COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..39714 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1728 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013309.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene dnaA CDS 2328..3524 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855336.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene dnaN CDS 3606..4787 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013310.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene recF CDS 4784..5293 product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855338.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 note possible pseudo, frameshifted CDS 5542..7650 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855339.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene gyrB CDS 7868..8497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 8494..9453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 9443..10330 product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066569851.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 10333..11928 product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013773.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 11921..12235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 12232..12525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 12529..13383 product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013770.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 13405..14028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(14038..14475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(14853..15203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 15545..16318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 note possible pseudo, frameshifted CDS 16251..16586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 note possible pseudo, frameshifted CDS complement(16705..16896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 17009..17677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(17856..18110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013316.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 18245..20806 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855346.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene gyrA CDS 20809..21180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 tRNA 21317..21393 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA 21395..21468 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(21563..23611) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014501.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(23612..24274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855924.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 24374..24964 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014502.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 tRNA 25022..25095 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 25494..25955 product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948529.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 26310..27497 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920938.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 27735..28037 product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857708.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 28064..28375 product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720474.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 28429..30141 product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013378.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene ureC CDS 30284..30760 product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013379.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene ureE CDS 30741..31460 product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013380.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 31494..32108 product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857703.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene ureG CDS 32110..32988 product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013381.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(33009..33362) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855958.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(33606..34325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 34624..35610 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803922.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 35701..37947 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878709.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene metE CDS 38127..39176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 39173..39532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 sequence02 source 1..22275 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(234..848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 note possible pseudo, frameshifted CDS complement(800..1207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 1285..2067 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014360.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(2084..2782) product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894906.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 note possible pseudo, frameshifted CDS complement(2821..3267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(3243..3887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(3894..4649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 note possible pseudo, frameshifted CDS complement(4628..5452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 note possible pseudo, frameshifted CDS complement(5449..6144) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208396322.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene cmk CDS complement(6141..7040) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856268.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(7085..7624) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856269.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene scpB CDS 7746..8294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(8305..9153) product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856272.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(9153..10028) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014352.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(10184..11053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(11258..12163) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014350.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene xerD CDS complement(12164..12640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 note possible pseudo, frameshifted CDS complement(12842..13813) product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014348.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(13860..15047) product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014347.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene steA CDS complement(15115..15891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 note possible pseudo, frameshifted CDS complement(15888..16196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 note possible pseudo, frameshifted CDS complement(16217..16555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 note possible pseudo, frameshifted CDS complement(16860..17783) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856294.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(17780..18607) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856296.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(18801..19784) product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014344.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(19795..20736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 rRNA complement(20884..20990) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence03 source 1..109671 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 30..197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 847..3585 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015301.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(3731..3928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 3852..4658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00700 note possible pseudo, frameshifted CDS 4634..4882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00710 note possible pseudo, frameshifted CDS 4882..5901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 note possible pseudo, frameshifted CDS 5924..6763 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363838.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 6768..7217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 7127..8452 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804335.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene ptsP note possible pseudo, frameshifted CDS complement(8591..9736) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031634.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 note possible pseudo, frameshifted CDS 9826..9996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(9997..10884) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015296.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 10915..11529 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853851.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 11606..12310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015294.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(12317..13366) product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015293.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene disA CDS complement(13393..14337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 note possible pseudo, frameshifted CDS complement(14442..14810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 note possible pseudo, frameshifted CDS complement(14874..15461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015291.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 15760..16356 product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853867.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 16374..17093 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015289.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene ispD CDS 17106..17606 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015288.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene ispF CDS 17637..18431 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015274.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene nagB CDS 18435..19847 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015271.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene cysS CDS 19851..20795 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863034.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene rlmB CDS 20922..22076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(22085..22948) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015262.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(22949..23650) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015261.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(23736..24755) product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015260.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 24922..25962 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015259.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(25922..26659) product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863055.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene otsB CDS complement(26656..27141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(27131..28447) product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230392.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(28451..28810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(29000..30421) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853939.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 30527..31498 product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015254.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 tRNA 31512..31585 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(31636..32871) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015250.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(32914..34275) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015248.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 34382..35113 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863097.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 35125..36558 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015245.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(36555..36980) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015240.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(36986..37321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 37336..38256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 note possible pseudo, frameshifted CDS 38309..39424 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285864.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 39451..40881 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173328348.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene purB CDS 40897..41778 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863110.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 41846..43354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01120 note possible pseudo, frameshifted CDS 43372..44025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 note possible pseudo, frameshifted CDS 44034..44714 product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854006.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 44744..45235 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015234.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(45246..47204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 note possible pseudo, frameshifted CDS complement(47201..47917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 note possible pseudo, frameshifted CDS complement(48112..49173) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225228.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(49243..50250) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015231.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 50355..50753 product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863125.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 50769..52310 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265975.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene purF CDS complement(52509..53066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 53129..53386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 note possible pseudo, frameshifted CDS complement(53469..53690) product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863131.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(53839..54996) product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015229.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 54995..55936 product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015228.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(55933..56604) product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863137.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(56594..57442) product LmeA family phospholipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015226.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 57417..57803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 note possible pseudo, frameshifted CDS 57758..58315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 note possible pseudo, frameshifted CDS 58655..59791 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015224.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene pstS CDS 59959..61056 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858938.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene pstC CDS 61076..61996 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015222.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene pstA CDS 62032..62178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 note possible pseudo, frameshifted CDS 62184..62804 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015221.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene pstB note possible pseudo, frameshifted CDS complement(62908..63651) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015220.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene phoU CDS complement(63744..64208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01370 note possible pseudo, frameshifted CDS complement(64247..64900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 note possible pseudo, frameshifted CDS 65222..66046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 note possible pseudo, frameshifted CDS 66046..66720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 note possible pseudo, frameshifted CDS 67197..67877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 67917..68405 product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930108.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 68605..69195 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803937.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 note possible pseudo, frameshifted CDS 69182..70090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 70111..71283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 71285..72217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 72214..72528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 72531..73817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(73753..74355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 74515..76041 product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933859.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 76175..76513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 77136..77762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 77678..80560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 80550..81305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(81302..82828) product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014154.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene cydC CDS complement(82825..84378) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211271322.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(84381..85385) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111154.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene cydB CDS complement(85385..85921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 note possible pseudo, internal stop codon CDS complement(85988..86959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 note possible pseudo, internal stop codon tRNA 87163..87236 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(87720..88037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 88176..88565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01610 note possible pseudo, frameshifted CDS 88642..88914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(88919..89269) product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726761.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 tRNA 89413..89486 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 89520..89596 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 89947..90021 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 90042..90115 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 90256..90549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(90559..91128) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286028.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene cysE CDS complement(91263..91529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 note possible pseudo, frameshifted CDS complement(91424..91831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 note possible pseudo, frameshifted CDS complement(91777..92106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 note possible pseudo, frameshifted CDS 92553..93392 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857068.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 93417..94574 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015212.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene murA CDS 95586..95810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 96648..97976 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015543.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene dnaB CDS 98184..98375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(98451..99773) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855060.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 99881..100258 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358748.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(100285..101646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 note possible pseudo, frameshifted CDS complement(101640..102590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 note possible pseudo, frameshifted CDS complement(102580..102780) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855276.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(102849..103841) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094641.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(103888..104091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 104188..104559 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861174.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene trxA CDS 104938..105183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 106040..106900 product rod-shaped morphology protein RsmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855053.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene rsmP CDS complement(106957..108213) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015516.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 108416..108790 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015515.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 sequence04 source 1..660 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence05 source 1..1384 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(1013..1119) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence06 source 1..46286 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(195..530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(664..1980) product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083202.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene paaF CDS complement(2173..2667) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223459.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 note possible pseudo, frameshifted CDS 2915..3367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 3521..4498 product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223463.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene paaA CDS 4525..4815 product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984048.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene paaB CDS 4812..5636 product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083205.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene paaC CDS 5664..6203 product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153451216.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene paaJ CDS 6203..6511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 note possible pseudo, frameshifted CDS 6502..7356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 note possible pseudo, frameshifted CDS 7367..8152 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085018.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 8167..9366 product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113327.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 9367..10122 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113991.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 10134..10985 product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729557.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(10982..11389) product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976812.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 11514..12794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 note possible pseudo, frameshifted CDS 12764..13567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 note possible pseudo, frameshifted CDS complement(13568..15184) product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014996.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 15325..16863 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015494.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(16895..17158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 note possible pseudo, frameshifted CDS complement(17131..18009) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015116.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 note possible pseudo, frameshifted CDS 18106..19443 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141748518.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 19613..20266 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013990.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 20325..20870 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265655.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene pth CDS complement(20931..22307) product 3-hydroxybenzoate 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015578.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(22372..23733) product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015577.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 23798..24574 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567940.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 24708..25826 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015576.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 25830..26657 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567937.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 26657..27223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 note possible pseudo, frameshifted CDS 27220..27372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 27465..27629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 27736..28737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 28737..28928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(29054..29332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(29296..30090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(30124..30843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 note possible pseudo, frameshifted CDS complement(30843..31505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 note possible pseudo, frameshifted CDS complement(31502..32455) product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013987.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 32485..33102 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013986.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene pth CDS 33287..33451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(33530..34084) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015486.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 34193..34969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 note possible pseudo, frameshifted CDS 34951..35823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 note possible pseudo, frameshifted CDS complement(35820..36680) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854943.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 36863..37537 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068323.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 37569..38312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 note possible pseudo, frameshifted CDS 38327..38896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 note possible pseudo, frameshifted CDS 38893..39840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 note possible pseudo, frameshifted CDS 39851..41569 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031071.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 41571..42287 product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854724.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(42294..43499) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013999.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 43498..43827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 44019..45269 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066852.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 45266..46111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 sequence07 source 1..5595 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(232..3630) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(3724..4662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(4685..4834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 sequence08 source 1..22491 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(218..547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(963..1484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(1802..2416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 note possible pseudo, frameshifted CDS complement(2554..4782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 note possible pseudo, frameshifted CDS complement(5436..5687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 6186..6581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(6718..7107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 7170..7349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 7509..8579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 tRNA complement(8803..8887) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 9095..9931 product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861088.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 9969..10415 product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861086.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 10412..11371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 note possible pseudo, frameshifted CDS 11311..11805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 note possible pseudo, frameshifted CDS 11807..13192 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013343.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 13189..14625 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013342.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 14625..16214 product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013341.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 16211..18214 product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013340.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene pknB CDS 18277..18546 product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861074.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene crgA CDS 19071..19328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(19482..19817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(19877..20404) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891350.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(20517..22130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 sequence09 source 1..2282 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(183..335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(675..1928) product IS256-like element IS1081 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901078.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 sequence10 source 1..42570 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 316..1953 product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775911.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(1950..2582) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287272.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(2730..2960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(3555..6554) product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013886.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 6647..7213 product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858126.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 7256..7978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(7975..9051) product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013885.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 9183..10607 product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858132.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(10624..11097) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013884.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 11180..12046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013883.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(12043..12753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 note possible pseudo, frameshifted CDS complement(12762..13700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 note possible pseudo, frameshifted CDS complement(13766..14101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 note possible pseudo, frameshifted CDS complement(14098..14859) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013881.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(14859..15950) product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863539.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(15947..19264) product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013880.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(19257..22298) product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013879.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(22302..23054) product TIGR02569 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858145.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(23085..24005) product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858148.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(24027..24251) product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013877.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 24378..25727 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013876.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 25724..26926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013875.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(26907..27374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443167.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 27921..28181 product WhiB family transcriptional regulator WhcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858159.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene whcE CDS complement(28430..28750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(28785..29063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(29063..29665) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858163.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(29722..30093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 note possible pseudo, frameshifted CDS 30417..31712 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013873.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene aroA CDS 31705..32727 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863555.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene rsgA CDS complement(32744..33238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858173.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(33238..33648) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863558.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 33793..34197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(34204..36765) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013871.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene secA CDS complement(37013..37594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03020 note possible pseudo, frameshifted CDS complement(37684..38106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 note possible pseudo, frameshifted CDS complement(38293..40023) product MtrAB system accessory lipoprotein LpqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013869.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene lpqB CDS complement(40020..41165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 note possible pseudo, frameshifted CDS complement(41108..41533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(41604..42287) product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013867.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene mtrA sequence11 source 1..60867 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(217..1182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(1294..2205) product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804173.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(2205..3380) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123347.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(3380..5041) product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778938.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(5083..5835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(6196..6387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(6504..6854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(7101..8231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(8318..8578) product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918759.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 8949..9218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(9303..10064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(10280..10615) product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(10892..13348) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013856.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(13436..13672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 note possible pseudo, internal stop codon CDS complement(13685..14335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03220 note possible pseudo, internal stop codon CDS complement(14462..14884) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815706.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene nrdI CDS complement(15384..16475) product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280585.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene rhuM CDS complement(16864..17349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(17346..17720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 17776..18171 product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015574.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 18244..19506 product quinone-dependent L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015490.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene lldD CDS 19487..20815 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061782.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 20846..21136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 note possible pseudo, frameshifted CDS 21106..21633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 note possible pseudo, frameshifted CDS complement(21787..23652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(23991..25265) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015579.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 25461..25901 product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855171.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 26154..27716 product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015581.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 27713..28366 product anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855176.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 28370..29398 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855178.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene trpD CDS 29391..30812 product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015582.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene trpCF CDS 30837..32099 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567953.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene trpB CDS 32102..32944 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567954.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene trpA CDS complement(33019..33717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 34016..34753 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567959.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 34756..36345 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015585.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 36386..36730 product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855195.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(36740..37516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03450 note possible pseudo, frameshifted CDS 37845..38837 product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855200.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 38848..39153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015617.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(39150..39491) product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015618.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(39491..40258) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015619.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(40272..40880) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855283.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(40873..42321) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855284.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 42400..43350 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015620.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 43431..45998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015621.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 46085..49615 product virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015622.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 49767..50363 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015623.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 50447..51400 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855300.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene trxB CDS 51430..51753 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855302.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene trxA CDS 51865..53046 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855304.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(53058..54584) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144178156.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(54665..55321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015626.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(55333..55524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 note possible pseudo, frameshifted CDS complement(56441..57439) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855308.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(57533..58036) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855311.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene rsmG CDS complement(58193..59170) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855313.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene yidC CDS complement(59206..59490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(59494..59880) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860977.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene rnpA CDS complement(59891..60028) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855320.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene rpmH sequence12 source 1..52213 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(421..873) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015544.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene rplI CDS complement(911..1555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(1609..1923) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855074.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene rpsF CDS complement(2065..2265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(2184..2663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 note possible pseudo, frameshifted CDS complement(2660..3652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 note possible pseudo, frameshifted CDS complement(3739..5694) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015547.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 note possible pseudo, frameshifted CDS complement(5610..6056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 note possible pseudo, frameshifted CDS complement(6143..6505) product DUF5318 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015548.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 6651..7742 product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855107.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 7992..8267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 note possible pseudo, frameshifted CDS 8326..9303 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855086.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 9314..9781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861203.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 9897..11540 product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(11537..12436) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015551.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(12479..14314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 14495..15196 product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855116.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 15221..16732 product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013753.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(16729..17454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(17632..17841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 note possible pseudo, frameshifted CDS complement(17841..18311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 note possible pseudo, frameshifted CDS complement(18308..19282) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803689.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 19453..20529 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027751.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 20526..21131 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803691.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 21142..22143 product ArsO family NAD(P)H-dependent flavin-containing monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014413.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 22191..23357 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015561.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 23426..24085 product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101572.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 24087..25145 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223247.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(26117..26344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(26409..27002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 note possible pseudo, frameshifted CDS complement(27049..27819) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013400.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene panB CDS complement(27892..28389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(28281..29576) product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328002.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 note possible pseudo, frameshifted CDS complement(29927..30115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 note possible pseudo, frameshifted CDS complement(30112..30516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 note possible pseudo, frameshifted CDS complement(30513..31424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 note possible pseudo, frameshifted CDS 31598..32332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 32317..32829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(32803..33165) product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857246.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(33162..33548) product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857248.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(33554..34030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 34151..35098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 35099..36082 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015197.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 36385..37560 product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726945.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(37575..40418) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015573.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene leuS CDS complement(40490..41617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 41947..42150 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862487.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 42276..43025 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015594.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(43419..45035) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868625.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(45531..45989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(46066..46635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 47186..47908 product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369184.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene lldR CDS 48063..48947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 note possible pseudo, frameshifted CDS 48944..49465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 note possible pseudo, frameshifted CDS 49486..50385 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803721.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 50392..51729 product GntP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104441.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(51838..51999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04240 sequence13 source 1..259812 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(518..706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(733..1890) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013907.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(1899..2552) product DUF3239 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013908.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(2564..4219) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858302.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(4295..5464) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086674640.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(5461..6348) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223991.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(6348..6887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(7217..7780) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013976.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(7896..9137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 10190..10384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858306.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(10636..11307) product DUF3235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862355.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 11871..12266 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858310.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(12375..12824) product DUF2771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858312.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 note possible pseudo, frameshifted CDS complement(12834..13079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 note possible pseudo, frameshifted CDS complement(13120..13644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 note possible pseudo, frameshifted CDS 13739..14467 product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104387.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(14471..15160) product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013911.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 15519..16871 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265630.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 16878..17720 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862361.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(17728..18573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858320.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(18669..19547) product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013912.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene sepH CDS complement(19694..20776) product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013913.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene serC CDS 21202..22497 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013914.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 22654..23013 product FKBP-type peptidyl-prolyl cis-trans isomerase FkpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858324.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene fkpA CDS 23094..23705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 note possible pseudo, frameshifted CDS 23758..23943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 24183..24524 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049745379.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 24528..25181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 note possible pseudo, frameshifted CDS 25169..26197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 note possible pseudo, frameshifted CDS complement(26282..27211) product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013919.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 27344..28813 product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461272.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 28922..29305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 29348..29602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(29618..30538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(31005..31295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 note possible pseudo, frameshifted CDS complement(31280..32347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 note possible pseudo, frameshifted CDS complement(32584..33147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 note possible pseudo, frameshifted CDS complement(33672..33983) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899493.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 34521..35027 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547510.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 tRNA 35628..35701 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 35766..36983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 38061..38237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 38283..39296 product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014907.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 39293..40726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 note possible pseudo, frameshifted CDS 40723..42042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 note possible pseudo, frameshifted CDS complement(42039..42884) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222519.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(42890..44824) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015065.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(44910..45803) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977210.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 45928..46854 product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066568686.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(46851..46985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(47243..47908) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014280.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 48165..48677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04750 note possible pseudo, frameshifted CDS 48662..49423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 note possible pseudo, frameshifted CDS 49436..50026 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014282.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene leuD CDS complement(50031..51032) product bifunctional NUDIX hydrolase/histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858854.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 51125..52123 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858849.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 52156..53661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 54170..55132 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858840.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 55132..55785 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223644.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 55797..57317 product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858835.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 57321..59414 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014290.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 59566..60009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04850 note possible pseudo, frameshifted CDS 60010..60486 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858828.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene coaD CDS 60483..61229 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857192.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(61469..62344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 note possible pseudo, frameshifted CDS complement(62422..62733) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899493.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(62838..63890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(63853..64794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 65008..66207 product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096454783.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(66224..67009) product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013898.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene hisN CDS complement(67019..67276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 note possible pseudo, frameshifted CDS complement(67299..67829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 note possible pseudo, frameshifted CDS 67877..68974 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863507.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene prfB CDS 69026..69718 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858089.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene ftsE CDS 69728..70630 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858086.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene ftsX CDS 70697..71185 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858084.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene smpB CDS 71481..71906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 note possible pseudo, frameshifted tmRNA 71968..72345 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 72368..72688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 72695..74170 product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114813.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 74310..76391 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014465.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene ppc note possible pseudo, frameshifted CDS 76508..76954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 note possible pseudo, frameshifted CDS 77046..77465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013365.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 77672..78715 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013905.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 78752..79762 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863480.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 79755..80141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 note possible pseudo, frameshifted CDS 80162..80806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 note possible pseudo, frameshifted CDS 80803..81558 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013906.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 rRNA 82178..83681 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 rRNA 84076..87122 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 rRNA 87285..87391 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 CDS complement(87985..88755) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015513.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 88919..89116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 89202..90095 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 90326..90589 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056989.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 91238..91765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 91749..92153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 92176..92652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 92954..93568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 94256..94798 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162012.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 note possible pseudo, frameshifted CDS complement(94901..95875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(95971..96231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(96499..97191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 97539..98198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(98225..98686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 98833..99444 product TetR/AcrR family transcriptional regulator MbcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015509.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene mcbR CDS complement(99596..100558) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015508.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene yidC note possible pseudo, frameshifted CDS 100636..101424 product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015507.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 101425..101577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858985.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(101582..102190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 102189..103454 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015505.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 103451..104089 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862544.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(104121..104858) product DUF6474 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907501.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(104953..105171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 105319..106377 product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015502.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(106391..107563) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015500.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 107635..108504 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015499.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(108793..108921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 note possible pseudo, frameshifted CDS complement(108981..109394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 note possible pseudo, frameshifted CDS 109574..109855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 note possible pseudo, frameshifted CDS 109923..110258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 note possible pseudo, frameshifted CDS 110464..111933 product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014996.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(111899..113761) product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015484.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 113945..114889 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015483.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 114980..116854 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015482.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 116854..117567 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053545848.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 117602..118516 product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284785.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 118609..119586 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265737.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 119586..120515 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014325.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 120603..121943 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014326.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 121983..123116 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014327.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene ugpC CDS complement(123425..124279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 124376..124693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(124690..125397) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857812.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 125907..126335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 note possible pseudo, frameshifted CDS 126336..126932 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015472.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(127272..128348) product septum formation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857824.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(128358..129110) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862621.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 129203..129787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 note possible pseudo, frameshifted CDS 129727..130482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 note possible pseudo, frameshifted CDS 130483..131349 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015469.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 131353..131946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 note possible pseudo, frameshifted CDS 131943..132167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 note possible pseudo, frameshifted CDS 132192..133667 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857839.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene glpK CDS complement(133664..135604) product LGFP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015467.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 135771..136961 product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015466.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene glf CDS complement(136958..138214) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564999.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 138421..139014 product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087078053.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 139233..139391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 139455..140051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 140214..142166 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284777.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 142153..142659 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015460.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 142656..143405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 note possible pseudo, frameshifted CDS 143378..143647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 note possible pseudo, frameshifted CDS 143663..145450 product beta-(1->2)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015458.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene aftB CDS 145587..146531 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015457.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 146789..148744 product protein PS1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015455.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 148748..149224 product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015454.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 149240..150166 product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015453.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 150248..150631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 150556..151362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 note possible pseudo, frameshifted CDS 151362..152084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 note possible pseudo, frameshifted CDS 152210..156982 product polyketide synthase Pks13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015451.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene pks13 CDS 156982..158349 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857874.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 158244..158534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 note possible pseudo, frameshifted CDS complement(158708..159112) product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857875.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(159205..160224) product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015450.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(160221..162512) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015449.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(162524..163201) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857880.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(163281..164003) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015448.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene trmB note possible pseudo, frameshifted CDS 164528..166360 product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015446.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 166590..166787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(166791..167555) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015445.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 167593..168657 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015443.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(168602..169957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015442.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(170025..171272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 171315..171644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 note possible pseudo, frameshifted CDS 171727..171903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 171948..172415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 note possible pseudo, frameshifted CDS complement(172304..174157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05990 note possible pseudo, frameshifted CDS 174788..174991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(174981..175340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 note possible pseudo, frameshifted CDS complement(175347..175544) product DUF2613 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853449.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(175566..176048) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015437.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 176193..177347 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853452.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 177455..179080 product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015435.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(179081..180394) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056390.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene zwf CDS 180443..182242 product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014997.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(182239..183066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 183495..184805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 184798..185382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(185479..186240) product DUF981 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888021.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(186248..186529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(186744..187205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 tRNA complement(187572..187645) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 187988..188278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 note possible pseudo, frameshifted CDS 188322..189647 product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015433.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 189679..190029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(190026..191246) product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015432.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(191248..192537) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862691.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(192661..193170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(193149..193739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(193732..194220) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459411.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 194490..195068 product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853486.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(195175..197508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 197661..198929 product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 199254..200393 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399688.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 200418..200996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(201228..203705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(203702..205111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 205195..205371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 206254..206832 product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853486.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(207370..208530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 note possible pseudo, frameshifted CDS complement(208548..209438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 note possible pseudo, internal stop codon, frameshifted CDS complement(209509..210762) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813597.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(210863..211852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 note possible pseudo, frameshifted CDS complement(211864..212796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 note possible pseudo, frameshifted CDS complement(212793..214499) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776838.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(214575..215945) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015406.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 216220..217887 product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015405.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 217884..219083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 219231..219767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 note possible pseudo, frameshifted CDS 219767..220978 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862775.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(220984..221151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 221208..221402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 221390..221662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 note possible pseudo, frameshifted CDS 221712..222632 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015401.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(222629..223810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(223929..224462) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228555.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(224516..225361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 note possible pseudo, frameshifted CDS complement(225358..225900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 note possible pseudo, frameshifted CDS 225945..226793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 227151..227438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 note possible pseudo, frameshifted CDS 227384..229006 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015390.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene dnaK note possible pseudo, frameshifted CDS 229062..229715 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015389.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene grpE CDS 229861..231051 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015388.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene dnaJ CDS 231064..231480 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015387.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(231558..232292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(232421..234190) product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015247.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(234252..235421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(235418..235675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 235757..236533 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015383.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(236530..237684) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230867.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(237751..238425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 note possible pseudo, frameshifted CDS 238614..238808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(238891..239979) product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015374.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 240082..241443 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015371.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 241632..243056 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015167.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 243128..244582 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015167.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 244937..246409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 246574..246837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 246789..247397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 note possible pseudo, frameshifted CDS 248431..251691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(252442..252984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 note possible pseudo, frameshifted CDS complement(252981..253289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 note possible pseudo, frameshifted CDS 254307..254546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 254530..255138 product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927004.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 255794..256645 product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966630.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 256656..257081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 257135..258361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(258429..259658) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730979.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 sequence14 source 1..15313 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(175..1092) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730435.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(1105..2307) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777092.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 2503..3600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(3597..4055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 note possible pseudo, frameshifted CDS complement(3968..4504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 note possible pseudo, frameshifted CDS complement(4598..4882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 note possible pseudo, frameshifted CDS complement(4894..5028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 note possible pseudo, frameshifted CDS complement(5028..5753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 note possible pseudo, frameshifted CDS 5981..6229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(6279..8336) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929004.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 8755..9885 product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 10023..10394 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948976.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(10635..11531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 note possible pseudo, frameshifted CDS complement(11528..11836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 note possible pseudo, frameshifted CDS 12194..12970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(13691..14797) product IS256-like element IS1081 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904572.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 note possible pseudo, internal stop codon, frameshifted sequence15 source 1..286315 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 235..1317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(1280..2155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 note possible pseudo, frameshifted CDS complement(3235..4137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 note possible pseudo, frameshifted CDS complement(4590..5573) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855430.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene rfbB CDS 5688..6779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(6741..7970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013578.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(8092..9339) product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013579.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 note possible pseudo, frameshifted CDS complement(9348..11279) product prolyl oligopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013580.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(11316..12449) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013583.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(12886..14124) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013583.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 14253..15683 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013602.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene lpdA CDS 15782..16897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225426.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(16932..18296) product acetate metabolism transcriptional regulator RamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859703.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene ramB CDS 18749..19507 product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855465.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 19521..21530 product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013606.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 21530..22279 product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013607.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 22348..22719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013608.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 22863..24179 product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855471.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 24316..24897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 24898..25209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 25190..25762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(25731..26522) product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096454126.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(26590..27417) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013626.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(27432..27926) product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855491.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 27951..28826 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208396413.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 note possible pseudo, frameshifted CDS 28820..29035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 note possible pseudo, frameshifted CDS complement(29032..29868) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013847.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(29865..32180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(32280..33293) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013851.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(33436..35499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 note possible pseudo, frameshifted CDS complement(35591..39847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 note possible pseudo, frameshifted CDS complement(39891..42503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 note possible pseudo, frameshifted CDS 42678..44357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(44434..44694) product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013354.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(44724..46334) product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208497.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(46341..46499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861489.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(46657..48375) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855494.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(48495..50204) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855494.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 50339..51616 product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013628.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene mshA CDS 51701..52447 product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855496.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 52464..53717 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855497.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 53714..54406 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013630.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 54417..54758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 54722..55276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(55779..56147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284373.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 56432..56968 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226185.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(56976..57872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013633.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 57991..58830 product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265553.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 58860..59714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 59746..60561 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855505.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene proC CDS 60704..60895 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855509.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(61342..61572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(61602..62498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 note possible pseudo, frameshifted CDS complement(62501..63538) product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855543.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 63684..63926 product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855545.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(63950..64294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 64579..65352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 note possible pseudo, frameshifted CDS 65354..66235 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013637.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene hemC CDS 66238..66501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 66889..68586 product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013645.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 68675..69349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07560 note possible pseudo, frameshifted CDS 69331..70065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 note possible pseudo, frameshifted CDS 70174..71175 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013646.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene hemB CDS 71292..71810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 71826..72311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096454196.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 72308..73225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 note possible pseudo, frameshifted CDS 73222..74898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 note possible pseudo, frameshifted CDS 74918..75268 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729125.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 75319..76377 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265560.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene hemE CDS 76378..76902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07650 note possible pseudo, frameshifted CDS 76815..77030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07660 note possible pseudo, frameshifted CDS 77027..77275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 note possible pseudo, frameshifted CDS 77281..77775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 note possible pseudo, frameshifted CDS 77803..78531 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856330.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(78549..79412) product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804286.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 79482..80198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 note possible pseudo, frameshifted CDS 80156..80464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 note possible pseudo, frameshifted CDS 80440..80820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 note possible pseudo, frameshifted CDS 80836..81444 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039673525.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 81445..82020 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855585.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 82013..82546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07760 note possible pseudo, frameshifted CDS 82635..82796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 note possible pseudo, frameshifted CDS 82819..83235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 note possible pseudo, frameshifted CDS 83163..84461 product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013653.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 note possible pseudo, frameshifted CDS 84505..85533 product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855590.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene ccsB CDS complement(86159..86455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 86500..86811 product DUF4229 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082868777.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(86815..87750) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015084.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 87960..88712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 88685..89131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(89061..89966) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013659.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(89970..90239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 note possible pseudo, frameshifted CDS complement(90154..91119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 note possible pseudo, frameshifted CDS complement(91144..91755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 91836..92123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 92251..93036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 93130..93642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 note possible pseudo, frameshifted CDS complement(93785..94720) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860502.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 94791..95690 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727412.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 95701..96183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 96207..96947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 note possible pseudo, frameshifted CDS 96932..98527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 note possible pseudo, frameshifted CDS 98533..100155 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013670.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene menD CDS 100607..101818 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854169.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(101821..102300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 102342..103031 product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013674.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(103143..104426) product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013675.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 104489..104905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 note possible pseudo, frameshifted CDS 104928..105503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 note possible pseudo, frameshifted tRNA 105581..105666 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 105905..105978 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 106022..106098 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 106165..106240 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 106264..106590 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013677.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene secE CDS 106780..107787 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013678.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene nusG CDS 107961..108389 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013679.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene rplK CDS 108452..109168 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013680.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene rplA CDS 109254..109679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 109682..109930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 109927..110928 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225345.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 111012..111740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 note possible pseudo, frameshifted CDS 111737..112522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 note possible pseudo, frameshifted CDS 112474..112947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 112948..113427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 113475..113822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(113909..114220) product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005100148.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene nirD CDS complement(114233..116734) product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726939.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene nirB CDS 117095..117628 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013688.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene rplJ CDS 117689..118078 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854210.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene rplL CDS 118280..119104 product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031512298.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(119101..119463) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776281.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 119920..122076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 note possible pseudo, frameshifted CDS 122001..123395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 note possible pseudo, frameshifted CDS 123542..124006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 note possible pseudo, frameshifted CDS 123892..124221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 note possible pseudo, frameshifted CDS 124128..126470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 note possible pseudo, frameshifted CDS 126491..127537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 127862..128236 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854221.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene rpsL CDS 128239..128706 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854222.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene rpsG CDS 128969..131095 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854224.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene fusA CDS 131519..132709 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013696.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene tuf CDS 132830..133528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013697.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(133525..134082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(134079..134642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(134639..135211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(135208..135411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(135408..135752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(135762..136226) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074067.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 136923..137228 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854291.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene rpsJ CDS 137268..137924 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854292.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene rplC CDS 137921..138586 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854293.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene rplD CDS 138586..138888 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854294.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene rplW CDS 138922..139758 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854295.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene rplB CDS 139775..140050 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854296.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene rpsS CDS 140054..140425 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854297.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene rplV CDS 140425..141168 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854298.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene rpsC CDS 141174..141590 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854302.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene rplP CDS 141590..141820 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854304.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene rpmC CDS 141912..142115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 note possible pseudo, frameshifted CDS complement(142219..143820) product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776426.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(143813..145438) product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073255020.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 145383..145559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 145565..146014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 146011..146424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 146608..146976 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854312.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene rplN CDS 146981..147295 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854314.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene rplX CDS 147297..147875 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854317.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene rplE CDS 148226..149014 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727259.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 149233..149946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(149943..150770) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776960.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene fdhD CDS complement(150770..150997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(151103..151693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 note possible pseudo, frameshifted CDS complement(151663..152079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 note possible pseudo, frameshifted CDS complement(152076..152336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 note possible pseudo, frameshifted CDS complement(152444..153937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 note possible pseudo, frameshifted CDS complement(153937..154737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 note possible pseudo, frameshifted CDS complement(155027..155467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 155446..155982 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860588.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene rplF CDS 155985..156389 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854346.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene rplR CDS 156430..157062 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854347.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene rpsE CDS 157066..157251 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814541.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene rpmD CDS 157260..157709 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013717.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene rplO CDS complement(157916..158467) product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392892.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(158467..159408) product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262982.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(159422..160081) product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421848.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene dmsB CDS complement(160101..161342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 note possible pseudo, frameshifted CDS complement(161273..162613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 note possible pseudo, frameshifted CDS 162894..164213 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854402.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene secY CDS 164213..164758 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854403.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 164864..165661 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013728.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene map CDS 165714..166535 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013729.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 166712..166939 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854422.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene infA CDS 167124..167504 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854425.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene rpsM CDS 167494..167883 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854428.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene rpsK CDS 167909..168514 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013730.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene rpsD CDS 168641..169654 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013731.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 169699..170235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 170299..171264 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854437.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene truA CDS 171332..171916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 note possible pseudo, frameshifted CDS 171841..173394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 note possible pseudo, frameshifted CDS 173331..173495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 173686..174837 product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013736.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene eccB CDS complement(175010..175243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 175145..176464 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013737.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 176519..177841 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013738.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(177932..178363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(178311..179420) product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013739.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene mycP CDS complement(179501..180808) product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564626.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene eccD CDS 180965..183361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 note possible pseudo, frameshifted CDS 183262..184071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 note possible pseudo, frameshifted CDS 183987..184640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 note possible pseudo, frameshifted CDS 184637..185605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 185758..186099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 186140..186436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 186834..187277 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854535.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene rplM CDS 187277..187840 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854537.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene rpsI CDS complement(188308..190170) product phenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015304.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(190335..191366) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853829.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(191418..191687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(191793..192272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 note possible pseudo, frameshifted CDS complement(192370..193137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 note possible pseudo, frameshifted CDS 193521..194075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 194128..195639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 195900..197075 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 197075..197785 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855103.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 197788..199107 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015552.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(199134..200675) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015310.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene lysS CDS complement(200735..201262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 201486..202166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 202163..203518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 203603..205717 product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029237.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(205786..206586) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015311.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(206588..207292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015312.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(207289..208230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853812.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(208241..208708) product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853810.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(208705..209190) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015314.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene folK CDS complement(209190..209603) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853806.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene folB CDS complement(209603..210490) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173664572.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene folP CDS complement(210493..211089) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015316.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene folE CDS complement(211092..212162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 note possible pseudo, frameshifted CDS complement(212129..213565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 note possible pseudo, frameshifted CDS complement(213648..214247) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285928.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene hpt CDS complement(214351..215304) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776965.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(215301..215978) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731209.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(215975..216628) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143979554.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 216780..217052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(217491..218393) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015318.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene tilS CDS complement(218393..219235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 note possible pseudo, frameshifted CDS complement(219133..219654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 note possible pseudo, frameshifted CDS 219741..220274 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015320.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 220324..220614 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862931.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 220869..221318 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015324.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 221318..225172 product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015325.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(225194..225412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(225298..226419) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014060.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 note possible pseudo, frameshifted CDS complement(226539..227288) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897046.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(227281..228180) product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853756.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene ppk2 CDS complement(228427..228573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(228642..228842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(229250..230887) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862917.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene groL CDS 231085..232401 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015336.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 232638..233012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 note possible pseudo, frameshifted CDS 232976..234316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 note possible pseudo, frameshifted CDS 234283..235680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 note possible pseudo, frameshifted CDS 235681..236172 product Na(+)/H(+) antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853720.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 236165..236710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09570 note possible pseudo, frameshifted CDS 236653..237441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 note possible pseudo, frameshifted CDS 237453..237995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 note possible pseudo, frameshifted CDS 237995..238504 product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015339.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 238505..238780 product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862899.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 238781..239191 product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853711.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene mnhG CDS complement(239188..240324) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853704.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(240324..240980) product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015340.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(241137..241388) product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853699.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 241387..241959 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862894.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 241959..243017 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015341.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 243028..243825 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853692.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 243980..245305 product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853689.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(245381..246304) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228638.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(246348..248117) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775581.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 248325..249470 product Na/Pi symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123063.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(249508..249675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(249621..250181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 note possible pseudo, frameshifted CDS complement(250241..251173) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015345.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(251166..251660) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853671.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 251781..253226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020309579.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 253226..254212 product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015348.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 254205..256580 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015349.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 257150..257746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(257881..259077) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862874.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(259077..259955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 note possible pseudo, frameshifted CDS 260078..260263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 260626..261987 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015351.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 262006..262455 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015352.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(262483..262842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(262808..263119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(263119..263427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(263508..263870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(263895..264212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(264271..265446) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853648.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene purT CDS complement(265571..266974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(267307..268605) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015361.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 268668..269606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853637.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 270001..271449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 271555..271977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 272005..272769 product PRC and DUF2382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229813.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(272770..273195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 note possible pseudo, frameshifted CDS complement(273183..273938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 note possible pseudo, frameshifted CDS complement(273948..275093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(275226..276260) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015363.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene fbaA CDS complement(276372..277553) product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167382136.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(277597..278253) product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511861.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(278246..278800) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862850.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene pyrE CDS complement(278811..279956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(279901..280938) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015366.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(280958..281404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(281414..283516) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015370.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene clpB note possible pseudo, frameshifted CDS complement(283513..283962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 note possible pseudo, frameshifted CDS complement(284275..285735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 sequence16 source 1..585305 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 278..1234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157746499.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(1520..2938) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013522.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 3061..4380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 note possible pseudo, frameshifted CDS 4263..6020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 note possible pseudo, frameshifted CDS 6017..6472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 6476..8014 product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211271326.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 8014..8415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 8417..8683 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013517.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 8683..9009 product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863340.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(9225..10784) product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013509.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 10841..11479 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013508.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 11680..13131 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014119.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(13341..13781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(13959..14990) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013506.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(15079..15999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 note possible pseudo, frameshifted CDS complement(15996..16343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 note possible pseudo, frameshifted CDS 16449..17333 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013505.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 17617..19455 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015439406.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene leuA CDS complement(19493..20122) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312123.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 20341..21885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 21953..22951 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013503.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 22970..24253 product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013502.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 24246..25004 product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013501.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(25024..25650) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013500.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(25772..26116) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855676.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(26351..28402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10360 note possible pseudo, frameshifted CDS complement(28408..28833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 note possible pseudo, frameshifted CDS complement(28842..29408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(29409..30683) product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222431737.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 31183..33588 product cytochrome P450/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187052.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 33633..33860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 34104..35222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 tRNA 35551..35637 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(35760..36302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(36582..38135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(38356..38994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 note possible pseudo, frameshifted CDS 39329..40003 product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863385.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(40007..41188) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020309519.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene tgt CDS complement(41297..43378) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013489.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 note possible pseudo, frameshifted CDS complement(43371..43625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 tRNA complement(43778..43865) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(43904..44116) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855652.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(44198..44674) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855650.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene tadA CDS complement(44661..45149) product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863394.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 45255..46217 product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013487.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 tRNA complement(46442..46515) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(46640..47248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 note possible pseudo, frameshifted CDS complement(47157..47972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 note possible pseudo, frameshifted CDS complement(47930..48223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 note possible pseudo, frameshifted CDS complement(48508..49866) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096453796.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene mgtE CDS complement(49942..50418) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031962.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(50419..52347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(52631..53839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10600 note possible pseudo, frameshifted tRNA complement(54140..54215) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA complement(54217..54306) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 54415..55437 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013481.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene hisC CDS complement(55442..55711) product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863405.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 55771..56997 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013476.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 57008..57484 product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013474.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 57474..57941 product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013473.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 57934..59001 product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013472.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 59151..59666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 60201..60797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 tRNA complement(61000..61087) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 61159..61869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 note possible pseudo, frameshifted CDS 61797..62147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10700 note possible pseudo, frameshifted CDS complement(62144..62488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 note possible pseudo, frameshifted CDS complement(62542..63393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 note possible pseudo, frameshifted CDS 63645..64082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 64145..64993 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857646.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 65004..65810 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013466.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 66274..67185 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013464.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(67195..67467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 note possible pseudo, frameshifted CDS complement(67697..68182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(68232..69167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013461.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(69188..69601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(69598..70071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 70107..70343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857667.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 70489..71901 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863441.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 71915..72682 product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013458.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(72743..72961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 72999..73496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 note possible pseudo, frameshifted CDS 73388..74749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 note possible pseudo, frameshifted CDS 74780..77857 product arabinosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013456.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 77917..78216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 note possible pseudo, frameshifted CDS complement(78219..78623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 note possible pseudo, frameshifted CDS complement(78623..79111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 note possible pseudo, frameshifted CDS complement(79142..79798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 79828..81759 product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013430.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(81762..82388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863725.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 82473..83408 product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013428.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(83425..83874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 note possible pseudo, frameshifted CDS complement(84061..84327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10970 note possible pseudo, frameshifted CDS complement(84402..85403) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056643.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(85501..86088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 note possible pseudo, frameshifted CDS complement(86085..86342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 note possible pseudo, frameshifted CDS complement(86347..86628) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857164.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(86652..87287) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013426.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(87312..87626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 note possible pseudo, frameshifted CDS complement(87557..88027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 note possible pseudo, frameshifted CDS 88599..89315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 note possible pseudo, frameshifted CDS complement(89378..89662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 89543..90934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(91551..92219) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974283.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(92212..92976) product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(93037..93717) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006283863.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 93811..94821 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013419.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(94844..95980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 note possible pseudo, frameshifted CDS complement(95977..96537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 note possible pseudo, frameshifted CDS 96625..97161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 note possible pseudo, frameshifted CDS 97173..97427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 note possible pseudo, frameshifted CDS 97573..98730 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013408.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 98799..99881 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006283847.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(99885..100397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(100495..101445) product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011896407.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(101445..102857) product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096453446.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene amn CDS complement(102897..103823) product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727678.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 103921..104823 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022593.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(105198..106043) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064408.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 106157..107851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 107871..108830 product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013373.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 108811..109548 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015241.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 109646..110377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 note possible pseudo, frameshifted CDS 110364..110660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 note possible pseudo, frameshifted CDS 110968..111306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 111334..112104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 112297..112785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 112779..113033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(113089..113421) product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047690.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 113441..113908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 note possible pseudo, frameshifted CDS 114034..114816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 note possible pseudo, frameshifted CDS complement(114949..115452) product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892495.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 115501..116901 product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897308.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 note possible pseudo, frameshifted CDS 116816..117004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 note possible pseudo, frameshifted CDS 117024..117530 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803955.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(117535..118722) product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013948.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 118847..119392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(119406..120947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(121072..122751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 123156..123317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 note possible pseudo, frameshifted CDS 124000..124431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 note possible pseudo, frameshifted CDS 124489..127188 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244282.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 127188..129179 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233883.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 129180..130346 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966754.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 130393..130770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 131080..131664 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013389.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 131753..131920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 131968..132651 product DUF6198 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855341.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 132655..133041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 133038..133325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 133386..133676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 133698..134492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 note possible pseudo, internal stop codon CDS 134489..135145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(135122..135565) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081784.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 135710..136945 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015567.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 repeat_region 137071..139598 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggctcatccccgctagcgcggggaacac CDS complement(140013..140351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(140941..141621) product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227610.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene cas6e CDS complement(142330..143316) product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene cas7e CDS complement(144117..145421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(145418..145795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(145875..148724) product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674070.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(149224..149664) product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776269.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene arfB CDS complement(149699..150226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(150223..150582) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222521.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 150692..151204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(151217..152341) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286427.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(152410..153672) product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080520.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene gdhA CDS complement(154120..156252) product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223614.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 156399..157346 product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501902.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 157448..158755 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729451.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 158781..159770 product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226183.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 159782..160765 product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167582487.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 160793..161686 product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777075.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene larE CDS complement(161724..162653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 note possible pseudo, frameshifted CDS complement(162728..163639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 note possible pseudo, frameshifted CDS complement(163653..164273) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227083.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(164330..164548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(164557..164967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 164860..165609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 note possible pseudo, frameshifted CDS 165606..167006 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726889.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 167017..167904 product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419249.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 167951..168529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 note possible pseudo, frameshifted CDS 168439..168624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 note possible pseudo, frameshifted CDS 168707..169114 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194559634.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(169437..169736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(170119..171120) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224940.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 171041..171223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(171286..171810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 171847..172479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(172887..174635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(174649..175716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(175901..176173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 176661..177134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(177188..178654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 178987..179949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(180203..180949) product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene istB CDS complement(180946..182019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(182147..182914) product IS21-like element ISMt2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418125.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene istB CDS complement(183016..183903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(183929..184096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(184096..184383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 note possible pseudo, frameshifted CDS complement(184388..184924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 note possible pseudo, frameshifted CDS complement(184897..185148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 tRNA complement(185782..185858) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(185922..186833) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013528.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 186878..187330 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863321.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(187348..187683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(187689..189761) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013529.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 note possible pseudo, frameshifted CDS 189991..190359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 190369..190545 product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855791.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 190546..191007 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855793.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 191046..191861 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285704.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(191945..192628) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855810.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 192995..193843 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013539.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene nth CDS 193840..194424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 194434..195165 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013541.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 195251..196444 product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013542.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(196423..197352) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013543.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(197455..197958) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013544.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 198088..198768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(198765..199601) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013545.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 200386..201117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 note possible pseudo, frameshifted CDS 201533..202285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 note possible pseudo, frameshifted CDS 202282..203052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 203049..203639 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013549.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 203670..203900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 203911..204216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863285.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 204216..204566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(204596..205321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 note possible pseudo, frameshifted CDS complement(205291..206952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 note possible pseudo, frameshifted CDS 207206..207409 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862487.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 207749..208840 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014490.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 note possible pseudo, frameshifted CDS 208776..209819 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014491.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 209820..210578 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014492.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 210609..211316 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024130.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(211313..212050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(212050..212976) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327302.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(212986..213156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(213358..213984) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013527.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(214033..214908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 note possible pseudo, frameshifted CDS complement(214985..215296) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899493.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 215349..216245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(216242..216547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 note possible pseudo, frameshifted CDS complement(216900..217712) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857487.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(217715..219016) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897397.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(218916..219815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 note possible pseudo, frameshifted CDS complement(219973..220413) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861694.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene rbfA CDS complement(220566..223394) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014802.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene infB CDS complement(223948..224949) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861701.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene nusA CDS complement(224946..225515) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014804.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene rimP CDS 225560..226420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 226431..227309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 note possible pseudo, frameshifted CDS 227195..227686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 note possible pseudo, frameshifted CDS 227683..228348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 note possible pseudo, frameshifted CDS 228641..229792 product tyramine oxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014462.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 229835..230341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 note possible pseudo, frameshifted CDS 230338..231270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 note possible pseudo, frameshifted CDS complement(231622..233373) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857500.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 233405..234133 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014808.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene yaaA CDS complement(234123..235337) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028249.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 235940..237298 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014224.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(237300..238613) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015051.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(238613..239170) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015052.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(239172..240206) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567704.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(240401..240925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 note possible pseudo, frameshifted CDS complement(240844..241377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(241364..241930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 241865..242110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 242127..243314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(243311..244036) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014813.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(244106..244267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 note possible pseudo, frameshifted CDS complement(244228..245604) product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014814.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene mqo CDS 245861..246862 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857515.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 246961..248376 product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014816.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene mtr CDS 248528..249109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 249168..249572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(249636..250532) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172769613.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene map CDS complement(250558..250878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 note possible pseudo, frameshifted CDS complement(250866..252341) product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857527.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 note possible pseudo, frameshifted CDS complement(252433..253596) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456766.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene ispG CDS complement(253661..254872) product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014824.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(254888..255823) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014825.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene dxr note possible pseudo, frameshifted CDS complement(255817..256056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 note possible pseudo, frameshifted CDS 256211..256711 product DUF2631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857542.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(256771..257352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 note possible pseudo, frameshifted CDS 257973..258389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(258386..259333) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857552.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(259340..259897) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014829.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene frr CDS complement(259974..261848) product peptidoglycan O-acetyltransferase OatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932001.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene oatA CDS 261956..262504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 note possible pseudo, frameshifted CDS 262423..263037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 note possible pseudo, frameshifted CDS complement(263034..263762) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284182.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene pyrH CDS complement(263894..264721) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014830.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene tsf CDS complement(264910..265743) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014831.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene rpsB CDS 266103..266408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12980 note possible pseudo, frameshifted CDS 266360..266560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 note possible pseudo, frameshifted CDS complement(266523..267413) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857565.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(267423..268586) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861752.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene dprA CDS complement(268583..270100) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014834.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(270087..270449) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014835.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(270597..270905) product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857573.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(270895..271362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 note possible pseudo, frameshifted CDS complement(271386..271550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 note possible pseudo, frameshifted CDS complement(271552..272307) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014836.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene lepB CDS complement(272403..272750) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014838.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene rplS CDS complement(272868..274673) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014841.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 note possible pseudo, frameshifted CDS complement(274646..275131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 note possible pseudo, frameshifted CDS complement(275149..276423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 276386..276664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 276598..276993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 note possible pseudo, frameshifted CDS complement(276990..277487) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014847.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene rimM CDS complement(277568..278080) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807782.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(278139..278639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 278966..279349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 note possible pseudo, frameshifted CDS 279346..280992 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013830.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 note possible pseudo, internal stop codon, frameshifted CDS complement(281064..281507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(281606..283219) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014851.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene ffh CDS complement(283313..284899) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029703265.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene ftsY CDS 285224..286399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(286396..289845) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014857.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene smc CDS complement(289855..290136) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856367.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(290142..291605) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863416.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(291639..292463) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728330.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene mutM CDS complement(292456..293226) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861938.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene rnc CDS complement(293223..293414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 note possible pseudo, frameshifted CDS complement(293515..293754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 note possible pseudo, frameshifted CDS complement(293765..294523) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861943.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(294577..295923) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856385.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene gdhA CDS 296017..297162 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014866.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(297132..297533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856390.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 297555..298694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 note possible pseudo, frameshifted CDS 298577..298906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 note possible pseudo, frameshifted CDS 298961..299641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 note possible pseudo, frameshifted CDS 299593..300216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 note possible pseudo, frameshifted CDS 300304..302691 product maltodextrin phosphorylase MalP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858869.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene malP CDS complement(302771..303949) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810346.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(304008..304811) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393147.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(304824..305588) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392974.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(305585..306721) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459052.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(306721..307770) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810346.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(308052..309332) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014873.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene pyk CDS complement(309555..310439) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014874.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene lgt CDS complement(310464..311279) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894608.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene trpC CDS complement(311393..312052) product TIGR02234 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014875.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(312068..312313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 note possible pseudo, frameshifted CDS complement(312420..313196) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856413.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene hisF CDS complement(313208..313996) product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861968.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(314015..314188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 note possible pseudo, frameshifted CDS complement(314164..314748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 note possible pseudo, frameshifted CDS complement(314759..315232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 note possible pseudo, frameshifted CDS complement(315229..315402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 note possible pseudo, frameshifted CDS complement(315408..316685) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856421.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(316843..317049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(317050..317652) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861983.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene hisB CDS complement(317655..318752) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014880.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(318752..319471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 note possible pseudo, frameshifted CDS complement(319477..320061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 note possible pseudo, frameshifted CDS 320232..321185 product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014882.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(321163..321744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(321745..322443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 322791..325079 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014885.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene glgX CDS 325165..326376 product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856453.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 326331..326534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 note possible pseudo, frameshifted CDS 326622..327176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 327247..329775 product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014893.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene treY CDS 329782..330795 product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856459.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(330792..331175) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014897.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(331179..331406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862025.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(331418..332068) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014898.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 332099..332494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 note possible pseudo, frameshifted CDS 332500..333837 product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856468.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene treZ note possible pseudo, frameshifted CDS complement(333834..334292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 note possible pseudo, frameshifted CDS complement(334250..335104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 note possible pseudo, frameshifted CDS 335254..335871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 note possible pseudo, frameshifted CDS 335873..337156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 note possible pseudo, frameshifted CDS 337307..337744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(337828..339036) product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856473.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(339177..340385) product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856473.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(340536..344096) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856475.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene dnaE CDS complement(344119..345339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 345479..345916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 note possible pseudo, frameshifted CDS 345913..346347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13850 note possible pseudo, frameshifted CDS complement(346334..346777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 note possible pseudo, frameshifted CDS complement(346899..347825) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856488.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(348051..348371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 note possible pseudo, frameshifted CDS 348537..349364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014909.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 349424..350194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 note possible pseudo, frameshifted CDS 350271..350801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 note possible pseudo, frameshifted CDS 350801..351115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 note possible pseudo, frameshifted CDS complement(351116..351775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860404.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 351897..352928 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860401.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(352840..354231) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014912.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(354249..355079) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014913.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(355152..357605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 note possible pseudo, frameshifted CDS complement(357614..358267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 note possible pseudo, frameshifted CDS complement(358570..359604) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860384.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(359812..360099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(360233..360712) product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856516.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(360785..361507) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856518.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(361508..362239) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014919.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene pgeF CDS complement(362288..363244) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014920.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene ftsZ note possible pseudo, frameshifted CDS complement(363154..363525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 note possible pseudo, frameshifted CDS complement(363695..364384) product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860375.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene ftsQ CDS complement(364395..365882) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066569796.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene murC CDS complement(365900..366973) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856529.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene murG CDS complement(366993..368456) product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014922.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(368459..369880) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014923.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene murD CDS complement(369881..370987) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014924.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene mraY CDS complement(370994..372556) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014925.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(372613..374157) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856539.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(374179..376113) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014926.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(376208..377047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(377061..378065) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860361.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene rsmH CDS complement(378225..378659) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856549.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene mraZ CDS complement(379223..379621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(379740..379937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 380360..380926 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856553.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 380984..381469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 note possible pseudo, frameshifted CDS 381433..381597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 note possible pseudo, frameshifted CDS 381764..382084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 note possible pseudo, frameshifted CDS 382087..383598 product alpha-(1->6)-mannopyranosyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856557.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(383570..383929) product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856558.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 384010..386226 product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014933.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene pknB CDS complement(386281..387639) product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856581.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(387735..388265) product polyadenylate-specific 3'-exoribonuclease AS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856583.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(388283..388495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(388502..389662) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014940.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(389792..390526) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014941.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(390538..391509) product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014942.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(391553..392305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 note possible pseudo, frameshifted CDS complement(392380..392667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 note possible pseudo, frameshifted CDS complement(392680..393510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14350 note possible pseudo, frameshifted CDS complement(394034..394777) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014945.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 395503..396861 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014843.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 396882..398372 product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157776019.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 398419..399369 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857593.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(399494..401113) product cytochrome bc1 complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856609.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene qcrB CDS complement(401113..402393) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014946.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(402406..403176) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172768931.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 note possible pseudo, frameshifted CDS complement(403228..403893) product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014948.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(404320..404751) product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014950.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(404772..405866) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014951.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 406395..406598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 note possible pseudo, frameshifted CDS 406586..408322 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014952.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene asnB CDS complement(408243..409019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(409122..409466) product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856623.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 409641..409895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 note possible pseudo, frameshifted CDS 409904..410365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 note possible pseudo, frameshifted CDS 410417..411421 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014954.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene cobT CDS complement(411499..412284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 note possible pseudo, frameshifted CDS complement(412368..412613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 note possible pseudo, frameshifted CDS 412695..414164 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856630.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(414169..414561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856631.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 414700..416841 product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014958.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene sucB CDS 416990..417169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 417270..417623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 note possible pseudo, frameshifted CDS 417620..419851 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene gcvP note possible pseudo, frameshifted CDS 419860..420930 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223708.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene gcvT CDS 420935..421324 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973527.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene gcvH CDS 421336..422127 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856633.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene lipB CDS 422164..423222 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856634.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene lipA CDS 423299..424087 product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859641.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(424349..424879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 note possible pseudo, frameshifted CDS complement(424894..425937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 note possible pseudo, frameshifted CDS complement(425988..426464) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856936.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 426604..427755 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014960.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene glnA note possible pseudo, frameshifted CDS 427749..428039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 note possible pseudo, frameshifted CDS 428230..428379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 428376..429059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(429132..429560) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015196.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 429703..430215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 430215..431111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(431118..431828) product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096802951.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(431847..432374) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859635.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 432693..433220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(433447..434400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(434400..434534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(434566..436098) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014964.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene thrC CDS 436176..437465 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856952.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(437482..437772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(437813..440848) product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014971.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(440862..442190) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856962.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 442257..443912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(443952..444158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856969.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 444249..445505 product galactokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856970.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(445555..446895) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856972.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(447048..448010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(448699..449856) product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859605.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(449859..450548) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014976.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(450567..451715) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014977.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 451772..452419 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856980.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 452507..452875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14950 note possible pseudo, frameshifted CDS 452891..453880 product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856984.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 453896..454702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 tRNA complement(455019..455094) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(455154..455390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 455799..458531 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014985.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene aceE CDS complement(458599..459576) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856999.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 459632..459922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 459942..460547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 note possible pseudo, frameshifted CDS 460547..460786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 note possible pseudo, frameshifted CDS complement(460796..461155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 461417..462895 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013348.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(462906..463733) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857011.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(463764..464684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(464802..465581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 note possible pseudo, frameshifted CDS complement(465554..466285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 note possible pseudo, frameshifted CDS 466398..467687 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013369.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 467689..467877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 467874..468290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(469444..470247) product Fe(3+) dicitrate ABC transporter ATP-binding protein FecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477430.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene fecE CDS complement(470244..470873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 note possible pseudo, internal stop codon, frameshifted CDS complement(470915..471205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 note possible pseudo, frameshifted CDS complement(471269..472300) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729924.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(472349..472969) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461185.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(472966..473379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 note possible pseudo, frameshifted CDS complement(473358..473678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 note possible pseudo, frameshifted CDS complement(473689..474537) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461187.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(474500..475048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 note possible pseudo, frameshifted CDS complement(474970..475539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 note possible pseudo, frameshifted CDS complement(475530..477167) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272184.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(477338..479362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(479591..480076) product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544978.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(480092..481228) product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933903.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(481412..481981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(482125..482658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(482649..484076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(484264..484782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(484786..485214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(485447..485689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(485979..486125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(486086..486352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(486462..486653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 tRNA complement(487657..487733) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA 487921..487994 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 488055..489263 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862889.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(489356..489559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(489490..490218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 490323..490568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014998.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(490569..491516) product exopolyphosphatase Ppx2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568167.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene ppx2 CDS complement(491513..492082) product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014021.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(492112..492720) product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014020.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 492982..493512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(493965..495242) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856756.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene eno CDS complement(495362..496105) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014019.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 496318..496737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(496785..497393) product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014016.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 497406..497636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 497573..498280 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894590.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene nadC note possible pseudo, frameshifted CDS complement(498357..499316) product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015309.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(499402..501300) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857029.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene dnaG CDS 501346..501765 product ribonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857030.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 501758..502009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857033.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(502017..502508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(502511..503653) product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933903.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(503728..504048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 note possible pseudo, frameshifted CDS complement(503970..504998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 note possible pseudo, frameshifted CDS 505206..507095 product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015004.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(507169..507585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015005.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 note possible pseudo, frameshifted CDS complement(507597..508100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(508100..509482) product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857047.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 509814..510272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 510357..510782 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015007.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(510775..511377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 note possible pseudo, frameshifted CDS complement(511374..511838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 note possible pseudo, frameshifted CDS complement(511835..512578) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015010.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(512582..513319) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859464.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene recO CDS complement(513320..514264) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015011.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene era CDS complement(514368..515219) product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene pdxY CDS complement(515407..516744) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859459.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(516744..517316) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015012.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene ybeY CDS complement(517313..518314) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015013.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(518334..519041) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015014.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(519042..519434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 note possible pseudo, frameshifted CDS complement(519374..520177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 note possible pseudo, frameshifted CDS complement(520196..521212) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859450.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene hrcA CDS complement(521250..522140) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015017.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene hemW note possible pseudo, frameshifted CDS complement(522146..522370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15780 note possible pseudo, frameshifted CDS complement(522391..523065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859444.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(523176..524249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 note possible pseudo, frameshifted CDS complement(524246..525019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 note possible pseudo, frameshifted CDS 525160..526731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15820 note possible pseudo, frameshifted CDS 526716..527303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 note possible pseudo, frameshifted CDS complement(527309..527449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(527461..527631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(527632..529602) product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015021.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 529623..530918 product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015022.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 530978..531265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 531307..532101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(532103..532657) product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948619.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene idi CDS complement(532668..533057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 533337..535229 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015020.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 535240..536376 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015029.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 536387..538144 product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208396061.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene treS CDS 538144..538494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 538410..539231 product trehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015024.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 note possible pseudo, frameshifted CDS 539326..540546 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015030.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene brnQ CDS complement(540456..540743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(540740..541807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 541849..542475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(542472..543410) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858824.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(543414..543731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 note possible pseudo, frameshifted CDS complement(543728..544306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 note possible pseudo, frameshifted CDS complement(544357..544665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(544676..545563) product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014292.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 tRNA complement(545702..545776) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 545879..547438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 note possible pseudo, frameshifted CDS 547507..548136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 note possible pseudo, frameshifted CDS 548103..548531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 note possible pseudo, frameshifted CDS 548515..549537 product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803865.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(549534..550280) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014302.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(550280..550453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 550490..551956 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014303.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene rpsA CDS complement(552051..552557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 552670..553269 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014305.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene coaE CDS 553306..555411 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948572.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene uvrB CDS 555433..555891 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014315.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 555984..556427 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014315.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(556503..556973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 note possible pseudo, frameshifted CDS complement(556868..558685) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208400581.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 note possible pseudo, frameshifted CDS complement(558812..559342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 note possible pseudo, frameshifted CDS complement(559372..559722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 note possible pseudo, frameshifted CDS complement(559813..560415) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858732.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 560571..563420 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014319.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene uvrA CDS 563519..563977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 564819..565208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 565239..565433 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858721.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene rpmI CDS 565491..565874 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858719.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene rplT CDS 566089..566817 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858706.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 566904..567962 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897202.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene pheS CDS 567975..568538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 note possible pseudo, frameshifted CDS 568463..569512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 note possible pseudo, frameshifted CDS 569461..570501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 note possible pseudo, frameshifted CDS 570555..571598 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858698.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene argC CDS 571608..572780 product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014333.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene argJ CDS 572810..573748 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858695.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene argB CDS 573751..574953 product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014334.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 574934..575788 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014335.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene argF note possible pseudo, frameshifted CDS 575722..575892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 note possible pseudo, frameshifted CDS 575893..576390 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858683.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(576474..576827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 576935..577693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 note possible pseudo, frameshifted CDS 577693..579129 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014337.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene argH CDS 579176..580333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014338.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 580333..580698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 note possible pseudo, frameshifted CDS 580806..581912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 note possible pseudo, frameshifted CDS 581899..582558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 582555..582737 product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861608.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 582810..584096 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014341.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene tyrS sequence17 source 1..371159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 41..208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 445..1926 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859734.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(1927..2481) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014038.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(2524..2745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 note possible pseudo, frameshifted CDS complement(2700..3470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 note possible pseudo, frameshifted CDS 3465..3617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(3980..4615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(4668..5306) product LysR family transcriptional regulator substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014037.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 5376..5708 product DUF5997 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856795.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(5705..6397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 note possible pseudo, frameshifted CDS complement(6394..6942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 note possible pseudo, frameshifted CDS complement(7123..8412) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856790.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene glyA CDS 8635..8973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 note possible pseudo, frameshifted CDS 8910..9482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 note possible pseudo, frameshifted CDS complement(9486..9992) product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014033.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(10013..11899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(12114..12404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856779.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(12404..13288) product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014030.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene mca CDS 13433..13906 product DUF4307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856773.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 14022..14543 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014029.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene greA CDS 14615..14890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(15024..15842) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014027.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 15992..16957 product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085957470.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 tRNA complement(17368..17444) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 17548..18801 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014015.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 note possible pseudo, frameshifted CDS 18798..19013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 note possible pseudo, frameshifted CDS complement(19010..19993) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038700.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 note possible pseudo, internal stop codon, frameshifted CDS complement(20107..20247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(20301..23939) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856733.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene mfd CDS complement(23929..24576) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014009.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 tRNA 24667..24739 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 24992..26257 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 26306..27643 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013993.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene glmU CDS 27774..28751 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860060.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 29168..30556 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289668.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(30630..31478) product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776251.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(31478..32641) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776250.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(32645..33652) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803841.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(33665..34507) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015208.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(34726..35847) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228261.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 36093..37322 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730979.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 37568..38335 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860245.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 38336..38770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 note possible pseudo, frameshifted CDS 38680..40890 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857914.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(40887..41243) product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860253.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(41244..41561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(41572..41826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 note possible pseudo, frameshifted CDS complement(41721..42989) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451037.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 note possible pseudo, frameshifted CDS 43209..44867 product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015199.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene pgm CDS 44941..45426 product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223188.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 45485..46216 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857927.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 tRNA 46329..46404 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 46468..47232 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015195.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(47229..47429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 note possible pseudo, frameshifted CDS complement(47456..48064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 note possible pseudo, frameshifted CDS 48147..48884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 note possible pseudo, frameshifted CDS complement(48970..49308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 49258..49479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 49529..49759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 50337..50570 product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857948.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene nrdH CDS 50720..51256 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857951.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene nrdI CDS 51327..53492 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857952.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene nrdE CDS complement(53573..54247) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467994.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(54244..55269) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817222.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(55274..56098) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084189.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(56265..56975) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567723.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 57235..58230 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015189.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene nrdF CDS 58658..59023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 note possible pseudo, frameshifted CDS 58957..60123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 note possible pseudo, frameshifted CDS 60120..60341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 note possible pseudo, frameshifted CDS 60513..61775 product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082353449.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene serB CDS 61775..62524 product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567712.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(62514..63074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 note possible pseudo, frameshifted CDS complement(63071..64192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 note possible pseudo, frameshifted CDS complement(64192..64500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 note possible pseudo, frameshifted CDS complement(64519..65793) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015184.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(65859..66446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 66591..66878 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897801.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene clpS CDS 66905..67441 product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857980.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 67441..68394 product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015182.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 68409..69113 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860306.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 69304..69765 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015181.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 69827..70603 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567685.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene murI CDS 70648..71322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 note possible pseudo, frameshifted CDS 71238..71444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 71463..72161 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857993.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene rph CDS 72187..72789 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015172.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene rdgB CDS complement(72796..73158) product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857996.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(73175..73618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857998.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 tRNA 73743..73825 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(73864..74400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 note possible pseudo, frameshifted CDS complement(74406..75752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 note possible pseudo, frameshifted CDS 76004..76411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 note possible pseudo, frameshifted CDS 76399..76590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 note possible pseudo, frameshifted CDS 76805..80272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 note possible pseudo, frameshifted CDS 80269..84771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 note possible pseudo, frameshifted CDS 84771..85151 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015166.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(85159..85800) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857691.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(85800..86276) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015164.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene bcp CDS 86368..86643 product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015163.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 86967..87167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(87256..87771) product gluconokinase, GntK/IdnK-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015160.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(87947..88828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(88927..90114) product glucuronide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075848.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene uidB note possible pseudo, frameshifted CDS complement(90202..91398) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037467968.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 note possible pseudo, frameshifted CDS complement(91556..92962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(93038..94117) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777069.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 94380..94904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 tRNA complement(94965..95038) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 95288..96457 product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015151.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 96458..97402 product MsnO8 family LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804400.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 tRNA complement(97447..97522) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(97572..98216) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015149.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene orn CDS 98450..100564 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385686.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene nrdD CDS 100548..101102 product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905258.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene nrdG CDS complement(101047..101898) product mycolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015148.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene cmrA CDS complement(102648..102818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 103399..103620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 103695..104084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 note possible pseudo, internal stop codon, frameshifted tRNA complement(104158..104232) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(104248..104730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(104736..105170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 105235..105786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17640 note possible pseudo, frameshifted CDS 105744..107288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 note possible pseudo, frameshifted CDS 107433..108011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 108081..108878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 note possible pseudo, frameshifted CDS 108896..109750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 note possible pseudo, frameshifted CDS 109777..110202 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567531.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 110199..110819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567537.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 110990..112237 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564999.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(112244..112615) product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015129.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(112635..113618) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727594.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 113723..114865 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015127.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 114963..115676 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073373.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(115673..116329) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013524.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(116326..117714) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013525.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(117752..118207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(118289..119257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 note possible pseudo, frameshifted CDS complement(119155..120687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 note possible pseudo, frameshifted CDS 120792..121418 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015107.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 121503..122786 product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943062.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 122842..123315 product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859211.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(123383..124207) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567680.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(124236..126227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(126227..126823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(126853..127083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 127196..128188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 128185..129249 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119846.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 129246..130214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119847.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 130199..130996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(131082..131783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015105.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 note possible pseudo, frameshifted tRNA 131941..132015 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA 132130..132204 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA 132363..132437 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS 132506..133891 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567596.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene tig CDS 134088..134687 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859220.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 134711..135331 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859221.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 135513..136115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 note possible pseudo, frameshifted CDS 136097..136945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 note possible pseudo, frameshifted CDS complement(137019..137783) product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015088.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene pcaD CDS complement(137789..139009) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859251.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(139006..139788) product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 139929..140672 product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859254.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 140672..141319 product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859257.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 141346..141636 product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859234.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene catC CDS complement(141665..144253) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567623.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(144302..144661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 note possible pseudo, frameshifted CDS complement(144691..145140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 note possible pseudo, frameshifted CDS complement(145140..146744) product benzoate 1,2-dioxygenase electron transfer component BenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859226.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene benC CDS complement(146861..147355) product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015095.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene benB CDS complement(147417..148934) product benzoate 1,2-dioxygenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015094.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene benA CDS 149514..150290 product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015093.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene catA CDS 150528..151649 product muconate/chloromuconate family cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015092.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 151675..151911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(151889..153016) product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015083.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 note possible pseudo, frameshifted CDS complement(152991..153221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 note possible pseudo, frameshifted CDS complement(153376..155637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(155641..156867) product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015099.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 157179..158390 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015085.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene clpX CDS complement(158409..159200) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015080.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 159550..159975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 note possible pseudo, frameshifted CDS 159936..160538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 note possible pseudo, frameshifted CDS 160796..162034 product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015077.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 note possible pseudo, frameshifted CDS 162047..164803 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015075.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 164804..165241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 165238..166086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 note possible pseudo, frameshifted CDS 165984..166412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 note possible pseudo, frameshifted CDS 166413..166829 product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567665.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 166834..167682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 167675..168469 product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229004.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene lysX CDS 168480..168788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 168851..169261 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859294.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene ndk CDS complement(169335..169661) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094643.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 169936..170508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 170743..173328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 note possible pseudo, frameshifted CDS 173325..173792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18340 note possible pseudo, frameshifted CDS 173964..174269 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859302.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene rplU CDS 174301..174579 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859304.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene rpmA CDS 174711..176231 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015064.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene obgE CDS 176255..177376 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015063.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene proB CDS 177394..178302 product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859319.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(178299..179816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 note possible pseudo, frameshifted CDS complement(179774..181246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(181249..181641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(181641..181901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(181922..184210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 184535..185824 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859321.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 185905..186300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 186326..186994 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015061.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene nadD CDS 187091..187567 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859327.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene rsfS CDS 187570..189054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 189202..189837 product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015059.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 190096..190956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18510 note possible pseudo, frameshifted CDS 190890..191483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18520 note possible pseudo, frameshifted CDS 191508..192440 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015057.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene holA CDS 192454..192840 product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567697.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 192837..193484 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015055.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(193692..193955) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859343.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene rpsT CDS complement(194150..194755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 194937..196793 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015054.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene lepA CDS complement(196807..197502) product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081233.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(197553..198287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(198335..200308) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015047.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 200382..201047 product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208206.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(201013..202728) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091849.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(202732..203454) product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567731.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 203484..204749 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027368.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 204879..205334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 205331..205867 product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859391.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene thpR CDS complement(205955..207379) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015040.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(207376..208188) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015039.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(208199..209143) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015038.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(209140..210642) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015037.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(210677..211438) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898123.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 211757..212314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 note possible pseudo, frameshifted CDS 212520..212669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 note possible pseudo, frameshifted CDS complement(212682..213707) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015031.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(214028..214318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 note possible pseudo, frameshifted CDS complement(214303..214506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(214527..215369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 note possible pseudo, frameshifted CDS complement(215428..215988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(216015..217064) product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015597.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(217472..218227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 218349..219692 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013744.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene glmM CDS 219861..220166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 220153..221283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 221283..221516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(221513..222373) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013747.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 222494..224398 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466588.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene glmS CDS 224430..225083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013979.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 225095..226183 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013748.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene alr CDS 226187..226681 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854549.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene tsaE CDS 226671..227414 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113396.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 227420..228070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 note possible pseudo, frameshifted CDS 228106..228447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 note possible pseudo, frameshifted CDS 228440..228778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 note possible pseudo, frameshifted CDS 228760..229011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 note possible pseudo, frameshifted CDS 229026..229532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 229532..230188 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013751.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene tsaB CDS 230185..230658 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860686.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene rimI CDS 230655..231707 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013752.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene tsaD CDS 231743..232177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860693.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 232320..232634 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854559.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene groES CDS 232648..234267 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013754.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene groL CDS complement(234341..234664) product WhiB family transcriptional regulator WhcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854562.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene whcB CDS 234997..235569 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013755.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 235573..236433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013756.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(236434..236802) product DUF5319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020447882.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 236961..238484 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013757.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene guaB CDS 238542..239690 product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013758.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 239743..241299 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013761.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene guaA CDS 241477..241722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 242535..243710 product two-component system sensor histidine kinase EsrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074469750.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 gene esrS CDS 243727..244362 product two-component system response regulator EsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854586.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene esrR CDS complement(244368..244781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013764.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 244848..245564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013766.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 245565..246173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 note possible pseudo, frameshifted CDS 246062..246859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 note possible pseudo, frameshifted CDS 246808..247104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 note possible pseudo, frameshifted CDS complement(247109..247528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 247785..248711 product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013769.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 248757..249233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 note possible pseudo, frameshifted CDS 249218..250234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 note possible pseudo, frameshifted CDS complement(250231..250992) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829896.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(251003..251683) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854626.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(251680..252699) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854632.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(252839..253576) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013784.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 note possible pseudo, frameshifted CDS 253797..256736 product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013785.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(256722..257624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(257761..258480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 note possible pseudo, frameshifted CDS complement(258477..259205) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(259202..260125) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427752.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 260229..260942 product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854638.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 260988..261344 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860754.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 note possible pseudo, frameshifted CDS 261341..262018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 note possible pseudo, frameshifted CDS 262015..262680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19340 note possible pseudo, frameshifted CDS complement(262707..263987) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564999.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(264145..264549) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854647.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 264640..265497 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860764.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 265579..265797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 note possible pseudo, frameshifted CDS complement(265794..266717) product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013793.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 note possible pseudo, frameshifted CDS complement(266729..266935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 note possible pseudo, frameshifted CDS complement(266951..268273) product O-acetylhomoserine/O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854667.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(268396..268992) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972584.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(269011..269577) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704847.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(269608..269802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(269910..270188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 270518..271015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 271018..272511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 272522..273217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(273214..274533) product pyridoxine biosynthesis transcriptional regulator PdxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013887.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene pdxR CDS 274739..275500 product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858119.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene pdxS note possible pseudo, frameshifted CDS complement(275585..277267) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013800.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 note possible pseudo, frameshifted CDS complement(277204..277758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19520 note possible pseudo, frameshifted CDS 277913..278107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 note possible pseudo, frameshifted CDS 278152..278808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19540 note possible pseudo, frameshifted CDS 278814..279167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 note possible pseudo, frameshifted CDS 279071..279607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 note possible pseudo, frameshifted CDS 279647..280048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 note possible pseudo, frameshifted CDS 280048..280656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 note possible pseudo, frameshifted CDS complement(280723..280938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 281105..282202 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858295.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(282177..283415) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013810.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(283768..283977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 284100..284273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(284270..285514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013811.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(285530..286399) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013812.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(286396..286683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 286743..287387 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858289.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene upp CDS 287513..287842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 287941..289125 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013814.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 289140..290426 product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013815.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS 290423..290590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 note possible pseudo, frameshifted CDS complement(290598..291917) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013825.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 292050..293561 product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112515.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 293561..294484 product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265603.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene prpB CDS 294503..295651 product bifunctional 2-methylcitrate synthase/citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013797.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(295882..299646) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042256.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 299822..300619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 note possible pseudo, frameshifted CDS 300553..303234 product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013816.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 note possible pseudo, frameshifted CDS complement(303300..303506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(303398..303802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(303824..305599) product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013826.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(305749..306654) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013827.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 306956..307780 product Cj0069 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013828.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 note possible pseudo, frameshifted CDS 307780..308016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 note possible pseudo, frameshifted CDS complement(308019..308417) product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013829.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(308509..309309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(309333..309620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(309627..310229) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013831.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(310306..310515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(310535..310858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 note possible pseudo, frameshifted CDS complement(310855..312006) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863615.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 note possible pseudo, frameshifted CDS complement(312114..312395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 312579..313997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 314000..314206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014745.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(314460..314918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19950 note possible pseudo, frameshifted CDS complement(314936..315481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 note possible pseudo, frameshifted CDS complement(315771..316868) product DUF2220 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015393.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(316852..318708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 note possible pseudo, frameshifted CDS complement(318705..320213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 note possible pseudo, frameshifted CDS complement(320210..320815) product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015395.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(320808..322019) product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015396.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 note possible pseudo, frameshifted CDS complement(322019..322291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 322640..323686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 note possible pseudo, frameshifted CDS 323668..324045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 note possible pseudo, frameshifted CDS 324859..325170 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899493.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 325248..325766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20060 note possible pseudo, frameshifted CDS 325694..326122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 note possible pseudo, frameshifted CDS 326210..326980 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533693.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(327579..327908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20090 note possible pseudo, frameshifted CDS complement(327948..328409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 note possible pseudo, frameshifted CDS complement(328379..329749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20110 note possible pseudo, frameshifted CDS complement(329914..330483) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230155.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 330647..331846 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228153.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 331908..332681 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222055.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(332685..333827) product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326515.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(333839..336475) product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 336750..338267 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727703.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 338328..339206 product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973583.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 gene mmsB CDS complement(339203..339784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 340023..341372 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090686.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 341413..341682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 341737..343263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(343270..344472) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727019.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(344512..346035) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013833.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 345919..346131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(346288..347355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 347327..347911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20270 note possible pseudo, internal stop codon, frameshifted CDS 347908..348537 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776709.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 348553..349668 product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861894.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene thiO CDS 349678..349872 product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857586.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene thiS CDS 349875..350483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 350486..351532 product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014840.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 351542..352258 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858258.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 352265..352720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(352802..353554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20350 note possible pseudo, frameshifted CDS 353492..354619 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013836.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 354638..355138 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858249.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene purE CDS 355139..355591 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013839.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(355581..356696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(356788..357453) product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013855.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 357543..358355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(358357..359925) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013861.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 360055..360963 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013862.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 361011..362090 product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013863.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 362386..362685 product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014300514.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(362682..363149) product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006283667.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 363330..363719 product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863575.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 363769..365148 product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863574.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 365160..365714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 note possible pseudo, frameshifted CDS 365615..366145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 note possible pseudo, frameshifted CDS 366159..367367 product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013865.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene manA CDS complement(367364..368110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 368388..368732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858196.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 368872..369033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20540 note possible pseudo, frameshifted CDS 369030..370307 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858195.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene ahcY CDS 370307..370954 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858194.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 sequence18 source 1..471004 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 488..1390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(1358..1573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(1494..1892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(1957..3357) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856814.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(3418..4428) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856830.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene glpX CDS 4675..5004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 note possible pseudo, frameshifted CDS 4995..5255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 note possible pseudo, frameshifted CDS complement(5245..5532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(5562..6830) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014055.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene xseA CDS 6938..7888 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878272.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(7892..8488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(8621..9715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(9745..11199) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014057.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 11257..12342 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014061.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene ychF CDS 12353..13006 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081641.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 13016..13510 product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014075.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(13519..14316) product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014223.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(14310..14648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20740 note possible pseudo, frameshifted CDS complement(14648..16267) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014084.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 note possible pseudo, frameshifted CDS complement(16260..17657) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167382044.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 17702..18310 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014086.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 18552..19016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20780 note possible pseudo, frameshifted CDS complement(19013..19426) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467790.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 19479..20177 product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776271.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(20174..20326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 20501..21358 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459737.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 21384..22946 product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803796.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(22950..24014) product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014101.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(24091..25263) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015562.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(25314..26420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 26533..26769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 26773..26982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 note possible pseudo, frameshifted CDS 27287..27580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 note possible pseudo, frameshifted CDS complement(27602..28417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 note possible pseudo, frameshifted CDS complement(28414..28644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20910 note possible pseudo, frameshifted CDS 28825..29634 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014114.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 29646..30005 product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921517.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 30150..30764 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858584.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 30878..31987 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862124.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 note possible pseudo, frameshifted CDS 32082..32843 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014105.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS 32840..33322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014106.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 33524..35119 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014806.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 35171..36097 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857497.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 36090..37076 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284211.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 37073..37318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 note possible pseudo, frameshifted CDS 37315..38796 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014807.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 note possible pseudo, frameshifted CDS complement(38797..39138) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862103.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene arsC CDS complement(39163..39699) product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858618.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(39719..40438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014120.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 40766..42106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21060 note possible pseudo, frameshifted CDS 42106..42678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21070 note possible pseudo, frameshifted CDS 42699..43670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21080 note possible pseudo, frameshifted CDS 43619..43927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21090 note possible pseudo, frameshifted CDS 43924..44517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21100 note possible pseudo, frameshifted CDS 44511..45584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21110 note possible pseudo, frameshifted CDS 45581..46468 product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858626.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene mshB CDS 46472..46858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858629.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 46928..47251 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858631.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 47252..48364 product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014123.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene dapC CDS 48399..48863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21160 note possible pseudo, internal stop codon CDS 48876..49208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21170 note possible pseudo, internal stop codon, frameshifted CDS 49263..49979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(50134..50286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 50307..51350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(51563..52504) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730317.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene dapD CDS complement(52508..53887) product aromatic amino acid transport protein AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014125.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene aroP CDS complement(53983..54264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(54261..55409) product aromatic amino acid transport protein AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014125.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene aroP note possible pseudo, frameshifted CDS complement(55492..56421) product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014126.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 56616..57425 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863794.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 57431..58273 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855021.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene folP CDS 58270..59040 product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855018.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 59046..59342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014129.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 59385..59552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 59610..60482 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014130.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(60492..61880) product GH32 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014131.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(61910..63052) product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855006.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene glgA CDS 63306..64523 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855005.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene glgC CDS complement(64605..65252) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863800.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 65373..66011 product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855001.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene sigE CDS 66054..66446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 66446..66958 product Sec-independent protein translocase subunit TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854998.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene tatB CDS complement(66966..67856) product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854996.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 note possible pseudo, frameshifted CDS complement(67853..68098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 note possible pseudo, frameshifted CDS complement(68141..68701) product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854995.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(68694..69995) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854992.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS 70098..70640 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014135.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 70704..71465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014136.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(71736..75341) product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014138.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(75651..77210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 note possible pseudo, frameshifted CDS complement(77237..78088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21470 note possible pseudo, frameshifted CDS complement(78031..79092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 note possible pseudo, frameshifted CDS complement(79243..80181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014140.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS 80495..81937 product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854963.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 82041..82862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014144.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(82872..83348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014145.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 83461..84090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 note possible pseudo, frameshifted CDS 84036..84698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 note possible pseudo, frameshifted CDS 84766..85641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 85656..86357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21560 note possible pseudo, frameshifted CDS 86342..87016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21570 note possible pseudo, frameshifted CDS 87036..87602 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967273.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(87635..90148) product DUF3427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014158.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 note possible pseudo, frameshifted CDS complement(90145..90555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 note possible pseudo, frameshifted CDS complement(90552..90950) product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854931.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(90975..91829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 92050..92601 product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856205.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(92611..93585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 93774..95849 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014161.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(95968..96444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014165.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(96487..97164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(97171..98769) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014167.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene putP CDS 98916..101234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21690 note possible pseudo, frameshifted CDS 101210..102046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21700 note possible pseudo, frameshifted CDS 102050..102859 product 2-oxo acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854920.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 102908..104062 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014169.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 104068..105786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21730 note possible pseudo, frameshifted CDS 105837..106706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 note possible pseudo, frameshifted CDS complement(106847..107389) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854913.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 107611..108120 product MarR family transcriptional regulator RosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861276.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene rosR CDS 108230..108460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(108429..108701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 108917..110806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21790 tRNA complement(110973..111049) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(111137..112777) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014178.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(112925..113551) product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978042.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(113552..115084) product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727053.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(115081..115866) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892015.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS 116075..117751 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731564.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 117803..118501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 note possible pseudo, frameshifted CDS 118501..119454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21860 note possible pseudo, frameshifted CDS 119459..120790 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014180.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene lysA CDS 120933..122270 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854900.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 122293..123219 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014183.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene thrB CDS complement(123216..123947) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014184.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(123954..125054) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230238.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(125033..125836) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409329.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(125878..126600) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110929.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene modA CDS complement(126766..127551) product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854891.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene narI CDS complement(127573..128265) product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014185.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene narJ CDS complement(128262..129842) product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014186.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 gene narH CDS complement(129865..133614) product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014187.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(133686..135023) product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014188.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 135367..135693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21990 note possible pseudo, frameshifted CDS complement(135690..136253) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014193.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(136250..136726) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene moaC CDS complement(136745..137992) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014194.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(138004..139125) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014195.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene moaA CDS complement(139201..140196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 note possible pseudo, frameshifted CDS complement(140133..140933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 note possible pseudo, frameshifted CDS 141327..142529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 note possible pseudo, frameshifted CDS 142472..143158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 note possible pseudo, frameshifted CDS 143220..144230 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854866.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene prfA CDS 144199..145074 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014198.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 gene prmC CDS 145101..145760 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861324.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 145761..146936 product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014199.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 146970..147410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854858.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 147811..148620 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854856.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene atpB CDS 148733..148942 product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854855.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 149014..149583 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014201.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS 149589..150419 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854845.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 150437..151276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22170 note possible pseudo, frameshifted CDS 151273..152112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22180 note possible pseudo, frameshifted CDS 152163..153137 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014203.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 153141..154592 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014204.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene atpD CDS 154602..154970 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861337.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 155175..155639 product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854831.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 155650..156342 product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014205.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene nucS CDS 156676..156984 product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854825.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 156985..157662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22250 note possible pseudo, frameshifted CDS 157583..157864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 note possible pseudo, frameshifted CDS complement(157861..158175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22270 note possible pseudo, frameshifted CDS complement(158088..160064) product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014214.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene glgB note possible pseudo, frameshifted CDS complement(160158..160631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 note possible pseudo, frameshifted CDS complement(160628..162181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22300 note possible pseudo, frameshifted CDS 162281..163114 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014216.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 163132..163998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854804.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 163985..165151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014217.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS 165203..165991 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014218.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS 166000..166173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS 166170..166580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22360 note possible pseudo, frameshifted CDS 166592..166948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22370 note possible pseudo, frameshifted CDS 166945..168063 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014220.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 168120..169169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(169166..170212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(170234..171514) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065409.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(171518..172162) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022434.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 note possible pseudo, frameshifted CDS complement(172180..172329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(172342..173253) product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990588.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(173389..174141) product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014223.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 174265..175017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22460 note possible pseudo, frameshifted CDS complement(175275..176696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 176844..177728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014226.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(177721..178395) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861387.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 178416..179363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22500 note possible pseudo, frameshifted CDS 179572..180441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22510 note possible pseudo, frameshifted CDS complement(180424..181098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861389.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 181198..181497 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854761.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene gatC CDS 181500..181847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 note possible pseudo, frameshifted CDS 181844..182983 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014228.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene gatA note possible pseudo, frameshifted CDS 183209..184240 product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013491.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 note possible pseudo, frameshifted CDS 184243..184389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 184436..186031 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011896558.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 186003..186443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22590 note possible pseudo, frameshifted CDS 186440..186880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22600 note possible pseudo, frameshifted CDS 186790..187347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22610 note possible pseudo, frameshifted CDS 187358..188389 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854754.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(188386..188946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(188964..189230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22640 note possible pseudo, frameshifted CDS 189396..190307 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854741.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 190329..191828 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854737.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene gatB CDS 191974..192264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22670 note possible pseudo, frameshifted CDS 192264..193427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22680 note possible pseudo, frameshifted CDS 193509..194771 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014119.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 194795..195865 product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014239.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene mgrA CDS complement(195919..196341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 196639..197334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22720 note possible pseudo, frameshifted CDS complement(197360..198406) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014241.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 198539..199366 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014243.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(199304..200596) product alpha-(1-2)-mannopyranosyltransferase MptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014935.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 gene mptD CDS complement(200618..202459) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854128.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene ilvD CDS complement(202461..202691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 note possible pseudo, frameshifted CDS complement(202688..203014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 note possible pseudo, frameshifted CDS complement(203060..204673) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096455574.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(204884..205183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 205079..205378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 note possible pseudo, frameshifted CDS 205381..206823 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014246.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 note possible pseudo, frameshifted CDS 206826..206966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22830 note possible pseudo, frameshifted CDS 206963..207334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22840 note possible pseudo, frameshifted CDS 207403..208161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22850 note possible pseudo, frameshifted CDS 208158..208433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22860 note possible pseudo, frameshifted CDS 208531..208749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 note possible pseudo, frameshifted CDS 208758..208952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 208934..209464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22890 note possible pseudo, frameshifted CDS 209804..211348 product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014255.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 note possible pseudo, frameshifted CDS 211401..212183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS 212266..213849 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854094.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene serA CDS 214154..215188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22930 note possible pseudo, frameshifted CDS 215233..216327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22940 note possible pseudo, frameshifted CDS 216330..216524 product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728261.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 216577..217593 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014258.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 217685..219205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014256.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 219252..221108 product cyclic nucleotide-binding/CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014260.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 221108..221692 product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014261.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 221714..222505 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861462.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(222547..224403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015026.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(224410..225021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(225043..225399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(225402..226046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(226124..227239) product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014263.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(227331..227954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(227915..228292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 228540..229388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 229489..230082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23090 note possible pseudo, frameshifted CDS 230082..231401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23100 note possible pseudo, frameshifted CDS 231341..231646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23110 note possible pseudo, frameshifted CDS 231646..232608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 232608..233345 product anchored repeat-type ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399434.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 233342..234208 product anchored repeat-type ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115980.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 234205..235263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS 235384..235935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23160 note possible pseudo, frameshifted CDS 235935..236813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 note possible pseudo, frameshifted tRNA 236974..237046 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 237070..237143 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(237259..237990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(238084..239358) product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059232860.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 239428..239685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 239833..240312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 240415..241830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(241844..244390) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286432.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(244426..245331) product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859825.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(245322..245498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS 245814..246869 product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158408213.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(246888..247883) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014754.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene galE CDS complement(247943..248629) product iron dependent repressor, metal binding and dimerization domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014753.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(248817..249806) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014752.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(249898..250311) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859832.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene dtd CDS complement(250329..251852) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014751.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(251878..252183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 252405..252653 product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005389816.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 252658..252978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 note possible pseudo, frameshifted CDS 252981..254411 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859837.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 note possible pseudo, frameshifted CDS 254546..255154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 255165..256424 product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014749.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS complement(256501..257472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 note possible pseudo, frameshifted CDS 257371..257661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(258185..258553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23400 note possible pseudo, frameshifted CDS complement(258550..258984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23410 note possible pseudo, frameshifted CDS 258984..259919 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014746.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 260000..260293 product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857344.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS complement(260369..260878) product DUF3093 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859852.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 261018..261413 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014744.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene dut CDS 261455..262381 product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014743.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 262381..263661 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014742.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 263764..264465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23480 note possible pseudo, frameshifted CDS 264426..265679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 note possible pseudo, frameshifted CDS complement(265676..266887) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014740.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(266889..267569) product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014739.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 267663..268364 product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014738.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(268466..268867) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857328.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 gene msrB CDS complement(268860..270092) product arabinofuranan 3-O-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014737.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene aftC CDS complement(270098..270811) product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014736.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 tRNA complement(270836..270911) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA complement(270949..271021) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA complement(271029..271102) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA complement(271135..271210) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(271249..271323) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(271324..271397) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA 271664..271738 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS 272202..272642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 272688..273344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 273381..274628 product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859878.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 274781..275851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23590 note possible pseudo, frameshifted CDS 275848..276846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23600 note possible pseudo, frameshifted CDS 276827..277420 product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511750.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS 277413..278063 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859882.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 278143..278988 product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014523.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 278991..280079 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859886.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 280084..280539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(280536..281024) product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014522.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 281076..281954 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014521.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 282082..282834 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014520.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 282920..283813 product DUF2268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244687.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 283827..284594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS 284646..285632 product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058916821.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS 285823..286338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS 286335..286955 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859897.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene ruvA CDS 286968..287840 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855899.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene ruvB note possible pseudo, frameshifted CDS 287864..288055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 note possible pseudo, frameshifted CDS 288105..288512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 288653..290548 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855902.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene secD CDS 290706..291446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23780 note possible pseudo, frameshifted CDS 291407..291757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23790 note possible pseudo, frameshifted CDS 291811..293445 product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014515.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS 293432..293995 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014514.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS 294087..296360 product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855910.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 296537..298204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23830 note possible pseudo, frameshifted CDS 298105..298419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 298374..298658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 298753..299322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(299412..299744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(300107..300985) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014511.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 301122..301622 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776224.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene tpx CDS 301713..302366 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014510.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 302386..303675 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014509.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 gene hisS CDS complement(303694..305034) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014507.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(305193..305861) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975539.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(305867..307000) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014504.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(307070..307288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23950 note possible pseudo, frameshifted CDS complement(307357..307683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23960 note possible pseudo, frameshifted CDS complement(307839..308720) product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014499.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 308892..309608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23980 note possible pseudo, frameshifted CDS 309515..310717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23990 note possible pseudo, frameshifted CDS 310854..312122 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014497.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 312132..313496 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855936.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 313546..316224 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014496.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 gene alaS CDS 316377..316739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24030 note possible pseudo, frameshifted CDS 316891..317514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24040 note possible pseudo, frameshifted CDS 317711..318052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24050 note possible pseudo, frameshifted CDS 318068..318778 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014493.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 note possible pseudo, internal stop codon, frameshifted CDS 318887..319288 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014489.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS 319328..320554 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855968.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene aroC CDS 320556..321101 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855969.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS 321143..322213 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014486.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene aroB CDS 322220..322654 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057656.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene aroQ CDS 322660..322971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24120 note possible pseudo, frameshifted CDS 322968..323750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24130 note possible pseudo, frameshifted CDS 323794..324357 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855973.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene efp CDS 324357..324836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 324848..325708 product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112196.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(325705..326388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(326868..327311) product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014482.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(327301..327783) product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014481.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(327804..329159) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948589.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS 329284..329853 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862208.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 gene pyrR CDS 329850..330779 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862210.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS 330791..332155 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014479.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 332167..333018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24240 note possible pseudo, frameshifted CDS 333063..333341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24250 note possible pseudo, frameshifted CDS 333524..334558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 note possible pseudo, internal stop codon, frameshifted CDS 334947..336716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24270 note possible pseudo, frameshifted CDS 336713..337507 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014477.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 gene pyrF CDS 337736..338059 product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 gene mihF CDS 338064..338663 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855988.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene gmk CDS 338670..338963 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855993.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene rpoZ CDS 339093..340325 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014475.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 gene coaBC CDS 340435..341655 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856000.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 gene metK CDS 341669..343687 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014474.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 343755..344267 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856004.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene def CDS 344273..345031 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862229.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 gene fmt note possible pseudo, frameshifted CDS 345028..345207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 note possible pseudo, frameshifted CDS 345305..346180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24380 note possible pseudo, frameshifted CDS 346213..346626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24390 note possible pseudo, frameshifted CDS 346637..347290 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014472.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene rpe CDS 347292..348275 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014471.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene ribD CDS 348256..348843 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014470.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 348855..350108 product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856016.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS 350120..350602 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856018.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene ribH CDS 350671..350931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24450 note possible pseudo, frameshifted CDS 350916..351215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 note possible pseudo, frameshifted CDS 351219..353210 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014468.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 gene uvrC CDS 353351..354238 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856023.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene rapZ CDS 354265..354783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 note possible pseudo, frameshifted CDS 354774..355238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 note possible pseudo, frameshifted CDS 355295..356278 product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862248.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene whiA CDS 356639..357643 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862250.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene gap CDS 357805..359022 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862252.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 gene pgk CDS 359056..359838 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014466.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene tpiA CDS 359923..362688 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014465.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene ppc CDS 362768..363001 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014464.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene secG CDS complement(363064..363789) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862263.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene pgl CDS complement(363816..364754) product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014458.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS complement(364784..366322) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856051.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene zwf CDS complement(366421..367503) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856053.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene tal CDS complement(367547..368386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 note possible pseudo, frameshifted CDS complement(368314..369351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24620 note possible pseudo, frameshifted CDS complement(369339..369656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24630 note possible pseudo, frameshifted CDS 370049..370978 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211271337.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(371007..371975) product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856060.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(372017..373021) product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014452.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(373084..373851) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014451.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(373855..374781) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014450.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(374787..375836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24690 note possible pseudo, frameshifted CDS complement(375782..376432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24700 note possible pseudo, frameshifted CDS 376619..377311 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862282.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS 377308..378753 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862284.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 gene sufB CDS 378759..379406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24730 note possible pseudo, frameshifted CDS 379310..379924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 note possible pseudo, frameshifted CDS 379970..380728 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856078.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene sufC CDS 380764..382026 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014447.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS 382041..382481 product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856080.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS 382478..382906 product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856083.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(382963..383328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(383333..384085) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810029.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS 384104..385174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 note possible pseudo, frameshifted CDS 385180..385782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24820 note possible pseudo, frameshifted CDS complement(385779..386324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24830 note possible pseudo, frameshifted CDS complement(386309..386563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24840 note possible pseudo, frameshifted CDS complement(386560..387249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 note possible pseudo, frameshifted CDS complement(387159..388463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24860 note possible pseudo, frameshifted CDS complement(388535..389899) product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856096.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(389912..390202) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856097.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 390295..390969 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856099.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(390953..391684) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014437.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(391708..392283) product TetR/AcrR family transcriptional regulator AcnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856101.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene acnR CDS complement(392420..394858) product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170844367.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 gene can CDS complement(394855..395196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24930 note possible pseudo, frameshifted CDS 395484..395957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014436.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 396405..398189 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014435.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 note possible pseudo, frameshifted CDS 398323..398736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24960 note possible pseudo, frameshifted CDS 398787..399353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24970 note possible pseudo, frameshifted CDS complement(399350..400096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014433.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 400130..400969 product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014432.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 400980..401408 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862316.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS 401411..402625 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014431.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(402594..403154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014430.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(403165..403842) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856111.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS 403931..404356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25040 tRNA complement(404481..404570) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS 404755..405309 product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856119.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 405310..405450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 405435..405653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(405666..406766) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014420.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(406776..407807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208396105.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(407824..408669) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856126.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 408716..409573 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856127.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 409584..410789 product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856128.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene mshC CDS 410814..411191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856129.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 411193..411879 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014410.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS 411890..412153 product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897259.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS 412169..413068 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856149.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene hisG CDS 413096..414520 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014409.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene aspA CDS 414712..416022 product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006590721.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 416027..417682 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776500.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS complement(417666..418865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS complement(418998..419819) product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856159.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS 419847..421064 product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285177.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 421098..421931 product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860005.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 421954..423465 product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265753.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 gene arc CDS complement(423584..423766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 423683..424165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25260 note possible pseudo, frameshifted CDS 424072..425004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25270 note possible pseudo, frameshifted CDS 425025..425210 product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856167.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS 425214..426491 product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066565680.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene pafA note possible pseudo, frameshifted CDS 426473..426607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS 426614..427528 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014403.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 427518..428471 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014402.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS 428526..428783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS 428793..429761 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856179.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene tatC CDS 429880..431028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25350 note possible pseudo, frameshifted CDS 431061..432569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25360 note possible pseudo, frameshifted CDS complement(432566..433087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS 433175..434281 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014398.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS 434278..435069 product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104467.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 gene ygiD CDS 435066..435785 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014397.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 435794..436990 product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167382062.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS 437001..437591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS 437592..438065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25430 note possible pseudo, frameshifted CDS 438079..439062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25440 note possible pseudo, frameshifted CDS 439116..440120 product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856192.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(440193..440570) product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863735.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 440688..441026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162467698.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 441041..441736 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863737.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(441920..443236) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014384.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS 443414..444820 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863745.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS 445065..447050 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819332.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene pflB CDS 446996..447160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25520 note possible pseudo, frameshifted CDS 447198..447449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25530 note possible pseudo, frameshifted CDS 447477..448367 product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068217.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 gene pflA CDS complement(448378..448908) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856229.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 449118..449771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25560 note possible pseudo, frameshifted CDS 449768..450118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25570 note possible pseudo, frameshifted CDS complement(450119..450559) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014373.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 450651..451535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25590 note possible pseudo, frameshifted CDS 451589..452110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25600 note possible pseudo, frameshifted CDS 452192..453610 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856236.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS 453636..453932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25620 note possible pseudo, frameshifted CDS 453961..455013 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014371.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 note possible pseudo, frameshifted CDS 455013..456065 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014370.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS 456067..456915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020309556.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS 456959..458332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014368.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(458418..458975) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856248.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(459097..459708) product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863762.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(459735..460409) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856252.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS complement(460626..461051) product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856253.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(461197..462840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25710 note possible pseudo, frameshifted CDS complement(462789..463487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25720 note possible pseudo, frameshifted CDS 463614..464345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25730 note possible pseudo, frameshifted CDS 464342..464785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 464778..465161 product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208400687.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 tRNA 465234..465308 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS 465410..465712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 465640..466020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 466038..466415 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404727.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(466420..467397) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804319.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS complement(467443..468018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25800 note possible pseudo, frameshifted CDS complement(468025..468450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(468447..470201) product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014362.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(470198..470698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25830 sequence19 source 1..153098 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(224..481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(484..1095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS complement(1409..2080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 2268..3122 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869311.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 note possible pseudo, frameshifted CDS 3364..4311 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254195.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene rbsK CDS 4325..5605 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014309.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS 5780..6718 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014308.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 6782..7645 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013572.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 gene rfbA CDS 7655..8491 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209330306.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 8501..9196 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013566.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 9197..9538 product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013565.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 9626..10417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(10731..12437) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932359.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS complement(12584..13504) product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013564.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(13542..14168) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013561.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(14168..15268) product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863269.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(15326..17350) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776044.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(17397..18257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS 18522..20186 product long-chain-fatty-acid--CoA ligase FadD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899884.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 gene fadD2 tRNA complement(20389..20464) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS complement(20546..21769) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013555.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS 21823..23349 product class III adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285716.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(23593..24261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(24203..26119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26060 note possible pseudo, frameshifted CDS complement(26131..26898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26070 note possible pseudo, frameshifted CDS 27193..27504 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899493.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 27581..28099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26090 note possible pseudo, frameshifted CDS 28027..28215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 note possible pseudo, frameshifted CDS 28215..28454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26110 note possible pseudo, frameshifted CDS complement(28417..28824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS complement(28849..30333) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028163.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(30333..31676) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013525.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(31829..32398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26150 note possible pseudo, frameshifted CDS complement(32386..32667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26160 note possible pseudo, frameshifted CDS 32770..33741 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014798.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 33782..34234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26180 note possible pseudo, frameshifted CDS 34234..34743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26190 note possible pseudo, frameshifted CDS 34890..35159 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857482.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene rpsO CDS 35485..37758 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014796.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(37834..38091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(38058..38507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 38701..39447 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014794.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 gene dapB CDS 39461..40213 product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014793.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 gene thyX CDS 40284..40937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26260 note possible pseudo, frameshifted CDS 40901..41200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26270 note possible pseudo, frameshifted CDS 41203..41733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26280 note possible pseudo, frameshifted CDS 41724..43190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26290 note possible pseudo, frameshifted CDS 43235..43846 product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857475.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS 44108..46567 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857472.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 note possible pseudo, frameshifted CDS 46545..46796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26320 note possible pseudo, frameshifted CDS 46748..47059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26330 note possible pseudo, frameshifted CDS 47089..47595 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803955.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS 47779..48948 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014789.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(49032..49328) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857466.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 49407..49973 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857464.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene pgsA CDS 49966..50517 product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014786.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS 50608..50922 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861658.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 51006..51851 product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857458.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(51857..52471) product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857456.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(52468..53157) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014785.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS complement(53170..53718) product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857452.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene bioY CDS 53842..54087 product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857447.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS 54356..55435 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857444.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 gene recA CDS 55435..56028 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857439.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene recX CDS complement(56049..56453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 note possible pseudo, frameshifted CDS complement(56378..56986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26480 note possible pseudo, frameshifted CDS complement(56986..57660) product glutamate ABC transporter permease GluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014780.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene gluC CDS complement(57706..58581) product glutamate ABC transporter substrate-binding protein GluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014779.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene gluB CDS complement(58606..59382) product glutamate ABC transporter ATP-binding protein GluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857431.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 gene gluA CDS 59523..61049 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857429.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene miaB CDS 61145..61795 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861637.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS complement(61792..62892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(62899..63606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26550 note possible pseudo, frameshifted CDS complement(63857..64279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26560 note possible pseudo, frameshifted CDS complement(64394..64612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 64670..65041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS 65038..65943 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014773.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 gene miaA CDS complement(65956..66465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(66473..67207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014770.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS 67320..68846 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857415.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 gene hflX CDS 68921..69751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26630 note possible pseudo, frameshifted CDS 69775..70218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26640 note possible pseudo, frameshifted CDS complement(70274..70537) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857409.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS complement(70724..72340) product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014766.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 note possible pseudo, frameshifted CDS complement(72337..72675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26670 note possible pseudo, frameshifted CDS complement(72672..73661) product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014765.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(73829..74272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26690 note possible pseudo, frameshifted CDS complement(74272..74607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26700 note possible pseudo, frameshifted CDS complement(74868..75560) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857389.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene lexA CDS 76308..76763 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857385.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene nrdR CDS complement(76764..78089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 note possible pseudo, frameshifted CDS complement(78086..78700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26740 note possible pseudo, frameshifted CDS complement(78697..80667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26750 note possible pseudo, frameshifted CDS 80851..81660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(81775..82302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26770 note possible pseudo, internal stop codon, frameshifted CDS complement(82350..83117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26780 note possible pseudo, frameshifted CDS 83233..83457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26790 tRNA complement(83622..83695) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS 83879..84157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS complement(84431..84976) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013924.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(84973..85773) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862391.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS complement(85813..86577) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862394.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS 86650..88779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26840 note possible pseudo, internal stop codon, frameshifted CDS 88683..91259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26850 note possible pseudo, frameshifted CDS 91284..91997 product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862398.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS complement(92074..92688) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013926.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS 92873..93100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26880 note possible pseudo, frameshifted CDS 93019..93285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26890 note possible pseudo, frameshifted CDS complement(93275..93772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26900 note possible pseudo, frameshifted CDS complement(93694..94758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26910 note possible pseudo, frameshifted CDS complement(94813..95190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26920 note possible pseudo, frameshifted CDS complement(95175..96446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26930 note possible pseudo, frameshifted CDS 96533..96859 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015550.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(96856..97173) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858377.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 97235..98290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26960 note possible pseudo, frameshifted CDS 98263..99603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26970 note possible pseudo, frameshifted CDS complement(99616..100302) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857696.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(100530..103121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(103124..103792) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013931.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(103789..104331) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862411.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(104472..105218) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013932.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS 105437..105817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 105853..106335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27040 note possible pseudo, frameshifted CDS 106517..106909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS 106920..107507 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858391.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene purN CDS 107512..109065 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013935.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene purH CDS 109129..109818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS 109953..110702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(110798..111043) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858407.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 gene rpsR CDS complement(111062..111367) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013938.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 gene rpsN CDS complement(111371..111535) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858439.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene rpmG CDS complement(111539..111808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS 112227..112496 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858446.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 112542..112715 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858448.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 gene rpmF CDS 112900..113598 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063392.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 113595..115025 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013941.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 115373..116440 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013942.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS 116499..117062 product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858456.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS 117096..117353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(117363..117809) product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013943.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene mscL CDS complement(117906..118580) product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013944.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS complement(118636..119232) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092258658.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS 119336..120232 product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858460.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 120380..120691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27250 note possible pseudo, frameshifted CDS 120688..121542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27260 note possible pseudo, frameshifted CDS 121562..122263 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186458539.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS 122368..123399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858464.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS complement(123473..124084) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015424.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS complement(124091..124633) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015559.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS 124632..125039 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013947.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 125032..125535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27320 note possible pseudo, frameshifted CDS 125532..125726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS complement(125757..127235) product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013949.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 127159..127356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 127427..128281 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858478.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene rsmI CDS 128526..129986 product glycine betaine transporter BetP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265645.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene betP note possible pseudo, frameshifted CDS 129974..130273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27380 note possible pseudo, frameshifted CDS 130475..132334 product glycine betaine transporter BetP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265645.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene betP CDS 132389..133798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27400 note possible pseudo, frameshifted CDS 133795..134241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27410 note possible pseudo, frameshifted CDS 134242..135414 product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013946.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS 135425..135853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27430 note possible pseudo, frameshifted CDS 135901..137307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27440 note possible pseudo, frameshifted CDS 137304..137546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27450 note possible pseudo, frameshifted CDS complement(137551..137943) product DUF3806 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855570.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 137980..138825 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013965.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS 138998..140392 product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858490.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS 140395..141048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27490 note possible pseudo, frameshifted CDS 141049..142065 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013967.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS 142075..143601 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013968.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 note possible pseudo, frameshifted CDS 143571..143885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27520 note possible pseudo, frameshifted CDS 143886..144221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27530 note possible pseudo, frameshifted CDS 144215..145534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 note possible pseudo, frameshifted CDS 145564..145887 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948541.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 145932..146786 product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013972.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene ppk2 CDS complement(146783..147355) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265466.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(147362..148144) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858506.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS 148210..149178 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013973.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS complement(149182..149340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS complement(149359..150357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013974.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 note possible pseudo, internal stop codon CDS 150539..152008 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013988.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS complement(152010..152393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS 152446..152757 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899493.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640