 2897772 2897981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 2899911 2898988 gene locus_tag LOCUS_25770 2899911 2898988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 2900575 2900727 gene locus_tag LOCUS_25780 2900575 2900727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 2901762 2901292 gene locus_tag LOCUS_25790 2901762 2901292 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_25790 2902427 2901903 gene locus_tag LOCUS_25800 2902427 2901903 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065425.1 protein_id gnl|my_center|LOCUS_25800 2902453 2902692 gene locus_tag LOCUS_25810 2902453 2902692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 2903605 2904174 gene locus_tag LOCUS_25820 2903605 2904174 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066367.1 protein_id gnl|my_center|LOCUS_25820 2904214 2904594 gene locus_tag LOCUS_25830 2904214 2904594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022476.1 protein_id gnl|my_center|LOCUS_25830 2904899 2905279 gene locus_tag LOCUS_25840 2904899 2905279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022475.1 protein_id gnl|my_center|LOCUS_25840 2905484 2907046 gene locus_tag LOCUS_25850 2905484 2907046 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065424.1 protein_id gnl|my_center|LOCUS_25850 2907198 2908238 gene locus_tag LOCUS_25860 2907198 2908238 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022473.1 protein_id gnl|my_center|LOCUS_25860 2908318 2911092 gene locus_tag LOCUS_25870 2908318 2911092 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022472.1 protein_id gnl|my_center|LOCUS_25870 2911437 2911940 gene locus_tag LOCUS_25880 2911437 2911940 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022471.1 protein_id gnl|my_center|LOCUS_25880 2912173 2913000 gene locus_tag LOCUS_25890 2912173 2913000 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066364.1 protein_id gnl|my_center|LOCUS_25890 2913813 2913229 gene locus_tag LOCUS_25900 2913813 2913229 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022469.1 protein_id gnl|my_center|LOCUS_25900 2914655 2913813 gene locus_tag LOCUS_25910 2914655 2913813 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065423.1 protein_id gnl|my_center|LOCUS_25910 2915689 2914880 gene locus_tag LOCUS_25920 2915689 2914880 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065422.1 protein_id gnl|my_center|LOCUS_25920 2918162 2917356 gene locus_tag LOCUS_25930 2918162 2917356 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065422.1 protein_id gnl|my_center|LOCUS_25930 2918896 2918225 gene locus_tag LOCUS_25940 2918896 2918225 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022466.1 protein_id gnl|my_center|LOCUS_25940 2919866 2919102 gene locus_tag LOCUS_25950 2919866 2919102 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878509.1 protein_id gnl|my_center|LOCUS_25950 2920743 2920105 gene locus_tag LOCUS_25960 2920743 2920105 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022464.1 protein_id gnl|my_center|LOCUS_25960 2920892 2922043 gene locus_tag LOCUS_25970 2920892 2922043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065646.1 protein_id gnl|my_center|LOCUS_25970 2922152 2923321 gene locus_tag LOCUS_25980 2922152 2923321 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065645.1 protein_id gnl|my_center|LOCUS_25980 2923408 2924577 gene locus_tag LOCUS_25990 2923408 2924577 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022460.1 protein_id gnl|my_center|LOCUS_25990 2924711 2925394 gene locus_tag LOCUS_26000 2924711 2925394 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065420.1 protein_id gnl|my_center|LOCUS_26000 2925930 2926643 gene locus_tag LOCUS_26010 2925930 2926643 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021850.1 protein_id gnl|my_center|LOCUS_26010 2926678 2927457 gene locus_tag LOCUS_26020 2926678 2927457 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460477.1 protein_id gnl|my_center|LOCUS_26020 2927454 2927672 gene locus_tag LOCUS_26030 2927454 2927672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 2928910 2928143 gene locus_tag LOCUS_26040 2928910 2928143 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065321.1 protein_id gnl|my_center|LOCUS_26040 2930224 2929082 gene locus_tag LOCUS_26050 2930224 2929082 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022139.1 protein_id gnl|my_center|LOCUS_26050 2931156 2930404 gene locus_tag LOCUS_26060 2931156 2930404 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022138.1 protein_id gnl|my_center|LOCUS_26060 2931958 2931173 gene locus_tag LOCUS_26070 2931958 2931173 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065321.1 protein_id gnl|my_center|LOCUS_26070 2932752 2931955 gene locus_tag LOCUS_26080 2932752 2931955 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065320.1 protein_id gnl|my_center|LOCUS_26080 2933792 2932749 gene locus_tag LOCUS_26090 2933792 2932749 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065319.1 protein_id gnl|my_center|LOCUS_26090 2934977 2933823 gene locus_tag LOCUS_26100 2934977 2933823 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990827.1 protein_id gnl|my_center|LOCUS_26100 2935524 2937149 gene locus_tag LOCUS_26110 2935524 2937149 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020360.1 protein_id gnl|my_center|LOCUS_26110 2937213 2938163 gene locus_tag LOCUS_26120 2937213 2938163 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_26120 2938160 2939005 gene locus_tag LOCUS_26130 2938160 2939005 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990759.1 protein_id gnl|my_center|LOCUS_26130 2939002 2939943 gene locus_tag LOCUS_26140 2939002 2939943 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020923.1 protein_id gnl|my_center|LOCUS_26140 2939936 2940877 gene locus_tag LOCUS_26150 2939936 2940877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 2941157 2942161 gene locus_tag LOCUS_26160 2941157 2942161 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_26160 2942155 2942949 gene locus_tag LOCUS_26170 2942155 2942949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_26170 2944691 2943363 gene locus_tag LOCUS_26180 2944691 2943363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 2947985 2946183 gene locus_tag LOCUS_26190 2947985 2946183 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022444.1 protein_id gnl|my_center|LOCUS_26190 2949793 2947982 gene locus_tag LOCUS_26200 2949793 2947982 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022443.1 protein_id gnl|my_center|LOCUS_26200 2950287 2951036 gene locus_tag LOCUS_26210 2950287 2951036 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023383.1 protein_id gnl|my_center|LOCUS_26210 2951315 2952244 gene locus_tag LOCUS_26220 2951315 2952244 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023382.1 protein_id gnl|my_center|LOCUS_26220 2952255 2953127 gene locus_tag LOCUS_26230 gene nikC 2952255 2953127 CDS product nickel ABC transporter permease subunit NikC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023381.1 protein_id gnl|my_center|LOCUS_26230 2953111 2953923 gene locus_tag LOCUS_26240 gene nikD 2953111 2953923 CDS product nickel import ATP-binding protein NikD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023380.1 protein_id gnl|my_center|LOCUS_26240 2953935 2954900 gene locus_tag LOCUS_26250 2953935 2954900 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065719.1 protein_id gnl|my_center|LOCUS_26250 2954926 2956542 gene locus_tag LOCUS_26260 2954926 2956542 CDS product nickel ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023378.1 protein_id gnl|my_center|LOCUS_26260 2956554 2957312 gene locus_tag LOCUS_26270 2956554 2957312 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065718.1 protein_id gnl|my_center|LOCUS_26270 2958130 2960898 gene locus_tag LOCUS_26280 2958130 2960898 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022429.1 protein_id gnl|my_center|LOCUS_26280 2961278 2961048 gene locus_tag LOCUS_26290 2961278 2961048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 2962717 2961281 gene locus_tag LOCUS_26300 2962717 2961281 CDS product lamin tail domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904188.1 protein_id gnl|my_center|LOCUS_26300 2963191 2964627 gene locus_tag LOCUS_26310 2963191 2964627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 2965044 2965634 gene locus_tag LOCUS_26320 2965044 2965634 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172525.1 protein_id gnl|my_center|LOCUS_26320 2965997 2967301 gene locus_tag LOCUS_26330 gene frhA 2965997 2967301 CDS product coenzyme F420 hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990767.1 protein_id gnl|my_center|LOCUS_26330 2967307 2967786 gene locus_tag LOCUS_26340 gene frhD 2967307 2967786 CDS product coenzyme F420-reducing hydrogenase, FrhD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021013.1 protein_id gnl|my_center|LOCUS_26340 2967773 2968579 gene locus_tag LOCUS_26350 gene frhG 2967773 2968579 CDS product coenzyme F420 hydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065016.1 protein_id gnl|my_center|LOCUS_26350 2968590 2969465 gene locus_tag LOCUS_26360 gene frhB 2968590 2969465 CDS product coenzyme F420 hydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021015.1 protein_id gnl|my_center|LOCUS_26360 2969752 2970213 gene locus_tag LOCUS_26370 2969752 2970213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 2971384 2970257 gene locus_tag LOCUS_26380 2971384 2970257 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085095815.1 protein_id gnl|my_center|LOCUS_26380 2971475 2974720 gene locus_tag LOCUS_26390 2971475 2974720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 2976132 2975536 gene locus_tag LOCUS_26400 2976132 2975536 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941226.1 protein_id gnl|my_center|LOCUS_26400 2976863 2977066 gene locus_tag LOCUS_26410 2976863 2977066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065018.1 protein_id gnl|my_center|LOCUS_26410 2977063 2977488 gene locus_tag LOCUS_26420 2977063 2977488 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065019.1 protein_id gnl|my_center|LOCUS_26420 2977800 2977585 gene locus_tag LOCUS_26430 2977800 2977585 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065020.1 protein_id gnl|my_center|LOCUS_26430 2978416 2978174 gene locus_tag LOCUS_26440 2978416 2978174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 2978778 2978533 gene locus_tag LOCUS_26450 2978778 2978533 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_26450 2979349 2980542 gene locus_tag LOCUS_26460 2979349 2980542 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391224.1 protein_id gnl|my_center|LOCUS_26460 2981128 2981505 gene locus_tag LOCUS_26470 2981128 2981505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 2981606 2981818 gene locus_tag LOCUS_26480 2981606 2981818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048140246.1 protein_id gnl|my_center|LOCUS_26480 2982457 2981909 gene locus_tag LOCUS_26490 2982457 2981909 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065022.1 protein_id gnl|my_center|LOCUS_26490 2982777 2983937 gene locus_tag LOCUS_26500 gene nagA 2982777 2983937 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271133.1 protein_id gnl|my_center|LOCUS_26500 2984052 2985014 gene locus_tag LOCUS_26510 2984052 2985014 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256476.1 protein_id gnl|my_center|LOCUS_26510 2985838 2986329 gene locus_tag LOCUS_26520 2985838 2986329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 2986771 2987910 gene locus_tag LOCUS_26530 2986771 2987910 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861550.1 protein_id gnl|my_center|LOCUS_26530 2989286 2988186 gene locus_tag LOCUS_26540 2989286 2988186 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021039.1 protein_id gnl|my_center|LOCUS_26540 2989706 2989942 gene locus_tag LOCUS_26550 2989706 2989942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26550 2990456 2991703 gene locus_tag LOCUS_26560 gene prf1 2990456 2991703 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021044.1 protein_id gnl|my_center|LOCUS_26560 2992532 2991810 gene locus_tag LOCUS_26570 2992532 2991810 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021027.1 protein_id gnl|my_center|LOCUS_26570 2993181 2994221 gene locus_tag LOCUS_26580 2993181 2994221 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022353.1 protein_id gnl|my_center|LOCUS_26580 2994806 2995219 gene locus_tag LOCUS_26590 2994806 2995219 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021041.1 protein_id gnl|my_center|LOCUS_26590 2995246 2995440 gene locus_tag LOCUS_26600 2995246 2995440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 2995419 2996735 gene locus_tag LOCUS_26610 2995419 2996735 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021042.1 protein_id gnl|my_center|LOCUS_26610 2996738 2997781 gene locus_tag LOCUS_26620 gene cydB 2996738 2997781 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021043.1 protein_id gnl|my_center|LOCUS_26620 3001538 2998026 gene locus_tag LOCUS_26630 3001538 2998026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 3002570 3002178 gene locus_tag LOCUS_26640 3002570 3002178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 3002921 3003223 gene locus_tag LOCUS_26650 3002921 3003223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26650 3005279 3004761 gene locus_tag LOCUS_26660 3005279 3004761 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229426.1 protein_id gnl|my_center|LOCUS_26660 3006139 3005387 gene locus_tag LOCUS_26670 3006139 3005387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 3006564 3007373 gene locus_tag LOCUS_26680 3006564 3007373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 3008326 3007649 gene locus_tag LOCUS_26690 3008326 3007649 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990622.1 protein_id gnl|my_center|LOCUS_26690 3009296 3008499 gene locus_tag LOCUS_26700 3009296 3008499 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065502.1 protein_id gnl|my_center|LOCUS_26700 3010432 3009665 gene locus_tag LOCUS_26710 3010432 3009665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065503.1 protein_id gnl|my_center|LOCUS_26710 3012364 3010877 gene locus_tag LOCUS_26720 3012364 3010877 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065504.1 protein_id gnl|my_center|LOCUS_26720 3013536 3013883 gene locus_tag LOCUS_26730 3013536 3013883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26730 3013886 3014188 gene locus_tag LOCUS_26740 3013886 3014188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26740 3015632 3014628 gene locus_tag LOCUS_26750 gene ala 3015632 3014628 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023186.1 protein_id gnl|my_center|LOCUS_26750 3015832 3016533 gene locus_tag LOCUS_26760 3015832 3016533 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023187.1 protein_id gnl|my_center|LOCUS_26760 3016624 3017250 gene locus_tag LOCUS_26770 3016624 3017250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 3018438 3017386 gene locus_tag LOCUS_26780 3018438 3017386 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065648.1 protein_id gnl|my_center|LOCUS_26780 3019324 3018935 gene locus_tag LOCUS_26790 3019324 3018935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023192.1 protein_id gnl|my_center|LOCUS_26790 3019699 3020493 gene locus_tag LOCUS_26800 3019699 3020493 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860293.1 protein_id gnl|my_center|LOCUS_26800 3022039 3020852 gene locus_tag LOCUS_26810 3022039 3020852 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023194.1 protein_id gnl|my_center|LOCUS_26810 3022871 3023275 gene locus_tag LOCUS_26820 gene fxsA 3022871 3023275 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023195.1 protein_id gnl|my_center|LOCUS_26820 3023955 3023383 gene locus_tag LOCUS_26830 3023955 3023383 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990639.1 protein_id gnl|my_center|LOCUS_26830 3024003 3025193 gene locus_tag LOCUS_26840 gene nifS 3024003 3025193 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065651.1 protein_id gnl|my_center|LOCUS_26840 3025224 3025613 gene locus_tag LOCUS_26850 gene nifU 3025224 3025613 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023199.1 protein_id gnl|my_center|LOCUS_26850 3025767 3026819 gene locus_tag LOCUS_26860 gene mptN 3025767 3026819 CDS product tetrahydromethanopterin:alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023202.1 protein_id gnl|my_center|LOCUS_26860 3027099 3027446 gene locus_tag LOCUS_26870 gene pth2 3027099 3027446 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023203.1 protein_id gnl|my_center|LOCUS_26870 3027566 3028807 gene locus_tag LOCUS_26880 3027566 3028807 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065654.1 protein_id gnl|my_center|LOCUS_26880 3029052 3030368 gene locus_tag LOCUS_26890 gene truD 3029052 3030368 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_26890 3032312 3030504 gene locus_tag LOCUS_26900 3032312 3030504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 3033829 3032561 gene locus_tag LOCUS_26910 3033829 3032561 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065659.1 protein_id gnl|my_center|LOCUS_26910 3034399 3033920 gene locus_tag LOCUS_26920 3034399 3033920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065660.1 protein_id gnl|my_center|LOCUS_26920 3034643 3035143 gene locus_tag LOCUS_26930 3034643 3035143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023210.1 protein_id gnl|my_center|LOCUS_26930 3035347 3035583 gene locus_tag LOCUS_26940 3035347 3035583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 3036380 3035793 gene locus_tag LOCUS_26950 3036380 3035793 CDS product DUF4013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023211.1 protein_id gnl|my_center|LOCUS_26950 3036983 3036846 gene locus_tag LOCUS_26960 3036983 3036846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 3037740 3037483 gene locus_tag LOCUS_26970 3037740 3037483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 3038008 3037874 gene locus_tag LOCUS_26980 3038008 3037874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 3039883 3038270 gene locus_tag LOCUS_26990 gene pyrG 3039883 3038270 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023212.1 protein_id gnl|my_center|LOCUS_26990 3041020 3040259 gene locus_tag LOCUS_27000 3041020 3040259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023213.1 protein_id gnl|my_center|LOCUS_27000 3041217 3041035 gene locus_tag LOCUS_27010 3041217 3041035 CDS product methytransferase partner Trm112 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023214.1 protein_id gnl|my_center|LOCUS_27010 3041765 3043639 gene locus_tag LOCUS_27020 gene cooS 3041765 3043639 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_27020 3043655 3044197 gene locus_tag LOCUS_27030 3043655 3044197 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023216.1 protein_id gnl|my_center|LOCUS_27030 3045210 3044548 gene locus_tag LOCUS_27040 3045210 3044548 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021991.1 protein_id gnl|my_center|LOCUS_27040 3046152 3045955 gene locus_tag LOCUS_27050 3046152 3045955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 3046294 3046097 gene locus_tag LOCUS_27060 3046294 3046097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 3046445 3046849 gene locus_tag LOCUS_27070 3046445 3046849 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022524.1 protein_id gnl|my_center|LOCUS_27070 3047251 3047460 gene locus_tag LOCUS_27080 3047251 3047460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022523.1 protein_id gnl|my_center|LOCUS_27080 3048080 3050233 gene locus_tag LOCUS_27090 3048080 3050233 CDS product CHASE4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990595.1 protein_id gnl|my_center|LOCUS_27090 3050866 3050303 gene locus_tag LOCUS_27100 3050866 3050303 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022520.1 protein_id gnl|my_center|LOCUS_27100 3051817 3053949 gene locus_tag LOCUS_27110 3051817 3053949 CDS product CHASE4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066374.1 protein_id gnl|my_center|LOCUS_27110 3055206 3054019 gene locus_tag LOCUS_27120 3055206 3054019 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022518.1 protein_id gnl|my_center|LOCUS_27120 3056666 3055425 gene locus_tag LOCUS_27130 3056666 3055425 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022516.1 protein_id gnl|my_center|LOCUS_27130 3058117 3056702 gene locus_tag LOCUS_27140 3058117 3056702 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021144.1 protein_id gnl|my_center|LOCUS_27140 3059050 3058127 gene locus_tag LOCUS_27150 3059050 3058127 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021145.1 protein_id gnl|my_center|LOCUS_27150 3060820 3061101 gene locus_tag LOCUS_27160 3060820 3061101 CDS product DUF4405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022513.1 protein_id gnl|my_center|LOCUS_27160 3062467 3061193 gene locus_tag LOCUS_27170 3062467 3061193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022512.1 protein_id gnl|my_center|LOCUS_27170 3063664 3062564 gene locus_tag LOCUS_27180 3063664 3062564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990594.1 protein_id gnl|my_center|LOCUS_27180 3064194 3063778 gene locus_tag LOCUS_27190 3064194 3063778 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065435.1 protein_id gnl|my_center|LOCUS_27190 3064405 3064187 gene locus_tag LOCUS_27200 3064405 3064187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 3065295 3066266 gene locus_tag LOCUS_27210 3065295 3066266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065434.1 protein_id gnl|my_center|LOCUS_27210 3066662 3067312 gene locus_tag LOCUS_27220 3066662 3067312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022508.1 protein_id gnl|my_center|LOCUS_27220 3067573 3068913 gene locus_tag LOCUS_27230 3067573 3068913 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860226.1 protein_id gnl|my_center|LOCUS_27230 3070359 3068953 gene locus_tag LOCUS_27240 3070359 3068953 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022506.1 protein_id gnl|my_center|LOCUS_27240 3072276 3072770 gene locus_tag LOCUS_27250 3072276 3072770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 3072878 3073570 gene locus_tag LOCUS_27260 3072878 3073570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990583.1 protein_id gnl|my_center|LOCUS_27260 3074226 3075260 gene locus_tag LOCUS_27270 3074226 3075260 CDS product UPF0228 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755937.1 protein_id gnl|my_center|LOCUS_27270 3075993 3076430 gene locus_tag LOCUS_27280 3075993 3076430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 3078050 3076497 gene locus_tag LOCUS_27290 gene gpmI 3078050 3076497 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065873.1 protein_id gnl|my_center|LOCUS_27290 3080676 3078262 gene locus_tag LOCUS_27300 gene ppsA 3080676 3078262 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022627.1 protein_id gnl|my_center|LOCUS_27300 3082310 3080937 gene locus_tag LOCUS_27310 gene glmM 3082310 3080937 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065480.1 protein_id gnl|my_center|LOCUS_27310 3083589 3082582 gene locus_tag LOCUS_27320 3083589 3082582 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021053.1 protein_id gnl|my_center|LOCUS_27320 3085544 3084306 gene locus_tag LOCUS_27330 gene pgk 3085544 3084306 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022629.1 protein_id gnl|my_center|LOCUS_27330 3086926 3085727 gene locus_tag LOCUS_27340 3086926 3085727 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021054.1 protein_id gnl|my_center|LOCUS_27340 3087355 3088419 gene locus_tag LOCUS_27350 3087355 3088419 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022353.1 protein_id gnl|my_center|LOCUS_27350 3088645 3090021 gene locus_tag LOCUS_27360 3088645 3090021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 3090616 3091212 gene locus_tag LOCUS_27370 3090616 3091212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 3091423 3092037 gene locus_tag LOCUS_27380 3091423 3092037 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022020.1 protein_id gnl|my_center|LOCUS_27380 3092342 3092665 gene locus_tag LOCUS_27390 3092342 3092665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 3092662 3093390 gene locus_tag LOCUS_27400 3092662 3093390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 3093387 3094343 gene locus_tag LOCUS_27410 3093387 3094343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 3094402 3094590 gene locus_tag LOCUS_27420 3094402 3094590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 3094583 3094801 gene locus_tag LOCUS_27430 3094583 3094801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 3094788 3096038 gene locus_tag LOCUS_27440 3094788 3096038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 3096111 3096572 gene locus_tag LOCUS_27450 3096111 3096572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 3096615 3097256 gene locus_tag LOCUS_27460 3096615 3097256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 3097253 3098725 gene locus_tag LOCUS_27470 3097253 3098725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 3098737 3099636 gene locus_tag LOCUS_27480 3098737 3099636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 3099649 3100923 gene locus_tag LOCUS_27490 3099649 3100923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 3101325 3101483 gene locus_tag LOCUS_27500 3101325 3101483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 3101484 3101765 gene locus_tag LOCUS_27510 3101484 3101765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 3101776 3101997 gene locus_tag LOCUS_27520 3101776 3101997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 3102047 3104113 gene locus_tag LOCUS_27530 3102047 3104113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 3104485 3104306 gene locus_tag LOCUS_27540 3104485 3104306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 3104794 3104994 gene locus_tag LOCUS_27550 3104794 3104994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 3105521 3106264 gene locus_tag LOCUS_27560 3105521 3106264 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022504.1 protein_id gnl|my_center|LOCUS_27560 3106827 3108425 gene locus_tag LOCUS_27570 3106827 3108425 CDS product TolB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022503.1 protein_id gnl|my_center|LOCUS_27570 3109752 3108547 gene locus_tag LOCUS_27580 gene pncB 3109752 3108547 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022501.1 protein_id gnl|my_center|LOCUS_27580 3110006 3111190 gene locus_tag LOCUS_27590 3110006 3111190 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022500.1 protein_id gnl|my_center|LOCUS_27590 3111338 3111838 gene locus_tag LOCUS_27600 3111338 3111838 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022499.1 protein_id gnl|my_center|LOCUS_27600 3112301 3112077 gene locus_tag LOCUS_27610 3112301 3112077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022495.1 protein_id gnl|my_center|LOCUS_27610 3112695 3113822 gene locus_tag LOCUS_27620 3112695 3113822 CDS product serine/threonine-protein kinase RIO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022486.1 protein_id gnl|my_center|LOCUS_27620 3114042 3113905 gene locus_tag LOCUS_27630 3114042 3113905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 3117035 3114039 gene locus_tag LOCUS_27640 3117035 3114039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 3117363 3119357 gene locus_tag LOCUS_27650 3117363 3119357 CDS product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990592.1 protein_id gnl|my_center|LOCUS_27650 3119617 3119378 gene locus_tag LOCUS_27660 3119617 3119378 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104925.1 protein_id gnl|my_center|LOCUS_27660 3120277 3120002 gene locus_tag LOCUS_27670 3120277 3120002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 3120716 3120270 gene locus_tag LOCUS_27680 3120716 3120270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 3122039 3121269 gene locus_tag LOCUS_27690 3122039 3121269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 3124118 3123537 gene locus_tag LOCUS_27700 3124118 3123537 CDS product DUF2148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022484.1 protein_id gnl|my_center|LOCUS_27700 3124703 3124954 gene locus_tag LOCUS_27710 3124703 3124954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27710 3124966 3125451 gene locus_tag LOCUS_27720 3124966 3125451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27720 3126878 3125628 gene locus_tag LOCUS_27730 3126878 3125628 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022483.1 protein_id gnl|my_center|LOCUS_27730 3130652 3127320 gene locus_tag LOCUS_27740 3130652 3127320 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022778.1 protein_id gnl|my_center|LOCUS_27740 3131300 3132115 gene locus_tag LOCUS_27750 3131300 3132115 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065531.1 protein_id gnl|my_center|LOCUS_27750 3133226 3132306 gene locus_tag LOCUS_27760 3133226 3132306 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022780.1 protein_id gnl|my_center|LOCUS_27760 3134038 3135645 gene locus_tag LOCUS_27770 3134038 3135645 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022533.1 protein_id gnl|my_center|LOCUS_27770 3136019 3137029 gene locus_tag LOCUS_27780 3136019 3137029 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065440.1 protein_id gnl|my_center|LOCUS_27780 3137004 3137633 gene locus_tag LOCUS_27790 gene engB 3137004 3137633 CDS product GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022535.1 protein_id gnl|my_center|LOCUS_27790 3139440 3137734 gene locus_tag LOCUS_27800 3139440 3137734 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022536.1 protein_id gnl|my_center|LOCUS_27800 3140523 3139525 gene locus_tag LOCUS_27810 3140523 3139525 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022537.1 protein_id gnl|my_center|LOCUS_27810 3141048 3140545 gene locus_tag LOCUS_27820 3141048 3140545 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065441.1 protein_id gnl|my_center|LOCUS_27820 3142455 3141379 gene locus_tag LOCUS_27830 3142455 3141379 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990596.1 protein_id gnl|my_center|LOCUS_27830 3142671 3143744 gene locus_tag LOCUS_27840 3142671 3143744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022540.1 protein_id gnl|my_center|LOCUS_27840 3143847 3144107 gene locus_tag LOCUS_27850 3143847 3144107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022541.1 protein_id gnl|my_center|LOCUS_27850 3144728 3145819 gene locus_tag LOCUS_27860 3144728 3145819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 3145833 3146087 gene locus_tag LOCUS_27870 3145833 3146087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065463.1 protein_id gnl|my_center|LOCUS_27870 3146446 3146120 gene locus_tag LOCUS_27880 3146446 3146120 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065462.1 protein_id gnl|my_center|LOCUS_27880 3147624 3147475 gene locus_tag LOCUS_27890 3147624 3147475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27890 3147917 3147621 gene locus_tag LOCUS_27900 3147917 3147621 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066199.1 protein_id gnl|my_center|LOCUS_27900 3149306 3148077 gene locus_tag LOCUS_27910 3149306 3148077 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023091.1 protein_id gnl|my_center|LOCUS_27910 3149816 3150571 gene locus_tag LOCUS_27920 3149816 3150571 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250907.1 protein_id gnl|my_center|LOCUS_27920 3151043 3150858 gene locus_tag LOCUS_27930 3151043 3150858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 3152282 3153574 gene locus_tag LOCUS_27940 3152282 3153574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 3153941 3154162 gene locus_tag LOCUS_27950 3153941 3154162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021736.1 protein_id gnl|my_center|LOCUS_27950 3154769 3154933 gene locus_tag LOCUS_27960 3154769 3154933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 3155249 3155103 gene locus_tag LOCUS_27970 3155249 3155103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 3155749 3157635 gene locus_tag LOCUS_27980 gene iorA 3155749 3157635 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021731.1 protein_id gnl|my_center|LOCUS_27980 3157632 3158309 gene locus_tag LOCUS_27990 3157632 3158309 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392451.1 protein_id gnl|my_center|LOCUS_27990 3158302 3159609 gene locus_tag LOCUS_28000 3158302 3159609 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021729.1 protein_id gnl|my_center|LOCUS_28000 3160984 3159830 gene locus_tag LOCUS_28010 3160984 3159830 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755895.1 protein_id gnl|my_center|LOCUS_28010 3164045 3161298 gene locus_tag LOCUS_28020 3164045 3161298 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021727.1 protein_id gnl|my_center|LOCUS_28020 3165713 3164793 gene locus_tag LOCUS_28030 3165713 3164793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065193.1 protein_id gnl|my_center|LOCUS_28030 3166013 3167083 gene locus_tag LOCUS_28040 gene corA 3166013 3167083 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021725.1 protein_id gnl|my_center|LOCUS_28040 3167264 3168007 gene locus_tag LOCUS_28050 3167264 3168007 CDS product DUF432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021723.1 protein_id gnl|my_center|LOCUS_28050 3168004 3168918 gene locus_tag LOCUS_28060 3168004 3168918 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990806.1 protein_id gnl|my_center|LOCUS_28060 3169732 3169133 gene locus_tag LOCUS_28070 3169732 3169133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 3170019 3176273 gene locus_tag LOCUS_28080 3170019 3176273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 3176937 3176635 gene locus_tag LOCUS_28090 3176937 3176635 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021717.1 protein_id gnl|my_center|LOCUS_28090 3178763 3176937 gene locus_tag LOCUS_28100 3178763 3176937 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066253.1 protein_id gnl|my_center|LOCUS_28100 3181861 3179204 gene locus_tag LOCUS_28110 3181861 3179204 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065170.1 protein_id gnl|my_center|LOCUS_28110 3182973 3182212 gene locus_tag LOCUS_28120 3182973 3182212 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021719.1 protein_id gnl|my_center|LOCUS_28120 3184703 3183546 gene locus_tag LOCUS_28130 3184703 3183546 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065191.1 protein_id gnl|my_center|LOCUS_28130 3184884 3185204 gene locus_tag LOCUS_28140 3184884 3185204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065190.1 protein_id gnl|my_center|LOCUS_28140 3185376 3185945 gene locus_tag LOCUS_28150 3185376 3185945 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948983.1 protein_id gnl|my_center|LOCUS_28150 3186515 3186048 gene locus_tag LOCUS_28160 3186515 3186048 CDS product DUF2124 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021715.1 protein_id gnl|my_center|LOCUS_28160 3187890 3186925 gene locus_tag LOCUS_28170 gene mch 3187890 3186925 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021714.1 protein_id gnl|my_center|LOCUS_28170 3189464 3188268 gene locus_tag LOCUS_28180 3189464 3188268 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066252.1 protein_id gnl|my_center|LOCUS_28180 3191327 3191052 gene locus_tag LOCUS_28190 3191327 3191052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 3192283 3191858 gene locus_tag LOCUS_28200 3192283 3191858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021710.1 protein_id gnl|my_center|LOCUS_28200 3192893 3192654 gene locus_tag LOCUS_28210 3192893 3192654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 3193195 3194490 gene locus_tag LOCUS_28220 3193195 3194490 CDS product histidine kinase dimerization/phosphoacceptor domain -containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990804.1 protein_id gnl|my_center|LOCUS_28220 3195116 3194910 gene locus_tag LOCUS_28230 3195116 3194910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 3196341 3196667 gene locus_tag LOCUS_28240 3196341 3196667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 3196700 3197647 gene locus_tag LOCUS_28250 3196700 3197647 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860263.1 protein_id gnl|my_center|LOCUS_28250 3198870 3199250 gene locus_tag LOCUS_28260 3198870 3199250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065456.1 protein_id gnl|my_center|LOCUS_28260 3199373 3199915 gene locus_tag LOCUS_28270 3199373 3199915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 3200931 3200368 gene locus_tag LOCUS_28280 3200931 3200368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 3201028 3201546 gene locus_tag LOCUS_28290 3201028 3201546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 3201697 3202053 gene locus_tag LOCUS_28300 3201697 3202053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 3203074 3203217 gene locus_tag LOCUS_28310 3203074 3203217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 3203447 3204055 gene locus_tag LOCUS_28320 3203447 3204055 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022020.1 protein_id gnl|my_center|LOCUS_28320 3204768 3205064 gene locus_tag LOCUS_28330 3204768 3205064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 3205079 3205456 gene locus_tag LOCUS_28340 3205079 3205456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 3205525 3207540 gene locus_tag LOCUS_28350 3205525 3207540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 3207537 3208493 gene locus_tag LOCUS_28360 3207537 3208493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 3208503 3209021 gene locus_tag LOCUS_28370 3208503 3209021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 3209194 3209508 gene locus_tag LOCUS_28380 3209194 3209508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 3209483 3209890 gene locus_tag LOCUS_28390 3209483 3209890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 3209895 3210044 gene locus_tag LOCUS_28400 3209895 3210044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 3210288 3211067 gene locus_tag LOCUS_28410 3210288 3211067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 3211137 3211505 gene locus_tag LOCUS_28420 3211137 3211505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 3211529 3212473 gene locus_tag LOCUS_28430 3211529 3212473 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860263.1 protein_id gnl|my_center|LOCUS_28430 3212602 3212748 gene locus_tag LOCUS_28440 3212602 3212748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 3212751 3213287 gene locus_tag LOCUS_28450 3212751 3213287 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982260.1 protein_id gnl|my_center|LOCUS_28450 3214067 3214252 gene locus_tag LOCUS_28460 3214067 3214252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 3214249 3214389 gene locus_tag LOCUS_28470 3214249 3214389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 3214798 3215094 gene locus_tag LOCUS_28480 3214798 3215094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 3215107 3215493 gene locus_tag LOCUS_28490 3215107 3215493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065456.1 protein_id gnl|my_center|LOCUS_28490 3215493 3215669 gene locus_tag LOCUS_28500 3215493 3215669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 3217688 3217846 gene locus_tag LOCUS_28510 3217688 3217846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 3217853 3217972 gene locus_tag LOCUS_28520 3217853 3217972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 3217977 3218219 gene locus_tag LOCUS_28530 3217977 3218219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 3218226 3218588 gene locus_tag LOCUS_28540 3218226 3218588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 3218860 3219021 gene locus_tag LOCUS_28550 3218860 3219021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 3219018 3219215 gene locus_tag LOCUS_28560 3219018 3219215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 3219212 3219748 gene locus_tag LOCUS_28570 3219212 3219748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 3220956 3220036 gene locus_tag LOCUS_28580 3220956 3220036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021570.1 protein_id gnl|my_center|LOCUS_28580 3221471 3220953 gene locus_tag LOCUS_28590 3221471 3220953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 3221569 3221934 gene locus_tag LOCUS_28600 3221569 3221934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 3221953 3222267 gene locus_tag LOCUS_28610 3221953 3222267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 3222428 3222616 gene locus_tag LOCUS_28620 3222428 3222616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 3222588 3223040 gene locus_tag LOCUS_28630 3222588 3223040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 3223040 3223981 gene locus_tag LOCUS_28640 3223040 3223981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 3223981 3224724 gene locus_tag LOCUS_28650 3223981 3224724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 3224739 3224987 gene locus_tag LOCUS_28660 3224739 3224987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 3224992 3227289 gene locus_tag LOCUS_28670 3224992 3227289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 3227322 3227672 gene locus_tag LOCUS_28680 3227322 3227672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 3227675 3228115 gene locus_tag LOCUS_28690 3227675 3228115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 3228254 3228379 gene locus_tag LOCUS_28700 3228254 3228379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 3228382 3230118 gene locus_tag LOCUS_28710 3228382 3230118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 3230257 3231201 gene locus_tag LOCUS_28720 3230257 3231201 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860263.1 protein_id gnl|my_center|LOCUS_28720 3231505 3231209 gene locus_tag LOCUS_28730 3231505 3231209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065527.1 protein_id gnl|my_center|LOCUS_28730 3231725 3231640 gene locus_tag LOCUS_t00390 3231725 3231640 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3232618 3231875 gene locus_tag LOCUS_28740 3232618 3231875 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022767.1 protein_id gnl|my_center|LOCUS_28740 3233328 3233750 gene locus_tag LOCUS_28750 gene nikR 3233328 3233750 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022768.1 protein_id gnl|my_center|LOCUS_28750 3234004 3234516 gene locus_tag LOCUS_28760 3234004 3234516 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022769.1 protein_id gnl|my_center|LOCUS_28760 3234772 3235404 gene locus_tag LOCUS_28770 3234772 3235404 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990615.1 protein_id gnl|my_center|LOCUS_28770 3235612 3236856 gene locus_tag LOCUS_28780 3235612 3236856 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022771.1 protein_id gnl|my_center|LOCUS_28780 3237291 3236962 gene locus_tag LOCUS_28790 3237291 3236962 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022772.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28790 3237612 3239021 gene locus_tag LOCUS_28800 3237612 3239021 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022789.1 protein_id gnl|my_center|LOCUS_28800 3239147 3240442 gene locus_tag LOCUS_28810 3239147 3240442 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065539.1 protein_id gnl|my_center|LOCUS_28810 3240493 3241698 gene locus_tag LOCUS_28820 3240493 3241698 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022791.1 protein_id gnl|my_center|LOCUS_28820 3241676 3242482 gene locus_tag LOCUS_28830 3241676 3242482 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755943.1 protein_id gnl|my_center|LOCUS_28830 3243051 3243917 gene locus_tag LOCUS_28840 3243051 3243917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022793.1 protein_id gnl|my_center|LOCUS_28840 3243992 3244993 gene locus_tag LOCUS_28850 3243992 3244993 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065541.1 protein_id gnl|my_center|LOCUS_28850 3245034 3245915 gene locus_tag LOCUS_28860 3245034 3245915 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066417.1 protein_id gnl|my_center|LOCUS_28860 3245924 3247810 gene locus_tag LOCUS_28870 3245924 3247810 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066418.1 protein_id gnl|my_center|LOCUS_28870 3247807 3250386 gene locus_tag LOCUS_28880 3247807 3250386 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022797.1 protein_id gnl|my_center|LOCUS_28880 3251325 3250969 gene locus_tag LOCUS_28890 3251325 3250969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048125578.1 protein_id gnl|my_center|LOCUS_28890 3252405 3252208 gene locus_tag LOCUS_28900 3252405 3252208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065096.1 protein_id gnl|my_center|LOCUS_28900 3253568 3252642 gene locus_tag LOCUS_28910 3253568 3252642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 3254198 3254013 gene locus_tag LOCUS_28920 3254198 3254013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065691.1 protein_id gnl|my_center|LOCUS_28920 3254696 3254391 gene locus_tag LOCUS_28930 3254696 3254391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065690.1 protein_id gnl|my_center|LOCUS_28930 3257773 3254768 gene locus_tag LOCUS_28940 3257773 3254768 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065689.1 protein_id gnl|my_center|LOCUS_28940 3258253 3257897 gene locus_tag LOCUS_28950 3258253 3257897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 3258432 3258187 gene locus_tag LOCUS_28960 3258432 3258187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 3258834 3259019 gene locus_tag LOCUS_28970 3258834 3259019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 3260612 3259389 gene locus_tag LOCUS_28980 3260612 3259389 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023315.1 protein_id gnl|my_center|LOCUS_28980 3261014 3262252 gene locus_tag LOCUS_28990 3261014 3262252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023314.1 protein_id gnl|my_center|LOCUS_28990 3262622 3262960 gene locus_tag LOCUS_29000 3262622 3262960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048140599.1 protein_id gnl|my_center|LOCUS_29000 3263545 3263081 gene locus_tag LOCUS_29010 gene tnpA 3263545 3263081 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979974.1 protein_id gnl|my_center|LOCUS_29010 3264689 3263799 gene locus_tag LOCUS_29020 3264689 3263799 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048140605.1 protein_id gnl|my_center|LOCUS_29020 3265426 3264839 gene locus_tag LOCUS_29030 3265426 3264839 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022276.1 protein_id gnl|my_center|LOCUS_29030 3266397 3266573 gene locus_tag LOCUS_29040 3266397 3266573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 3266675 3268093 gene locus_tag LOCUS_29050 3266675 3268093 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021144.1 protein_id gnl|my_center|LOCUS_29050 3268074 3269357 gene locus_tag LOCUS_29060 3268074 3269357 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021143.1 protein_id gnl|my_center|LOCUS_29060 3269871 3271103 gene locus_tag LOCUS_29070 3269871 3271103 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021143.1 protein_id gnl|my_center|LOCUS_29070 3271972 3271295 gene locus_tag LOCUS_29080 3271972 3271295 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021737.1 protein_id gnl|my_center|LOCUS_29080 3272165 3272413 gene locus_tag LOCUS_29090 3272165 3272413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021738.1 protein_id gnl|my_center|LOCUS_29090 3273140 3272985 gene locus_tag LOCUS_29100 3273140 3272985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 3274556 3273246 gene locus_tag LOCUS_29110 3274556 3273246 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021739.1 protein_id gnl|my_center|LOCUS_29110 3274756 3275151 gene locus_tag LOCUS_29120 3274756 3275151 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066255.1 protein_id gnl|my_center|LOCUS_29120 3275519 3275692 gene locus_tag LOCUS_29130 3275519 3275692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162829679.1 protein_id gnl|my_center|LOCUS_29130 3278675 3276516 gene locus_tag LOCUS_29140 3278675 3276516 CDS product CHASE4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065198.1 protein_id gnl|my_center|LOCUS_29140 3279294 3279022 gene locus_tag LOCUS_29150 3279294 3279022 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021744.1 protein_id gnl|my_center|LOCUS_29150 3279802 3279434 gene locus_tag LOCUS_29160 3279802 3279434 CDS product rRNA maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021745.1 protein_id gnl|my_center|LOCUS_29160 3281559 3281768 gene locus_tag LOCUS_29170 3281559 3281768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860252.1 protein_id gnl|my_center|LOCUS_29170 3282038 3282643 gene locus_tag LOCUS_29180 3282038 3282643 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065212.1 protein_id gnl|my_center|LOCUS_29180 3283305 3283168 gene locus_tag LOCUS_29190 3283305 3283168 CDS product DNA-directed RNA polymerase subunit P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021777.1 protein_id gnl|my_center|LOCUS_29190 3283619 3283335 gene locus_tag LOCUS_29200 3283619 3283335 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021778.1 protein_id gnl|my_center|LOCUS_29200 3284573 3283782 gene locus_tag LOCUS_29210 gene rrp42 3284573 3283782 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021779.1 protein_id gnl|my_center|LOCUS_29210 3286020 3284566 gene locus_tag LOCUS_29220 3286020 3284566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 3286882 3286100 gene locus_tag LOCUS_29230 gene rrp4 3286882 3286100 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021780.1 protein_id gnl|my_center|LOCUS_29230 3287586 3286894 gene locus_tag LOCUS_29240 3287586 3286894 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021781.1 protein_id gnl|my_center|LOCUS_29240 3288414 3287665 gene locus_tag LOCUS_29250 gene psmA 3288414 3287665 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_29250 3290017 3289667 gene locus_tag LOCUS_29260 3290017 3289667 CDS product Rpp14/Pop5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021784.1 protein_id gnl|my_center|LOCUS_29260 3290733 3290014 gene locus_tag LOCUS_29270 3290733 3290014 CDS product ribonuclease P protein component 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021785.1 protein_id gnl|my_center|LOCUS_29270 3291169 3290726 gene locus_tag LOCUS_29280 3291169 3290726 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755897.1 protein_id gnl|my_center|LOCUS_29280 3291756 3291166 gene locus_tag LOCUS_29290 3291756 3291166 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021787.1 protein_id gnl|my_center|LOCUS_29290 3292113 3292640 gene locus_tag LOCUS_29300 3292113 3292640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065215.1 protein_id gnl|my_center|LOCUS_29300 3296085 3292798 gene locus_tag LOCUS_29310 3296085 3292798 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022738.1 protein_id gnl|my_center|LOCUS_29310 3299091 3296518 gene locus_tag LOCUS_29320 3299091 3296518 CDS product MEDS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052730877.1 protein_id gnl|my_center|LOCUS_29320 3299497 3301413 gene locus_tag LOCUS_29330 3299497 3301413 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022623.1 protein_id gnl|my_center|LOCUS_29330 3301656 3303440 gene locus_tag LOCUS_29340 3301656 3303440 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022623.1 protein_id gnl|my_center|LOCUS_29340 3303471 3304019 gene locus_tag LOCUS_29350 3303471 3304019 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_29350 3304453 3307194 gene locus_tag LOCUS_29360 3304453 3307194 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022632.1 protein_id gnl|my_center|LOCUS_29360 3307863 3309332 gene locus_tag LOCUS_29370 3307863 3309332 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066384.1 protein_id gnl|my_center|LOCUS_29370 3310865 3310401 gene locus_tag LOCUS_29380 gene tnpA 3310865 3310401 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979974.1 protein_id gnl|my_center|LOCUS_29380 3312614 3312150 gene locus_tag LOCUS_29390 3312614 3312150 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755987.1 protein_id gnl|my_center|LOCUS_29390 3313140 3312586 gene locus_tag LOCUS_29400 3313140 3312586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 3313567 3314046 gene locus_tag LOCUS_29410 3313567 3314046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158024191.1 protein_id gnl|my_center|LOCUS_29410 3314503 3314757 gene locus_tag LOCUS_29420 3314503 3314757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 3314931 3315203 gene locus_tag LOCUS_29430 3314931 3315203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 3315388 3315888 gene locus_tag LOCUS_29440 3315388 3315888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29440 3316115 3316852 gene locus_tag LOCUS_29450 3316115 3316852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022777.1 protein_id gnl|my_center|LOCUS_29450 3317284 3317057 gene locus_tag LOCUS_29460 3317284 3317057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 3317919 3318098 gene locus_tag LOCUS_29470 3317919 3318098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29470 3319308 3318583 gene locus_tag LOCUS_29480 3319308 3318583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 3320338 3319499 gene locus_tag LOCUS_29490 3320338 3319499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 3320786 3320619 gene locus_tag LOCUS_29500 3320786 3320619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 3321074 3321334 gene locus_tag LOCUS_29510 3321074 3321334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 3321842 3321606 gene locus_tag LOCUS_29520 3321842 3321606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 3322310 3321921 gene locus_tag LOCUS_29530 3322310 3321921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990616.1 protein_id gnl|my_center|LOCUS_29530 3323325 3322588 gene locus_tag LOCUS_29540 3323325 3322588 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023421.1 protein_id gnl|my_center|LOCUS_29540 3323923 3323642 gene locus_tag LOCUS_29550 3323923 3323642 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023420.1 protein_id gnl|my_center|LOCUS_29550 3325202 3326866 gene locus_tag LOCUS_29560 3325202 3326866 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020884.1 protein_id gnl|my_center|LOCUS_29560 3326850 3327704 gene locus_tag LOCUS_29570 3326850 3327704 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064977.1 protein_id gnl|my_center|LOCUS_29570 3327732 3328715 gene locus_tag LOCUS_29580 3327732 3328715 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020886.1 protein_id gnl|my_center|LOCUS_29580 3328712 3329641 gene locus_tag LOCUS_29590 3328712 3329641 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064978.1 protein_id gnl|my_center|LOCUS_29590 3329644 3331365 gene locus_tag LOCUS_29600 3329644 3331365 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020888.1 protein_id gnl|my_center|LOCUS_29600 3331541 3332146 gene locus_tag LOCUS_29610 3331541 3332146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 3332143 3332865 gene locus_tag LOCUS_29620 3332143 3332865 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020890.1 protein_id gnl|my_center|LOCUS_29620 3333106 3335028 gene locus_tag LOCUS_29630 3333106 3335028 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023418.1 protein_id gnl|my_center|LOCUS_29630 3335196 3337193 gene locus_tag LOCUS_29640 3335196 3337193 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023417.1 protein_id gnl|my_center|LOCUS_29640 3337478 3338029 gene locus_tag LOCUS_29650 3337478 3338029 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023416.1 protein_id gnl|my_center|LOCUS_29650 3338267 3338542 gene locus_tag LOCUS_29660 3338267 3338542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 3339118 3338849 gene locus_tag LOCUS_29670 3339118 3338849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 3344882 3339270 gene locus_tag LOCUS_29680 3344882 3339270 CDS product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065729.1 protein_id gnl|my_center|LOCUS_29680 3346558 3345665 gene locus_tag LOCUS_29690 3346558 3345665 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023411.1 protein_id gnl|my_center|LOCUS_29690 3346691 3346870 gene locus_tag LOCUS_29700 3346691 3346870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 3346821 3347036 gene locus_tag LOCUS_29710 3346821 3347036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29710 3347855 3347097 gene locus_tag LOCUS_29720 gene tatC 3347855 3347097 CDS product Sec-independent protein translocase TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023410.1 protein_id gnl|my_center|LOCUS_29720 3348362 3349147 gene locus_tag LOCUS_29730 gene tatC 3348362 3349147 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023409.1 protein_id gnl|my_center|LOCUS_29730 3349311 3349655 gene locus_tag LOCUS_29740 3349311 3349655 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023408.1 protein_id gnl|my_center|LOCUS_29740 3350005 3350319 gene locus_tag LOCUS_29750 3350005 3350319 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990651.1 protein_id gnl|my_center|LOCUS_29750 3350540 3351061 gene locus_tag LOCUS_29760 3350540 3351061 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990650.1 protein_id gnl|my_center|LOCUS_29760 3352249 3351191 gene locus_tag LOCUS_29770 gene amrS 3352249 3351191 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023404.1 protein_id gnl|my_center|LOCUS_29770 3352522 3352770 gene locus_tag LOCUS_29780 3352522 3352770 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023401.1 protein_id gnl|my_center|LOCUS_29780 3352772 3353026 gene locus_tag LOCUS_29790 3352772 3353026 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860313.1 protein_id gnl|my_center|LOCUS_29790 3353019 3355016 gene locus_tag LOCUS_29800 gene feoB 3353019 3355016 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065727.1 protein_id gnl|my_center|LOCUS_29800 3355030 3355470 gene locus_tag LOCUS_29810 3355030 3355470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023398.1 protein_id gnl|my_center|LOCUS_29810 3355521 3355832 gene locus_tag LOCUS_29820 3355521 3355832 CDS product FeoC-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023397.1 protein_id gnl|my_center|LOCUS_29820 3356723 3357208 gene locus_tag LOCUS_29830 3356723 3357208 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023392.1 protein_id gnl|my_center|LOCUS_29830 3358554 3357349 gene locus_tag LOCUS_29840 3358554 3357349 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023391.1 protein_id gnl|my_center|LOCUS_29840 3359484 3358786 gene locus_tag LOCUS_29850 3359484 3358786 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023389.1 protein_id gnl|my_center|LOCUS_29850 3360500 3359472 gene locus_tag LOCUS_29860 3360500 3359472 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065722.1 protein_id gnl|my_center|LOCUS_29860 3361396 3360497 gene locus_tag LOCUS_29870 gene nikC 3361396 3360497 CDS product nickel ABC transporter permease subunit NikC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023387.1 protein_id gnl|my_center|LOCUS_29870 3362321 3361380 gene locus_tag LOCUS_29880 3362321 3361380 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023386.1 protein_id gnl|my_center|LOCUS_29880 3364013 3362439 gene locus_tag LOCUS_29890 3364013 3362439 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065721.1 protein_id gnl|my_center|LOCUS_29890 3367723 3364583 gene locus_tag LOCUS_29900 3367723 3364583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 3368170 3370188 gene locus_tag LOCUS_29910 3368170 3370188 CDS product MASE3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860314.1 protein_id gnl|my_center|LOCUS_29910 3370470 3370769 gene locus_tag LOCUS_29920 3370470 3370769 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065930.1 protein_id gnl|my_center|LOCUS_29920 3371161 3370976 gene locus_tag LOCUS_29930 3371161 3370976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065717.1 protein_id gnl|my_center|LOCUS_29930 3372202 3371438 gene locus_tag LOCUS_29940 3372202 3371438 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065715.1 protein_id gnl|my_center|LOCUS_29940 3373004 3372654 gene locus_tag LOCUS_29950 3373004 3372654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29950 3373357 3372998 gene locus_tag LOCUS_29960 3373357 3372998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29960 3373545 3373907 gene locus_tag LOCUS_29970 3373545 3373907 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023370.1 protein_id gnl|my_center|LOCUS_29970 3375564 3374047 gene locus_tag LOCUS_29980 3375564 3374047 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_29980 3375723 3375902 gene locus_tag LOCUS_29990 3375723 3375902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 3377071 3375962 gene locus_tag LOCUS_30000 3377071 3375962 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023369.1 protein_id gnl|my_center|LOCUS_30000 3378374 3377265 gene locus_tag LOCUS_30010 gene rsgA 3378374 3377265 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023368.1 protein_id gnl|my_center|LOCUS_30010 3378549 3378848 gene locus_tag LOCUS_30020 3378549 3378848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 3378944 3379312 gene locus_tag LOCUS_30030 3378944 3379312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 3380054 3381991 gene locus_tag LOCUS_30040 3380054 3381991 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066516.1 protein_id gnl|my_center|LOCUS_30040 3382785 3382231 gene locus_tag LOCUS_30050 3382785 3382231 CDS product CatA-like O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021707.1 protein_id gnl|my_center|LOCUS_30050 3383111 3383893 gene locus_tag LOCUS_30060 3383111 3383893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020687.1 protein_id gnl|my_center|LOCUS_30060 3384803 3384192 gene locus_tag LOCUS_30070 3384803 3384192 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065188.1 protein_id gnl|my_center|LOCUS_30070 3386048 3385026 gene locus_tag LOCUS_30080 3386048 3385026 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967612.1 protein_id gnl|my_center|LOCUS_30080 3386370 3386975 gene locus_tag LOCUS_30090 3386370 3386975 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687254.1 protein_id gnl|my_center|LOCUS_30090 3387267 3387070 gene locus_tag LOCUS_30100 3387267 3387070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 3387380 3387619 gene locus_tag LOCUS_30110 3387380 3387619 CDS product DUF2683 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162829681.1 protein_id gnl|my_center|LOCUS_30110 3388362 3389162 gene locus_tag LOCUS_30120 3388362 3389162 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942064.1 protein_id gnl|my_center|LOCUS_30120 3389190 3389915 gene locus_tag LOCUS_30130 3389190 3389915 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065512.1 protein_id gnl|my_center|LOCUS_30130 3390467 3390144 gene locus_tag LOCUS_30140 3390467 3390144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 3391589 3390642 gene locus_tag LOCUS_30150 3391589 3390642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 3391925 3391758 gene locus_tag LOCUS_30160 3391925 3391758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 3391858 3392070 gene locus_tag LOCUS_30170 3391858 3392070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 3392860 3392420 gene locus_tag LOCUS_30180 3392860 3392420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021706.1 protein_id gnl|my_center|LOCUS_30180 3394050 3393190 gene locus_tag LOCUS_30190 gene nudC 3394050 3393190 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 protein_id gnl|my_center|LOCUS_30190 3395499 3394321 gene locus_tag LOCUS_30200 3395499 3394321 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240264.1 protein_id gnl|my_center|LOCUS_30200 3396676 3396068 gene locus_tag LOCUS_30210 3396676 3396068 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021454.1 protein_id gnl|my_center|LOCUS_30210 3397099 3396680 gene locus_tag LOCUS_30220 3397099 3396680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 3398383 3397652 gene locus_tag LOCUS_30230 3398383 3397652 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065124.1 protein_id gnl|my_center|LOCUS_30230 3399091 3398738 gene locus_tag LOCUS_30240 3399091 3398738 CDS product RNA polymerase Rpb4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021458.1 protein_id gnl|my_center|LOCUS_30240 3399868 3399575 gene locus_tag LOCUS_30250 3399868 3399575 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021460.1 protein_id gnl|my_center|LOCUS_30250 3401428 3400133 gene locus_tag LOCUS_30260 3401428 3400133 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021461.1 protein_id gnl|my_center|LOCUS_30260 3402151 3401516 gene locus_tag LOCUS_30270 gene trmY 3402151 3401516 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066221.1 protein_id gnl|my_center|LOCUS_30270 3402351 3403007 gene locus_tag LOCUS_30280 3402351 3403007 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021463.1 protein_id gnl|my_center|LOCUS_30280 3403291 3404490 gene locus_tag LOCUS_30290 3403291 3404490 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021464.1 protein_id gnl|my_center|LOCUS_30290 3404969 3405511 gene locus_tag LOCUS_30300 3404969 3405511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065126.1 protein_id gnl|my_center|LOCUS_30300 3405760 3405924 gene locus_tag LOCUS_30310 3405760 3405924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 3405949 3407115 gene locus_tag LOCUS_30320 3405949 3407115 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021469.1 protein_id gnl|my_center|LOCUS_30320 3407239 3407904 gene locus_tag LOCUS_30330 3407239 3407904 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021470.1 protein_id gnl|my_center|LOCUS_30330 3407950 3408645 gene locus_tag LOCUS_30340 3407950 3408645 CDS product DUF2110 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021471.1 protein_id gnl|my_center|LOCUS_30340 3409554 3408814 gene locus_tag LOCUS_30350 3409554 3408814 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021472.1 protein_id gnl|my_center|LOCUS_30350 3409918 3410676 gene locus_tag LOCUS_30360 3409918 3410676 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021474.1 protein_id gnl|my_center|LOCUS_30360 3410679 3410957 gene locus_tag LOCUS_30370 3410679 3410957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021475.1 protein_id gnl|my_center|LOCUS_30370 3411689 3411225 gene locus_tag LOCUS_30380 3411689 3411225 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021476.1 protein_id gnl|my_center|LOCUS_30380 3413890 3412022 gene locus_tag LOCUS_30390 3413890 3412022 CDS product histidine kinase dimerization/phosphoacceptor domain -containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021477.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30390 3414270 3414584 gene locus_tag LOCUS_30400 3414270 3414584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30400 3414970 3414815 gene locus_tag LOCUS_30410 3414970 3414815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 3415152 3415679 gene locus_tag LOCUS_30420 3415152 3415679 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023327.1 protein_id gnl|my_center|LOCUS_30420 3415878 3415729 gene locus_tag LOCUS_30430 3415878 3415729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 3417183 3416419 gene locus_tag LOCUS_30440 3417183 3416419 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023329.1 protein_id gnl|my_center|LOCUS_30440 3419708 3417420 gene locus_tag LOCUS_30450 3419708 3417420 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023330.1 protein_id gnl|my_center|LOCUS_30450 3420724 3420545 gene locus_tag LOCUS_30460 3420724 3420545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 3421124 3422440 gene locus_tag LOCUS_30470 gene thiI 3421124 3422440 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021480.1 protein_id gnl|my_center|LOCUS_30470 3423761 3423348 gene locus_tag LOCUS_30480 3423761 3423348 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021483.1 protein_id gnl|my_center|LOCUS_30480 3427183 3423758 gene locus_tag LOCUS_30490 3427183 3423758 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021484.1 protein_id gnl|my_center|LOCUS_30490 3428392 3432513 gene locus_tag LOCUS_30500 3428392 3432513 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020600.1 protein_id gnl|my_center|LOCUS_30500 3432566 3432495 gene locus_tag LOCUS_t00400 3432566 3432495 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3432901 3432632 gene locus_tag LOCUS_30510 3432901 3432632 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021485.1 protein_id gnl|my_center|LOCUS_30510 3433165 3432995 gene locus_tag LOCUS_30520 3433165 3432995 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021486.1 protein_id gnl|my_center|LOCUS_30520 3434032 3433355 gene locus_tag LOCUS_30530 3434032 3433355 CDS product amino acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021487.1 protein_id gnl|my_center|LOCUS_30530 3435176 3434115 gene locus_tag LOCUS_30540 3435176 3434115 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021488.1 protein_id gnl|my_center|LOCUS_30540 3436160 3435198 gene locus_tag LOCUS_30550 3436160 3435198 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021489.1 protein_id gnl|my_center|LOCUS_30550 3436681 3437127 gene locus_tag LOCUS_30560 3436681 3437127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048125745.1 protein_id gnl|my_center|LOCUS_30560 3437255 3437884 gene locus_tag LOCUS_30570 gene grpE 3437255 3437884 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021491.1 protein_id gnl|my_center|LOCUS_30570 3438277 3440133 gene locus_tag LOCUS_30580 gene dnaK 3438277 3440133 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021492.1 protein_id gnl|my_center|LOCUS_30580 3440242 3441411 gene locus_tag LOCUS_30590 gene dnaJ 3440242 3441411 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021493.1 protein_id gnl|my_center|LOCUS_30590 3441887 3441711 gene locus_tag LOCUS_30600 3441887 3441711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 3441953 3443299 gene locus_tag LOCUS_30610 gene trkA 3441953 3443299 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021494.1 protein_id gnl|my_center|LOCUS_30610 3443316 3444755 gene locus_tag LOCUS_30620 3443316 3444755 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021495.1 protein_id gnl|my_center|LOCUS_30620 3445347 3446690 gene locus_tag LOCUS_30630 gene trkA 3445347 3446690 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021496.1 protein_id gnl|my_center|LOCUS_30630 3446755 3448185 gene locus_tag LOCUS_30640 3446755 3448185 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_30640 3449522 3448299 gene locus_tag LOCUS_30650 3449522 3448299 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021498.1 protein_id gnl|my_center|LOCUS_30650 3449647 3449519 gene locus_tag LOCUS_30660 3449647 3449519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 3450863 3450300 gene locus_tag LOCUS_30670 3450863 3450300 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021501.1 protein_id gnl|my_center|LOCUS_30670 3451956 3451330 gene locus_tag LOCUS_30680 gene cofC 3451956 3451330 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021502.1 protein_id gnl|my_center|LOCUS_30680 3453208 3452054 gene locus_tag LOCUS_30690 gene cofH 3453208 3452054 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021503.1 protein_id gnl|my_center|LOCUS_30690 3454393 3453263 gene locus_tag LOCUS_30700 gene cofH 3454393 3453263 CDS product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021504.1 protein_id gnl|my_center|LOCUS_30700 3455292 3454390 gene locus_tag LOCUS_30710 gene cofG 3455292 3454390 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755891.1 protein_id gnl|my_center|LOCUS_30710 3456731 3455460 gene locus_tag LOCUS_30720 3456731 3455460 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021506.1 protein_id gnl|my_center|LOCUS_30720 3456955 3456728 gene locus_tag LOCUS_30730 3456955 3456728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 3457827 3458201 gene locus_tag LOCUS_30740 gene fpoA 3457827 3458201 CDS product F420H2 dehydrogenase subunit FpoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021509.1 protein_id gnl|my_center|LOCUS_30740 3458189 3458743 gene locus_tag LOCUS_30750 gene fpoB 3458189 3458743 CDS product F(420)H(2) dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021510.1 protein_id gnl|my_center|LOCUS_30750 3458774 3459250 gene locus_tag LOCUS_30760 gene fpoC 3458774 3459250 CDS product F420H2 dehydrogenase subunit FpoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021511.1 protein_id gnl|my_center|LOCUS_30760 3459261 3460403 gene locus_tag LOCUS_30770 gene fpoD 3459261 3460403 CDS product F420H2 dehydrogenase subunit FpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021512.1 protein_id gnl|my_center|LOCUS_30770 3460409 3461449 gene locus_tag LOCUS_30780 gene fpoH 3460409 3461449 CDS product F420H2 dehydrogenase subunit FpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065137.1 protein_id gnl|my_center|LOCUS_30780 3461454 3461864 gene locus_tag LOCUS_30790 gene fpoI 3461454 3461864 CDS product F420H2 dehydrogenase subunit FpoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021514.1 protein_id gnl|my_center|LOCUS_30790 3461861 3462148 gene locus_tag LOCUS_30800 3461861 3462148 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048140880.1 protein_id gnl|my_center|LOCUS_30800 3462138 3462389 gene locus_tag LOCUS_30810 gene fpoJ 3462138 3462389 CDS product F420H2 dehydrogenase subunit FpoJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048140882.1 protein_id gnl|my_center|LOCUS_30810 3462386 3462694 gene locus_tag LOCUS_30820 gene fpoK 3462386 3462694 CDS product F420H2 dehydrogenase subunit FpoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589525.1 protein_id gnl|my_center|LOCUS_30820 3462688 3464706 gene locus_tag LOCUS_30830 gene fpoL 3462688 3464706 CDS product F420H2 dehydrogenase subunit FpoL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021518.1 protein_id gnl|my_center|LOCUS_30830 3464706 3466193 gene locus_tag LOCUS_30840 gene fpoM 3464706 3466193 CDS product F(420)H(2) dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021519.1 protein_id gnl|my_center|LOCUS_30840 3466197 3467666 gene locus_tag LOCUS_30850 gene fpoN 3466197 3467666 CDS product F(420)H(2) dehydrogenase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 protein_id gnl|my_center|LOCUS_30850 3467680 3468069 gene locus_tag LOCUS_30860 3467680 3468069 CDS product F420H2 dehydrogenase subunit FpoO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021521.1 protein_id gnl|my_center|LOCUS_30860 3468581 3469123 gene locus_tag LOCUS_30870 3468581 3469123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020614.1 protein_id gnl|my_center|LOCUS_30870 3469315 3471585 gene locus_tag LOCUS_30880 3469315 3471585 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162013073.1 protein_id gnl|my_center|LOCUS_30880 3472051 3472269 gene locus_tag LOCUS_30890 3472051 3472269 CDS product antitoxin VapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021528.1 protein_id gnl|my_center|LOCUS_30890 3472967 3473227 gene locus_tag LOCUS_30900 3472967 3473227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 3473224 3473496 gene locus_tag LOCUS_30910 3473224 3473496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226987603.1 protein_id gnl|my_center|LOCUS_30910 3474226 3473840 gene locus_tag LOCUS_30920 3474226 3473840 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876102.1 protein_id gnl|my_center|LOCUS_30920 3474712 3474266 gene locus_tag LOCUS_30930 3474712 3474266 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065140.1 protein_id gnl|my_center|LOCUS_30930 3474995 3476509 gene locus_tag LOCUS_30940 3474995 3476509 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021531.1 protein_id gnl|my_center|LOCUS_30940 3476839 3476717 gene locus_tag LOCUS_30950 3476839 3476717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 3478307 3476841 gene locus_tag LOCUS_30960 3478307 3476841 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990850.1 protein_id gnl|my_center|LOCUS_30960 3478654 3480048 gene locus_tag LOCUS_30970 3478654 3480048 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990792.1 protein_id gnl|my_center|LOCUS_30970 3480846 3480214 gene locus_tag LOCUS_30980 3480846 3480214 CDS product TatD family nuclease-associated radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990793.1 protein_id gnl|my_center|LOCUS_30980 3481179 3481541 gene locus_tag LOCUS_30990 gene rpl7ae 3481179 3481541 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021535.1 protein_id gnl|my_center|LOCUS_30990 3481566 3481787 gene locus_tag LOCUS_31000 3481566 3481787 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065141.1 protein_id gnl|my_center|LOCUS_31000 3481810 3481998 gene locus_tag LOCUS_31010 3481810 3481998 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021537.1 protein_id gnl|my_center|LOCUS_31010 3482031 3482480 gene locus_tag LOCUS_31020 gene ndk 3482031 3482480 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065142.1 protein_id gnl|my_center|LOCUS_31020 3482635 3484410 gene locus_tag LOCUS_31030 gene infB 3482635 3484410 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065143.1 protein_id gnl|my_center|LOCUS_31030 3484535 3484945 gene locus_tag LOCUS_31040 3484535 3484945 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021540.1 protein_id gnl|my_center|LOCUS_31040 3485239 3486135 gene locus_tag LOCUS_31050 gene tnpB 3485239 3486135 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31050 3486732 3486487 gene locus_tag LOCUS_31060 3486732 3486487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 3487509 3486889 gene locus_tag LOCUS_31070 3487509 3486889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 3488652 3487885 gene locus_tag LOCUS_31080 3488652 3487885 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990796.1 protein_id gnl|my_center|LOCUS_31080 3488836 3488636 gene locus_tag LOCUS_31090 3488836 3488636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 3489906 3489247 gene locus_tag LOCUS_31100 3489906 3489247 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065150.1 protein_id gnl|my_center|LOCUS_31100 3490235 3490020 gene locus_tag LOCUS_31110 3490235 3490020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 3490234 3490440 gene locus_tag LOCUS_31120 3490234 3490440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 3492083 3491088 gene locus_tag LOCUS_31130 3492083 3491088 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021548.1 protein_id gnl|my_center|LOCUS_31130 3493654 3492086 gene locus_tag LOCUS_31140 3493654 3492086 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021549.1 protein_id gnl|my_center|LOCUS_31140 3494129 3494548 gene locus_tag LOCUS_31150 3494129 3494548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 3494774 3496270 gene locus_tag LOCUS_31160 3494774 3496270 CDS product TolB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066233.1 protein_id gnl|my_center|LOCUS_31160 3496275 3497129 gene locus_tag LOCUS_31170 3496275 3497129 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021555.1 protein_id gnl|my_center|LOCUS_31170 3497142 3498026 gene locus_tag LOCUS_31180 3497142 3498026 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021556.1 protein_id gnl|my_center|LOCUS_31180 3498274 3498110 gene locus_tag LOCUS_31190 3498274 3498110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 3498643 3498861 gene locus_tag LOCUS_31200 3498643 3498861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 3499027 3499170 gene locus_tag LOCUS_31210 3499027 3499170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 3499323 3499532 gene locus_tag LOCUS_31220 3499323 3499532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 3500336 3499659 gene locus_tag LOCUS_31230 3500336 3499659 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990794.1 protein_id gnl|my_center|LOCUS_31230 3500838 3500383 gene locus_tag LOCUS_31240 3500838 3500383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066236.1 protein_id gnl|my_center|LOCUS_31240 3501531 3501124 gene locus_tag LOCUS_31250 3501531 3501124 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065151.1 protein_id gnl|my_center|LOCUS_31250 3502373 3501774 gene locus_tag LOCUS_31260 gene pdxT 3502373 3501774 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021577.1 protein_id gnl|my_center|LOCUS_31260 3503545 3502649 gene locus_tag LOCUS_31270 gene pdxS 3503545 3502649 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065155.1 protein_id gnl|my_center|LOCUS_31270 3505345 3504317 gene locus_tag LOCUS_31280 3505345 3504317 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860134.1 protein_id gnl|my_center|LOCUS_31280 3505527 3505976 gene locus_tag LOCUS_31290 3505527 3505976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065156.1 protein_id gnl|my_center|LOCUS_31290 3506336 3507265 gene locus_tag LOCUS_31300 3506336 3507265 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021582.1 protein_id gnl|my_center|LOCUS_31300 3507609 3508670 gene locus_tag LOCUS_31310 3507609 3508670 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021583.1 protein_id gnl|my_center|LOCUS_31310 3508985 3510160 gene locus_tag LOCUS_31320 3508985 3510160 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021584.1 protein_id gnl|my_center|LOCUS_31320 3510436 3510762 gene locus_tag LOCUS_31330 3510436 3510762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 3510793 3511656 gene locus_tag LOCUS_31340 3510793 3511656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31340 3512490 3511879 gene locus_tag LOCUS_31350 3512490 3511879 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065157.1 protein_id gnl|my_center|LOCUS_31350 3513049 3514101 gene locus_tag LOCUS_31360 3513049 3514101 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021587.1 protein_id gnl|my_center|LOCUS_31360 3514239 3517412 gene locus_tag LOCUS_31370 3514239 3517412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 3518437 3518123 gene locus_tag LOCUS_31380 3518437 3518123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 3518739 3518560 gene locus_tag LOCUS_31390 3518739 3518560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 3520050 3518803 gene locus_tag LOCUS_31400 3520050 3518803 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942660.1 protein_id gnl|my_center|LOCUS_31400 3520453 3520013 gene locus_tag LOCUS_31410 gene tnpA 3520453 3520013 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249883.1 protein_id gnl|my_center|LOCUS_31410 3523621 3520778 gene locus_tag LOCUS_31420 gene gyrA 3523621 3520778 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_31420 3525537 3523633 gene locus_tag LOCUS_31430 gene gyrB 3525537 3523633 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021594.1 protein_id gnl|my_center|LOCUS_31430 3527355 3526246 gene locus_tag LOCUS_31440 3527355 3526246 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065160.1 protein_id gnl|my_center|LOCUS_31440 3529222 3527357 gene locus_tag LOCUS_31450 3529222 3527357 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 protein_id gnl|my_center|LOCUS_31450 3529725 3529513 gene locus_tag LOCUS_31460 3529725 3529513 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021598.1 protein_id gnl|my_center|LOCUS_31460 3530125 3530649 gene locus_tag LOCUS_31470 3530125 3530649 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021452.1 protein_id gnl|my_center|LOCUS_31470 3530646 3531224 gene locus_tag LOCUS_31480 3530646 3531224 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066220.1 protein_id gnl|my_center|LOCUS_31480 3531374 3532573 gene locus_tag LOCUS_31490 3531374 3532573 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021450.1 protein_id gnl|my_center|LOCUS_31490 3533090 3533968 gene locus_tag LOCUS_31500 3533090 3533968 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065121.1 protein_id gnl|my_center|LOCUS_31500 3534236 3534442 gene locus_tag LOCUS_31510 3534236 3534442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065120.1 protein_id gnl|my_center|LOCUS_31510 3534826 3535455 gene locus_tag LOCUS_31520 3534826 3535455 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065119.1 protein_id gnl|my_center|LOCUS_31520 3535490 3536056 gene locus_tag LOCUS_31530 gene msrA 3535490 3536056 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021447.1 protein_id gnl|my_center|LOCUS_31530 3536185 3536898 gene locus_tag LOCUS_31540 3536185 3536898 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_31540 3537012 3537692 gene locus_tag LOCUS_31550 3537012 3537692 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_31550 3538189 3538902 gene locus_tag LOCUS_31560 3538189 3538902 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065117.1 protein_id gnl|my_center|LOCUS_31560 3538999 3539832 gene locus_tag LOCUS_31570 3538999 3539832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990789.1 protein_id gnl|my_center|LOCUS_31570 3539945 3541048 gene locus_tag LOCUS_31580 3539945 3541048 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021442.1 protein_id gnl|my_center|LOCUS_31580 3541360 3541938 gene locus_tag LOCUS_31590 3541360 3541938 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021440.1 protein_id gnl|my_center|LOCUS_31590 3542061 3542516 gene locus_tag LOCUS_31600 3542061 3542516 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 protein_id gnl|my_center|LOCUS_31600 3542615 3544267 gene locus_tag LOCUS_31610 3542615 3544267 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021438.1 protein_id gnl|my_center|LOCUS_31610 3545489 3545265 gene locus_tag LOCUS_31620 3545489 3545265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 3545580 3546002 gene locus_tag LOCUS_31630 3545580 3546002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 3547027 3546242 gene locus_tag LOCUS_31640 3547027 3546242 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065114.1 protein_id gnl|my_center|LOCUS_31640 3548534 3547032 gene locus_tag LOCUS_31650 3548534 3547032 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021434.1 protein_id gnl|my_center|LOCUS_31650 3549062 3548538 gene locus_tag LOCUS_31660 3549062 3548538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065113.1 protein_id gnl|my_center|LOCUS_31660 3549480 3550391 gene locus_tag LOCUS_31670 3549480 3550391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860124.1 protein_id gnl|my_center|LOCUS_31670 3550690 3550613 gene locus_tag LOCUS_t00410 3550690 3550613 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3551133 3551056 gene locus_tag LOCUS_t00420 3551133 3551056 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3551731 3551342 gene locus_tag LOCUS_31680 3551731 3551342 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589516.1 protein_id gnl|my_center|LOCUS_31680 3551983 3551759 gene locus_tag LOCUS_31690 3551983 3551759 CDS product Sm protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021429.1 protein_id gnl|my_center|LOCUS_31690 3552880 3552479 gene locus_tag LOCUS_31700 3552880 3552479 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021428.1 protein_id gnl|my_center|LOCUS_31700 3555540 3553060 gene locus_tag LOCUS_31710 3555540 3553060 CDS product DUF5814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021427.1 protein_id gnl|my_center|LOCUS_31710 3556872 3556096 gene locus_tag LOCUS_31720 gene mtnP 3556872 3556096 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021425.1 protein_id gnl|my_center|LOCUS_31720 3558078 3556939 gene locus_tag LOCUS_31730 3558078 3556939 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066217.1 protein_id gnl|my_center|LOCUS_31730 3558677 3558991 gene locus_tag LOCUS_31740 3558677 3558991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021423.1 protein_id gnl|my_center|LOCUS_31740 3559488 3559126 gene locus_tag LOCUS_31750 3559488 3559126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021422.1 protein_id gnl|my_center|LOCUS_31750 3560101 3559550 gene locus_tag LOCUS_31760 3560101 3559550 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021421.1 protein_id gnl|my_center|LOCUS_31760 3560582 3560112 gene locus_tag LOCUS_31770 3560582 3560112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065112.1 protein_id gnl|my_center|LOCUS_31770 3560852 3561040 gene locus_tag LOCUS_31780 3560852 3561040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 3561538 3562026 gene locus_tag LOCUS_31790 3561538 3562026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 3564517 3562607 gene locus_tag LOCUS_31800 3564517 3562607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 3566486 3565335 gene locus_tag LOCUS_31810 3566486 3565335 CDS product PGF-pre-PGF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021746.1 protein_id gnl|my_center|LOCUS_31810 3568158 3566983 gene locus_tag LOCUS_31820 3568158 3566983 CDS product DUF2117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066216.1 protein_id gnl|my_center|LOCUS_31820 3568565 3569755 gene locus_tag LOCUS_31830 3568565 3569755 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990807.1 protein_id gnl|my_center|LOCUS_31830 3569833 3570774 gene locus_tag LOCUS_31840 3569833 3570774 CDS product DUF3344 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021749.1 protein_id gnl|my_center|LOCUS_31840 3570817 3571908 gene locus_tag LOCUS_31850 3570817 3571908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021750.1 protein_id gnl|my_center|LOCUS_31850 3573786 3571951 gene locus_tag LOCUS_31860 3573786 3571951 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021751.1 protein_id gnl|my_center|LOCUS_31860 3573895 3574758 gene locus_tag LOCUS_31870 3573895 3574758 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065199.1 protein_id gnl|my_center|LOCUS_31870 3576107 3574839 gene locus_tag LOCUS_31880 3576107 3574839 CDS product DUF3344 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065200.1 protein_id gnl|my_center|LOCUS_31880 3576655 3578442 gene locus_tag LOCUS_31890 3576655 3578442 CDS product DUF3344 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065201.1 protein_id gnl|my_center|LOCUS_31890 3578411 3579397 gene locus_tag LOCUS_31900 3578411 3579397 CDS product DUF3344 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065202.1 protein_id gnl|my_center|LOCUS_31900 3579431 3580114 gene locus_tag LOCUS_31910 3579431 3580114 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021756.1 protein_id gnl|my_center|LOCUS_31910 3580749 3580246 gene locus_tag LOCUS_31920 3580749 3580246 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021413.1 protein_id gnl|my_center|LOCUS_31920 3581246 3582940 gene locus_tag LOCUS_31930 3581246 3582940 CDS product DUF3344 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021763.1 protein_id gnl|my_center|LOCUS_31930 3582937 3584547 gene locus_tag LOCUS_31940 3582937 3584547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065208.1 protein_id gnl|my_center|LOCUS_31940 3588779 3585132 gene locus_tag LOCUS_31950 3588779 3585132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 3590846 3589809 gene locus_tag LOCUS_31960 3590846 3589809 CDS product DUF3344 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990663.1 protein_id gnl|my_center|LOCUS_31960 3592455 3592090 gene locus_tag LOCUS_31970 3592455 3592090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 3596155 3593897 gene locus_tag LOCUS_31980 3596155 3593897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 3599739 3597916 gene locus_tag LOCUS_31990 3599739 3597916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 3602428 3600863 gene locus_tag LOCUS_32000 3602428 3600863 CDS product DUF3344 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065207.1 protein_id gnl|my_center|LOCUS_32000 3604987 3604565 gene locus_tag LOCUS_32010 gene nikR 3604987 3604565 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065209.1 protein_id gnl|my_center|LOCUS_32010 3606353 3605829 gene locus_tag LOCUS_32020 gene nikR 3606353 3605829 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065107.1 protein_id gnl|my_center|LOCUS_32020 3607469 3607714 gene locus_tag LOCUS_32030 3607469 3607714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 3610305 3607834 gene locus_tag LOCUS_32040 3610305 3607834 CDS product PKD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048141058.1 protein_id gnl|my_center|LOCUS_32040 3611186 3610317 gene locus_tag LOCUS_32050 3611186 3610317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024179.1 protein_id gnl|my_center|LOCUS_32050 3616094 3611307 gene locus_tag LOCUS_32060 3616094 3611307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 3620804 3617001 gene locus_tag LOCUS_32070 3620804 3617001 CDS product DUF3344 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065210.1 protein_id gnl|my_center|LOCUS_32070 3624445 3621677 gene locus_tag LOCUS_32080 3624445 3621677 CDS product DUF3344 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990811.1 protein_id gnl|my_center|LOCUS_32080 3625314 3626141 gene locus_tag LOCUS_32090 3625314 3626141 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065106.1 protein_id gnl|my_center|LOCUS_32090 3626452 3627747 gene locus_tag LOCUS_32100 3626452 3627747 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589524.1 protein_id gnl|my_center|LOCUS_32100 3627826 3628140 gene locus_tag LOCUS_32110 gene hisE 3627826 3628140 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021409.1 protein_id gnl|my_center|LOCUS_32110 3629192 3628317 gene locus_tag LOCUS_32120 3629192 3628317 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021408.1 protein_id gnl|my_center|LOCUS_32120 3629713 3630744 gene locus_tag LOCUS_32130 3629713 3630744 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589523.1 protein_id gnl|my_center|LOCUS_32130 3631702 3630764 gene locus_tag LOCUS_32140 3631702 3630764 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990787.1 protein_id gnl|my_center|LOCUS_32140 3632222 3633367 gene locus_tag LOCUS_32150 gene tnpB 3632222 3633367 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_32150 3634572 3633460 gene locus_tag LOCUS_32160 3634572 3633460 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021402.1 protein_id gnl|my_center|LOCUS_32160 3635329 3634715 gene locus_tag LOCUS_32170 gene hxlB 3635329 3634715 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065105.1 protein_id gnl|my_center|LOCUS_32170 3636124 3635612 gene locus_tag LOCUS_32180 3636124 3635612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065104.1 protein_id gnl|my_center|LOCUS_32180 3636497 3636138 gene locus_tag LOCUS_32190 3636497 3636138 CDS product DUF2073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021399.1 protein_id gnl|my_center|LOCUS_32190 3637144 3636503 gene locus_tag LOCUS_32200 3637144 3636503 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021398.1 protein_id gnl|my_center|LOCUS_32200 3638976 3638338 gene locus_tag LOCUS_32210 3638976 3638338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 3639599 3640480 gene locus_tag LOCUS_32220 3639599 3640480 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021396.1 protein_id gnl|my_center|LOCUS_32220 3640477 3640764 gene locus_tag LOCUS_32230 3640477 3640764 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021395.1 protein_id gnl|my_center|LOCUS_32230 3640785 3641180 gene locus_tag LOCUS_32240 3640785 3641180 CDS product AIR carboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021394.1 protein_id gnl|my_center|LOCUS_32240 3642289 3641618 gene locus_tag LOCUS_32250 3642289 3641618 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066212.1 protein_id gnl|my_center|LOCUS_32250 3643320 3642421 gene locus_tag LOCUS_32260 3643320 3642421 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021391.1 protein_id gnl|my_center|LOCUS_32260 3643993 3643604 gene locus_tag LOCUS_32270 3643993 3643604 CDS product DUF555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021390.1 protein_id gnl|my_center|LOCUS_32270 3644537 3644256 gene locus_tag LOCUS_32280 3644537 3644256 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066211.1 protein_id gnl|my_center|LOCUS_32280 3645481 3644681 gene locus_tag LOCUS_32290 gene dph5 3645481 3644681 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021388.1 protein_id gnl|my_center|LOCUS_32290 3645646 3645888 gene locus_tag LOCUS_32300 3645646 3645888 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021387.1 protein_id gnl|my_center|LOCUS_32300 3645942 3646859 gene locus_tag LOCUS_32310 gene trxB 3645942 3646859 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065103.1 protein_id gnl|my_center|LOCUS_32310 3647466 3647185 gene locus_tag LOCUS_32320 3647466 3647185 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066210.1 protein_id gnl|my_center|LOCUS_32320 3647712 3648224 gene locus_tag LOCUS_32330 3647712 3648224 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065101.1 protein_id gnl|my_center|LOCUS_32330 3649253 3650131 gene locus_tag LOCUS_32340 3649253 3650131 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021382.1 protein_id gnl|my_center|LOCUS_32340 3651080 3650292 gene locus_tag LOCUS_32350 3651080 3650292 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021381.1 protein_id gnl|my_center|LOCUS_32350 3651444 3652640 gene locus_tag LOCUS_32360 3651444 3652640 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065100.1 protein_id gnl|my_center|LOCUS_32360 3652928 3653359 gene locus_tag LOCUS_32370 3652928 3653359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 3653719 3654624 gene locus_tag LOCUS_32380 3653719 3654624 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021379.1 protein_id gnl|my_center|LOCUS_32380 3655904 3655059 gene locus_tag LOCUS_32390 3655904 3655059 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021378.1 protein_id gnl|my_center|LOCUS_32390 3656226 3656083 gene locus_tag LOCUS_32400 3656226 3656083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 3656899 3656408 gene locus_tag LOCUS_32410 3656899 3656408 CDS product cupredoxin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065099.1 protein_id gnl|my_center|LOCUS_32410 3657838 3657449 gene locus_tag LOCUS_32420 3657838 3657449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 3658843 3658487 gene locus_tag LOCUS_32430 3658843 3658487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021374.1 protein_id gnl|my_center|LOCUS_32430 3659112 3660476 gene locus_tag LOCUS_32440 3659112 3660476 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021373.1 protein_id gnl|my_center|LOCUS_32440 3660664 3662298 gene locus_tag LOCUS_32450 3660664 3662298 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065098.1 protein_id gnl|my_center|LOCUS_32450 3662510 3663730 gene locus_tag LOCUS_32460 3662510 3663730 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141457.1 protein_id gnl|my_center|LOCUS_32460 3663934 3663755 gene locus_tag LOCUS_32470 3663934 3663755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 3664582 3664358 gene locus_tag LOCUS_32480 3664582 3664358 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755886.1 protein_id gnl|my_center|LOCUS_32480 3665155 3664952 gene locus_tag LOCUS_32490 3665155 3664952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065096.1 protein_id gnl|my_center|LOCUS_32490 3665619 3665476 gene locus_tag LOCUS_32500 3665619 3665476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065095.1 protein_id gnl|my_center|LOCUS_32500 3666172 3665939 gene locus_tag LOCUS_32510 3666172 3665939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 3667060 3666836 gene locus_tag LOCUS_32520 3667060 3666836 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755886.1 protein_id gnl|my_center|LOCUS_32520 3667601 3667371 gene locus_tag LOCUS_32530 3667601 3667371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 3667984 3668250 gene locus_tag LOCUS_32540 3667984 3668250 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065092.1 protein_id gnl|my_center|LOCUS_32540 3669891 3671225 gene locus_tag LOCUS_32550 3669891 3671225 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021364.1 protein_id gnl|my_center|LOCUS_32550 3671555 3673570 gene locus_tag LOCUS_32560 3671555 3673570 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021363.1 protein_id gnl|my_center|LOCUS_32560 3674929 3674681 gene locus_tag LOCUS_32570 3674929 3674681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066205.1 protein_id gnl|my_center|LOCUS_32570 3678230 3675336 gene locus_tag LOCUS_32580 3678230 3675336 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021360.1 protein_id gnl|my_center|LOCUS_32580 3678469 3678272 gene locus_tag LOCUS_32590 3678469 3678272 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065088.1 protein_id gnl|my_center|LOCUS_32590 3678820 3678644 gene locus_tag LOCUS_32600 3678820 3678644 CDS product copper ion binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082089387.1 protein_id gnl|my_center|LOCUS_32600 3680182 3679238 gene locus_tag LOCUS_32610 3680182 3679238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 3680679 3680488 gene locus_tag LOCUS_32620 3680679 3680488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 3681859 3680900 gene locus_tag LOCUS_32630 3681859 3680900 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021352.1 protein_id gnl|my_center|LOCUS_32630 3682056 3681856 gene locus_tag LOCUS_32640 3682056 3681856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 3683182 3682628 gene locus_tag LOCUS_32650 3683182 3682628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 3683535 3684038 gene locus_tag LOCUS_32660 3683535 3684038 CDS product protein-S-isoprenylcysteine O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328453.1 protein_id gnl|my_center|LOCUS_32660 3684317 3684156 gene locus_tag LOCUS_32670 3684317 3684156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 3684757 3685941 gene locus_tag LOCUS_32680 3684757 3685941 CDS product FAD-binding domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898508.1 protein_id gnl|my_center|LOCUS_32680 3686540 3687190 gene locus_tag LOCUS_32690 3686540 3687190 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992322.1 protein_id gnl|my_center|LOCUS_32690 3687928 3687659 gene locus_tag LOCUS_32700 3687928 3687659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 3688615 3688460 gene locus_tag LOCUS_32710 3688615 3688460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 3688909 3689082 gene locus_tag LOCUS_32720 3688909 3689082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 3689227 3689084 gene locus_tag LOCUS_32730 3689227 3689084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 3691254 3689488 gene locus_tag LOCUS_32740 3691254 3689488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 3691786 3691541 gene locus_tag LOCUS_32750 3691786 3691541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 3692132 3691887 gene locus_tag LOCUS_32760 3692132 3691887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 3692270 3693211 gene locus_tag LOCUS_32770 3692270 3693211 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022353.1 protein_id gnl|my_center|LOCUS_32770 3693896 3693651 gene locus_tag LOCUS_32780 3693896 3693651 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021345.1 protein_id gnl|my_center|LOCUS_32780 3694358 3693984 gene locus_tag LOCUS_32790 3694358 3693984 CDS product DUF2173 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022242.1 protein_id gnl|my_center|LOCUS_32790 3695410 3694781 gene locus_tag LOCUS_32800 3695410 3694781 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946775.1 protein_id gnl|my_center|LOCUS_32800 3695745 3695407 gene locus_tag LOCUS_32810 3695745 3695407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 3696025 3696675 gene locus_tag LOCUS_32820 3696025 3696675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 3698522 3696882 gene locus_tag LOCUS_32830 3698522 3696882 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021343.1 protein_id gnl|my_center|LOCUS_32830 3698964 3698647 gene locus_tag LOCUS_32840 3698964 3698647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065086.1 protein_id gnl|my_center|LOCUS_32840 3699505 3698966 gene locus_tag LOCUS_32850 3699505 3698966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 3700274 3701005 gene locus_tag LOCUS_32860 3700274 3701005 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021349.1 protein_id gnl|my_center|LOCUS_32860 3701715 3703301 gene locus_tag LOCUS_32870 gene cooS 3701715 3703301 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768251.1 protein_id gnl|my_center|LOCUS_32870 3703353 3704324 gene locus_tag LOCUS_32880 3703353 3704324 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393471.1 protein_id gnl|my_center|LOCUS_32880 3704330 3705103 gene locus_tag LOCUS_32890 3704330 3705103 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393472.1 protein_id gnl|my_center|LOCUS_32890 3705105 3705842 gene locus_tag LOCUS_32900 3705105 3705842 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393473.1 protein_id gnl|my_center|LOCUS_32900 3706029 3705853 gene locus_tag LOCUS_32910 3706029 3705853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 3707875 3706220 gene locus_tag LOCUS_32920 3707875 3706220 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021343.1 protein_id gnl|my_center|LOCUS_32920 3708100 3709035 gene locus_tag LOCUS_32930 3708100 3709035 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021342.1 protein_id gnl|my_center|LOCUS_32930 3709173 3710357 gene locus_tag LOCUS_32940 3709173 3710357 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869500.1 protein_id gnl|my_center|LOCUS_32940 3710354 3711127 gene locus_tag LOCUS_32950 3710354 3711127 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_32950 3712812 3711430 gene locus_tag LOCUS_32960 3712812 3711430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 3713761 3713162 gene locus_tag LOCUS_32970 3713761 3713162 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021338.1 protein_id gnl|my_center|LOCUS_32970 3714065 3715540 gene locus_tag LOCUS_32980 gene argH 3714065 3715540 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021337.1 protein_id gnl|my_center|LOCUS_32980 3715711 3716988 gene locus_tag LOCUS_32990 gene gatD 3715711 3716988 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021336.1 protein_id gnl|my_center|LOCUS_32990 3717429 3717593 gene locus_tag LOCUS_33000 3717429 3717593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 3717693 3719351 gene locus_tag LOCUS_33010 3717693 3719351 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021335.1 protein_id gnl|my_center|LOCUS_33010 3720433 3719666 gene locus_tag LOCUS_33020 3720433 3719666 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202509.1 protein_id gnl|my_center|LOCUS_33020 3721101 3720472 gene locus_tag LOCUS_33030 3721101 3720472 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868049.1 protein_id gnl|my_center|LOCUS_33030 3722732 3721461 gene locus_tag LOCUS_33040 gene larA 3722732 3721461 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 protein_id gnl|my_center|LOCUS_33040 3724141 3722873 gene locus_tag LOCUS_33050 gene larA 3724141 3722873 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065079.1 protein_id gnl|my_center|LOCUS_33050 3724727 3726511 gene locus_tag LOCUS_33060 3724727 3726511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021330.1 protein_id gnl|my_center|LOCUS_33060 3726997 3728898 gene locus_tag LOCUS_33070 gene cooS 3726997 3728898 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021329.1 protein_id gnl|my_center|LOCUS_33070 3729725 3729033 gene locus_tag LOCUS_33080 3729725 3729033 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021328.1 protein_id gnl|my_center|LOCUS_33080 3729927 3731111 gene locus_tag LOCUS_33090 3729927 3731111 CDS product DUF2117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990783.1 protein_id gnl|my_center|LOCUS_33090 3731404 3731802 gene locus_tag LOCUS_33100 3731404 3731802 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023127.1 protein_id gnl|my_center|LOCUS_33100 3733335 3731878 gene locus_tag LOCUS_33110 gene purF 3733335 3731878 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065634.1 protein_id gnl|my_center|LOCUS_33110 3733912 3733694 gene locus_tag LOCUS_33120 3733912 3733694 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023130.1 protein_id gnl|my_center|LOCUS_33120 3734374 3735720 gene locus_tag LOCUS_33130 gene thiD 3734374 3735720 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023132.1 protein_id gnl|my_center|LOCUS_33130 3735897 3737195 gene locus_tag LOCUS_33140 3735897 3737195 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065635.1 protein_id gnl|my_center|LOCUS_33140 3737783 3737373 gene locus_tag LOCUS_33150 3737783 3737373 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023134.1 protein_id gnl|my_center|LOCUS_33150 3738686 3738273 gene locus_tag LOCUS_33160 3738686 3738273 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023135.1 protein_id gnl|my_center|LOCUS_33160 3740082 3738790 gene locus_tag LOCUS_33170 gene hisD 3740082 3738790 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023136.1 protein_id gnl|my_center|LOCUS_33170 3742737 3740545 gene locus_tag LOCUS_33180 3742737 3740545 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_33180 3744696 3742930 gene locus_tag LOCUS_33190 3744696 3742930 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023139.1 protein_id gnl|my_center|LOCUS_33190 3745506 3745093 gene locus_tag LOCUS_33200 3745506 3745093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990637.1 protein_id gnl|my_center|LOCUS_33200 3746451 3745648 gene locus_tag LOCUS_33210 3746451 3745648 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066456.1 protein_id gnl|my_center|LOCUS_33210 3746540 3746758 gene locus_tag LOCUS_33220 3746540 3746758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 3747528 3747121 gene locus_tag LOCUS_33230 3747528 3747121 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023146.1 protein_id gnl|my_center|LOCUS_33230 3748325 3748110 gene locus_tag LOCUS_33240 gene trxA 3748325 3748110 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065637.1 protein_id gnl|my_center|LOCUS_33240 3749451 3748645 gene locus_tag LOCUS_33250 gene cofE 3749451 3748645 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023428.1 protein_id gnl|my_center|LOCUS_33250 3750546 3749665 gene locus_tag LOCUS_33260 3750546 3749665 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023430.1 protein_id gnl|my_center|LOCUS_33260 3751515 3750901 gene locus_tag LOCUS_33270 3751515 3750901 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023431.1 protein_id gnl|my_center|LOCUS_33270 3752744 3751518 gene locus_tag LOCUS_33280 gene folP 3752744 3751518 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065738.1 protein_id gnl|my_center|LOCUS_33280 3754382 3753519 gene locus_tag LOCUS_33290 3754382 3753519 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023435.1 protein_id gnl|my_center|LOCUS_33290 3755645 3754407 gene locus_tag LOCUS_33300 gene glyA 3755645 3754407 CDS product bifunctional serine hydroxymethyltransferase/L-allo-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023436.1 protein_id gnl|my_center|LOCUS_33300 3756946 3756338 gene locus_tag LOCUS_33310 gene purN 3756946 3756338 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065739.1 protein_id gnl|my_center|LOCUS_33310 3758058 3757072 gene locus_tag LOCUS_33320 3758058 3757072 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023440.1 protein_id gnl|my_center|LOCUS_33320 3758212 3759498 gene locus_tag LOCUS_33330 3758212 3759498 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066507.1 protein_id gnl|my_center|LOCUS_33330 3760317 3759547 gene locus_tag LOCUS_33340 3760317 3759547 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023442.1 protein_id gnl|my_center|LOCUS_33340 3760873 3763251 gene locus_tag LOCUS_33350 3760873 3763251 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023443.1 protein_id gnl|my_center|LOCUS_33350 3763398 3763652 gene locus_tag LOCUS_33360 3763398 3763652 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023444.1 protein_id gnl|my_center|LOCUS_33360 3764464 3764081 gene locus_tag LOCUS_33370 3764464 3764081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 3764758 3765723 gene locus_tag LOCUS_33380 3764758 3765723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 3765810 3766349 gene locus_tag LOCUS_33390 3765810 3766349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 3766451 3766729 gene locus_tag LOCUS_33400 3766451 3766729 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037342.1 protein_id gnl|my_center|LOCUS_33400 3766980 3767171 gene locus_tag LOCUS_33410 3766980 3767171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 3767168 3767986 gene locus_tag LOCUS_33420 3767168 3767986 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095645285.1 protein_id gnl|my_center|LOCUS_33420 3768195 3768377 gene locus_tag LOCUS_33430 3768195 3768377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33430 3768535 3769266 gene locus_tag LOCUS_33440 3768535 3769266 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023449.1 protein_id gnl|my_center|LOCUS_33440 3769358 3769885 gene locus_tag LOCUS_33450 3769358 3769885 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065742.1 protein_id gnl|my_center|LOCUS_33450 3770087 3769947 gene locus_tag LOCUS_33460 3770087 3769947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 3770364 3770714 gene locus_tag LOCUS_33470 3770364 3770714 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023452.1 protein_id gnl|my_center|LOCUS_33470 3771144 3771746 gene locus_tag LOCUS_33480 3771144 3771746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 3773420 3772293 gene locus_tag LOCUS_33490 3773420 3772293 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085095815.1 protein_id gnl|my_center|LOCUS_33490 3774014 3774637 gene locus_tag LOCUS_33500 3774014 3774637 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230410.1 protein_id gnl|my_center|LOCUS_33500 3774855 3775820 gene locus_tag LOCUS_33510 3774855 3775820 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023456.1 protein_id gnl|my_center|LOCUS_33510 3776612 3775932 gene locus_tag LOCUS_33520 3776612 3775932 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023459.1 protein_id gnl|my_center|LOCUS_33520 3777711 3776734 gene locus_tag LOCUS_33530 gene radA 3777711 3776734 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023460.1 protein_id gnl|my_center|LOCUS_33530 3777998 3778462 gene locus_tag LOCUS_33540 3777998 3778462 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023461.1 protein_id gnl|my_center|LOCUS_33540 3778587 3778919 gene locus_tag LOCUS_33550 3778587 3778919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023462.1 protein_id gnl|my_center|LOCUS_33550 3779004 3779837 gene locus_tag LOCUS_33560 3779004 3779837 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023463.1 protein_id gnl|my_center|LOCUS_33560 3781029 3779989 gene locus_tag LOCUS_33570 3781029 3779989 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023464.1 protein_id gnl|my_center|LOCUS_33570 3781672 3781376 gene locus_tag LOCUS_33580 3781672 3781376 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990654.1 protein_id gnl|my_center|LOCUS_33580 3783318 3781957 gene locus_tag LOCUS_33590 3783318 3781957 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023466.1 protein_id gnl|my_center|LOCUS_33590 3784111 3783329 gene locus_tag LOCUS_33600 gene cbiQ 3784111 3783329 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065744.1 protein_id gnl|my_center|LOCUS_33600 3784562 3784224 gene locus_tag LOCUS_33610 3784562 3784224 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023468.1 protein_id gnl|my_center|LOCUS_33610 3785266 3784559 gene locus_tag LOCUS_33620 3785266 3784559 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023469.1 protein_id gnl|my_center|LOCUS_33620 3786403 3785945 gene locus_tag LOCUS_33630 3786403 3785945 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023470.1 protein_id gnl|my_center|LOCUS_33630 3787505 3786564 gene locus_tag LOCUS_33640 3787505 3786564 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065056.1 protein_id gnl|my_center|LOCUS_33640 3787880 3789139 gene locus_tag LOCUS_33650 3787880 3789139 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065055.1 protein_id gnl|my_center|LOCUS_33650 3789270 3789707 gene locus_tag LOCUS_33660 3789270 3789707 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021215.1 protein_id gnl|my_center|LOCUS_33660 3791842 3789797 gene locus_tag LOCUS_33670 3791842 3789797 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021214.1 protein_id gnl|my_center|LOCUS_33670 3792185 3792373 gene locus_tag LOCUS_33680 3792185 3792373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 3793461 3792832 gene locus_tag LOCUS_33690 gene wrbA 3793461 3792832 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021213.1 protein_id gnl|my_center|LOCUS_33690 3793678 3794823 gene locus_tag LOCUS_33700 3793678 3794823 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021211.1 protein_id gnl|my_center|LOCUS_33700 3794833 3795993 gene locus_tag LOCUS_33710 3794833 3795993 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021210.1 protein_id gnl|my_center|LOCUS_33710 3797452 3798378 gene locus_tag LOCUS_33720 3797452 3798378 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990845.1 protein_id gnl|my_center|LOCUS_33720 3798354 3799295 gene locus_tag LOCUS_33730 3798354 3799295 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021208.1 protein_id gnl|my_center|LOCUS_33730 3799292 3800431 gene locus_tag LOCUS_33740 3799292 3800431 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021207.1 protein_id gnl|my_center|LOCUS_33740 3800424 3801131 gene locus_tag LOCUS_33750 3800424 3801131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 3802013 3801297 gene locus_tag LOCUS_33760 3802013 3801297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 3803185 3802514 gene locus_tag LOCUS_33770 3803185 3802514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 3805192 3804692 gene locus_tag LOCUS_33780 3805192 3804692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 3805815 3805997 gene locus_tag LOCUS_33790 3805815 3805997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 3805984 3806193 gene locus_tag LOCUS_33800 3805984 3806193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 3806926 3806342 gene locus_tag LOCUS_33810 3806926 3806342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 3810387 3807082 gene locus_tag LOCUS_33820 3810387 3807082 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880674.1 protein_id gnl|my_center|LOCUS_33820 3811631 3810417 gene locus_tag LOCUS_33830 3811631 3810417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 3812877 3811633 gene locus_tag LOCUS_33840 3812877 3811633 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021201.1 protein_id gnl|my_center|LOCUS_33840 3813656 3812877 gene locus_tag LOCUS_33850 3813656 3812877 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021200.1 protein_id gnl|my_center|LOCUS_33850 3814725 3813646 gene locus_tag LOCUS_33860 3814725 3813646 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021199.1 protein_id gnl|my_center|LOCUS_33860 3815102 3816124 gene locus_tag LOCUS_33870 gene gmd 3815102 3816124 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021198.1 protein_id gnl|my_center|LOCUS_33870 3816153 3817184 gene locus_tag LOCUS_33880 gene gmd 3816153 3817184 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066186.1 protein_id gnl|my_center|LOCUS_33880 3817274 3819772 gene locus_tag LOCUS_33890 3817274 3819772 CDS product oligosaccharyl transferase, archaeosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065054.1 protein_id gnl|my_center|LOCUS_33890 3821417 3819951 gene locus_tag LOCUS_33900 3821417 3819951 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065053.1 protein_id gnl|my_center|LOCUS_33900 3822164 3823666 gene locus_tag LOCUS_33910 3822164 3823666 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021194.1 protein_id gnl|my_center|LOCUS_33910 3823833 3824018 gene locus_tag LOCUS_33920 3823833 3824018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065052.1 protein_id gnl|my_center|LOCUS_33920 3824140 3824607 gene locus_tag LOCUS_33930 gene moaC 3824140 3824607 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066185.1 protein_id gnl|my_center|LOCUS_33930 3824706 3825557 gene locus_tag LOCUS_33940 3824706 3825557 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021191.1 protein_id gnl|my_center|LOCUS_33940 3829070 3825831 gene locus_tag LOCUS_33950 3829070 3825831 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_33950 3830086 3829067 gene locus_tag LOCUS_33960 3830086 3829067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 3831198 3830083 gene locus_tag LOCUS_33970 3831198 3830083 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103419.1 protein_id gnl|my_center|LOCUS_33970 3831794 3831195 gene locus_tag LOCUS_33980 3831794 3831195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 3833635 3832118 gene locus_tag LOCUS_33990 3833635 3832118 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851467.1 protein_id gnl|my_center|LOCUS_33990 3834094 3834264 gene locus_tag LOCUS_34000 3834094 3834264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 3834837 3835412 gene locus_tag LOCUS_34010 3834837 3835412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 3836106 3835861 gene locus_tag LOCUS_34020 3836106 3835861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34020 3836622 3836374 gene locus_tag LOCUS_34030 3836622 3836374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 3836925 3837104 gene locus_tag LOCUS_34040 3836925 3837104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 3837185 3838954 gene locus_tag LOCUS_34050 3837185 3838954 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940935.1 protein_id gnl|my_center|LOCUS_34050 3839164 3839913 gene locus_tag LOCUS_34060 3839164 3839913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021190.1 protein_id gnl|my_center|LOCUS_34060 3840426 3841226 gene locus_tag LOCUS_34070 3840426 3841226 CDS product C15orf41 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065051.1 protein_id gnl|my_center|LOCUS_34070 3841531 3842529 gene locus_tag LOCUS_34080 gene fgd 3841531 3842529 CDS product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898438.1 protein_id gnl|my_center|LOCUS_34080 3845791 3842579 gene locus_tag LOCUS_34090 3845791 3842579 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021188.1 protein_id gnl|my_center|LOCUS_34090 3847821 3845788 gene locus_tag LOCUS_34100 3847821 3845788 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021187.1 protein_id gnl|my_center|LOCUS_34100 3848631 3849089 gene locus_tag LOCUS_34110 3848631 3849089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34110 3849322 3849555 gene locus_tag LOCUS_34120 3849322 3849555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34120 3850353 3850901 gene locus_tag LOCUS_34130 3850353 3850901 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021181.1 protein_id gnl|my_center|LOCUS_34130 3851678 3851073 gene locus_tag LOCUS_34140 3851678 3851073 CDS product sarcinarray family MAST domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065049.1 protein_id gnl|my_center|LOCUS_34140 3852490 3851675 gene locus_tag LOCUS_34150 3852490 3851675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 3853177 3852569 gene locus_tag LOCUS_34160 3853177 3852569 CDS product sarcinarray family MAST domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065049.1 protein_id gnl|my_center|LOCUS_34160 3857340 3853174 gene locus_tag LOCUS_34170 3857340 3853174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021179.1 protein_id gnl|my_center|LOCUS_34170 3858868 3857561 gene locus_tag LOCUS_34180 3858868 3857561 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021177.1 protein_id gnl|my_center|LOCUS_34180 3860240 3859152 gene locus_tag LOCUS_34190 gene glpX 3860240 3859152 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021176.1 protein_id gnl|my_center|LOCUS_34190 3860547 3861275 gene locus_tag LOCUS_34200 3860547 3861275 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021175.1 protein_id gnl|my_center|LOCUS_34200 3862021 3861497 gene locus_tag LOCUS_34210 gene cgi121 3862021 3861497 CDS product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021174.1 protein_id gnl|my_center|LOCUS_34210 3862248 3864779 gene locus_tag LOCUS_34220 3862248 3864779 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021173.1 protein_id gnl|my_center|LOCUS_34220 3865950 3865138 gene locus_tag LOCUS_34230 3865950 3865138 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021172.1 protein_id gnl|my_center|LOCUS_34230 3867752 3865962 gene locus_tag LOCUS_34240 3867752 3865962 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021171.1 protein_id gnl|my_center|LOCUS_34240 3868963 3867752 gene locus_tag LOCUS_34250 3868963 3867752 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065047.1 protein_id gnl|my_center|LOCUS_34250 3869281 3870270 gene locus_tag LOCUS_34260 3869281 3870270 CDS product peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021169.1 protein_id gnl|my_center|LOCUS_34260 3870898 3870413 gene locus_tag LOCUS_34270 3870898 3870413 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021168.1 protein_id gnl|my_center|LOCUS_34270 3871822 3871010 gene locus_tag LOCUS_34280 3871822 3871010 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021167.1 protein_id gnl|my_center|LOCUS_34280 3873633 3871846 gene locus_tag LOCUS_34290 3873633 3871846 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021166.1 protein_id gnl|my_center|LOCUS_34290 3874819 3873641 gene locus_tag LOCUS_34300 3874819 3873641 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066182.1 protein_id gnl|my_center|LOCUS_34300 3876096 3876374 gene locus_tag LOCUS_34310 gene hypC 3876096 3876374 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021164.1 protein_id gnl|my_center|LOCUS_34310 3876376 3877494 gene locus_tag LOCUS_34320 gene hypD 3876376 3877494 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066181.1 protein_id gnl|my_center|LOCUS_34320 3877487 3877888 gene locus_tag LOCUS_34330 gene hypA 3877487 3877888 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021162.1 protein_id gnl|my_center|LOCUS_34330 3878108 3878785 gene locus_tag LOCUS_34340 gene hypB 3878108 3878785 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860109.1 protein_id gnl|my_center|LOCUS_34340 3878841 3879887 gene locus_tag LOCUS_34350 gene hypE 3878841 3879887 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021160.1 protein_id gnl|my_center|LOCUS_34350 3881257 3881580 gene locus_tag LOCUS_34360 3881257 3881580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 3882082 3882240 gene locus_tag LOCUS_34370 3882082 3882240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 3882323 3882637 gene locus_tag LOCUS_34380 3882323 3882637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 3882781 3883326 gene locus_tag LOCUS_34390 3882781 3883326 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021158.1 protein_id gnl|my_center|LOCUS_34390 3883374 3884012 gene locus_tag LOCUS_34400 3883374 3884012 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990775.1 protein_id gnl|my_center|LOCUS_34400 3884953 3884189 gene locus_tag LOCUS_34410 3884953 3884189 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021156.1 protein_id gnl|my_center|LOCUS_34410 3886028 3884958 gene locus_tag LOCUS_34420 3886028 3884958 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065044.1 protein_id gnl|my_center|LOCUS_34420 3887482 3886166 gene locus_tag LOCUS_34430 3887482 3886166 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755879.1 protein_id gnl|my_center|LOCUS_34430 3887758 3889068 gene locus_tag LOCUS_34440 3887758 3889068 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021153.1 protein_id gnl|my_center|LOCUS_34440 3889429 3890655 gene locus_tag LOCUS_34450 3889429 3890655 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279118.1 protein_id gnl|my_center|LOCUS_34450 3890713 3891540 gene locus_tag LOCUS_34460 3890713 3891540 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021151.1 protein_id gnl|my_center|LOCUS_34460 3891937 3892284 gene locus_tag LOCUS_34470 3891937 3892284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 3893813 3892473 gene locus_tag LOCUS_34480 3893813 3892473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 3894471 3894235 gene locus_tag LOCUS_34490 3894471 3894235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34490 3895187 3895651 gene locus_tag LOCUS_34500 3895187 3895651 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065043.1 protein_id gnl|my_center|LOCUS_34500 3895686 3897092 gene locus_tag LOCUS_34510 3895686 3897092 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066177.1 protein_id gnl|my_center|LOCUS_34510 3897206 3897466 gene locus_tag LOCUS_34520 3897206 3897466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34520 3898811 3897936 gene locus_tag LOCUS_34530 3898811 3897936 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021142.1 protein_id gnl|my_center|LOCUS_34530 3899894 3899694 gene locus_tag LOCUS_34540 3899894 3899694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 3900186 3899938 gene locus_tag LOCUS_34550 3900186 3899938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 3900819 3900313 gene locus_tag LOCUS_34560 3900819 3900313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 3907497 3900826 gene locus_tag LOCUS_34570 3907497 3900826 CDS product DUF2341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065292.1 protein_id gnl|my_center|LOCUS_34570 3908079 3907576 gene locus_tag LOCUS_34580 3908079 3907576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 3908835 3908200 gene locus_tag LOCUS_34590 3908835 3908200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 3909157 3909468 gene locus_tag LOCUS_34600 3909157 3909468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 3911654 3909561 gene locus_tag LOCUS_34610 3911654 3909561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 3912246 3911839 gene locus_tag LOCUS_34620 3912246 3911839 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023146.1 protein_id gnl|my_center|LOCUS_34620 3913732 3913956 gene locus_tag LOCUS_34630 3913732 3913956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 3914507 3914420 gene locus_tag LOCUS_t00430 3914507 3914420 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3914687 3914600 gene locus_tag LOCUS_t00440 3914687 3914600 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3915745 3914945 gene locus_tag LOCUS_34640 3915745 3914945 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879771.1 protein_id gnl|my_center|LOCUS_34640 3916198 3915818 gene locus_tag LOCUS_34650 3916198 3915818 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021138.1 protein_id gnl|my_center|LOCUS_34650 3916869 3916201 gene locus_tag LOCUS_34660 3916869 3916201 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021137.1 protein_id gnl|my_center|LOCUS_34660 3917350 3916892 gene locus_tag LOCUS_34670 3917350 3916892 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066175.1 protein_id gnl|my_center|LOCUS_34670 3918158 3917703 gene locus_tag LOCUS_34680 3918158 3917703 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083908.1 protein_id gnl|my_center|LOCUS_34680 3918869 3919657 gene locus_tag LOCUS_34690 3918869 3919657 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948483.1 protein_id gnl|my_center|LOCUS_34690 3919662 3921335 gene locus_tag LOCUS_34700 3919662 3921335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948484.1 protein_id gnl|my_center|LOCUS_34700 3922186 3922323 gene locus_tag LOCUS_34710 3922186 3922323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 3922940 3922856 gene locus_tag LOCUS_t00450 3922940 3922856 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3924068 3923052 gene locus_tag LOCUS_34720 3924068 3923052 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021133.1 protein_id gnl|my_center|LOCUS_34720 3925039 3924497 gene locus_tag LOCUS_34730 3925039 3924497 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021132.1 protein_id gnl|my_center|LOCUS_34730 3925659 3925039 gene locus_tag LOCUS_34740 3925659 3925039 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021131.1 protein_id gnl|my_center|LOCUS_34740 3926380 3926925 gene locus_tag LOCUS_34750 3926380 3926925 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021127.1 protein_id gnl|my_center|LOCUS_34750 3927341 3927063 gene locus_tag LOCUS_34760 3927341 3927063 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065040.1 protein_id gnl|my_center|LOCUS_34760 3928678 3928031 gene locus_tag LOCUS_34770 3928678 3928031 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021125.1 protein_id gnl|my_center|LOCUS_34770 3930243 3928768 gene locus_tag LOCUS_34780 gene secY 3930243 3928768 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021124.1 protein_id gnl|my_center|LOCUS_34780 3930806 3930384 gene locus_tag LOCUS_34790 3930806 3930384 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021123.1 protein_id gnl|my_center|LOCUS_34790 3931279 3930818 gene locus_tag LOCUS_34800 3931279 3930818 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021122.1 protein_id gnl|my_center|LOCUS_34800 3931907 3931281 gene locus_tag LOCUS_34810 3931907 3931281 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021121.1 protein_id gnl|my_center|LOCUS_34810 3932441 3931917 gene locus_tag LOCUS_34820 3932441 3931917 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021120.1 protein_id gnl|my_center|LOCUS_34820 3932910 3932458 gene locus_tag LOCUS_34830 3932910 3932458 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021119.1 protein_id gnl|my_center|LOCUS_34830 3933355 3932912 gene locus_tag LOCUS_34840 3933355 3932912 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066173.1 protein_id gnl|my_center|LOCUS_34840 3933888 3933358 gene locus_tag LOCUS_34850 gene rpl6p 3933888 3933358 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021117.1 protein_id gnl|my_center|LOCUS_34850 3934295 3933903 gene locus_tag LOCUS_34860 3934295 3933903 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021116.1 protein_id gnl|my_center|LOCUS_34860 3934458 3934306 gene locus_tag LOCUS_34870 3934458 3934306 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021115.1 protein_id gnl|my_center|LOCUS_34870 3934968 3934459 gene locus_tag LOCUS_34880 3934968 3934459 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021114.1 protein_id gnl|my_center|LOCUS_34880 3935669 3934965 gene locus_tag LOCUS_34890 3935669 3934965 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021113.1 protein_id gnl|my_center|LOCUS_34890 3936033 3935683 gene locus_tag LOCUS_34900 gene rplX 3936033 3935683 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065039.1 protein_id gnl|my_center|LOCUS_34900 3936442 3936044 gene locus_tag LOCUS_34910 gene rpl14p 3936442 3936044 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021111.1 protein_id gnl|my_center|LOCUS_34910 3936768 3936439 gene locus_tag LOCUS_34920 3936768 3936439 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021110.1 protein_id gnl|my_center|LOCUS_34920 3937105 3936773 gene locus_tag LOCUS_34930 3937105 3936773 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021109.1 protein_id gnl|my_center|LOCUS_34930 3937298 3937095 gene locus_tag LOCUS_34940 gene rpmC 3937298 3937095 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021108.1 protein_id gnl|my_center|LOCUS_34940 3938224 3937298 gene locus_tag LOCUS_34950 3938224 3937298 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021107.1 protein_id gnl|my_center|LOCUS_34950 3938680 3938225 gene locus_tag LOCUS_34960 3938680 3938225 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021106.1 protein_id gnl|my_center|LOCUS_34960 3939102 3938692 gene locus_tag LOCUS_34970 3939102 3938692 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021105.1 protein_id gnl|my_center|LOCUS_34970 3939834 3939118 gene locus_tag LOCUS_34980 3939834 3939118 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021104.1 protein_id gnl|my_center|LOCUS_34980 3940093 3939845 gene locus_tag LOCUS_34990 3940093 3939845 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021103.1 protein_id gnl|my_center|LOCUS_34990 3940851 3940090 gene locus_tag LOCUS_35000 gene rpl4p 3940851 3940090 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021102.1 protein_id gnl|my_center|LOCUS_35000 3941871 3940858 gene locus_tag LOCUS_35010 gene rpl3p 3941871 3940858 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021101.1 protein_id gnl|my_center|LOCUS_35010 3943118 3942855 gene locus_tag LOCUS_35020 3943118 3942855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 3944658 3943135 gene locus_tag LOCUS_35030 3944658 3943135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 3945100 3944696 gene locus_tag LOCUS_35040 3945100 3944696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 3945883 3945263 gene locus_tag LOCUS_35050 3945883 3945263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 3946294 3946139 gene locus_tag LOCUS_35060 3946294 3946139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 3947424 3947185 gene locus_tag LOCUS_35070 3947424 3947185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 3948461 3947595 gene locus_tag LOCUS_35080 3948461 3947595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 3949352 3950893 gene locus_tag LOCUS_35090 3949352 3950893 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860105.1 protein_id gnl|my_center|LOCUS_35090 3951145 3952845 gene locus_tag LOCUS_35100 3951145 3952845 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021096.1 protein_id gnl|my_center|LOCUS_35100 3953051 3953827 gene locus_tag LOCUS_35110 3953051 3953827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021095.1 protein_id gnl|my_center|LOCUS_35110 3953827 3954840 gene locus_tag LOCUS_35120 3953827 3954840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 3954858 3955886 gene locus_tag LOCUS_35130 3954858 3955886 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024333.1 protein_id gnl|my_center|LOCUS_35130 3955950 3957056 gene locus_tag LOCUS_35140 3955950 3957056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 3957171 3958130 gene locus_tag LOCUS_35150 3957171 3958130 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869707.1 protein_id gnl|my_center|LOCUS_35150 3958139 3959278 gene locus_tag LOCUS_35160 gene pseC 3958139 3959278 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_35160 3959414 3960727 gene locus_tag LOCUS_35170 3959414 3960727 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860184.1 protein_id gnl|my_center|LOCUS_35170 3960897 3960739 gene locus_tag LOCUS_35180 3960897 3960739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 3962366 3962773 gene locus_tag LOCUS_35190 3962366 3962773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 3964140 3962863 gene locus_tag LOCUS_35200 3964140 3962863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 3967937 3964992 gene locus_tag LOCUS_35210 3967937 3964992 CDS product disaggregatase related repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065037.1 protein_id gnl|my_center|LOCUS_35210 3969472 3969624 gene locus_tag LOCUS_35220 3969472 3969624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 3970287 3970871 gene locus_tag LOCUS_35230 3970287 3970871 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990773.1 protein_id gnl|my_center|LOCUS_35230 3971594 3971070 gene locus_tag LOCUS_35240 3971594 3971070 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021067.1 protein_id gnl|my_center|LOCUS_35240 3972865 3971732 gene locus_tag LOCUS_35250 3972865 3971732 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021066.1 protein_id gnl|my_center|LOCUS_35250 3974161 3973145 gene locus_tag LOCUS_35260 3974161 3973145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021064.1 protein_id gnl|my_center|LOCUS_35260 3974611 3974321 gene locus_tag LOCUS_35270 3974611 3974321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 3974872 3974627 gene locus_tag LOCUS_35280 3974872 3974627 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021062.1 protein_id gnl|my_center|LOCUS_35280 3975704 3975102 gene locus_tag LOCUS_35290 3975704 3975102 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021058.1 protein_id gnl|my_center|LOCUS_35290 3977503 3975701 gene locus_tag LOCUS_35300 gene iorA 3977503 3975701 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065029.1 protein_id gnl|my_center|LOCUS_35300 3978706 3977891 gene locus_tag LOCUS_35310 3978706 3977891 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021056.1 protein_id gnl|my_center|LOCUS_35310 3981784 3978869 gene locus_tag LOCUS_35320 3981784 3978869 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279148.1 protein_id gnl|my_center|LOCUS_35320 3982512 3982294 gene locus_tag LOCUS_35330 3982512 3982294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 3983250 3982675 gene locus_tag LOCUS_35340 3983250 3982675 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279091.1 protein_id gnl|my_center|LOCUS_35340 3983855 3983382 gene locus_tag LOCUS_35350 3983855 3983382 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020237.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35350 3984219 3984689 gene locus_tag LOCUS_35360 3984219 3984689 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020238.1 protein_id gnl|my_center|LOCUS_35360 3984734 3985945 gene locus_tag LOCUS_35370 3984734 3985945 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020239.1 protein_id gnl|my_center|LOCUS_35370 3986764 3986285 gene locus_tag LOCUS_35380 3986764 3986285 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095644076.1 protein_id gnl|my_center|LOCUS_35380 3988507 3990924 gene locus_tag LOCUS_35390 gene cdhA 3988507 3990924 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023758.1 protein_id gnl|my_center|LOCUS_35390 3990927 3991439 gene locus_tag LOCUS_35400 gene cdhB 3990927 3991439 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023759.1 protein_id gnl|my_center|LOCUS_35400 3991464 3992867 gene locus_tag LOCUS_35410 gene cdhC 3991464 3992867 CDS product CO dehydrogenase/CO-methylating acetyl-CoA synthase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023760.1 protein_id gnl|my_center|LOCUS_35410 3992923 3993684 gene locus_tag LOCUS_35420 3992923 3993684 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023761.1 protein_id gnl|my_center|LOCUS_35420 3993933 3995246 gene locus_tag LOCUS_35430 gene cdhD 3993933 3995246 CDS product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023762.1 protein_id gnl|my_center|LOCUS_35430 3995250 3996659 gene locus_tag LOCUS_35440 gene acsC 3995250 3996659 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021046.1 protein_id gnl|my_center|LOCUS_35440 3997852 3997190 gene locus_tag LOCUS_35450 gene pyrF 3997852 3997190 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065013.1 protein_id gnl|my_center|LOCUS_35450 3998810 3997857 gene locus_tag LOCUS_35460 3998810 3997857 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021005.1 protein_id gnl|my_center|LOCUS_35460 3999267 3999908 gene locus_tag LOCUS_35470 3999267 3999908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 4000056 4000901 gene locus_tag LOCUS_35480 4000056 4000901 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768886.1 protein_id gnl|my_center|LOCUS_35480 4001342 4000950 gene locus_tag LOCUS_35490 4001342 4000950 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021003.1 protein_id gnl|my_center|LOCUS_35490 4002198 4001764 gene locus_tag LOCUS_35500 4002198 4001764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589515.1 protein_id gnl|my_center|LOCUS_35500 4002653 4003396 gene locus_tag LOCUS_35510 4002653 4003396 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021001.1 protein_id gnl|my_center|LOCUS_35510 4003546 4004778 gene locus_tag LOCUS_35520 4003546 4004778 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021000.1 protein_id gnl|my_center|LOCUS_35520 4005875 4005057 gene locus_tag LOCUS_35530 4005875 4005057 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020999.1 protein_id gnl|my_center|LOCUS_35530 4006586 4007329 gene locus_tag LOCUS_35540 4006586 4007329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 4007392 4007970 gene locus_tag LOCUS_35550 4007392 4007970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 4009042 4008128 gene locus_tag LOCUS_35560 gene nadA 4009042 4008128 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020997.1 protein_id gnl|my_center|LOCUS_35560 4010197 4009544 gene locus_tag LOCUS_35570 4010197 4009544 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_35570 4010705 4011538 gene locus_tag LOCUS_35580 gene nadC 4010705 4011538 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020993.1 protein_id gnl|my_center|LOCUS_35580 4012136 4013404 gene locus_tag LOCUS_35590 4012136 4013404 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020992.1 protein_id gnl|my_center|LOCUS_35590 4013501 4014616 gene locus_tag LOCUS_35600 4013501 4014616 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066160.1 protein_id gnl|my_center|LOCUS_35600 4014873 4015700 gene locus_tag LOCUS_35610 4014873 4015700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 4016487 4016969 gene locus_tag LOCUS_35620 4016487 4016969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 4017540 4017082 gene locus_tag LOCUS_35630 4017540 4017082 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020987.1 protein_id gnl|my_center|LOCUS_35630 4019049 4017808 gene locus_tag LOCUS_35640 4019049 4017808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020986.1 protein_id gnl|my_center|LOCUS_35640 4019744 4019175 gene locus_tag LOCUS_35650 4019744 4019175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 4020357 4019719 gene locus_tag LOCUS_35660 4020357 4019719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020984.1 protein_id gnl|my_center|LOCUS_35660 4020599 4020363 gene locus_tag LOCUS_35670 4020599 4020363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 4023224 4021983 gene locus_tag LOCUS_35680 gene hisS 4023224 4021983 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020981.1 protein_id gnl|my_center|LOCUS_35680 4023703 4025193 gene locus_tag LOCUS_35690 gene cobD 4023703 4025193 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020980.1 protein_id gnl|my_center|LOCUS_35690 4025190 4026176 gene locus_tag LOCUS_35700 4025190 4026176 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020979.1 protein_id gnl|my_center|LOCUS_35700 4026506 4027048 gene locus_tag LOCUS_35710 gene cobZ 4026506 4027048 CDS product alpha-ribazole phosphatase CobZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065005.1 protein_id gnl|my_center|LOCUS_35710 4027066 4027902 gene locus_tag LOCUS_35720 gene cobS 4027066 4027902 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020977.1 protein_id gnl|my_center|LOCUS_35720 4027887 4028498 gene locus_tag LOCUS_35730 4027887 4028498 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020976.1 protein_id gnl|my_center|LOCUS_35730 4028544 4029251 gene locus_tag LOCUS_35740 4028544 4029251 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020975.1 protein_id gnl|my_center|LOCUS_35740 4029251 4030213 gene locus_tag LOCUS_35750 4029251 4030213 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020974.1 protein_id gnl|my_center|LOCUS_35750 4030333 4030695 gene locus_tag LOCUS_35760 4030333 4030695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990763.1 protein_id gnl|my_center|LOCUS_35760 4031285 4036216 gene locus_tag LOCUS_35770 4031285 4036216 CDS product PKD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066275.1 protein_id gnl|my_center|LOCUS_35770 4036908 4036567 gene locus_tag LOCUS_35780 4036908 4036567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35780 4037556 4037026 gene locus_tag LOCUS_35790 4037556 4037026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35790 4039311 4038157 gene locus_tag LOCUS_35800 4039311 4038157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 4039617 4042373 gene locus_tag LOCUS_35810 4039617 4042373 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020246.1 protein_id gnl|my_center|LOCUS_35810 4043355 4042447 gene locus_tag LOCUS_35820 4043355 4042447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073998.1 protein_id gnl|my_center|LOCUS_35820 4044498 4045166 gene locus_tag LOCUS_35830 4044498 4045166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 4045349 4045176 gene locus_tag LOCUS_35840 4045349 4045176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 4046634 4046455 gene locus_tag LOCUS_35850 4046634 4046455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 4047971 4047288 gene locus_tag LOCUS_35860 4047971 4047288 CDS product DUF5591 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020965.1 protein_id gnl|my_center|LOCUS_35860 4048374 4048784 gene locus_tag LOCUS_35870 4048374 4048784 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020964.1 protein_id gnl|my_center|LOCUS_35870 4050046 4048865 gene locus_tag LOCUS_35880 4050046 4048865 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020963.1 protein_id gnl|my_center|LOCUS_35880 4050618 4050127 gene locus_tag LOCUS_35890 4050618 4050127 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020962.1 protein_id gnl|my_center|LOCUS_35890 4051066 4050689 gene locus_tag LOCUS_35900 4051066 4050689 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020961.1 protein_id gnl|my_center|LOCUS_35900 4051620 4051946 gene locus_tag LOCUS_35910 4051620 4051946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020960.1 protein_id gnl|my_center|LOCUS_35910 4052208 4052894 gene locus_tag LOCUS_35920 4052208 4052894 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064997.1 protein_id gnl|my_center|LOCUS_35920 4053740 4053189 gene locus_tag LOCUS_35930 4053740 4053189 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107760.1 protein_id gnl|my_center|LOCUS_35930 4054170 4054676 gene locus_tag LOCUS_35940 4054170 4054676 CDS product NOB1 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066159.1 protein_id gnl|my_center|LOCUS_35940 4054841 4055455 gene locus_tag LOCUS_35950 4054841 4055455 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020957.1 protein_id gnl|my_center|LOCUS_35950 4057805 4055673 gene locus_tag LOCUS_35960 4057805 4055673 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064996.1 protein_id gnl|my_center|LOCUS_35960 4058357 4059139 gene locus_tag LOCUS_35970 4058357 4059139 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020954.1 protein_id gnl|my_center|LOCUS_35970 4059191 4060495 gene locus_tag LOCUS_35980 4059191 4060495 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020953.1 protein_id gnl|my_center|LOCUS_35980 4061904 4060570 gene locus_tag LOCUS_35990 4061904 4060570 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066157.1 protein_id gnl|my_center|LOCUS_35990 4062580 4061972 gene locus_tag LOCUS_36000 gene hisH 4062580 4061972 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020951.1 protein_id gnl|my_center|LOCUS_36000 4063230 4063715 gene locus_tag LOCUS_36010 4063230 4063715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048170305.1 protein_id gnl|my_center|LOCUS_36010 4063770 4064216 gene locus_tag LOCUS_36020 4063770 4064216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020949.1 protein_id gnl|my_center|LOCUS_36020 4065130 4064450 gene locus_tag LOCUS_36030 4065130 4064450 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064923.1 protein_id gnl|my_center|LOCUS_36030 4066187 4065303 gene locus_tag LOCUS_36040 4066187 4065303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990760.1 protein_id gnl|my_center|LOCUS_36040 4068263 4066341 gene locus_tag LOCUS_36050 4068263 4066341 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020947.1 protein_id gnl|my_center|LOCUS_36050 4068820 4068458 gene locus_tag LOCUS_36060 gene hisI 4068820 4068458 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020946.1 protein_id gnl|my_center|LOCUS_36060 4069156 4070559 gene locus_tag LOCUS_36070 4069156 4070559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 4072676 4070697 gene locus_tag LOCUS_36080 4072676 4070697 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064995.1 protein_id gnl|my_center|LOCUS_36080 4072835 4073977 gene locus_tag LOCUS_36090 4072835 4073977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064994.1 protein_id gnl|my_center|LOCUS_36090 4074271 4074591 gene locus_tag LOCUS_36100 4074271 4074591 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020942.1 protein_id gnl|my_center|LOCUS_36100 4074673 4075035 gene locus_tag LOCUS_36110 4074673 4075035 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064993.1 protein_id gnl|my_center|LOCUS_36110 4075284 4076654 gene locus_tag LOCUS_36120 4075284 4076654 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_36120 4076934 4076818 gene locus_tag LOCUS_r00070 4076934 4076818 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4079910 4077024 gene locus_tag LOCUS_r00080 4079910 4077024 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4081620 4080152 gene locus_tag LOCUS_r00090 4081620 4080152 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4082640 4082804 gene locus_tag LOCUS_36130 4082640 4082804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 4082806 4083594 gene locus_tag LOCUS_36140 4082806 4083594 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020938.1 protein_id gnl|my_center|LOCUS_36140 4083591 4084139 gene locus_tag LOCUS_36150 4083591 4084139 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020937.1 protein_id gnl|my_center|LOCUS_36150 4085574 4084171 gene locus_tag LOCUS_36160 4085574 4084171 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020936.1 protein_id gnl|my_center|LOCUS_36160 4086563 4085913 gene locus_tag LOCUS_36170 gene phoU 4086563 4085913 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020935.1 protein_id gnl|my_center|LOCUS_36170 4087361 4086570 gene locus_tag LOCUS_36180 gene pstB 4087361 4086570 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020934.1 protein_id gnl|my_center|LOCUS_36180 4088400 4087477 gene locus_tag LOCUS_36190 gene pstA 4088400 4087477 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990843.1 protein_id gnl|my_center|LOCUS_36190 4089293 4088403 gene locus_tag LOCUS_36200 gene pstC 4089293 4088403 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_36200 4090258 4089341 gene locus_tag LOCUS_36210 4090258 4089341 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_36210 4093538 4090734 gene locus_tag LOCUS_36220 4093538 4090734 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064990.1 protein_id gnl|my_center|LOCUS_36220 4095705 4093645 gene locus_tag LOCUS_36230 4095705 4093645 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020921.1 protein_id gnl|my_center|LOCUS_36230 4097481 4095724 gene locus_tag LOCUS_36240 4097481 4095724 CDS product S-layer protein domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020920.1 protein_id gnl|my_center|LOCUS_36240 4097836 4098429 gene locus_tag LOCUS_36250 4097836 4098429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020919.1 protein_id gnl|my_center|LOCUS_36250 4098468 4099997 gene locus_tag LOCUS_36260 4098468 4099997 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020918.1 protein_id gnl|my_center|LOCUS_36260 4100002 4101741 gene locus_tag LOCUS_36270 4100002 4101741 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020917.1 protein_id gnl|my_center|LOCUS_36270 4101751 4105608 gene locus_tag LOCUS_36280 gene cobN 4101751 4105608 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020916.1 protein_id gnl|my_center|LOCUS_36280 4105622 4107211 gene locus_tag LOCUS_36290 4105622 4107211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066150.1 protein_id gnl|my_center|LOCUS_36290 4107309 4109039 gene locus_tag LOCUS_36300 4107309 4109039 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990758.1 protein_id gnl|my_center|LOCUS_36300 4109155 4110048 gene locus_tag LOCUS_36310 4109155 4110048 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020913.1 protein_id gnl|my_center|LOCUS_36310 4110045 4110812 gene locus_tag LOCUS_36320 4110045 4110812 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064988.1 protein_id gnl|my_center|LOCUS_36320 4110812 4111537 gene locus_tag LOCUS_36330 4110812 4111537 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020911.1 protein_id gnl|my_center|LOCUS_36330 4111996 4112790 gene locus_tag LOCUS_36340 4111996 4112790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 4112879 4113832 gene locus_tag LOCUS_36350 4112879 4113832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 4113813 4114130 gene locus_tag LOCUS_36360 4113813 4114130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 4115446 4114493 gene locus_tag LOCUS_36370 4115446 4114493 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020910.1 protein_id gnl|my_center|LOCUS_36370 4122849 4115860 gene locus_tag LOCUS_36380 4122849 4115860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 4123744 4124391 gene locus_tag LOCUS_36390 4123744 4124391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36390 4124548 4126659 gene locus_tag LOCUS_36400 4124548 4126659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36400 4126725 4127513 gene locus_tag LOCUS_36410 4126725 4127513 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020906.1 protein_id gnl|my_center|LOCUS_36410 4128537 4128112 gene locus_tag LOCUS_36420 4128537 4128112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 4129348 4128800 gene locus_tag LOCUS_36430 4129348 4128800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 4129845 4129363 gene locus_tag LOCUS_36440 4129845 4129363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020904.1 protein_id gnl|my_center|LOCUS_36440 4130369 4132273 gene locus_tag LOCUS_36450 4130369 4132273 CDS product methyltransferase cognate corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064984.1 protein_id gnl|my_center|LOCUS_36450 4132539 4134473 gene locus_tag LOCUS_36460 4132539 4134473 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064983.1 protein_id gnl|my_center|LOCUS_36460 4134568 4136175 gene locus_tag LOCUS_36470 4134568 4136175 CDS product TCP-1/cpn60 chaperonin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064982.1 protein_id gnl|my_center|LOCUS_36470 4136717 4136989 gene locus_tag LOCUS_36480 4136717 4136989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36480 4137095 4137787 gene locus_tag LOCUS_36490 4137095 4137787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36490 4138829 4139320 gene locus_tag LOCUS_36500 4138829 4139320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36500 4139599 4139880 gene locus_tag LOCUS_36510 4139599 4139880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36510 4139930 4140181 gene locus_tag LOCUS_36520 4139930 4140181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 4140501 4140908 gene locus_tag LOCUS_36530 4140501 4140908 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_36530 4141633 4141253 gene locus_tag LOCUS_36540 4141633 4141253 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023831.1 protein_id gnl|my_center|LOCUS_36540 4142028 4141630 gene locus_tag LOCUS_36550 gene crcB 4142028 4141630 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023830.1 protein_id gnl|my_center|LOCUS_36550 4142685 4144364 gene locus_tag LOCUS_36560 4142685 4144364 CDS product methylamine methyltransferase corrinoid protein reductive activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020893.1 protein_id gnl|my_center|LOCUS_36560 4144406 4144777 gene locus_tag LOCUS_36570 4144406 4144777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36570 4145287 4144835 gene locus_tag LOCUS_36580 4145287 4144835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 4145883 4145443 gene locus_tag LOCUS_36590 4145883 4145443 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466989.1 protein_id gnl|my_center|LOCUS_36590 4147591 4146515 gene locus_tag LOCUS_36600 4147591 4146515 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064979.1 protein_id gnl|my_center|LOCUS_36600 4148777 4149160 gene locus_tag LOCUS_36610 4148777 4149160 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020879.1 protein_id gnl|my_center|LOCUS_36610 4149237 4150541 gene locus_tag LOCUS_36620 4149237 4150541 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020878.1 protein_id gnl|my_center|LOCUS_36620 4150543 4152261 gene locus_tag LOCUS_36630 4150543 4152261 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064976.1 protein_id gnl|my_center|LOCUS_36630 4152262 4153020 gene locus_tag LOCUS_36640 4152262 4153020 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020876.1 protein_id gnl|my_center|LOCUS_36640 4153948 4153361 gene locus_tag LOCUS_36650 4153948 4153361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020874.1 protein_id gnl|my_center|LOCUS_36650 4156090 4154123 gene locus_tag LOCUS_36660 4156090 4154123 CDS product S-layer protein SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020873.1 protein_id gnl|my_center|LOCUS_36660 4157120 4157695 gene locus_tag LOCUS_36670 4157120 4157695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020871.1 protein_id gnl|my_center|LOCUS_36670 4158104 4159747 gene locus_tag LOCUS_36680 4158104 4159747 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020870.1 protein_id gnl|my_center|LOCUS_36680 4161176 4161571 gene locus_tag LOCUS_36690 4161176 4161571 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066143.1 protein_id gnl|my_center|LOCUS_36690 4162085 4162588 gene locus_tag LOCUS_36700 4162085 4162588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020868.1 protein_id gnl|my_center|LOCUS_36700 4162621 4164021 gene locus_tag LOCUS_36710 4162621 4164021 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064974.1 protein_id gnl|my_center|LOCUS_36710 4165037 4164279 gene locus_tag LOCUS_36720 4165037 4164279 CDS product NrpR regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020866.1 protein_id gnl|my_center|LOCUS_36720 4166010 4165270 gene locus_tag LOCUS_36730 4166010 4165270 CDS product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020865.1 protein_id gnl|my_center|LOCUS_36730 4166971 4166222 gene locus_tag LOCUS_36740 4166971 4166222 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020864.1 protein_id gnl|my_center|LOCUS_36740 4167437 4168360 gene locus_tag LOCUS_36750 gene mdh 4167437 4168360 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020863.1 protein_id gnl|my_center|LOCUS_36750 4168637 4168894 gene locus_tag LOCUS_36760 4168637 4168894 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020862.1 protein_id gnl|my_center|LOCUS_36760 4168903 4169646 gene locus_tag LOCUS_36770 4168903 4169646 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_36770 4169684 4170637 gene locus_tag LOCUS_36780 4169684 4170637 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020859.1 protein_id gnl|my_center|LOCUS_36780 4170812 4171984 gene locus_tag LOCUS_36790 4170812 4171984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064972.1 protein_id gnl|my_center|LOCUS_36790 4172548 4174692 gene locus_tag LOCUS_36800 4172548 4174692 CDS product CARDB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162013069.1 protein_id gnl|my_center|LOCUS_36800 4175113 4174757 gene locus_tag LOCUS_36810 4175113 4174757 CDS product DUF5518 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020856.1 protein_id gnl|my_center|LOCUS_36810 4175516 4175205 gene locus_tag LOCUS_36820 4175516 4175205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 4175680 4176099 gene locus_tag LOCUS_36830 4175680 4176099 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064971.1 protein_id gnl|my_center|LOCUS_36830 4176289 4176516 gene locus_tag LOCUS_36840 4176289 4176516 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020854.1 protein_id gnl|my_center|LOCUS_36840 4176492 4176956 gene locus_tag LOCUS_36850 4176492 4176956 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020853.1 protein_id gnl|my_center|LOCUS_36850 4177150 4178304 gene locus_tag LOCUS_36860 4177150 4178304 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020852.1 protein_id gnl|my_center|LOCUS_36860 4178376 4179035 gene locus_tag LOCUS_36870 4178376 4179035 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020851.1 protein_id gnl|my_center|LOCUS_36870 4179060 4179857 gene locus_tag LOCUS_36880 4179060 4179857 CDS product DUF5602 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020850.1 protein_id gnl|my_center|LOCUS_36880 4181126 4179969 gene locus_tag LOCUS_36890 4181126 4179969 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020849.1 protein_id gnl|my_center|LOCUS_36890 4182008 4182142 gene locus_tag LOCUS_36900 4182008 4182142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 4182567 4183262 gene locus_tag LOCUS_36910 4182567 4183262 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064970.1 protein_id gnl|my_center|LOCUS_36910 4185565 4183430 gene locus_tag LOCUS_36920 4185565 4183430 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243331.1 protein_id gnl|my_center|LOCUS_36920 4187051 4186182 gene locus_tag LOCUS_36930 4187051 4186182 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020847.1 protein_id gnl|my_center|LOCUS_36930 4188511 4187579 gene locus_tag LOCUS_36940 4188511 4187579 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020846.1 protein_id gnl|my_center|LOCUS_36940 4188828 4189511 gene locus_tag LOCUS_36950 4188828 4189511 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020844.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36950 4190928 4189801 gene locus_tag LOCUS_36960 4190928 4189801 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949066.1 protein_id gnl|my_center|LOCUS_36960 4192373 4193503 gene locus_tag LOCUS_36970 4192373 4193503 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020842.1 protein_id gnl|my_center|LOCUS_36970 4193478 4194185 gene locus_tag LOCUS_36980 4193478 4194185 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064968.1 protein_id gnl|my_center|LOCUS_36980 4194319 4194642 gene locus_tag LOCUS_36990 4194319 4194642 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020840.1 protein_id gnl|my_center|LOCUS_36990 4195639 4194710 gene locus_tag LOCUS_37000 4195639 4194710 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020839.1 protein_id gnl|my_center|LOCUS_37000 4195932 4195783 gene locus_tag LOCUS_37010 4195932 4195783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 4197063 4196065 gene locus_tag LOCUS_37020 4197063 4196065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 4197894 4198964 gene locus_tag LOCUS_37030 4197894 4198964 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020838.1 protein_id gnl|my_center|LOCUS_37030 4199248 4200279 gene locus_tag LOCUS_37040 4199248 4200279 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990756.1 protein_id gnl|my_center|LOCUS_37040 4200368 4201354 gene locus_tag LOCUS_37050 4200368 4201354 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064967.1 protein_id gnl|my_center|LOCUS_37050 4202971 4202078 gene locus_tag LOCUS_37060 4202971 4202078 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064966.1 protein_id gnl|my_center|LOCUS_37060 4203435 4203719 gene locus_tag LOCUS_37070 4203435 4203719 CDS product non-histone chromosomal MC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023527.1 protein_id gnl|my_center|LOCUS_37070 4205160 4204774 gene locus_tag LOCUS_37080 4205160 4204774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 4205857 4206168 gene locus_tag LOCUS_37090 4205857 4206168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 4206434 4207558 gene locus_tag LOCUS_37100 4206434 4207558 CDS product DUF5050 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064964.1 protein_id gnl|my_center|LOCUS_37100 4207653 4208513 gene locus_tag LOCUS_37110 4207653 4208513 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020826.1 protein_id gnl|my_center|LOCUS_37110 4209280 4208561 gene locus_tag LOCUS_37120 4209280 4208561 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020825.1 protein_id gnl|my_center|LOCUS_37120 4209552 4209367 gene locus_tag LOCUS_37130 4209552 4209367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 4209630 4209884 gene locus_tag LOCUS_37140 4209630 4209884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37140 4211207 4210182 gene locus_tag LOCUS_37150 gene mtaA 4211207 4210182 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020823.1 protein_id gnl|my_center|LOCUS_37150 4211380 4211694 gene locus_tag LOCUS_37160 4211380 4211694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 4213678 4212083 gene locus_tag LOCUS_37170 4213678 4212083 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064963.1 protein_id gnl|my_center|LOCUS_37170 4215475 4214417 gene locus_tag LOCUS_37180 4215475 4214417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020820.1 protein_id gnl|my_center|LOCUS_37180 4216044 4216583 gene locus_tag LOCUS_37190 4216044 4216583 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020819.1 protein_id gnl|my_center|LOCUS_37190 4219256 4216671 gene locus_tag LOCUS_37200 4219256 4216671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 4219819 4220046 gene locus_tag LOCUS_37210 4219819 4220046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 4220353 4220655 gene locus_tag LOCUS_37220 4220353 4220655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020818.1 protein_id gnl|my_center|LOCUS_37220 4220705 4221634 gene locus_tag LOCUS_37230 4220705 4221634 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020817.1 protein_id gnl|my_center|LOCUS_37230 4222960 4221722 gene locus_tag LOCUS_37240 4222960 4221722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 4223376 4223215 gene locus_tag LOCUS_37250 4223376 4223215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 4223742 4224143 gene locus_tag LOCUS_37260 4223742 4224143 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020816.1 protein_id gnl|my_center|LOCUS_37260 4224820 4224425 gene locus_tag LOCUS_37270 4224820 4224425 CDS product DUF2769 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023170.1 protein_id gnl|my_center|LOCUS_37270 4225600 4225094 gene locus_tag LOCUS_37280 4225600 4225094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064960.1 protein_id gnl|my_center|LOCUS_37280 4226262 4225966 gene locus_tag LOCUS_37290 4226262 4225966 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020811.1 protein_id gnl|my_center|LOCUS_37290 4226490 4226693 gene locus_tag LOCUS_37300 4226490 4226693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 4226694 4226957 gene locus_tag LOCUS_37310 4226694 4226957 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879831.1 protein_id gnl|my_center|LOCUS_37310 4227165 4226917 gene locus_tag LOCUS_37320 4227165 4226917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 4227914 4228405 gene locus_tag LOCUS_37330 4227914 4228405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 4228426 4228749 gene locus_tag LOCUS_37340 4228426 4228749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 4230582 4228945 gene locus_tag LOCUS_37350 4230582 4228945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070104981.1 protein_id gnl|my_center|LOCUS_37350 4233590 4230705 gene locus_tag LOCUS_37360 4233590 4230705 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020807.1 protein_id gnl|my_center|LOCUS_37360 4235367 4233844 gene locus_tag LOCUS_37370 4235367 4233844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 4237219 4235675 gene locus_tag LOCUS_37380 gene lysS 4237219 4235675 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020805.1 protein_id gnl|my_center|LOCUS_37380 4240742 4237662 gene locus_tag LOCUS_37390 4240742 4237662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 4242073 4241216 gene locus_tag LOCUS_37400 4242073 4241216 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020802.1 protein_id gnl|my_center|LOCUS_37400 4242409 4242885 gene locus_tag LOCUS_37410 4242409 4242885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 4244139 4243222 gene locus_tag LOCUS_37420 4244139 4243222 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020797.1 protein_id gnl|my_center|LOCUS_37420 4244795 4244370 gene locus_tag LOCUS_37430 4244795 4244370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 4246695 4245274 gene locus_tag LOCUS_37440 gene cysS 4246695 4245274 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020794.1 protein_id gnl|my_center|LOCUS_37440 4247442 4246849 gene locus_tag LOCUS_37450 4247442 4246849 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020793.1 protein_id gnl|my_center|LOCUS_37450 4249529 4247511 gene locus_tag LOCUS_37460 4249529 4247511 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023047.1 protein_id gnl|my_center|LOCUS_37460 4250573 4249914 gene locus_tag LOCUS_37470 4250573 4249914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 4250795 4251280 gene locus_tag LOCUS_37480 4250795 4251280 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844895.1 protein_id gnl|my_center|LOCUS_37480 4252629 4251343 gene locus_tag LOCUS_37490 4252629 4251343 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970232.1 protein_id gnl|my_center|LOCUS_37490 4253529 4253074 gene locus_tag LOCUS_37500 4253529 4253074 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990749.1 protein_id gnl|my_center|LOCUS_37500 4254466 4254182 gene locus_tag LOCUS_37510 4254466 4254182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 4256270 4255023 gene locus_tag LOCUS_37520 4256270 4255023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 4256373 4256233 gene locus_tag LOCUS_37530 4256373 4256233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 4257970 4257704 gene locus_tag LOCUS_37540 4257970 4257704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 4258634 4259302 gene locus_tag LOCUS_37550 4258634 4259302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 4260492 4259731 gene locus_tag LOCUS_37560 4260492 4259731 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385631.1 protein_id gnl|my_center|LOCUS_37560 4262041 4260980 gene locus_tag LOCUS_37570 4262041 4260980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064954.1 protein_id gnl|my_center|LOCUS_37570 4263023 4262343 gene locus_tag LOCUS_37580 4263023 4262343 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020781.1 protein_id gnl|my_center|LOCUS_37580 4263335 4263742 gene locus_tag LOCUS_37590 4263335 4263742 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064953.1 protein_id gnl|my_center|LOCUS_37590 4263866 4263793 gene locus_tag LOCUS_t00460 4263866 4263793 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4264078 4265820 gene locus_tag LOCUS_37600 4264078 4265820 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020773.1 protein_id gnl|my_center|LOCUS_37600 4265914 4267668 gene locus_tag LOCUS_37610 gene polX 4265914 4267668 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020772.1 protein_id gnl|my_center|LOCUS_37610 4267781 4269043 gene locus_tag LOCUS_37620 gene lysA 4267781 4269043 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020771.1 protein_id gnl|my_center|LOCUS_37620 4270538 4269240 gene locus_tag LOCUS_37630 4270538 4269240 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_37630 4271163 4271759 gene locus_tag LOCUS_37640 4271163 4271759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020769.1 protein_id gnl|my_center|LOCUS_37640 4271869 4272207 gene locus_tag LOCUS_37650 4271869 4272207 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020768.1 protein_id gnl|my_center|LOCUS_37650 4272980 4272420 gene locus_tag LOCUS_37660 4272980 4272420 CDS product ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020770.1 protein_id gnl|my_center|LOCUS_37660 4273757 4274023 gene locus_tag LOCUS_37670 4273757 4274023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37670 4274198 4275166 gene locus_tag LOCUS_37680 4274198 4275166 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022154.1 protein_id gnl|my_center|LOCUS_37680 4275246 4276463 gene locus_tag LOCUS_37690 4275246 4276463 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_37690 4276467 4277945 gene locus_tag LOCUS_37700 gene hpnJ 4276467 4277945 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941811.1 protein_id gnl|my_center|LOCUS_37700 4277996 4279024 gene locus_tag LOCUS_37710 4277996 4279024 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060762.1 protein_id gnl|my_center|LOCUS_37710 4279946 4279812 gene locus_tag LOCUS_37720 4279946 4279812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 4280823 4281029 gene locus_tag LOCUS_37730 4280823 4281029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 4281083 4281349 gene locus_tag LOCUS_37740 4281083 4281349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 4282757 4281891 gene locus_tag LOCUS_37750 4282757 4281891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 4283235 4282846 gene locus_tag LOCUS_37760 4283235 4282846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 4283270 4283569 gene locus_tag LOCUS_37770 4283270 4283569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 4285960 4285055 gene locus_tag LOCUS_37780 4285960 4285055 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_37780 4287783 4285969 gene locus_tag LOCUS_37790 4287783 4285969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 4289244 4287799 gene locus_tag LOCUS_37800 4289244 4287799 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060802.1 protein_id gnl|my_center|LOCUS_37800 4289977 4289258 gene locus_tag LOCUS_37810 4289977 4289258 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022168.1 protein_id gnl|my_center|LOCUS_37810 4290783 4289974 gene locus_tag LOCUS_37820 gene rfbD 4290783 4289974 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023678.1 protein_id gnl|my_center|LOCUS_37820 4291712 4290756 gene locus_tag LOCUS_37830 gene rfbB 4291712 4290756 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023679.1 protein_id gnl|my_center|LOCUS_37830 4292243 4292401 gene locus_tag LOCUS_37840 4292243 4292401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 4293458 4293213 gene locus_tag LOCUS_37850 4293458 4293213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 4293982 4298949 gene locus_tag LOCUS_37860 4293982 4298949 CDS product PKD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066275.1 protein_id gnl|my_center|LOCUS_37860 4299273 4299410 gene locus_tag LOCUS_37870 4299273 4299410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 4300719 4299559 gene locus_tag LOCUS_37880 gene pscS 4300719 4299559 CDS product O-phospho-L-seryl-tRNA:Cys-tRNA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020767.1 protein_id gnl|my_center|LOCUS_37880 4301283 4301005 gene locus_tag LOCUS_37890 4301283 4301005 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020766.1 protein_id gnl|my_center|LOCUS_37890 4302371 4301397 gene locus_tag LOCUS_37900 4302371 4301397 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020765.1 protein_id gnl|my_center|LOCUS_37900 4302541 4302368 gene locus_tag LOCUS_37910 4302541 4302368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 4303374 4302781 gene locus_tag LOCUS_37920 4303374 4302781 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020764.1 protein_id gnl|my_center|LOCUS_37920 4304449 4303442 gene locus_tag LOCUS_37930 gene dph2 4304449 4303442 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020763.1 protein_id gnl|my_center|LOCUS_37930 4305002 4304430 gene locus_tag LOCUS_37940 gene hpt 4305002 4304430 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020762.1 protein_id gnl|my_center|LOCUS_37940 4307524 4305431 gene locus_tag LOCUS_37950 4307524 4305431 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020760.1 protein_id gnl|my_center|LOCUS_37950 4308730 4307801 gene locus_tag LOCUS_37960 gene cofD 4308730 4307801 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066127.1 protein_id gnl|my_center|LOCUS_37960 4309249 4310466 gene locus_tag LOCUS_37970 4309249 4310466 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020758.1 protein_id gnl|my_center|LOCUS_37970 4310471 4310851 gene locus_tag LOCUS_37980 4310471 4310851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020757.1 protein_id gnl|my_center|LOCUS_37980 4310851 4311402 gene locus_tag LOCUS_37990 4310851 4311402 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020756.1 protein_id gnl|my_center|LOCUS_37990 4311607 4311684 gene locus_tag LOCUS_t00470 4311607 4311684 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4312222 4312650 gene locus_tag LOCUS_38000 4312222 4312650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020755.1 protein_id gnl|my_center|LOCUS_38000 4315019 4312887 gene locus_tag LOCUS_38010 4315019 4312887 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990744.1 protein_id gnl|my_center|LOCUS_38010 4316358 4315009 gene locus_tag LOCUS_38020 4316358 4315009 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020753.1 protein_id gnl|my_center|LOCUS_38020 4316918 4316553 gene locus_tag LOCUS_38030 4316918 4316553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064952.1 protein_id gnl|my_center|LOCUS_38030 4317593 4317096 gene locus_tag LOCUS_38040 4317593 4317096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020749.1 protein_id gnl|my_center|LOCUS_38040 4318103 4318927 gene locus_tag LOCUS_38050 4318103 4318927 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066126.1 protein_id gnl|my_center|LOCUS_38050 4319418 4321202 gene locus_tag LOCUS_38060 4319418 4321202 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020746.1 protein_id gnl|my_center|LOCUS_38060 4321225 4322172 gene locus_tag LOCUS_38070 4321225 4322172 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020745.1 protein_id gnl|my_center|LOCUS_38070 4322169 4323137 gene locus_tag LOCUS_38080 4322169 4323137 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020744.1 protein_id gnl|my_center|LOCUS_38080 4323134 4324087 gene locus_tag LOCUS_38090 4323134 4324087 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020743.1 protein_id gnl|my_center|LOCUS_38090 4324069 4324767 gene locus_tag LOCUS_38100 4324069 4324767 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990743.1 protein_id gnl|my_center|LOCUS_38100 4325551 4324832 gene locus_tag LOCUS_38110 4325551 4324832 CDS product dihydromethanopterin reductase (acceptor) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020741.1 protein_id gnl|my_center|LOCUS_38110 4326259 4325621 gene locus_tag LOCUS_38120 4326259 4325621 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020740.1 protein_id gnl|my_center|LOCUS_38120 4327311 4326256 gene locus_tag LOCUS_38130 4327311 4326256 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020739.1 protein_id gnl|my_center|LOCUS_38130 4328437 4327298 gene locus_tag LOCUS_38140 4328437 4327298 CDS product methanogenesis marker 9 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020738.1 protein_id gnl|my_center|LOCUS_38140 4330478 4329303 gene locus_tag LOCUS_38150 4330478 4329303 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020737.1 protein_id gnl|my_center|LOCUS_38150 4331940 4330816 gene locus_tag LOCUS_38160 4331940 4330816 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064950.1 protein_id gnl|my_center|LOCUS_38160 4332960 4331962 gene locus_tag LOCUS_38170 4332960 4331962 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020792.1 protein_id gnl|my_center|LOCUS_38170 4333844 4333215 gene locus_tag LOCUS_38180 4333844 4333215 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020735.1 protein_id gnl|my_center|LOCUS_38180 4334472 4333837 gene locus_tag LOCUS_38190 4334472 4333837 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020734.1 protein_id gnl|my_center|LOCUS_38190 4335816 4334572 gene locus_tag LOCUS_38200 4335816 4334572 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020733.1 protein_id gnl|my_center|LOCUS_38200 4336601 4335819 gene locus_tag LOCUS_38210 4336601 4335819 CDS product disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064949.1 protein_id gnl|my_center|LOCUS_38210 4337880 4337206 gene locus_tag LOCUS_38220 4337880 4337206 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064948.1 protein_id gnl|my_center|LOCUS_38220 4338448 4338645 gene locus_tag LOCUS_38230 4338448 4338645 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020728.1 protein_id gnl|my_center|LOCUS_38230 4338677 4339435 gene locus_tag LOCUS_38240 4338677 4339435 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064947.1 protein_id gnl|my_center|LOCUS_38240 4339560 4341665 gene locus_tag LOCUS_38250 4339560 4341665 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020726.1 protein_id gnl|my_center|LOCUS_38250 4341810 4342100 gene locus_tag LOCUS_38260 4341810 4342100 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020725.1 protein_id gnl|my_center|LOCUS_38260 4342242 4342865 gene locus_tag LOCUS_38270 4342242 4342865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066125.1 protein_id gnl|my_center|LOCUS_38270 4342896 4343858 gene locus_tag LOCUS_38280 4342896 4343858 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020723.1 protein_id gnl|my_center|LOCUS_38280 4344643 4344065 gene locus_tag LOCUS_38290 4344643 4344065 CDS product S-layer protein domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064946.1 protein_id gnl|my_center|LOCUS_38290 4345646 4344669 gene locus_tag LOCUS_38300 4345646 4344669 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020721.1 protein_id gnl|my_center|LOCUS_38300 4347245 4345764 gene locus_tag LOCUS_38310 4347245 4345764 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020720.1 protein_id gnl|my_center|LOCUS_38310 4348989 4347268 gene locus_tag LOCUS_38320 gene oadA 4348989 4347268 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020719.1 protein_id gnl|my_center|LOCUS_38320 4350446 4349475 gene locus_tag LOCUS_38330 4350446 4349475 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020718.1 protein_id gnl|my_center|LOCUS_38330 4350786 4350998 gene locus_tag LOCUS_38340 4350786 4350998 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020717.1 protein_id gnl|my_center|LOCUS_38340 4351524 4351261 gene locus_tag LOCUS_38350 4351524 4351261 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020716.1 protein_id gnl|my_center|LOCUS_38350 4352211 4351699 gene locus_tag LOCUS_38360 4352211 4351699 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064945.1 protein_id gnl|my_center|LOCUS_38360 4353342 4352338 gene locus_tag LOCUS_38370 4353342 4352338 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064944.1 protein_id gnl|my_center|LOCUS_38370 4353990 4353655 gene locus_tag LOCUS_38380 4353990 4353655 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020712.1 protein_id gnl|my_center|LOCUS_38380 4354850 4354038 gene locus_tag LOCUS_38390 4354850 4354038 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020711.1 protein_id gnl|my_center|LOCUS_38390 4355437 4354847 gene locus_tag LOCUS_38400 4355437 4354847 CDS product electron transport complex protein RnfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064941.1 protein_id gnl|my_center|LOCUS_38400 4356074 4355439 gene locus_tag LOCUS_38410 4356074 4355439 CDS product RnfABCDGE type electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064940.1 protein_id gnl|my_center|LOCUS_38410 4356639 4356079 gene locus_tag LOCUS_38420 4356639 4356079 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020708.1 protein_id gnl|my_center|LOCUS_38420 4357535 4356636 gene locus_tag LOCUS_38430 4357535 4356636 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020707.1 protein_id gnl|my_center|LOCUS_38430 4358883 4357540 gene locus_tag LOCUS_38440 4358883 4357540 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860093.1 protein_id gnl|my_center|LOCUS_38440 4360324 4358861 gene locus_tag LOCUS_38450 4360324 4358861 CDS product methanogenesis multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064939.1 protein_id gnl|my_center|LOCUS_38450 4361583 4362482 gene locus_tag LOCUS_38460 4361583 4362482 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020704.1 protein_id gnl|my_center|LOCUS_38460 4363131 4362586 gene locus_tag LOCUS_38470 gene thpR 4363131 4362586 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066123.1 protein_id gnl|my_center|LOCUS_38470 4363558 4364442 gene locus_tag LOCUS_38480 4363558 4364442 CDS product diadenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064938.1 protein_id gnl|my_center|LOCUS_38480 4364624 4365343 gene locus_tag LOCUS_38490 4364624 4365343 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064937.1 protein_id gnl|my_center|LOCUS_38490 4367907 4365718 gene locus_tag LOCUS_38500 4367907 4365718 CDS product S-layer protein domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990741.1 protein_id gnl|my_center|LOCUS_38500 4369349 4368297 gene locus_tag LOCUS_38510 4369349 4368297 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020699.1 protein_id gnl|my_center|LOCUS_38510 4371712 4369346 gene locus_tag LOCUS_38520 gene rqcH 4371712 4369346 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020698.1 protein_id gnl|my_center|LOCUS_38520 4372751 4371891 gene locus_tag LOCUS_38530 4372751 4371891 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020696.1 protein_id gnl|my_center|LOCUS_38530 4373162 4374406 gene locus_tag LOCUS_38540 gene priS 4373162 4374406 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020695.1 protein_id gnl|my_center|LOCUS_38540 4374372 4375091 gene locus_tag LOCUS_38550 4374372 4375091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064936.1 protein_id gnl|my_center|LOCUS_38550 4375486 4375764 gene locus_tag LOCUS_38560 4375486 4375764 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020693.1 protein_id gnl|my_center|LOCUS_38560 4375771 4375959 gene locus_tag LOCUS_38570 4375771 4375959 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020692.1 protein_id gnl|my_center|LOCUS_38570 4376032 4376838 gene locus_tag LOCUS_38580 4376032 4376838 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064935.1 protein_id gnl|my_center|LOCUS_38580 4377009 4377779 gene locus_tag LOCUS_38590 4377009 4377779 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020689.1 protein_id gnl|my_center|LOCUS_38590 4377900 4379303 gene locus_tag LOCUS_38600 4377900 4379303 CDS product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020688.1 protein_id gnl|my_center|LOCUS_38600 4379488 4379572 gene locus_tag LOCUS_t00480 4379488 4379572 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4380227 4380391 gene locus_tag LOCUS_38610 4380227 4380391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 4380472 4381227 gene locus_tag LOCUS_38620 4380472 4381227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 4381521 4382012 gene locus_tag LOCUS_38630 4381521 4382012 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020686.1 protein_id gnl|my_center|LOCUS_38630 4382349 4382519 gene locus_tag LOCUS_38640 4382349 4382519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 4383035 4383841 gene locus_tag LOCUS_38650 4383035 4383841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020685.1 protein_id gnl|my_center|LOCUS_38650 4384297 4384947 gene locus_tag LOCUS_38660 4384297 4384947 CDS product PEGA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064932.1 protein_id gnl|my_center|LOCUS_38660 4386250 4385066 gene locus_tag LOCUS_38670 4386250 4385066 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020683.1 protein_id gnl|my_center|LOCUS_38670 4387103 4386465 gene locus_tag LOCUS_38680 4387103 4386465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064931.1 protein_id gnl|my_center|LOCUS_38680 4387911 4387228 gene locus_tag LOCUS_38690 4387911 4387228 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020681.1 protein_id gnl|my_center|LOCUS_38690 4388874 4388047 gene locus_tag LOCUS_38700 4388874 4388047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064930.1 protein_id gnl|my_center|LOCUS_38700 4390395 4389280 gene locus_tag LOCUS_38710 gene tnpB 4390395 4389280 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_38710 4390775 4390467 gene locus_tag LOCUS_38720 4390775 4390467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 4392550 4390940 gene locus_tag LOCUS_38730 gene groL 4392550 4390940 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020679.1 protein_id gnl|my_center|LOCUS_38730 4392986 4392708 gene locus_tag LOCUS_38740 gene groES 4392986 4392708 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020678.1 protein_id gnl|my_center|LOCUS_38740 4393243 4393650 gene locus_tag LOCUS_38750 4393243 4393650 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020677.1 protein_id gnl|my_center|LOCUS_38750 4393772 4394965 gene locus_tag LOCUS_38760 4393772 4394965 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020676.1 protein_id gnl|my_center|LOCUS_38760 4397146 4395152 gene locus_tag LOCUS_38770 4397146 4395152 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064929.1 protein_id gnl|my_center|LOCUS_38770 4398124 4397297 gene locus_tag LOCUS_38780 4398124 4397297 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066121.1 protein_id gnl|my_center|LOCUS_38780 4398669 4398914 gene locus_tag LOCUS_38790 4398669 4398914 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066120.1 protein_id gnl|my_center|LOCUS_38790 4399626 4399003 gene locus_tag LOCUS_38800 4399626 4399003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020671.1 protein_id gnl|my_center|LOCUS_38800 4400551 4399709 gene locus_tag LOCUS_38810 4400551 4399709 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020670.1 protein_id gnl|my_center|LOCUS_38810 4401005 4401970 gene locus_tag LOCUS_38820 4401005 4401970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020669.1 protein_id gnl|my_center|LOCUS_38820 4402905 4402216 gene locus_tag LOCUS_38830 4402905 4402216 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022579.1 protein_id gnl|my_center|LOCUS_38830 4404675 4403458 gene locus_tag LOCUS_38840 4404675 4403458 CDS product cell wall-binding repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948956.1 protein_id gnl|my_center|LOCUS_38840 4406558 4404672 gene locus_tag LOCUS_38850 4406558 4404672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 4406599 4406838 gene locus_tag LOCUS_38860 4406599 4406838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 4408312 4406888 gene locus_tag LOCUS_38870 4408312 4406888 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006194892.1 protein_id gnl|my_center|LOCUS_38870 4410571 4408532 gene locus_tag LOCUS_38880 4410571 4408532 CDS product MASE3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990925.1 protein_id gnl|my_center|LOCUS_38880 4413107 4411089 gene locus_tag LOCUS_38890 4413107 4411089 CDS product MASE3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020667.1 protein_id gnl|my_center|LOCUS_38890 4413308 4413964 gene locus_tag LOCUS_38900 4413308 4413964 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064926.1 protein_id gnl|my_center|LOCUS_38900 4414098 4414775 gene locus_tag LOCUS_38910 4414098 4414775 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064925.1 protein_id gnl|my_center|LOCUS_38910 4414971 4415963 gene locus_tag LOCUS_38920 4414971 4415963 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020666.1 protein_id gnl|my_center|LOCUS_38920 4418841 4416430 gene locus_tag LOCUS_38930 4418841 4416430 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279148.1 protein_id gnl|my_center|LOCUS_38930 4419284 4419751 gene locus_tag LOCUS_38940 4419284 4419751 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020665.1 protein_id gnl|my_center|LOCUS_38940 4420298 4421095 gene locus_tag LOCUS_38950 gene csnA 4420298 4421095 CDS product chitosanase CsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027289.1 protein_id gnl|my_center|LOCUS_38950 4421914 4422720 gene locus_tag LOCUS_38960 4421914 4422720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 4423745 4424800 gene locus_tag LOCUS_38970 4423745 4424800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 4426133 4428748 gene locus_tag LOCUS_38980 4426133 4428748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 4430089 4429853 gene locus_tag LOCUS_38990 4430089 4429853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 4431667 4430957 gene locus_tag LOCUS_39000 4431667 4430957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 4433336 4432191 gene locus_tag LOCUS_39010 4433336 4432191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172210.1 protein_id gnl|my_center|LOCUS_39010 4434343 4433525 gene locus_tag LOCUS_39020 4434343 4433525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 4434651 4434310 gene locus_tag LOCUS_39030 4434651 4434310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 4435507 4435436 gene locus_tag LOCUS_t00490 4435507 4435436 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4437078 4436068 gene locus_tag LOCUS_39040 4437078 4436068 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020662.1 protein_id gnl|my_center|LOCUS_39040 4437223 4437654 gene locus_tag LOCUS_39050 4437223 4437654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755872.1 protein_id gnl|my_center|LOCUS_39050 4438365 4437712 gene locus_tag LOCUS_39060 4438365 4437712 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064923.1 protein_id gnl|my_center|LOCUS_39060 4439579 4438566 gene locus_tag LOCUS_39070 4439579 4438566 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020659.1 protein_id gnl|my_center|LOCUS_39070 4440039 4439770 gene locus_tag LOCUS_39080 4440039 4439770 CDS product Gar1/Naf1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020658.1 protein_id gnl|my_center|LOCUS_39080 4440352 4443003 gene locus_tag LOCUS_39090 gene ppdK 4440352 4443003 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020657.1 protein_id gnl|my_center|LOCUS_39090 4444250 4443285 gene locus_tag LOCUS_39100 4444250 4443285 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066119.1 protein_id gnl|my_center|LOCUS_39100 4445629 4444286 gene locus_tag LOCUS_39110 4445629 4444286 CDS product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020654.1 protein_id gnl|my_center|LOCUS_39110 4448105 4447008 gene locus_tag LOCUS_39120 gene fni 4448105 4447008 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020653.1 protein_id gnl|my_center|LOCUS_39120 4448893 4448102 gene locus_tag LOCUS_39130 4448893 4448102 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020652.1 protein_id gnl|my_center|LOCUS_39130 4449928 4449023 gene locus_tag LOCUS_39140 4449928 4449023 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064922.1 protein_id gnl|my_center|LOCUS_39140 4450923 4450126 gene locus_tag LOCUS_39150 4450923 4450126 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020650.1 protein_id gnl|my_center|LOCUS_39150 4451738 4450998 gene locus_tag LOCUS_39160 gene rpsB 4451738 4450998 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020649.1 protein_id gnl|my_center|LOCUS_39160 4451991 4451809 gene locus_tag LOCUS_39170 4451991 4451809 CDS product DNA-directed RNA polymerase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020648.1 protein_id gnl|my_center|LOCUS_39170 4452179 4452104 gene locus_tag LOCUS_t00500 4452179 4452104 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4452368 4452180 gene locus_tag LOCUS_39180 4452368 4452180 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020647.1 protein_id gnl|my_center|LOCUS_39180 4452781 4452377 gene locus_tag LOCUS_39190 4452781 4452377 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020646.1 protein_id gnl|my_center|LOCUS_39190 4453217 4452795 gene locus_tag LOCUS_39200 4453217 4452795 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020645.1 protein_id gnl|my_center|LOCUS_39200 4453608 4453228 gene locus_tag LOCUS_39210 4453608 4453228 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064921.1 protein_id gnl|my_center|LOCUS_39210 4454043 4454231 gene locus_tag LOCUS_39220 4454043 4454231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 4454342 4455973 gene locus_tag LOCUS_39230 4454342 4455973 CDS product alpha-keto acid decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020643.1 protein_id gnl|my_center|LOCUS_39230 4457155 4456646 gene locus_tag LOCUS_39240 4457155 4456646 CDS product DUF2240 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020642.1 protein_id gnl|my_center|LOCUS_39240 4458924 4457344 gene locus_tag LOCUS_39250 gene serA 4458924 4457344 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020641.1 protein_id gnl|my_center|LOCUS_39250 4459946 4459080 gene locus_tag LOCUS_39260 4459946 4459080 CDS product RPA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064919.1 protein_id gnl|my_center|LOCUS_39260 4461300 4459939 gene locus_tag LOCUS_39270 4461300 4459939 CDS product Single-stranded DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020639.1 protein_id gnl|my_center|LOCUS_39270 4462779 4461670 gene locus_tag LOCUS_39280 4462779 4461670 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020257.1 protein_id gnl|my_center|LOCUS_39280 4463556 4464647 gene locus_tag LOCUS_39290 4463556 4464647 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020637.1 protein_id gnl|my_center|LOCUS_39290 4466136 4465168 gene locus_tag LOCUS_39300 4466136 4465168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 4468681 4466966 gene locus_tag LOCUS_39310 4468681 4466966 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064918.1 protein_id gnl|my_center|LOCUS_39310 4469229 4468924 gene locus_tag LOCUS_39320 4469229 4468924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020635.1 protein_id gnl|my_center|LOCUS_39320 4469963 4469229 gene locus_tag LOCUS_39330 4469963 4469229 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020634.1 protein_id gnl|my_center|LOCUS_39330 4470820 4470041 gene locus_tag LOCUS_39340 4470820 4470041 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020633.1 protein_id gnl|my_center|LOCUS_39340 4471725 4470820 gene locus_tag LOCUS_39350 4471725 4470820 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066118.1 protein_id gnl|my_center|LOCUS_39350 4472717 4471764 gene locus_tag LOCUS_39360 gene hemC 4472717 4471764 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020631.1 protein_id gnl|my_center|LOCUS_39360 4474073 4472799 gene locus_tag LOCUS_39370 gene hemL 4474073 4472799 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020630.1 protein_id gnl|my_center|LOCUS_39370 4475443 4474469 gene locus_tag LOCUS_39380 gene hemB 4475443 4474469 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020627.1 protein_id gnl|my_center|LOCUS_39380 4476886 4475540 gene locus_tag LOCUS_39390 gene hemA 4476886 4475540 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020626.1 protein_id gnl|my_center|LOCUS_39390 4477737 4477075 gene locus_tag LOCUS_39400 4477737 4477075 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020625.1 protein_id gnl|my_center|LOCUS_39400 4478273 4477815 gene locus_tag LOCUS_39410 gene ahbB 4478273 4477815 CDS product siroheme decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064915.1 protein_id gnl|my_center|LOCUS_39410 4478835 4478278 gene locus_tag LOCUS_39420 4478835 4478278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 4479887 4478838 gene locus_tag LOCUS_39430 gene ahbD 4479887 4478838 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_39430 4480696 4480187 gene locus_tag LOCUS_39440 4480696 4480187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39440 4481825 4480800 gene locus_tag LOCUS_39450 4481825 4480800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39450 4482160 4481906 gene locus_tag LOCUS_39460 4482160 4481906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39460 4483070 4482165 gene locus_tag LOCUS_39470 4483070 4482165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39470 4483505 4484350 gene locus_tag LOCUS_39480 4483505 4484350 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877445.1 protein_id gnl|my_center|LOCUS_39480 4484791 4484351 gene locus_tag LOCUS_39490 4484791 4484351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064914.1 protein_id gnl|my_center|LOCUS_39490 4485665 4485267 gene locus_tag LOCUS_39500 4485665 4485267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 4486534 4485668 gene locus_tag LOCUS_39510 4486534 4485668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39510 4487724 4486540 gene locus_tag LOCUS_39520 4487724 4486540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39520 4488056 4487715 gene locus_tag LOCUS_39530 4488056 4487715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39530 4490437 4488143 gene locus_tag LOCUS_39540 4490437 4488143 CDS product DUF3160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860088.1 protein_id gnl|my_center|LOCUS_39540 4491688 4490708 gene locus_tag LOCUS_39550 4491688 4490708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020604.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39550 4493379 4492282 gene locus_tag LOCUS_39560 gene aroC 4493379 4492282 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_39560 4494239 4493385 gene locus_tag LOCUS_39570 4494239 4493385 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064910.1 protein_id gnl|my_center|LOCUS_39570 4495347 4494604 gene locus_tag LOCUS_39580 gene ribB 4495347 4494604 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020597.1 protein_id gnl|my_center|LOCUS_39580 4496030 4495347 gene locus_tag LOCUS_39590 4496030 4495347 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169713.1 protein_id gnl|my_center|LOCUS_39590 4496215 4496709 gene locus_tag LOCUS_39600 4496215 4496709 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020595.1 protein_id gnl|my_center|LOCUS_39600 4496890 4497525 gene locus_tag LOCUS_39610 4496890 4497525 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020594.1 protein_id gnl|my_center|LOCUS_39610 4497485 4498201 gene locus_tag LOCUS_39620 4497485 4498201 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020592.1 protein_id gnl|my_center|LOCUS_39620 4498315 4498779 gene locus_tag LOCUS_39630 4498315 4498779 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020591.1 protein_id gnl|my_center|LOCUS_39630 4498976 4499797 gene locus_tag LOCUS_39640 gene hisF 4498976 4499797 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020590.1 protein_id gnl|my_center|LOCUS_39640 4499940 4500227 gene locus_tag LOCUS_39650 4499940 4500227 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020589.1 protein_id gnl|my_center|LOCUS_39650 4500469 4500870 gene locus_tag LOCUS_39660 4500469 4500870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020588.1 protein_id gnl|my_center|LOCUS_39660 4501933 4501079 gene locus_tag LOCUS_39670 4501933 4501079 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048298.1 protein_id gnl|my_center|LOCUS_39670 4502107 4504710 gene locus_tag LOCUS_39680 4502107 4504710 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020587.1 protein_id gnl|my_center|LOCUS_39680 4504735 4505184 gene locus_tag LOCUS_39690 4504735 4505184 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020586.1 protein_id gnl|my_center|LOCUS_39690 4505336 4505593 gene locus_tag LOCUS_39700 4505336 4505593 CDS product pro-sigmaK processing inhibitor BofA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020585.1 protein_id gnl|my_center|LOCUS_39700 4506412 4505702 gene locus_tag LOCUS_39710 4506412 4505702 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020584.1 protein_id gnl|my_center|LOCUS_39710 4508043 4506430 gene locus_tag LOCUS_39720 gene lysS 4508043 4506430 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066108.1 protein_id gnl|my_center|LOCUS_39720 4510466 4509063 gene locus_tag LOCUS_39730 gene mtbB 4510466 4509063 CDS product dimethylamine methyltransferase MtbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:P58971 transl_except (pos:complement(4509399..4509401),aa:Pyl) note codon on position 356 is pyrrolysine amber codon. protein_id gnl|my_center|LOCUS_39730 4510673 4510524 gene locus_tag LOCUS_39740 4510673 4510524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 4510987 4510694 gene locus_tag LOCUS_39750 4510987 4510694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020966.1 protein_id gnl|my_center|LOCUS_39750 4512035 4510989 gene locus_tag LOCUS_39760 4512035 4510989 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020579.1 protein_id gnl|my_center|LOCUS_39760 4513206 4512556 gene locus_tag LOCUS_39770 4513206 4512556 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020578.1 protein_id gnl|my_center|LOCUS_39770 4514724 4513237 gene locus_tag LOCUS_39780 gene mttB 4514724 4513237 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:P58973 transl_except (pos:complement(4513723..4513725),aa:Pyl) note codon on position 334 is pyrrolysine amber codon. protein_id gnl|my_center|LOCUS_39780 4515254 4514751 gene locus_tag LOCUS_39790 4515254 4514751 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020576.1 protein_id gnl|my_center|LOCUS_39790 4517466 4516306 gene locus_tag LOCUS_39800 4517466 4516306 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020575.1 protein_id gnl|my_center|LOCUS_39800 4517789 4518319 gene locus_tag LOCUS_39810 4517789 4518319 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020574.1 protein_id gnl|my_center|LOCUS_39810 4518498 4518575 gene locus_tag LOCUS_t00510 4518498 4518575 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4520542 4518671 gene locus_tag LOCUS_39820 4520542 4518671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 4521282 4523984 gene locus_tag LOCUS_39830 gene mutS 4521282 4523984 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020572.1 protein_id gnl|my_center|LOCUS_39830 4524037 4526163 gene locus_tag LOCUS_39840 gene mutL 4524037 4526163 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020571.1 protein_id gnl|my_center|LOCUS_39840 4526702 4527721 gene locus_tag LOCUS_39850 4526702 4527721 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020570.1 protein_id gnl|my_center|LOCUS_39850 4527790 4528377 gene locus_tag LOCUS_39860 4527790 4528377 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020569.1 protein_id gnl|my_center|LOCUS_39860 4529235 4528471 gene locus_tag LOCUS_39870 4529235 4528471 CDS product A24 family peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020568.1 protein_id gnl|my_center|LOCUS_39870 4529496 4529570 gene locus_tag LOCUS_t00520 4529496 4529570 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4529863 4529558 gene locus_tag LOCUS_39880 4529863 4529558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 4530909 4530361 gene locus_tag LOCUS_39890 4530909 4530361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 4531541 4531008 gene locus_tag LOCUS_39900 4531541 4531008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 4532008 4531838 gene locus_tag LOCUS_39910 4532008 4531838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39910 4533819 4532329 gene locus_tag LOCUS_39920 4533819 4532329 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022102.1 protein_id gnl|my_center|LOCUS_39920 4536249 4534219 gene locus_tag LOCUS_39930 4536249 4534219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 4537717 4536227 gene locus_tag LOCUS_39940 4537717 4536227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 4538128 4538697 gene locus_tag LOCUS_39950 4538128 4538697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020530.1 protein_id gnl|my_center|LOCUS_39950 4540547 4538868 gene locus_tag LOCUS_39960 4540547 4538868 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065307.1 protein_id gnl|my_center|LOCUS_39960 4540765 4542144 gene locus_tag LOCUS_39970 4540765 4542144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 4545483 4542730 gene locus_tag LOCUS_39980 4545483 4542730 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022108.1 protein_id gnl|my_center|LOCUS_39980 4546971 4546066 gene locus_tag LOCUS_39990 4546971 4546066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 4547369 4547184 gene locus_tag LOCUS_40000 4547369 4547184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 4548193 4547543 gene locus_tag LOCUS_40010 4548193 4547543 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020542.1 protein_id gnl|my_center|LOCUS_40010 4549781 4548534 gene locus_tag LOCUS_40020 4549781 4548534 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942660.1 protein_id gnl|my_center|LOCUS_40020 4550184 4549744 gene locus_tag LOCUS_40030 gene tnpA 4550184 4549744 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249883.1 protein_id gnl|my_center|LOCUS_40030 4551850 4551530 gene locus_tag LOCUS_40040 4551850 4551530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 4552485 4552180 gene locus_tag LOCUS_40050 4552485 4552180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 4552952 4553158 gene locus_tag LOCUS_40060 4552952 4553158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066103.1 protein_id gnl|my_center|LOCUS_40060 4553623 4553396 gene locus_tag LOCUS_40070 4553623 4553396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 4553884 4554468 gene locus_tag LOCUS_40080 4553884 4554468 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990735.1 protein_id gnl|my_center|LOCUS_40080 4554945 4556108 gene locus_tag LOCUS_40090 4554945 4556108 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 protein_id gnl|my_center|LOCUS_40090 4556499 4556657 gene locus_tag LOCUS_40100 4556499 4556657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 4557355 4558599 gene locus_tag LOCUS_40110 4557355 4558599 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990798.1 protein_id gnl|my_center|LOCUS_40110 4558887 4559045 gene locus_tag LOCUS_40120 4558887 4559045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 4560051 4559665 gene locus_tag LOCUS_40130 4560051 4559665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40130 4562099 4560828 gene locus_tag LOCUS_40140 4562099 4560828 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263870.1 protein_id gnl|my_center|LOCUS_40140 4563800 4562595 gene locus_tag LOCUS_40150 4563800 4562595 CDS product PGF-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020536.1 protein_id gnl|my_center|LOCUS_40150 4564636 4564496 gene locus_tag LOCUS_40160 4564636 4564496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 4567574 4565016 gene locus_tag LOCUS_40170 4567574 4565016 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020539.1 protein_id gnl|my_center|LOCUS_40170 4568712 4567912 gene locus_tag LOCUS_40180 4568712 4567912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 4569023 4571428 gene locus_tag LOCUS_40190 4569023 4571428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 4571422 4571898 gene locus_tag LOCUS_40200 4571422 4571898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 4571968 4572147 gene locus_tag LOCUS_40210 4571968 4572147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 4572211 4572807 gene locus_tag LOCUS_40220 4572211 4572807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40220 4574301 4572844 gene locus_tag LOCUS_40230 4574301 4572844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 4574562 4574335 gene locus_tag LOCUS_40240 4574562 4574335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 4575578 4574550 gene locus_tag LOCUS_40250 4575578 4574550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 4577723 4576830 gene locus_tag LOCUS_40260 4577723 4576830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020518.1 protein_id gnl|my_center|LOCUS_40260 4580096 4578093 gene locus_tag LOCUS_40270 4580096 4578093 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065598.1 protein_id gnl|my_center|LOCUS_40270 4580695 4580543 gene locus_tag LOCUS_40280 4580695 4580543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40280 4581368 4580907 gene locus_tag LOCUS_40290 4581368 4580907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40290 4582807 4581554 gene locus_tag LOCUS_40300 4582807 4581554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 4583097 4584641 gene locus_tag LOCUS_40310 4583097 4584641 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048142299.1 protein_id gnl|my_center|LOCUS_40310 4584686 4586206 gene locus_tag LOCUS_40320 4584686 4586206 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020516.1 protein_id gnl|my_center|LOCUS_40320 4586244 4588211 gene locus_tag LOCUS_40330 4586244 4588211 CDS product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020515.1 protein_id gnl|my_center|LOCUS_40330 4590076 4591860 gene locus_tag LOCUS_40340 4590076 4591860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 4591860 4592645 gene locus_tag LOCUS_40350 4591860 4592645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 4592953 4593132 gene locus_tag LOCUS_40360 4592953 4593132 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020514.1 protein_id gnl|my_center|LOCUS_40360 4593702 4593226 gene locus_tag LOCUS_40370 4593702 4593226 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020513.1 protein_id gnl|my_center|LOCUS_40370 4594646 4593855 gene locus_tag LOCUS_40380 4594646 4593855 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064889.1 protein_id gnl|my_center|LOCUS_40380 4595732 4594926 gene locus_tag LOCUS_40390 4595732 4594926 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020510.1 protein_id gnl|my_center|LOCUS_40390 4596717 4597493 gene locus_tag LOCUS_40400 gene mtaC 4596717 4597493 CDS product methanol--corrinoid protein MtaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020507.1 protein_id gnl|my_center|LOCUS_40400 4597504 4598889 gene locus_tag LOCUS_40410 gene mtaB 4597504 4598889 CDS product methanol--corrinoid protein co-methyltransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020506.1 protein_id gnl|my_center|LOCUS_40410 4599867 4598953 gene locus_tag LOCUS_40420 4599867 4598953 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860082.1 protein_id gnl|my_center|LOCUS_40420 4600710 4601876 gene locus_tag LOCUS_40430 4600710 4601876 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066094.1 protein_id gnl|my_center|LOCUS_40430 4601933 4603072 gene locus_tag LOCUS_40440 4601933 4603072 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020503.1 protein_id gnl|my_center|LOCUS_40440 4603833 4603174 gene locus_tag LOCUS_40450 4603833 4603174 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020502.1 protein_id gnl|my_center|LOCUS_40450 4604246 4604058 gene locus_tag LOCUS_40460 4604246 4604058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860425.1 protein_id gnl|my_center|LOCUS_40460 4604765 4604337 gene locus_tag LOCUS_40470 gene msrB 4604765 4604337 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066093.1 protein_id gnl|my_center|LOCUS_40470 4605012 4605461 gene locus_tag LOCUS_40480 4605012 4605461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064885.1 protein_id gnl|my_center|LOCUS_40480 4606774 4605563 gene locus_tag LOCUS_40490 4606774 4605563 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020498.1 protein_id gnl|my_center|LOCUS_40490 4607015 4608304 gene locus_tag LOCUS_40500 4607015 4608304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 4609519 4608932 gene locus_tag LOCUS_40510 4609519 4608932 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990729.1 protein_id gnl|my_center|LOCUS_40510 4610495 4609749 gene locus_tag LOCUS_40520 4610495 4609749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020494.1 protein_id gnl|my_center|LOCUS_40520 4613119 4610996 gene locus_tag LOCUS_40530 4613119 4610996 CDS product DUF2341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064883.1 protein_id gnl|my_center|LOCUS_40530 4613407 4613922 gene locus_tag LOCUS_40540 4613407 4613922 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020492.1 protein_id gnl|my_center|LOCUS_40540 4614023 4614826 gene locus_tag LOCUS_40550 4614023 4614826 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020491.1 protein_id gnl|my_center|LOCUS_40550 4617059 4616064 gene locus_tag LOCUS_40560 4617059 4616064 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066092.1 protein_id gnl|my_center|LOCUS_40560 4617323 4617826 gene locus_tag LOCUS_40570 4617323 4617826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020487.1 protein_id gnl|my_center|LOCUS_40570 4618707 4619012 gene locus_tag LOCUS_40580 4618707 4619012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020486.1 protein_id gnl|my_center|LOCUS_40580 4619278 4620336 gene locus_tag LOCUS_40590 4619278 4620336 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020485.1 protein_id gnl|my_center|LOCUS_40590 4620487 4620795 gene locus_tag LOCUS_40600 4620487 4620795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020484.1 protein_id gnl|my_center|LOCUS_40600 4621042 4621224 gene locus_tag LOCUS_40610 4621042 4621224 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020483.1 protein_id gnl|my_center|LOCUS_40610 4621319 4622347 gene locus_tag LOCUS_40620 gene asd 4621319 4622347 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020482.1 protein_id gnl|my_center|LOCUS_40620 4623780 4622590 gene locus_tag LOCUS_40630 gene larC 4623780 4622590 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020481.1 protein_id gnl|my_center|LOCUS_40630 4624656 4623853 gene locus_tag LOCUS_40640 gene larB 4624656 4623853 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020480.1 protein_id gnl|my_center|LOCUS_40640 4626168 4624969 gene locus_tag LOCUS_40650 4626168 4624969 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020474.1 protein_id gnl|my_center|LOCUS_40650 4626540 4626385 gene locus_tag LOCUS_40660 4626540 4626385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40660 4626919 4626551 gene locus_tag LOCUS_40670 4626919 4626551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40670 4627792 4627130 gene locus_tag LOCUS_40680 4627792 4627130 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020462.1 protein_id gnl|my_center|LOCUS_40680 4627965 4628675 gene locus_tag LOCUS_40690 4627965 4628675 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444615.1 protein_id gnl|my_center|LOCUS_40690 4628672 4629016 gene locus_tag LOCUS_40700 4628672 4629016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 4629394 4629185 gene locus_tag LOCUS_40710 4629394 4629185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 4630011 4629526 gene locus_tag LOCUS_40720 4630011 4629526 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_40720 4630458 4630036 gene locus_tag LOCUS_40730 4630458 4630036 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020469.1 protein_id gnl|my_center|LOCUS_40730 4631875 4630748 gene locus_tag LOCUS_40740 4631875 4630748 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755866.1 protein_id gnl|my_center|LOCUS_40740 4633062 4632484 gene locus_tag LOCUS_40750 4633062 4632484 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020425.1 protein_id gnl|my_center|LOCUS_40750 4633884 4633294 gene locus_tag LOCUS_40760 4633884 4633294 CDS product DUF111 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990917.1 protein_id gnl|my_center|LOCUS_40760 4635809 4634022 gene locus_tag LOCUS_40770 4635809 4634022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020427.1 protein_id gnl|my_center|LOCUS_40770 4636109 4636810 gene locus_tag LOCUS_40780 gene pyrH 4636109 4636810 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020429.1 protein_id gnl|my_center|LOCUS_40780 4636973 4638166 gene locus_tag LOCUS_40790 4636973 4638166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020430.1 protein_id gnl|my_center|LOCUS_40790 4638282 4639397 gene locus_tag LOCUS_40800 4638282 4639397 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020431.1 protein_id gnl|my_center|LOCUS_40800 4639390 4640193 gene locus_tag LOCUS_40810 4639390 4640193 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984863.1 protein_id gnl|my_center|LOCUS_40810 4641247 4640324 gene locus_tag LOCUS_40820 4641247 4640324 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020436.1 protein_id gnl|my_center|LOCUS_40820 4642022 4641333 gene locus_tag LOCUS_40830 4642022 4641333 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020437.1 protein_id gnl|my_center|LOCUS_40830 4643567 4644187 gene locus_tag LOCUS_40840 4643567 4644187 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082088841.1 protein_id gnl|my_center|LOCUS_40840 4644180 4644617 gene locus_tag LOCUS_40850 gene tsaA 4644180 4644617 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064869.1 protein_id gnl|my_center|LOCUS_40850 4650603 4644808 gene locus_tag LOCUS_40860 gene cobN 4650603 4644808 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162013063.1 protein_id gnl|my_center|LOCUS_40860 4655434 4651085 gene locus_tag LOCUS_40870 4655434 4651085 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064871.1 protein_id gnl|my_center|LOCUS_40870 4656174 4655779 gene locus_tag LOCUS_40880 4656174 4655779 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020403.1 protein_id gnl|my_center|LOCUS_40880 4656828 4656199 gene locus_tag LOCUS_40890 4656828 4656199 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020402.1 protein_id gnl|my_center|LOCUS_40890 4657514 4656825 gene locus_tag LOCUS_40900 4657514 4656825 CDS product DUF2162 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020401.1 protein_id gnl|my_center|LOCUS_40900 4657988 4658503 gene locus_tag LOCUS_40910 4657988 4658503 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020400.1 protein_id gnl|my_center|LOCUS_40910 4659342 4658659 gene locus_tag LOCUS_40920 4659342 4658659 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020399.1 protein_id gnl|my_center|LOCUS_40920 4660353 4659343 gene locus_tag LOCUS_40930 4660353 4659343 CDS product NOP5/NOP56 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020398.1 protein_id gnl|my_center|LOCUS_40930 4661321 4660350 gene locus_tag LOCUS_40940 4661321 4660350 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064863.1 protein_id gnl|my_center|LOCUS_40940 4662267 4661350 gene locus_tag LOCUS_40950 4662267 4661350 CDS product DUF2953 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064862.1 protein_id gnl|my_center|LOCUS_40950 4662841 4662374 gene locus_tag LOCUS_40960 4662841 4662374 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020395.1 protein_id gnl|my_center|LOCUS_40960 4663366 4666044 gene locus_tag LOCUS_40970 4663366 4666044 CDS product PKD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064861.1 protein_id gnl|my_center|LOCUS_40970 4666872 4669565 gene locus_tag LOCUS_40980 4666872 4669565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 4672072 4669718 gene locus_tag LOCUS_40990 4672072 4669718 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066079.1 protein_id gnl|my_center|LOCUS_40990 4672375 4673778 gene locus_tag LOCUS_41000 4672375 4673778 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_41000 4674210 4673824 gene locus_tag LOCUS_41010 4674210 4673824 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020391.1 protein_id gnl|my_center|LOCUS_41010 4674373 4674930 gene locus_tag LOCUS_41020 4674373 4674930 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020390.1 protein_id gnl|my_center|LOCUS_41020 4675037 4675561 gene locus_tag LOCUS_41030 4675037 4675561 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064860.1 protein_id gnl|my_center|LOCUS_41030 4675612 4675902 gene locus_tag LOCUS_41040 4675612 4675902 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860072.1 protein_id gnl|my_center|LOCUS_41040 4676024 4676611 gene locus_tag LOCUS_41050 4676024 4676611 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020386.1 protein_id gnl|my_center|LOCUS_41050 4676667 4677242 gene locus_tag LOCUS_41060 4676667 4677242 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_41060 4677315 4677956 gene locus_tag LOCUS_41070 4677315 4677956 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020384.1 protein_id gnl|my_center|LOCUS_41070 4678129 4678947 gene locus_tag LOCUS_41080 gene modA 4678129 4678947 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020383.1 protein_id gnl|my_center|LOCUS_41080 4678935 4679813 gene locus_tag LOCUS_41090 4678935 4679813 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020382.1 protein_id gnl|my_center|LOCUS_41090 4679810 4680871 gene locus_tag LOCUS_41100 4679810 4680871 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020381.1 protein_id gnl|my_center|LOCUS_41100 4680984 4681775 gene locus_tag LOCUS_41110 4680984 4681775 CDS product nicotinate-nucleotide pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064859.1 protein_id gnl|my_center|LOCUS_41110 4681803 4682639 gene locus_tag LOCUS_41120 4681803 4682639 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020379.1 protein_id gnl|my_center|LOCUS_41120 4683332 4682712 gene locus_tag LOCUS_41130 4683332 4682712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 4684379 4683630 gene locus_tag LOCUS_41140 4684379 4683630 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064856.1 protein_id gnl|my_center|LOCUS_41140 4684882 4685628 gene locus_tag LOCUS_41150 4684882 4685628 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023847.1 protein_id gnl|my_center|LOCUS_41150 4686209 4685904 gene locus_tag LOCUS_41160 4686209 4685904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 4687921 4686620 gene locus_tag LOCUS_41170 4687921 4686620 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020367.1 protein_id gnl|my_center|LOCUS_41170 4688313 4687924 gene locus_tag LOCUS_41180 4688313 4687924 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020366.1 protein_id gnl|my_center|LOCUS_41180 4689190 4688324 gene locus_tag LOCUS_41190 4689190 4688324 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020365.1 protein_id gnl|my_center|LOCUS_41190 4690949 4689195 gene locus_tag LOCUS_41200 4690949 4689195 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020364.1 protein_id gnl|my_center|LOCUS_41200 4691990 4690950 gene locus_tag LOCUS_41210 4691990 4690950 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020363.1 protein_id gnl|my_center|LOCUS_41210 4692578 4692009 gene locus_tag LOCUS_41220 4692578 4692009 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990722.1 protein_id gnl|my_center|LOCUS_41220 4693577 4694362 gene locus_tag LOCUS_41230 4693577 4694362 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064853.1 protein_id gnl|my_center|LOCUS_41230 4694406 4696058 gene locus_tag LOCUS_41240 4694406 4696058 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020360.1 protein_id gnl|my_center|LOCUS_41240 4696172 4697113 gene locus_tag LOCUS_41250 4696172 4697113 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020359.1 protein_id gnl|my_center|LOCUS_41250 4697118 4698023 gene locus_tag LOCUS_41260 4697118 4698023 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020358.1 protein_id gnl|my_center|LOCUS_41260 4698039 4698980 gene locus_tag LOCUS_41270 4698039 4698980 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020357.1 protein_id gnl|my_center|LOCUS_41270 4698956 4699663 gene locus_tag LOCUS_41280 4698956 4699663 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020356.1 protein_id gnl|my_center|LOCUS_41280 4699660 4700421 gene locus_tag LOCUS_41290 4699660 4700421 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020355.1 protein_id gnl|my_center|LOCUS_41290 4701099 4700719 gene locus_tag LOCUS_41300 4701099 4700719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020354.1 protein_id gnl|my_center|LOCUS_41300 4702846 4702541 gene locus_tag LOCUS_41310 4702846 4702541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020354.1 protein_id gnl|my_center|LOCUS_41310 4703418 4703077 gene locus_tag LOCUS_41320 4703418 4703077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020354.1 protein_id gnl|my_center|LOCUS_41320 4705068 4704388 gene locus_tag LOCUS_41330 4705068 4704388 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990721.1 protein_id gnl|my_center|LOCUS_41330 4706050 4705181 gene locus_tag LOCUS_41340 4706050 4705181 CDS product DUF5803 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990720.1 protein_id gnl|my_center|LOCUS_41340 4706502 4706245 gene locus_tag LOCUS_41350 4706502 4706245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020351.1 protein_id gnl|my_center|LOCUS_41350 4706682 4706993 gene locus_tag LOCUS_41360 4706682 4706993 CDS product signal recognition particle protein Srp19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066074.1 protein_id gnl|my_center|LOCUS_41360 4707342 4707632 gene locus_tag LOCUS_41370 4707342 4707632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020349.1 protein_id gnl|my_center|LOCUS_41370 4707990 4707667 gene locus_tag LOCUS_41380 4707990 4707667 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020348.1 protein_id gnl|my_center|LOCUS_41380 4708775 4708104 gene locus_tag LOCUS_41390 4708775 4708104 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064852.1 protein_id gnl|my_center|LOCUS_41390 4709691 4708912 gene locus_tag LOCUS_41400 4709691 4708912 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020345.1 protein_id gnl|my_center|LOCUS_41400 4710005 4712275 gene locus_tag LOCUS_41410 4710005 4712275 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020344.1 protein_id gnl|my_center|LOCUS_41410 4712272 4713450 gene locus_tag LOCUS_41420 4712272 4713450 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020343.1 protein_id gnl|my_center|LOCUS_41420 4713443 4714504 gene locus_tag LOCUS_41430 4713443 4714504 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064850.1 protein_id gnl|my_center|LOCUS_41430 4715234 4714647 gene locus_tag LOCUS_41440 4715234 4714647 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020341.1 protein_id gnl|my_center|LOCUS_41440 4716294 4715248 gene locus_tag LOCUS_41450 4716294 4715248 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020340.1 protein_id gnl|my_center|LOCUS_41450 4717099 4716281 gene locus_tag LOCUS_41460 4717099 4716281 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020339.1 protein_id gnl|my_center|LOCUS_41460 4718305 4717217 gene locus_tag LOCUS_41470 gene wtpA 4718305 4717217 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020338.1 protein_id gnl|my_center|LOCUS_41470 4718803 4720722 gene locus_tag LOCUS_41480 4718803 4720722 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020337.1 protein_id gnl|my_center|LOCUS_41480 4721606 4720797 gene locus_tag LOCUS_41490 4721606 4720797 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020335.1 protein_id gnl|my_center|LOCUS_41490 4722412 4723326 gene locus_tag LOCUS_41500 gene mtrE 4722412 4723326 CDS product tetrahydromethanopterin S-methyltransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020334.1 protein_id gnl|my_center|LOCUS_41500 4723323 4724072 gene locus_tag LOCUS_41510 gene mtrD 4723323 4724072 CDS product tetrahydromethanopterin S-methyltransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020333.1 protein_id gnl|my_center|LOCUS_41510 4724074 4724877 gene locus_tag LOCUS_41520 gene mtrC 4724074 4724877 CDS product tetrahydromethanopterin S-methyltransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020332.1 protein_id gnl|my_center|LOCUS_41520 4724874 4725200 gene locus_tag LOCUS_41530 4724874 4725200 CDS product tetrahydromethanopterin S-methyltransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020331.1 protein_id gnl|my_center|LOCUS_41530 4725202 4725924 gene locus_tag LOCUS_41540 gene mtrA 4725202 4725924 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020330.1 protein_id gnl|my_center|LOCUS_41540 4725930 4726148 gene locus_tag LOCUS_41550 gene mtrF 4725930 4726148 CDS product tetrahydromethanopterin S-methyltransferase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020329.1 protein_id gnl|my_center|LOCUS_41550 4726166 4726387 gene locus_tag LOCUS_41560 gene mtrG 4726166 4726387 CDS product tetrahydromethanopterin S-methyltransferase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020328.1 protein_id gnl|my_center|LOCUS_41560 4726400 4727350 gene locus_tag LOCUS_41570 gene mtrH 4726400 4727350 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020327.1 protein_id gnl|my_center|LOCUS_41570 4728515 4729645 gene locus_tag LOCUS_41580 4728515 4729645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020325.1 protein_id gnl|my_center|LOCUS_41580 4731242 4729740 gene locus_tag LOCUS_41590 4731242 4729740 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020324.1 protein_id gnl|my_center|LOCUS_41590 4731926 4731486 gene locus_tag LOCUS_41600 4731926 4731486 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020323.1 protein_id gnl|my_center|LOCUS_41600 4732674 4732063 gene locus_tag LOCUS_41610 4732674 4732063 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020322.1 protein_id gnl|my_center|LOCUS_41610 4733433 4732885 gene locus_tag LOCUS_41620 4733433 4732885 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020321.1 protein_id gnl|my_center|LOCUS_41620 4733627 4733700 gene locus_tag LOCUS_t00530 4733627 4733700 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4734304 4734014 gene locus_tag LOCUS_41630 4734304 4734014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 4735051 4736133 gene locus_tag LOCUS_41640 4735051 4736133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066073.1 protein_id gnl|my_center|LOCUS_41640 4737441 4736245 gene locus_tag LOCUS_41650 gene thiC 4737441 4736245 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020319.1 protein_id gnl|my_center|LOCUS_41650 4738330 4740816 gene locus_tag LOCUS_41660 4738330 4740816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 4742019 4741159 gene locus_tag LOCUS_41670 4742019 4741159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755865.1 protein_id gnl|my_center|LOCUS_41670 4743787 4744683 gene locus_tag LOCUS_41680 4743787 4744683 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020317.1 protein_id gnl|my_center|LOCUS_41680 4745820 4744873 gene locus_tag LOCUS_41690 4745820 4744873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020314.1 protein_id gnl|my_center|LOCUS_41690 4746693 4745959 gene locus_tag LOCUS_41700 4746693 4745959 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020313.1 protein_id gnl|my_center|LOCUS_41700 4747317 4748828 gene locus_tag LOCUS_41710 4747317 4748828 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064848.1 protein_id gnl|my_center|LOCUS_41710 4748874 4750604 gene locus_tag LOCUS_41720 4748874 4750604 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064847.1 protein_id gnl|my_center|LOCUS_41720 4751343 4750621 gene locus_tag LOCUS_41730 4751343 4750621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020310.1 protein_id gnl|my_center|LOCUS_41730 4751703 4753088 gene locus_tag LOCUS_41740 4751703 4753088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064846.1 protein_id gnl|my_center|LOCUS_41740 4753687 4756497 gene locus_tag LOCUS_41750 gene acnA 4753687 4756497 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020308.1 protein_id gnl|my_center|LOCUS_41750 4756910 4757977 gene locus_tag LOCUS_41760 4756910 4757977 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020307.1 protein_id gnl|my_center|LOCUS_41760 4758329 4759597 gene locus_tag LOCUS_41770 4758329 4759597 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020304.1 protein_id gnl|my_center|LOCUS_41770 4759712 4760911 gene locus_tag LOCUS_41780 4759712 4760911 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020303.1 protein_id gnl|my_center|LOCUS_41780 4760898 4761332 gene locus_tag LOCUS_41790 4760898 4761332 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020302.1 protein_id gnl|my_center|LOCUS_41790 4761574 4762692 gene locus_tag LOCUS_41800 4761574 4762692 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020301.1 protein_id gnl|my_center|LOCUS_41800 4762758 4763882 gene locus_tag LOCUS_41810 4762758 4763882 CDS product TIGR04013 family B12-binding domain/radical SAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020300.1 protein_id gnl|my_center|LOCUS_41810 4766042 4764696 gene locus_tag LOCUS_41820 gene glmM 4766042 4764696 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020299.1 protein_id gnl|my_center|LOCUS_41820 4767382 4766267 gene locus_tag LOCUS_41830 gene tnpB 4767382 4766267 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_41830 4767707 4768552 gene locus_tag LOCUS_41840 gene larE 4767707 4768552 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020298.1 protein_id gnl|my_center|LOCUS_41840 4768636 4769094 gene locus_tag LOCUS_41850 4768636 4769094 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020297.1 protein_id gnl|my_center|LOCUS_41850 4769168 4769704 gene locus_tag LOCUS_41860 4769168 4769704 CDS product DUF531 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020296.1 protein_id gnl|my_center|LOCUS_41860 4770135 4770293 gene locus_tag LOCUS_41870 4770135 4770293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41870 4770340 4771521 gene locus_tag LOCUS_41880 4770340 4771521 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020294.1 protein_id gnl|my_center|LOCUS_41880 4772229 4773905 gene locus_tag LOCUS_41890 4772229 4773905 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020292.1 protein_id gnl|my_center|LOCUS_41890 4773916 4775904 gene locus_tag LOCUS_41900 4773916 4775904 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020291.1 protein_id gnl|my_center|LOCUS_41900 4775976 4776953 gene locus_tag LOCUS_41910 4775976 4776953 CDS product type IV pilin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020288.1 protein_id gnl|my_center|LOCUS_41910 4776984 4777466 gene locus_tag LOCUS_41920 4776984 4777466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 4777497 4778423 gene locus_tag LOCUS_41930 4777497 4778423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020287.1 protein_id gnl|my_center|LOCUS_41930 4778518 4778880 gene locus_tag LOCUS_41940 4778518 4778880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 4778965 4780026 gene locus_tag LOCUS_41950 4778965 4780026 CDS product type IV pilin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860069.1 protein_id gnl|my_center|LOCUS_41950 4781172 4780717 gene locus_tag LOCUS_41960 4781172 4780717 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020282.1 protein_id gnl|my_center|LOCUS_41960 4781473 4782474 gene locus_tag LOCUS_41970 4781473 4782474 CDS product type IV pilin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064843.1 protein_id gnl|my_center|LOCUS_41970 4782514 4783446 gene locus_tag LOCUS_41980 4782514 4783446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064842.1 protein_id gnl|my_center|LOCUS_41980 4783630 4785183 gene locus_tag LOCUS_41990 4783630 4785183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020279.1 protein_id gnl|my_center|LOCUS_41990 4785285 4786028 gene locus_tag LOCUS_42000 4785285 4786028 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020278.1 protein_id gnl|my_center|LOCUS_42000 4786642 4786067 gene locus_tag LOCUS_42010 gene hisB 4786642 4786067 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020277.1 protein_id gnl|my_center|LOCUS_42010 4787535 4786798 gene locus_tag LOCUS_42020 gene hisA 4787535 4786798 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020276.1 protein_id gnl|my_center|LOCUS_42020 4788507 4787638 gene locus_tag LOCUS_42030 gene hisG 4788507 4787638 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020275.1 protein_id gnl|my_center|LOCUS_42030 4789072 4790268 gene locus_tag LOCUS_42040 4789072 4790268 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020274.1 protein_id gnl|my_center|LOCUS_42040 4790971 4790633 gene locus_tag LOCUS_42050 4790971 4790633 CDS product protease inhibitor I42 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020273.1 protein_id gnl|my_center|LOCUS_42050 4791457 4791530 gene locus_tag LOCUS_t00540 4791457 4791530 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 4791768 4792430 gene locus_tag LOCUS_42060 4791768 4792430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020272.1 protein_id gnl|my_center|LOCUS_42060 4792599 4793780 gene locus_tag LOCUS_42070 4792599 4793780 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020271.1 protein_id gnl|my_center|LOCUS_42070 4794075 4794872 gene locus_tag LOCUS_42080 gene map 4794075 4794872 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020270.1 protein_id gnl|my_center|LOCUS_42080 4794962 4795762 gene locus_tag LOCUS_42090 4794962 4795762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990719.1 protein_id gnl|my_center|LOCUS_42090 4795783 4796091 gene locus_tag LOCUS_42100 4795783 4796091 CDS product YunC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066065.1 protein_id gnl|my_center|LOCUS_42100 4796450 4797496 gene locus_tag LOCUS_42110 4796450 4797496 CDS product TRM11 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020267.1 protein_id gnl|my_center|LOCUS_42110 4798418 4797609 gene locus_tag LOCUS_42120 gene truA 4798418 4797609 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020266.1 protein_id gnl|my_center|LOCUS_42120 4799386 4798430 gene locus_tag LOCUS_42130 4799386 4798430 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020265.1 protein_id gnl|my_center|LOCUS_42130 4799586 4800656 gene locus_tag LOCUS_42140 4799586 4800656 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064840.1 protein_id gnl|my_center|LOCUS_42140 4801656 4800664 gene locus_tag LOCUS_42150 4801656 4800664 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860067.1 protein_id gnl|my_center|LOCUS_42150 4802355 4803287 gene locus_tag LOCUS_42160 4802355 4803287 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021904.1 protein_id gnl|my_center|LOCUS_42160 4803910 4803302 gene locus_tag LOCUS_42170 4803910 4803302 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226951.1 protein_id gnl|my_center|LOCUS_42170 4804241 4805530 gene locus_tag LOCUS_42180 4804241 4805530 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020262.1 protein_id gnl|my_center|LOCUS_42180 4805761 4806249 gene locus_tag LOCUS_42190 4805761 4806249 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020260.1 protein_id gnl|my_center|LOCUS_42190 4806345 4807472 gene locus_tag LOCUS_42200 4806345 4807472 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020259.1 protein_id gnl|my_center|LOCUS_42200 4807782 4808846 gene locus_tag LOCUS_42210 4807782 4808846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 4809043 4809360 gene locus_tag LOCUS_42220 4809043 4809360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860065.1 protein_id gnl|my_center|LOCUS_42220 4809636 4809427 gene locus_tag LOCUS_42230 4809636 4809427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 4809619 4810659 gene locus_tag LOCUS_42240 4809619 4810659 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064837.1 protein_id gnl|my_center|LOCUS_42240 4813568 4810788 gene locus_tag LOCUS_42250 gene alaS 4813568 4810788 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020252.1 protein_id gnl|my_center|LOCUS_42250 4814831 4814571 gene locus_tag LOCUS_42260 4814831 4814571 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020250.1 protein_id gnl|my_center|LOCUS_42260 4815218 4816015 gene locus_tag LOCUS_42270 4815218 4816015 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020249.1 protein_id gnl|my_center|LOCUS_42270 4816286 4818430 gene locus_tag LOCUS_42280 gene feoB 4816286 4818430 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045027.1 protein_id gnl|my_center|LOCUS_42280 4818427 4818591 gene locus_tag LOCUS_42290 4818427 4818591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 4818588 4818863 gene locus_tag LOCUS_42300 4818588 4818863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 4819848 4818901 gene locus_tag LOCUS_42310 4819848 4818901 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064836.1 protein_id gnl|my_center|LOCUS_42310 4823077 4819841 gene locus_tag LOCUS_42320 4823077 4819841 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020247.1 protein_id gnl|my_center|LOCUS_42320 4823983 4823462 gene locus_tag LOCUS_42330 4823983 4823462 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065298.1 protein_id gnl|my_center|LOCUS_42330 4825130 4824591 gene locus_tag LOCUS_42340 4825130 4824591 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064835.1 protein_id gnl|my_center|LOCUS_42340 4826046 4825273 gene locus_tag LOCUS_42350 4826046 4825273 CDS product DUF6293 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020244.1 protein_id gnl|my_center|LOCUS_42350 4826330 4827514 gene locus_tag LOCUS_42360 4826330 4827514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42360 4827501 4828121 gene locus_tag LOCUS_42370 4827501 4828121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42370 4828282 4829403 gene locus_tag LOCUS_42380 4828282 4829403 CDS product DUF1786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020242.1 protein_id gnl|my_center|LOCUS_42380 4829823 4830035 gene locus_tag LOCUS_42390 4829823 4830035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 4830035 4830556 gene locus_tag LOCUS_42400 4830035 4830556 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020241.1 protein_id gnl|my_center|LOCUS_42400 4830591 4831199 gene locus_tag LOCUS_42410 4830591 4831199 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020240.1 protein_id gnl|my_center|LOCUS_42410 4831631 4832845 gene locus_tag LOCUS_42420 4831631 4832845 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020233.1 protein_id gnl|my_center|LOCUS_42420 4833341 4832919 gene locus_tag LOCUS_42430 4833341 4832919 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094555.1 protein_id gnl|my_center|LOCUS_42430 4833747 4833343 gene locus_tag LOCUS_42440 4833747 4833343 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020231.1 protein_id gnl|my_center|LOCUS_42440 4834816 4833899 gene locus_tag LOCUS_42450 4834816 4833899 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082089262.1 protein_id gnl|my_center|LOCUS_42450 4835129 4836454 gene locus_tag LOCUS_42460 4835129 4836454 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020230.1 protein_id gnl|my_center|LOCUS_42460 4836621 4838099 gene locus_tag LOCUS_42470 4836621 4838099 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020229.1 protein_id gnl|my_center|LOCUS_42470 4839119 4838250 gene locus_tag LOCUS_42480 4839119 4838250 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020228.1 protein_id gnl|my_center|LOCUS_42480 4839804 4841009 gene locus_tag LOCUS_42490 4839804 4841009 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020227.1 protein_id gnl|my_center|LOCUS_42490 4841227 4841529 gene locus_tag LOCUS_42500 4841227 4841529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 4841695 4841913 gene locus_tag LOCUS_42510 4841695 4841913 CDS product PLDc N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064831.1 protein_id gnl|my_center|LOCUS_42510 4842748 4842101 gene locus_tag LOCUS_42520 4842748 4842101 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990717.1 protein_id gnl|my_center|LOCUS_42520 4845312 4842997 gene locus_tag LOCUS_42530 4845312 4842997 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990716.1 protein_id gnl|my_center|LOCUS_42530 4845505 4846053 gene locus_tag LOCUS_42540 4845505 4846053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065743.1 protein_id gnl|my_center|LOCUS_42540 4846365 4846637 gene locus_tag LOCUS_42550 4846365 4846637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 4846577 4846855 gene locus_tag LOCUS_42560 4846577 4846855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42560 4846903 4847070 gene locus_tag LOCUS_42570 4846903 4847070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 4847323 4847087 gene locus_tag LOCUS_42580 4847323 4847087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 4847933 4847706 gene locus_tag LOCUS_42590 4847933 4847706 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990715.1 protein_id gnl|my_center|LOCUS_42590 4848138 4849412 gene locus_tag LOCUS_42600 4848138 4849412 CDS product YcaO-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020223.1 protein_id gnl|my_center|LOCUS_42600 4849437 4850114 gene locus_tag LOCUS_42610 4849437 4850114 CDS product TfuA-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020222.1 protein_id gnl|my_center|LOCUS_42610 4850483 4850226 gene locus_tag LOCUS_42620 4850483 4850226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064828.1 protein_id gnl|my_center|LOCUS_42620 4851445 4850480 gene locus_tag LOCUS_42630 4851445 4850480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990714.1 protein_id gnl|my_center|LOCUS_42630 4852425 4853165 gene locus_tag LOCUS_42640 4852425 4853165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020214.1 protein_id gnl|my_center|LOCUS_42640 4853461 4853532 gene locus_tag LOCUS_t00550 4853461 4853532 tRNA product tRNA-Pyl inference COORDINATES:profile:Aragorn:1.2.38 4853760 4855031 gene locus_tag LOCUS_42650 gene pylS 4853760 4855031 CDS product pyrrolysine--tRNA(Pyl) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020213.1 protein_id gnl|my_center|LOCUS_42650 4855257 4856309 gene locus_tag LOCUS_42660 gene pylB 4855257 4856309 CDS product methylornithine synthase PylB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020212.1 protein_id gnl|my_center|LOCUS_42660 4856389 4857402 gene locus_tag LOCUS_42670 gene pylC 4856389 4857402 CDS product 3-methylornithine--L-lysine ligase PylC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020211.1 protein_id gnl|my_center|LOCUS_42670 4857450 4858241 gene locus_tag LOCUS_42680 gene pylD 4857450 4858241 CDS product 3-methylornithyl-N6-L-lysine dehydrogenase PylD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020210.1 protein_id gnl|my_center|LOCUS_42680 4858906 4858397 gene locus_tag LOCUS_42690 4858906 4858397 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022634.1 protein_id gnl|my_center|LOCUS_42690 4860794 4859172 gene locus_tag LOCUS_42700 4860794 4859172 CDS product methylamine methyltransferase corrinoid protein reductive activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020208.1 protein_id gnl|my_center|LOCUS_42700 4861695 4860994 gene locus_tag LOCUS_42710 4861695 4860994 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020206.1 protein_id gnl|my_center|LOCUS_42710 4862062 4861850 gene locus_tag LOCUS_42720 4862062 4861850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42720 4862514 4863533 gene locus_tag LOCUS_42730 4862514 4863533 CDS product MtaA/CmuA family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020204.1 protein_id gnl|my_center|LOCUS_42730 4864459 4865115 gene locus_tag LOCUS_42740 4864459 4865115 CDS product methyltransferase cognate corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020203.1 protein_id gnl|my_center|LOCUS_42740 4865135 4866511 gene locus_tag LOCUS_42750 gene mtmB 4865135 4866511 CDS product monomethylamine methyltransferase MtmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:P58969 transl_except (pos:4865738..4865740,aa:Pyl) note codon on position 202 is pyrrolysine amber codon. protein_id gnl|my_center|LOCUS_42750 4866807 4868213 gene locus_tag LOCUS_42760 4866807 4868213 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020201.1 protein_id gnl|my_center|LOCUS_42760 4868200 4868469 gene locus_tag LOCUS_42770 4868200 4868469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064822.1 protein_id gnl|my_center|LOCUS_42770 4868483 4868719 gene locus_tag LOCUS_42780 4868483 4868719 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020200.1 protein_id gnl|my_center|LOCUS_42780 4869989 4870174 gene locus_tag LOCUS_42790 4869989 4870174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 4870934 4871428 gene locus_tag LOCUS_42800 4870934 4871428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42800 4871813 4873720 gene locus_tag LOCUS_42810 4871813 4873720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 4874973 4873951 gene locus_tag LOCUS_42820 4874973 4873951 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064821.1 protein_id gnl|my_center|LOCUS_42820 4876755 4875040 gene locus_tag LOCUS_42830 4876755 4875040 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020198.1 protein_id gnl|my_center|LOCUS_42830 4877657 4876752 gene locus_tag LOCUS_42840 4877657 4876752 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020197.1 protein_id gnl|my_center|LOCUS_42840 4878073 4878525 gene locus_tag LOCUS_42850 4878073 4878525 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020196.1 protein_id gnl|my_center|LOCUS_42850 4879724 4878663 gene locus_tag LOCUS_42860 4879724 4878663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 4879871 4880194 gene locus_tag LOCUS_42870 4879871 4880194 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061058.1 protein_id gnl|my_center|LOCUS_42870 4881049 4880285 gene locus_tag LOCUS_42880 4881049 4880285 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020194.1 protein_id gnl|my_center|LOCUS_42880 4881585 4881998 gene locus_tag LOCUS_42890 4881585 4881998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020193.1 protein_id gnl|my_center|LOCUS_42890 4882724 4882263 gene locus_tag LOCUS_42900 4882724 4882263 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020192.1 protein_id gnl|my_center|LOCUS_42900 4884215 4883022 gene locus_tag LOCUS_42910 4884215 4883022 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020191.1 protein_id gnl|my_center|LOCUS_42910 4884697 4886115 gene locus_tag LOCUS_42920 4884697 4886115 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020190.1 protein_id gnl|my_center|LOCUS_42920 4886138 4887139 gene locus_tag LOCUS_42930 gene purM 4886138 4887139 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066059.1 protein_id gnl|my_center|LOCUS_42930 4887656 4887282 gene locus_tag LOCUS_42940 4887656 4887282 CDS product DUF1894 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020188.1 protein_id gnl|my_center|LOCUS_42940 4888111 4887653 gene locus_tag LOCUS_42950 4888111 4887653 CDS product DUF1890 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020187.1 protein_id gnl|my_center|LOCUS_42950 4888504 4889892 gene locus_tag LOCUS_42960 4888504 4889892 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020186.1 protein_id gnl|my_center|LOCUS_42960 4890162 4890464 gene locus_tag LOCUS_42970 4890162 4890464 CDS product DUF1894 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020185.1 protein_id gnl|my_center|LOCUS_42970 4891068 4890499 gene locus_tag LOCUS_42980 4891068 4890499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066058.1 protein_id gnl|my_center|LOCUS_42980 4892253 4891120 gene locus_tag LOCUS_42990 4892253 4891120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066057.1 protein_id gnl|my_center|LOCUS_42990 4893226 4892603 gene locus_tag LOCUS_43000 4893226 4892603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43000 4893652 4893242 gene locus_tag LOCUS_43010 4893652 4893242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43010 4893676 4893849 gene locus_tag LOCUS_43020 4893676 4893849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 4894879 4893773 gene locus_tag LOCUS_43030 4894879 4893773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064819.1 protein_id gnl|my_center|LOCUS_43030 4895175 4895657 gene locus_tag LOCUS_43040 4895175 4895657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020180.1 protein_id gnl|my_center|LOCUS_43040 4896070 4897188 gene locus_tag LOCUS_43050 4896070 4897188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860060.1 protein_id gnl|my_center|LOCUS_43050 4897646 4898833 gene locus_tag LOCUS_43060 4897646 4898833 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066055.1 protein_id gnl|my_center|LOCUS_43060 4898814 4899914 gene locus_tag LOCUS_43070 gene hisC 4898814 4899914 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064817.1 protein_id gnl|my_center|LOCUS_43070 4900402 4900046 gene locus_tag LOCUS_43080 4900402 4900046 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020176.1 protein_id gnl|my_center|LOCUS_43080 4901215 4900472 gene locus_tag LOCUS_43090 4901215 4900472 CDS product archaetidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020175.1 protein_id gnl|my_center|LOCUS_43090 4901844 4901218 gene locus_tag LOCUS_43100 4901844 4901218 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020174.1 protein_id gnl|my_center|LOCUS_43100 4902719 4901850 gene locus_tag LOCUS_43110 gene artA 4902719 4901850 CDS product archaeosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064816.1 protein_id gnl|my_center|LOCUS_43110 4903567 4904001 gene locus_tag LOCUS_43120 4903567 4904001 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020172.1 protein_id gnl|my_center|LOCUS_43120 4903988 4904275 gene locus_tag LOCUS_43130 4903988 4904275 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020171.1 protein_id gnl|my_center|LOCUS_43130 4904602 4905339 gene locus_tag LOCUS_43140 4904602 4905339 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020169.1 protein_id gnl|my_center|LOCUS_43140 4905346 4906473 gene locus_tag LOCUS_43150 gene priL 4905346 4906473 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020168.1 protein_id gnl|my_center|LOCUS_43150 4907019 4906555 gene locus_tag LOCUS_43160 4907019 4906555 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064815.1 protein_id gnl|my_center|LOCUS_43160 4907308 4907445 gene locus_tag LOCUS_43170 4907308 4907445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43170 4907509 4908075 gene locus_tag LOCUS_43180 4907509 4908075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43180 4909695 4908376 gene locus_tag LOCUS_43190 4909695 4908376 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064814.1 protein_id gnl|my_center|LOCUS_43190 4910143 4911192 gene locus_tag LOCUS_43200 gene moaA 4910143 4911192 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020164.1 protein_id gnl|my_center|LOCUS_43200 4911261 4911422 gene locus_tag LOCUS_43210 4911261 4911422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 4912342 4911539 gene locus_tag LOCUS_43220 gene surE 4912342 4911539 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020163.1 protein_id gnl|my_center|LOCUS_43220 4912732 4913322 gene locus_tag LOCUS_43230 4912732 4913322 CDS product acetate uptake transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066054.1 protein_id gnl|my_center|LOCUS_43230 4914188 4914006 gene locus_tag LOCUS_43240 4914188 4914006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064813.1 protein_id gnl|my_center|LOCUS_43240 4915181 4915981 gene locus_tag LOCUS_43250 4915181 4915981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 4916432 4916112 gene locus_tag LOCUS_43260 4916432 4916112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 4916853 4918694 gene locus_tag LOCUS_43270 gene glyS 4916853 4918694 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020156.1 protein_id gnl|my_center|LOCUS_43270 4918964 4921477 gene locus_tag LOCUS_43280 4918964 4921477 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020155.1 protein_id gnl|my_center|LOCUS_43280 4921935 4921753 gene locus_tag LOCUS_43290 4921935 4921753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064807.1 protein_id gnl|my_center|LOCUS_43290 4923442 4922816 gene locus_tag LOCUS_43300 4923442 4922816 CDS product Sjogren's syndrome/scleroderma autoantigen 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066053.1 protein_id gnl|my_center|LOCUS_43300 4923689 4923961 gene locus_tag LOCUS_43310 4923689 4923961 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064806.1 protein_id gnl|my_center|LOCUS_43310 4924717 4925349 gene locus_tag LOCUS_43320 4924717 4925349 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020150.1 protein_id gnl|my_center|LOCUS_43320 4925668 4927287 gene locus_tag LOCUS_43330 gene sepS 4925668 4927287 CDS product O-phosphoserine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020149.1 protein_id gnl|my_center|LOCUS_43330 4927421 4928143 gene locus_tag LOCUS_43340 4927421 4928143 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064805.1 protein_id gnl|my_center|LOCUS_43340 4928943 4928236 gene locus_tag LOCUS_43350 4928943 4928236 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860058.1 protein_id gnl|my_center|LOCUS_43350 4930566 4929088 gene locus_tag LOCUS_43360 gene dnaK 4930566 4929088 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990713.1 protein_id gnl|my_center|LOCUS_43360 4931476 4933131 gene locus_tag LOCUS_43370 gene thsB 4931476 4933131 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020145.1 protein_id gnl|my_center|LOCUS_43370 4934594 4933473 gene locus_tag LOCUS_43380 4934594 4933473 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020144.1 protein_id gnl|my_center|LOCUS_43380 4935392 4938034 gene locus_tag LOCUS_43390 4935392 4938034 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064804.1 protein_id gnl|my_center|LOCUS_43390 4939790 4938159 gene locus_tag LOCUS_43400 4939790 4938159 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020142.1 protein_id gnl|my_center|LOCUS_43400 4942336 4940138 gene locus_tag LOCUS_43410 gene ppk1 4942336 4940138 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755861.1 protein_id gnl|my_center|LOCUS_43410 4945253 4943130 gene locus_tag LOCUS_43420 4945253 4943130 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020139.1 protein_id gnl|my_center|LOCUS_43420 4946374 4945406 gene locus_tag LOCUS_43430 4946374 4945406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 4946562 4946371 gene locus_tag LOCUS_43440 4946562 4946371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 4947661 4946720 gene locus_tag LOCUS_43450 4947661 4946720 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860057.1 protein_id gnl|my_center|LOCUS_43450 4947890 4947723 gene locus_tag LOCUS_43460 4947890 4947723 CDS product preprotein translocase subunit Sec61beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064803.1 protein_id gnl|my_center|LOCUS_43460 4949320 4948301 gene locus_tag LOCUS_43470 4949320 4948301 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064802.1 protein_id gnl|my_center|LOCUS_43470 4949966 4951066 gene locus_tag LOCUS_43480 4949966 4951066 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020134.1 protein_id gnl|my_center|LOCUS_43480 4952031 4951318 gene locus_tag LOCUS_43490 gene radB 4952031 4951318 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860416.1 protein_id gnl|my_center|LOCUS_43490 4952983 4953234 gene locus_tag LOCUS_43500 4952983 4953234 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064801.1 protein_id gnl|my_center|LOCUS_43500 4953325 4955709 gene locus_tag LOCUS_43510 gene nrdD 4953325 4955709 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020131.1 protein_id gnl|my_center|LOCUS_43510 4955799 4956593 gene locus_tag LOCUS_43520 4955799 4956593 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020130.1 protein_id gnl|my_center|LOCUS_43520 4957211 4958230 gene locus_tag LOCUS_43530 gene thiL 4957211 4958230 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066048.1 protein_id gnl|my_center|LOCUS_43530 4958400 4961888 gene locus_tag LOCUS_43540 4958400 4961888 CDS product S-layer protein domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020127.1 protein_id gnl|my_center|LOCUS_43540 4962547 4962026 gene locus_tag LOCUS_43550 4962547 4962026 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020126.1 protein_id gnl|my_center|LOCUS_43550 4962929 4963918 gene locus_tag LOCUS_43560 4962929 4963918 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020124.1 protein_id gnl|my_center|LOCUS_43560 4964053 4964841 gene locus_tag LOCUS_43570 4964053 4964841 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020123.1 protein_id gnl|my_center|LOCUS_43570 4964843 4965607 gene locus_tag LOCUS_43580 4964843 4965607 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_43580 4966080 4965652 gene locus_tag LOCUS_43590 4966080 4965652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020121.1 protein_id gnl|my_center|LOCUS_43590 4966670 4966464 gene locus_tag LOCUS_43600 4966670 4966464 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064799.1 protein_id gnl|my_center|LOCUS_43600 4966948 4966733 gene locus_tag LOCUS_43610 4966948 4966733 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011033303.1 protein_id gnl|my_center|LOCUS_43610 4967210 4967004 gene locus_tag LOCUS_43620 4967210 4967004 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011033302.1 protein_id gnl|my_center|LOCUS_43620 4967488 4967273 gene locus_tag LOCUS_43630 4967488 4967273 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064798.1 protein_id gnl|my_center|LOCUS_43630 4968033 4968107 gene locus_tag LOCUS_t00560 4968033 4968107 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4968542 4968712 gene locus_tag LOCUS_43640 4968542 4968712 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020114.1 protein_id gnl|my_center|LOCUS_43640 4970127 4969093 gene locus_tag LOCUS_43650 4970127 4969093 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020113.1 protein_id gnl|my_center|LOCUS_43650 4971291 4970248 gene locus_tag LOCUS_43660 4971291 4970248 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020112.1 protein_id gnl|my_center|LOCUS_43660 4971908 4973671 gene locus_tag LOCUS_43670 4971908 4973671 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020110.1 protein_id gnl|my_center|LOCUS_43670 4974368 4973958 gene locus_tag LOCUS_43680 4974368 4973958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048174356.1 protein_id gnl|my_center|LOCUS_43680 4976421 4974712 gene locus_tag LOCUS_43690 gene argS 4976421 4974712 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064797.1 protein_id gnl|my_center|LOCUS_43690 4977954 4976707 gene locus_tag LOCUS_43700 gene prf1 4977954 4976707 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020101.1 protein_id gnl|my_center|LOCUS_43700 4979875 4978838 gene locus_tag LOCUS_43710 gene twy1 4979875 4978838 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020099.1 protein_id gnl|my_center|LOCUS_43710 4981965 4979977 gene locus_tag LOCUS_43720 4981965 4979977 CDS product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066045.1 protein_id gnl|my_center|LOCUS_43720 4983041 4983598 gene locus_tag LOCUS_43730 4983041 4983598 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020095.1 protein_id gnl|my_center|LOCUS_43730 4983922 4984893 gene locus_tag LOCUS_43740 gene dusB 4983922 4984893 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020094.1 protein_id gnl|my_center|LOCUS_43740 4984921 4985139 gene locus_tag LOCUS_43750 4984921 4985139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 4985478 4986026 gene locus_tag LOCUS_43760 4985478 4986026 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_43760 4986023 4986355 gene locus_tag LOCUS_43770 4986023 4986355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 4986355 4987563 gene locus_tag LOCUS_43780 gene porA 4986355 4987563 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 protein_id gnl|my_center|LOCUS_43780 4987560 4988450 gene locus_tag LOCUS_43790 4987560 4988450 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022378.1 protein_id gnl|my_center|LOCUS_43790 4989772 4989317 gene locus_tag LOCUS_43800 4989772 4989317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020085.1 protein_id gnl|my_center|LOCUS_43800 4991350 4990526 gene locus_tag LOCUS_43810 4991350 4990526 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_43810 4992163 4991399 gene locus_tag LOCUS_43820 4992163 4991399 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_43820 4993193 4992246 gene locus_tag LOCUS_43830 4993193 4992246 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020082.1 protein_id gnl|my_center|LOCUS_43830 4993938 4993417 gene locus_tag LOCUS_43840 4993938 4993417 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066044.1 protein_id gnl|my_center|LOCUS_43840 4994508 4994098 gene locus_tag LOCUS_43850 4994508 4994098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43850 4995320 4994610 gene locus_tag LOCUS_43860 4995320 4994610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43860 4995559 4995410 gene locus_tag LOCUS_43870 4995559 4995410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43870 4996209 4995664 gene locus_tag LOCUS_43880 4996209 4995664 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020079.1 protein_id gnl|my_center|LOCUS_43880 4998322 4996253 gene locus_tag LOCUS_43890 4998322 4996253 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990711.1 protein_id gnl|my_center|LOCUS_43890 4998975 4998595 gene locus_tag LOCUS_43900 4998975 4998595 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020077.1 protein_id gnl|my_center|LOCUS_43900 5000192 5000557 gene locus_tag LOCUS_43910 5000192 5000557 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064788.1 protein_id gnl|my_center|LOCUS_43910 5000810 5001244 gene locus_tag LOCUS_43920 5000810 5001244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43920 5001426 5001731 gene locus_tag LOCUS_43930 5001426 5001731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43930 5001884 5003917 gene locus_tag LOCUS_43940 5001884 5003917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 5003948 5004823 gene locus_tag LOCUS_43950 5003948 5004823 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020072.1 protein_id gnl|my_center|LOCUS_43950 5005661 5006554 gene locus_tag LOCUS_43960 gene fhcD 5005661 5006554 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020069.1 protein_id gnl|my_center|LOCUS_43960 5008686 5007229 gene locus_tag LOCUS_43970 5008686 5007229 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020067.1 protein_id gnl|my_center|LOCUS_43970 5010613 5009519 gene locus_tag LOCUS_43980 5010613 5009519 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020066.1 protein_id gnl|my_center|LOCUS_43980 5012323 5011124 gene locus_tag LOCUS_43990 gene mfnA 5012323 5011124 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020065.1 protein_id gnl|my_center|LOCUS_43990 5013880 5013416 gene locus_tag LOCUS_44000 gene tnpA 5013880 5013416 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979974.1 protein_id gnl|my_center|LOCUS_44000 5016371 5014833 gene locus_tag LOCUS_44010 gene putP 5016371 5014833 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_44010 5016610 5017737 gene locus_tag LOCUS_44020 5016610 5017737 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085095815.1 protein_id gnl|my_center|LOCUS_44020