COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..463550 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..906 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547453.1:ferric reductase locus_tag LOCUS_00010 CDS complement(980..1528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(1590..2231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(2511..3533) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292882.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene rfbB CDS complement(3603..4994) product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288482.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(5207..6448) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674871.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(6445..7239) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643611.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene proB CDS complement(7369..7872) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889486.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene cysE CDS 8090..9292 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906047.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(9348..10028) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003708379.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(10158..11159) product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355805.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(11396..12259) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059807.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 13358..14047 product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244307.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(14099..14407) product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461833.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(14429..14935) product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047762.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene thiW CDS complement(15361..16170) product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102282.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(16634..17287) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245344.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(17425..18135) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548802.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(18251..20068) product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476310.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene spxB CDS complement(20202..20462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(20449..20847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224434963.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(20840..22168) product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564452.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(22291..22839) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475812.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(22926..24158) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101725.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(24287..25249) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138879.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(25246..26031) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660829.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene recO CDS complement(26114..27025) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640679.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene era CDS complement(27031..27552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(27530..28012) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003710168.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene ybeY CDS complement(28012..29022) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644473.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(29106..30524) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700208.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene pyk CDS complement(30620..34030) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101583.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene dnaE CDS 34231..34428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(34505..35740) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644443.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene pepT CDS complement(35767..36552) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660853.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(36527..37237) product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382286.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(37339..38103) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369352.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(38096..38941) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700107.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene ylqF CDS complement(38961..39188) product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703777.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(39178..39738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(39757..40608) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674491.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(40634..41131) product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073447.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene folA CDS complement(41118..42335) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101577.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(42421..43662) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644434.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 43881..44432 product bifunctional transcriptional activator/DNA repair enzyme AdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379037.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 44528..45313 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547434.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(45380..46201) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905393.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(46249..48336) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645027.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene topA CDS complement(48493..49362) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640564.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene dprA CDS complement(49471..51384) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644431.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 51470..52339 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640692.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(52571..54424) product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906162.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(54554..55441) product murein tripeptide/oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003140250.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene oppC CDS complement(55452..56417) product murein tripeptide/oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906163.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene oppB CDS complement(56420..57406) product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906164.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene oppF CDS complement(57403..58416) product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906165.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene oppD CDS 58877..59416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(59465..60358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(60424..61299) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101568.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(61387..62307) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570336.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene xerC CDS 62446..62709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(62803..64146) product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(64189..64458) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963800.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(64528..64971) product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101401.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(65110..66273) product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732325.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(66348..67973) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702586.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(68067..68462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(68555..69295) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475974.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(69330..70268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 assembly_gap 70049..70095 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(70336..71475) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674119.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(71550..73403) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699919.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene lepA CDS complement(73549..73956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(74071..75864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(75972..76679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 76804..76995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(76972..78345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(78830..80887) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476035.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene glyS CDS complement(80887..81834) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130667.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene glyQ CDS complement(81890..83371) product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002646.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(83623..84168) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356762.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene frr CDS complement(84168..84893) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263605.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene pyrH CDS complement(84989..85873) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699817.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene tsf CDS complement(85985..86758) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475795.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene rpsB CDS complement(86985..87284) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660754.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(87319..88083) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644499.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 88147..88782 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475794.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(88793..89014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 89269..89904 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640747.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene lexA CDS complement(89995..91089) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254270.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(91136..92596) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263406.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene thrC CDS 92728..93987 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476391.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 93981..94862 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640906.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene thrB CDS 94915..96279 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546873.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(96322..96678) product YlbF/YmcA family competence regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261936.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(96719..98704) product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643108.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(98875..100566) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475862.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene argS CDS complement(100796..101050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643130.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(101084..102328) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640363.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene coaBC CDS complement(102331..103860) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592802.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(103957..105102) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701155.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(105275..106294) product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642208.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(106403..107011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(107023..108048) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255227.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(108058..108618) product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643749.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(108734..109660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(109669..111036) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574158.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(111250..112344) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476154.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(112513..112827) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638594.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene rpmA CDS complement(112855..113154) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene rplU CDS complement(113310..113882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(114062..114826) product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641839.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene pnuC CDS complement(114869..115195) product multidrug efflux SMR transporter AbeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004700493.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene abeS tRNA 115362..115436 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 115924..116940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 117232..117489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(117533..118192) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709822.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene trmB CDS complement(118212..119504) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101412.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(119501..120211) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644277.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 120310..120738 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548425.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 120740..120979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 121031..121930 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254505.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(121998..123011) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643103.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(123004..125400) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254507.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(125390..126580) product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645226.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(126719..128071) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356929.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene glnA CDS complement(128164..128502) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644308.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(128531..131221) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101451.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene polA CDS complement(131303..132028) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262553.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(132118..133452) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699774.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene murC CDS complement(133468..134124) product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101413.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(134188..134865) product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689790.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(134888..135196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(135183..135761) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393827.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(135763..135978) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554837.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(136094..137560) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562776.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(137650..141963) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640729.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(142016..143752) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640732.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(143826..145082) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565798.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene rseP CDS complement(145126..145923) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640734.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(145948..146730) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475819.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(146863..148668) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641075.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene glmS CDS 148906..150567 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102113.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene ade CDS 150573..151073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(151141..153504) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231579.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 tRNA complement(153651..153723) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(153811..154323) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644616.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(154320..155468) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640873.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 155653..156684 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101686.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(156790..158277) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989934.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(158891..159265) product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638751.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene gpsB CDS complement(159414..159968) product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640485.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(159971..160642) product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131746.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene recU CDS 160797..161834 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101728.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(161938..162570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(162624..163286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 note possible pseudo, frameshifted CDS complement(163292..164200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 note possible pseudo, frameshifted assembly_gap 163333..163397 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(164269..165060) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548762.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene phnE CDS complement(165060..165842) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576383.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene phnE CDS complement(165839..166606) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569258.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene phnC CDS complement(166700..167674) product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567447.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(168045..169586) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836956.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene guaA CDS complement(169590..170549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(170603..171715) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254072.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(171972..172946) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289114.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(173087..175183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(175288..177723) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643180.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene leuS CDS 178042..178569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 178633..178764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 assembly_gap 178800..178878 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(178918..180105) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700007.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene tuf CDS complement(180278..181189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101658.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(181257..183167) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640800.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(183349..183768) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355799.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene rplT CDS complement(183814..184011) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638526.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene rpmI CDS complement(184067..184495) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691023.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene infC CDS complement(184816..185475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 185693..185866 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565316.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene rpmF CDS 185987..187696 product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640521.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 187734..188126 product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906303.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene mscL CDS complement(188167..188799) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643169.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(188898..189509) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549165.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene ruvA CDS complement(189546..190307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(190492..191298) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546391.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(191430..192902) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824486.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene ffh CDS complement(192949..193290) product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640380.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(193290..194426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(194441..197998) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101482.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene smc CDS complement(198023..198724) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640377.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene rnc CDS complement(198841..200202) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101166.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene glmM CDS complement(200254..201195) product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641072.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(201228..202052) product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643987.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene cdaA CDS complement(202065..204164) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101165.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(204168..205046) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641067.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene murB CDS complement(205173..205661) product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251731.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(205705..207783) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101707.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene mutL CDS complement(207764..210460) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674831.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene mutS CDS complement(210549..211145) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(211193..212584) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101269.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene rlmD CDS complement(212587..213651) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641344.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(213790..215241) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476295.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene gatB CDS complement(215254..216714) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288475.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene gatA CDS complement(216720..217022) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896305.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene gatC CDS 217311..217592 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701713.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene rpsO CDS 217639..217890 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645660.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene rpsT CDS complement(217967..218890) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675041.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(219113..220384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 note possible pseudo, frameshifted CDS complement(221502..222164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(222412..223959) product levansucrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022105.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene sacB CDS complement(224199..224642) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476244.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(224978..225328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(225362..226069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(226033..226662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(226819..228474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(228498..230267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(230260..231213) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965621.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(231237..232139) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254560.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(232159..233100) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289773.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(233162..234352) product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376666.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene glf CDS complement(234352..235122) product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101322.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(235122..236510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(236522..237145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(237176..237808) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966340.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(237874..239316) product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101324.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(239353..240390) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963395.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(240521..242686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 note possible pseudo, internal stop codon, frameshifted CDS complement(242749..244371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(244386..244790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(245036..246526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(246747..248114) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362548.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene mgtE CDS complement(248197..249102) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640877.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(249207..250004) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476267.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(250071..250646) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640879.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(250799..251755) product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699875.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(251936..252184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(252302..256222) product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476466.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene addA CDS complement(256215..259118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 assembly_gap 257420..257467 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(259108..259893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 assembly_gap 259160..259207 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(259970..260539) product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643214.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(260656..261459) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101330.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene recX CDS 261617..262576 product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705582.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(262668..263711) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101660.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene holA CDS complement(263632..265800) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101661.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(265947..266642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(266708..267187) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295492.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene coaD CDS complement(267208..267762) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101663.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene rsmD CDS complement(267762..268136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(268137..269321) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645668.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(269321..270394) product glutamyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355013.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene pepA CDS 270681..271112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 271555..272862 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644001.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(272922..273992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(273985..274323) product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015735.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(274455..276140) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387037.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene recN CDS complement(276164..276991) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640353.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(276995..277873) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660686.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(277866..278093) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262107.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(278095..279363) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387036.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene xseA CDS 279748..279993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(280047..280577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(280655..281998) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674807.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 282216..282428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(282331..283707) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548882.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene glmU CDS complement(283711..284511) product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381336.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene purR CDS complement(284699..285484) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646500.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(285477..286196) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101016.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(286264..286494) product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548879.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(286590..287477) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101015.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene rsmA CDS complement(287461..288045) product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305490.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene rnmV CDS complement(288038..288832) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294001.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(288953..289363) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699843.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene nusB CDS complement(289363..289812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(289895..290455) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226377.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene efp CDS complement(290639..290839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 291262..291477 product DNA-directed RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640827.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 291477..293159 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640828.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 293303..294820 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980180.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene ppcA CDS 294967..295881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(295935..297095) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027546.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene metK CDS 297324..298208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(298256..299398) product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701508.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(299470..301509) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101267.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene ligA CDS complement(301543..303681) product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644128.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene pcrA assembly_gap 303713..303764 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 303992..305143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(305208..305870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(306036..306971) product dihydroorotate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130679.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(306975..310145) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775076.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene carB CDS complement(310147..311232) product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101887.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(311237..312505) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475572.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(312502..313434) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101888.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(313787..314086) product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706616.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(314129..314563) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047035765.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene ruvX CDS complement(314563..314814) product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703962.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(314960..317641) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003587396.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene alaS CDS complement(317924..319258) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101522.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(319353..320780) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700547.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(320991..322589) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030720.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(322731..324101) product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568836.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(324162..325700) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906368.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene gntK CDS complement(325845..326753) product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032398514.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene gnd CDS 326908..327759 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644133.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(327799..328431) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700143.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene udk CDS complement(328563..329915) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003585579.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(330033..331046) product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564050.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene ccpA CDS complement(331140..331349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(331400..331954) product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640904.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(331938..332186) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294295.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene acpP CDS complement(332239..333270) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475845.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene plsX CDS complement(333309..335342) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645148.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene recG CDS complement(335475..335795) product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563849.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 tRNA complement(335952..336023) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(336099..336401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101169.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(336385..337164) product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132559.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(337161..338261) product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015426122.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(338349..339293) product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644286.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene dnaI CDS complement(339302..340678) product replication initiation and membrane attachment family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989742.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(340682..341281) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579584.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene coaE CDS complement(341278..341988) product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475557.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(342039..342869) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640272.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene mutM CDS complement(342931..344304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(344429..345745) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476163.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene obgE CDS complement(345860..347653) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640789.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene uvrC CDS complement(347740..349359) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642042.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(349569..350948) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476526.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(351317..352333) product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215631.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(352358..352687) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703477.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(352671..354101) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640267.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene sufB CDS complement(354091..354564) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986018.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(354557..355780) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376739.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(355758..356945) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287681.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene sufD CDS complement(356957..357736) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004894681.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene sufC CDS complement(357869..358450) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644787.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene nrdG CDS complement(358386..360596) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644788.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene nrdD CDS 360865..362310 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476240.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 362307..363128 product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476239.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene nadE tRNA complement(363258..363332) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(363418..363975) product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101020.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene rpoE CDS complement(364001..364441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 364523..365869 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475699.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 assembly_gap 365903..365979 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(366035..368593) product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674135.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 368783..370861 product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101852.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(370956..371549) product DUF1054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101714.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(371542..372390) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048320.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(372475..373836) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254451.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(373951..374667) product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642968.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(374680..375354) product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130417.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 375509..375907 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905993.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(375966..378008) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476158.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 378186..380738 product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101465.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 380801..381286 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640314.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene greA CDS complement(381400..382344) product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566496.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(382470..383684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(383848..385080) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476174.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(385124..386128) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475752.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(386166..386462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(386468..386614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(386903..387151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(387129..387524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(387508..387819) product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356991.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene comGC CDS complement(387816..388856) product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356990.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene comGB CDS complement(388914..389807) product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101696.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene comGA CDS complement(389910..390761) product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645162.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 390868..391347 product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640806.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 391429..392391 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546979.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(392440..395325) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476196.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene uvrA CDS complement(395413..397422) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641029.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene uvrB CDS complement(397525..399639) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644210.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(399661..399921) product YkuJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379802.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(399929..400963) product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564081.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(400973..402052) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287604.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(402053..403282) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475730.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(403432..405204) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702733.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(405197..406930) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475471.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(407066..407410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(407459..408676) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921852.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene tgt CDS 408831..409337 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035009.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 409806..410552 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072535403.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(410603..411373) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene trpA CDS complement(411366..412562) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562635.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene trpB CDS complement(412904..413155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 note possible pseudo, internal stop codon, frameshifted CDS complement(413142..413954) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene trpC CDS complement(413951..414133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 note possible pseudo, frameshifted CDS complement(414091..415011) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene trpD note possible pseudo, frameshifted assembly_gap 414165..414211 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(415004..415606) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000479265.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(415590..417032) product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101488.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(417194..417421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 417919..418800 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703273.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 418797..419570 product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102187.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene aroD CDS 419557..420987 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644494.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 421027..422196 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644493.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene aroC CDS 422207..422806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 note possible pseudo, frameshifted assembly_gap 422694..422752 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 422838..423533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 note possible pseudo, frameshifted CDS 423538..424395 product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644490.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 424392..424904 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640717.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 424916..425458 product amino acid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644492.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(425486..425743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(425863..426588) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475489.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(426698..427036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(427052..427375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 repeat_region 427900..428398 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggaagaaaccccattaatctgacatacatctaaagc CDS complement(428424..429098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(429095..429400) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475522.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene cas2 CDS complement(429412..430287) product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475521.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene cas1 CDS complement(430531..433860) product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475518.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene cas9 note possible pseudo, internal stop codon, frameshifted CDS complement(433773..434471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 note possible pseudo, internal stop codon, frameshifted CDS complement(434623..434925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 435218..435433 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578365.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 435426..435860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(435974..437101) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027822226.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(437283..437564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(437893..439083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(439093..439356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(439674..439871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(439888..440097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 440233..440814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(441463..441708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(441756..443183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(443180..444172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(444233..444823) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050340461.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(444938..445120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(445259..445465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(445501..446442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(446674..447018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 tRNA complement(447505..447578) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 447829..448725 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255238.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 448718..449941 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906132.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(450039..451754) product ABC transporter permease/substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130445.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(451747..452937) product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130443.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 453104..453721 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130442.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(453777..455123) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642759.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(455221..456543) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254512.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(456533..457645) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549721.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(457648..458337) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642424.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(458341..459051) product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476455.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(459078..460178) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476456.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene ychF CDS complement(460204..460413) product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293106.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(460416..461315) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476457.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(461308..462066) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102075.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(462086..462802) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131091.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene rsmG tRNA complement(462939..463025) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA complement(463050..463123) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA complement(463126..463199) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA complement(463302..463376) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA complement(463379..463471) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 sequence02 source 1..283981 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1574..2419) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101600.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 2668..4353 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641787.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(4412..5587) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575944.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(5758..7176) product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475887.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(7190..8695) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270490.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene xylB CDS complement(8710..9408) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596501.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(9417..10298) product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674994.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(10295..10942) product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381985.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(10954..12027) product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571790.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene ulaG CDS 12866..13687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(13768..14160) product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398711.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(14238..15026) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100886.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene thiM CDS complement(15023..15670) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100887.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene thiE CDS complement(15667..16488) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646310.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene thiD CDS complement(16481..17137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 17488..17946 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262079.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(17992..19347) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379815.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(19696..21222) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675048.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(21212..21682) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662387.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(21774..22544) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103661284.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene proC CDS complement(22672..23799) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294242.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(23786..23998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 note possible pseudo, frameshifted CDS 24109..24981 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674958.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(25024..25692) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100921.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(25689..27089) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100922.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(27101..27658) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643692.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(27944..29284) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592860.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(29499..29774) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658248.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(29989..31299) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700239.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene der CDS complement(31356..32546) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640589.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene rpsA CDS complement(32743..33420) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700259.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene cmk CDS complement(33442..33948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(34023..34604) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264050.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(34928..35677) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294391.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(35674..36375) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640596.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene scpB CDS complement(36359..37042) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382313.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(37101..37478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(37499..38386) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294386.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene xerD CDS complement(38390..39283) product S1 RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476057.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(39360..39806) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640683.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(39902..40090) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638914.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene rpsU CDS complement(40261..41448) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808709.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(41515..42171) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662275.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(42235..42645) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900910.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 42718..43176 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902601.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(43231..44097) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640688.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(44333..46123) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101612.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene aspS CDS complement(46123..47430) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475997.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene hisS CDS complement(47777..50548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 note possible pseudo, frameshifted CDS complement(50485..51987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(51975..57218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04820 note possible pseudo, frameshifted CDS 57255..57422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(58568..59140) product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078128.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(59145..60104) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209628184.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 tRNA complement(60235..60324) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(60382..62220) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644590.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene typA CDS complement(62275..63069) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640819.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(63062..63337) product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101669.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 63535..64113 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565220.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene def CDS complement(64146..65123) product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940692.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 assembly_gap 64165..64228 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(65204..67051) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101636.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene dnaK CDS complement(67145..67735) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101637.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene grpE CDS complement(67754..68785) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640713.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene hrcA CDS complement(68991..69875) product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363808.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene ribF CDS complement(69999..70922) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013232.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene truB CDS complement(70991..72178) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366378.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(72356..73531) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905073.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(73760..74113) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475824.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene rbfA CDS complement(74136..76601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(76601..76918) product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565784.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(76908..77207) product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640726.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(77229..78395) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101642.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene nusA CDS complement(78420..78896) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439519.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene rimP CDS complement(79076..79345) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674890.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene rpsN CDS complement(79345..79494) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566154.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene rpmG CDS complement(79635..80540) product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674498.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(80615..83047) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640556.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene parC CDS complement(83069..85201) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640557.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene parE CDS 85454..86071 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644419.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene plsY CDS complement(86158..88404) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640696.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 88701..89915 product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286708.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(89955..90239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(90226..92760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(92741..93820) product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101548.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(93915..94442) product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704375.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene pyrR CDS complement(94483..95421) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475978.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(95422..95799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 95903..96286 product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594509.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(96367..96891) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906361.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(97143..102320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(102321..102527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(102533..104176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(104464..105603) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644375.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 105629..105925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(105954..106643) product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644365.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(106712..108037) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640473.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene asnS CDS complement(108092..109285) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016511714.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(109295..109753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(109922..111127) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546886.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(111202..111972) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027870.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene dapB CDS complement(111969..112853) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640801.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene dapA CDS complement(112879..114057) product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546881.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(114122..114835) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673976.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene dapD CDS complement(114946..116244) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592630.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene lysA CDS complement(116316..117431) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642062.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene alr CDS complement(117787..120210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 120360..121298 product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131564.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene mvk CDS 121365..122330 product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905319.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene mvaD CDS 122334..123404 product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355777.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 123427..124518 product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905320.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene fni assembly_gap 123947..124001 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(124559..125614) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101252.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene aroB CDS complement(125616..126605) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644102.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene aroF CDS complement(127038..127298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(127325..128248) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924976.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(128492..129235) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642554.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(129235..129792) product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476359.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(129974..131263) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640674.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene rpoD CDS complement(131276..133210) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101607.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene dnaG CDS complement(133356..134627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 note possible pseudo, internal stop codon, frameshifted CDS complement(134640..135665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 note possible pseudo, internal stop codon, frameshifted CDS complement(135794..138046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(138191..139519) product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002308483.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(139637..141034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(141195..142571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(142727..144046) product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002308483.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(144134..144922) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547007.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(144935..146341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(146493..148031) product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101259.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene citF CDS complement(148021..148932) product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644111.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene citE CDS complement(148932..149225) product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641303.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene citD CDS complement(149215..150279) product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092462393.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene citC CDS complement(150289..151434) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905808.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 151732..152679 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905809.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(152724..154091) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288744.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene brnQ CDS complement(154231..155223) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033099007.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(155226..156140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(156137..157105) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705524.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(157210..159762) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289594.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(159814..160467) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640836.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(160464..160805) product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644603.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(160832..162202) product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640460.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(162228..163016) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705135.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene map CDS 163170..163454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(163514..164938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(164947..165576) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294095.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene upp tRNA 165730..165802 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(165880..166482) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295844.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(166575..167405) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644479.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(167637..169028) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886939.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(169025..169582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(169658..170317) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262115.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(170433..171791) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263094.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(171874..173832) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356319.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene thrS CDS 174416..174877 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476243.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(174960..175685) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674355.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(175755..176243) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393497.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(176246..177433) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475515.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(177436..178521) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442921.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene serC tRNA 178786..178872 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 179010..179807 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644715.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(179915..180904) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129898.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 181049..181699 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101683.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(181765..183207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(183207..184745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(184795..186234) product accessory Sec system protein Asp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485487.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene asp1 CDS complement(186259..187095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(187080..188543) product accessory Sec system glycosyltransferase GtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836746.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene gtfA CDS complement(188627..189616) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641060.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene pta CDS complement(189683..190357) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682955.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 190459..191193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475715.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(191236..192702) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015381020.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene cls CDS complement(192753..193289) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700501.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(193309..195384) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263074.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene recJ CDS complement(195371..196327) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476161.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene rnz CDS complement(196362..197111) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640384.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene trmD CDS complement(197101..197628) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170278.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene rimM CDS complement(197729..198202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(198308..201106) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922491.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene ileS CDS complement(201380..202144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(202172..202966) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074526.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(202971..203228) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644609.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(203235..203672) product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565171.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(203686..204936) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640854.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene ftsZ CDS complement(204960..206312) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640855.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene ftsA CDS complement(206428..207129) product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476138.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(207142..208236) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640857.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene murG CDS complement(208249..209604) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565159.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene murD CDS complement(209679..210635) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640859.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene mraY CDS complement(210636..212780) product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101681.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(212785..213159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(213227..214180) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476142.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene rsmH CDS complement(214237..214668) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644614.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene mraZ CDS 215272..215514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(215564..217270) product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101481.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(217278..217637) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638623.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(217771..217971) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638622.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene rpmB CDS complement(218177..218494) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564019.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene trxA CDS complement(218496..219143) product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645150.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(219210..219866) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287380.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene rpe CDS complement(219922..220827) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027877.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene rsgA CDS complement(220931..222739) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101478.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene pknB CDS complement(222739..223599) product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648703.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(223605..224954) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101476.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene rsmB CDS complement(224947..225918) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101475.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene fmt CDS complement(226023..228446) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101474.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene priA CDS complement(228545..229660) product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906251.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 229918..230364 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861965.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 230361..230804 product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100899.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(230829..231050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(231179..231736) product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227127.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene pdxT CDS complement(231748..232398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 note possible pseudo, frameshifted assembly_gap 232432..232510 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(233279..233572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 233714..233959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(234012..234803) product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047711.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(235122..235259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(235262..235456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(235684..236121) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475469.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene msrB CDS complement(236124..236645) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706147.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene msrA CDS complement(236719..237303) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640795.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene yihA CDS complement(237306..238559) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288492.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene clpX CDS complement(238680..239972) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292069.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene tig CDS complement(240202..240846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(240981..242396) product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645262.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene pepV CDS 242516..243349 product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569460.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 243379..244197 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549252.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(244229..244762) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291442.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(244759..245280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(245280..245735) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101163.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene tsaE CDS 245849..246559 product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390224.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene budA CDS complement(246605..247666) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563971.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene queA CDS complement(247746..248801) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476176.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene ruvB CDS complement(248891..249496) product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549206.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(249538..250323) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644631.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene racE assembly_gap 250588..250685 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 250753..251271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(251363..252724) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476172.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(252743..253708) product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101704.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(253786..254886) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641518.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene dinB CDS complement(254959..255318) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640385.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene rplS CDS complement(255947..257650) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646085.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(257654..258337) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549229.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 258877..259893 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583055.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 259899..260609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475562.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 260646..261035 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289210.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(261118..262059) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476540.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene trxB CDS complement(262164..263039) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641010.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene galU CDS complement(263110..264120) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289572.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(264113..265078) product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643956.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene hprK CDS complement(265083..265436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(265536..266210) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641004.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene phoU CDS complement(266327..267094) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289489.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene pstB CDS complement(267091..267933) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641002.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene pstB CDS complement(267941..268825) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641001.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene pstA CDS complement(268825..269748) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002316421.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene pstC CDS complement(269757..270647) product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357425.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(270826..271944) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546531.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene recA CDS complement(272073..272651) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706586.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene pgsA CDS complement(272663..273523) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732284.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(273532..274803) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644640.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(274807..276069) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180259804.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(276132..276974) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989800.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(276971..277612) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641493.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(277617..278258) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383057.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(278602..279129) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989738.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene mreD CDS complement(279131..279985) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641488.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene mreC CDS complement(280075..281082) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700472.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(281181..281354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(281371..282264) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129541.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene miaA CDS 282349..282534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(282570..282968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(283098..283796) product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579619.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 sequence03 source 1..188015 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 357..1667 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702338.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene serS CDS 1811..4222 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643952.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene secA CDS 4271..5389 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096641376.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene prfB CDS 5522..7987 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101242.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(8752..9525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 9957..11705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 12783..13196 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703807.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene rpsL CDS 13214..13684 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699701.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene rpsG CDS 13810..15921 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645499.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene fusA CDS 16340..17494 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320739.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 17494..18324 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287038.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 18321..19124 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564363.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 19121..20197 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674347.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 20561..20869 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567567.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene rpsJ CDS 20927..21616 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641252.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene rplC CDS 21645..22268 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641253.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene rplD CDS 22268..22555 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701304.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene rplW CDS 22578..23411 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641255.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene rplB CDS 23428..23703 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705314.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene rpsS CDS 23718..24074 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638065.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene rplV CDS 24074..24742 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701310.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene rpsC CDS 24757..25170 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960948.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene rplP CDS 25170..25376 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638068.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene rpmC CDS 25399..25665 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701314.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene rpsQ CDS 25717..26085 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288669.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene rplN CDS 26107..26415 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641258.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene rplX CDS 26455..26997 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701318.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene rplE CDS 27125..27523 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356215.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene rpsH CDS 27548..28084 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641259.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene rplF CDS 28170..28523 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624044.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene rplR CDS 28544..29050 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701326.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene rpsE CDS 29062..29244 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567529.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene rpmD CDS 29274..29708 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701328.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene rplO CDS 29709..31007 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701329.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene secY CDS 31029..31595 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101246.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 31693..31908 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638082.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene infA CDS 31956..32075 product 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878160.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene rpmJ CDS 32152..32523 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641265.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene rpsM CDS 32700..33086 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262316.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene rpsK CDS 33134..34078 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641267.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 34115..34498 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641268.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene rplQ assembly_gap 34526..34640 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(34711..35847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 36040..36909 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264876.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 36911..37768 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263702.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 37786..38256 product LytTR family transcriptional regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263701.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 38265..38657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 38760..39578 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641275.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 39554..40522 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381364.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 40515..41318 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288724.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 41340..42113 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644097.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene truA CDS 42158..42565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(42791..43027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 43347..43790 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476333.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene rplM CDS 43809..44204 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476332.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene rpsI CDS complement(44376..46343) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101999.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 46453..47052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 47490..47795 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286315.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 47797..48351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 48356..49051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 49063..49812 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003584392.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 49814..51793 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489404.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(52386..53210) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564150.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(53548..54969) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102117.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(55298..56440) product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101045.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(56461..57186) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642071.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene argB CDS complement(57191..58096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 note possible pseudo, frameshifted CDS complement(58152..58379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07650 note possible pseudo, frameshifted CDS complement(58421..59452) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646527.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene argC CDS complement(59528..60571) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254507.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene argF CDS 61137..61664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 61730..62044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 note possible pseudo, frameshifted CDS 62127..62915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 note possible pseudo, frameshifted CDS 63114..66089 product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905479.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 66106..67701 product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905480.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 67694..68245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(68831..69763) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058548.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(69890..70468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 70528..70716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 70786..71469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 note possible pseudo, internal stop codon CDS 71630..71866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 71775..72119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 72200..72655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 72743..73207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 73307..73810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 73928..74281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 74636..75874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 75914..83089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(83187..83771) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641335.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 83909..84664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(84737..86035) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645874.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 86400..86609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(86657..87163) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643401.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 87293..89560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(89642..90154) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643401.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 90281..92551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 assembly_gap 93233..93316 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA 93345..93416 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(93499..94848) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641141.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene hflX assembly_gap 93947..94001 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(94932..95603) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475535.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(95745..97184) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101876.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 97606..97836 product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259246.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene nrdH CDS 97945..100116 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643938.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene nrdE CDS 100388..100828 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642628.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene nrdI CDS 100830..101801 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703371.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene nrdF CDS complement(101865..102533) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641231.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(102658..102807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 102983..103951 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674242.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene mutY CDS 103938..105092 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643221.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 tRNA 105239..105322 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 105390..105465 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(105666..106022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(106174..106839) product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674956.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 107021..107218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389845.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 assembly_gap 107577..107702 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 107725..108579 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593032.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 108587..109924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 109939..110811 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101819.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 110804..112084 product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101818.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 112103..113248 product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101860.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 113241..114398 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989782.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene metC CDS complement(114584..115642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484522.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(115793..116368) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262077.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(116419..116880) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001631030.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 tRNA complement(117000..117073) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 117311..118009 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640897.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(118060..118755) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905283.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(118752..119855) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985970.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(119877..121211) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176657.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(121272..122111) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131676.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(122150..122989) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131676.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(123437..125032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 125291..125905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 125956..126855 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989461.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 126916..128172 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675040.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(128287..129141) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287475.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 129574..132252 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643866.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 132259..132696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 133001..134449 product amino acid ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643977.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 134446..135195 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699922.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 135235..136683 product amino acid ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643977.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 137870..139618 product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577415.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene pepF CDS 139647..140576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 140891..141940 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288048.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene pheS CDS 141943..144396 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101464.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene pheT CDS 144466..145752 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642050.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 145841..146101 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710757.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 146179..147564 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101269.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene rlmD CDS 147589..148932 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475711.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 148942..150126 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594959.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 150256..151815 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355724.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 151927..153141 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723235.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 153123..154124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 assembly_gap 154031..154118 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 154159..154551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 154611..155225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 155322..156287 product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641037.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 156288..157232 product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564251.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene whiA CDS 157319..157930 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002937303.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 157997..158992 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613274.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 159182..159958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 note possible pseudo, frameshifted CDS 159906..160178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 note possible pseudo, frameshifted CDS 160420..161574 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355369.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 161825..163144 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547412.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 163285..163878 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703661.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 163988..164551 product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836600.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 164551..165729 product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703227.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene yqeH CDS 165729..166046 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699799.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene yhbY CDS 166077..166664 product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548313.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene yqeK CDS 166674..167048 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475792.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene rsfS assembly_gap 167098..167201 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 167276..167944 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645186.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 167944..169128 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101458.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 169129..169692 product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640295.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 169796..170485 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638551.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 170487..171581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 171688..172638 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101463.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene yidC CDS 172653..173426 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640308.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 173477..173713 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356546.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene secG CDS 173785..176247 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101159.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene rnr CDS 176274..176738 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641053.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene smpB CDS 176947..178503 product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644638.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene rny CDS 178618..178992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 179011..179319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(179380..180363) product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071586.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene rnhC CDS 180512..181033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 181056..183455 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296458.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 183509..183859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 183870..184955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(185000..185329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 185609..186208 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287358.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene gmk CDS 186220..186435 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640362.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene rpoZ CDS 186437..187015 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475488.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 187064..187444 product CvfD/Ygs/GSP13 family RNA-binding post-transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566816.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 187454..187825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 sequence04 source 1..165506 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(89..1021) product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002911924.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 1082..2287 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081491.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 2374..2673 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015379645.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(2749..3033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 3089..4204 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674006.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 4271..4468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 4537..5280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 5290..5952 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263713.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 6032..6334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 6379..6873 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103118.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(7098..7358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 7303..7536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08960 assembly_gap 7504..7513 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7957..8109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(8470..8664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(8764..9255) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674616.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(9282..9821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(9911..10303) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675091.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 10523..11461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 11755..12207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 12299..12997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 13197..13934 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641125.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 13959..14828 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563836.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 14825..15466 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701287.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 15479..16132 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575766.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 16343..17080 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641125.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 17199..17993 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101188.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 17990..18631 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644017.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 18642..19295 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575766.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 19322..19549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 20005..22056 product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643475.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(22107..23021) product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476521.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene mmuM CDS complement(22975..24366) product S-methylmethionine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966441.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene mmuP CDS complement(24474..26114) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093960.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(26144..27274) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547400.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 27770..28315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 28734..29663 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644197.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 tRNA 29763..29837 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 30075..30150 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 30421..31689 product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701408.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 31959..32414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 32724..35405 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476148.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 35551..36525 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640915.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 36679..37392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 37678..38772 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701236.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 38868..39800 product Ppx/GppA family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101010.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 39804..41036 product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906035.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 41020..41991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674945.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 42037..42744 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613281.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 42830..43837 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642507.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 44184..45575 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261924.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 46025..47398 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001073014.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 47423..47884 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642165.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 47998..48615 product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222025.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 48623..48958 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321425.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 tRNA 49035..49119 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(49208..50122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(50122..50856) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701034.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(50853..51551) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642440.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(51580..52371) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535753.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 52804..54846 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643823.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene metG CDS complement(54906..55538) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548040.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene pyrE CDS complement(55578..56294) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548039.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene pyrF CDS complement(56498..57832) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674807.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(57965..58456) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642092.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 58678..59688 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643974.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene gap CDS 59794..60606 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640888.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 60811..61254 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563897.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene fabZ CDS 61241..61711 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699732.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 61733..62707 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192131.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 62794..63036 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699734.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 63089..64060 product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566773.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 64074..65015 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356280.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene fabD CDS 65022..65750 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699736.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene fabG CDS 65793..67043 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475765.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene fabF CDS 67059..67538 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921156.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene accB CDS 67621..68052 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699740.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene fabZ CDS 68054..69436 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475767.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene accC CDS 69535..70377 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025022359.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene accD CDS 70377..71174 product carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057868922.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene accA CDS 71393..72964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 72894..73775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 note possible pseudo, frameshifted tmRNA 73855..74209 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 74449..74685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(74969..75571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 75928..76107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(76021..76653) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674423.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(76653..76976) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476446.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(77255..78592) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674934.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(78605..79780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674935.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 80279..81460 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188891678.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 81669..82079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(82140..83192) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674971.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(83235..85454) product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674254.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 85736..86293 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683453.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(86341..87738) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641110.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 87841..88710 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642437.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(88749..89306) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004139.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 89476..90963 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208365.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 90966..91496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 91632..92648 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382358.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(92679..92855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(92938..93831) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289801.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(93850..93984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(94202..94828) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567793.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(94895..95809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(95839..96723) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262025.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(96716..97933) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101271.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 98245..99774 product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640707.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene dltA CDS 99767..100978 product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476021.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene dltB CDS 100994..101230 product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549523.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene dltC CDS 101327..102523 product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288094.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene dltD CDS 102592..102993 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922620.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene acpS CDS 102996..104129 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642062.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene alr CDS 104190..104555 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699581.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 104657..105355 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130364.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 105339..106646 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286064.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 106677..107546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(107607..107936) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565903.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 108030..108779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 108875..110719 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700646.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(110769..111500) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699925.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(111500..112858) product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546733.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 112998..113588 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644660.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 113598..114674 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564946.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene prfA CDS 114677..115600 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641434.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene prmC CDS 115587..116600 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699933.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 116684..116953 product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546482.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 117114..117911 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640977.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene tsaB CDS 117883..118434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 118424..118840 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289526.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene rimI CDS 118837..119862 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101143.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene tsaD CDS 119961..120608 product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003710514.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 120613..121653 product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993638.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 121715..122545 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546391.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(122571..123056) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262487.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 123142..123885 product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002387.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene nfsA CDS 124055..124339 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567052.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene groES CDS 124402..126021 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640986.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene groL CDS 126164..126607 product DUF3290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550049.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 126604..127254 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906307.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 127291..127965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(128011..128661) product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643849.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene cbpA CDS 128780..129346 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836278.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene pth CDS 129349..132888 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101049.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene mfd CDS 132878..133150 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642082.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 133228..133620 product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476303.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 133669..134976 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476302.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene tilS CDS 134973..135509 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642086.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene hpt CDS 135571..137652 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643854.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene ftsH CDS 137726..138673 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642088.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene hslO CDS 138795..140282 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701392.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene lysS tRNA 140360..140434 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 140615..141874 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288985.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 142001..142285 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101001.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 142299..142589 product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646479.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(142632..143201) product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644741.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 tRNA 143381..143455 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 143461..143533 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 143620..144069 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902601.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 144175..145299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 tRNA complement(145471..145558) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 145680..146021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 146018..146794 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643975.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene tpiA CDS 146930..148255 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700615.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene eno CDS 148379..148918 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476152.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 tRNA complement(148979..149050) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(149069..149704) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101145.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 149748..151028 product DNA/RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101146.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 151025..151762 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643951.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 151818..152042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 152152..153135 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644658.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 153145..153354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 153438..154652 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699953.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 154662..155645 product DUF2785 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645413.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 155735..156880 product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476153.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(156954..157394) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703973.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(157805..159133) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641463.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(159148..159522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(159624..159878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(160034..160645) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641475.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene rpsD CDS 161015..162715 product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355233.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene ezrA CDS 162849..163310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(163358..164698) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701275.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 164874..165437 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101185.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 sequence05 source 1..114644 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(175..1596) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549082.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene cysS CDS complement(1669..3165) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254122.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene gltX CDS complement(3293..4660) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643928.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene radA CDS complement(4660..5130) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389647.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 5233..5547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(5624..7774) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475490.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(7832..8113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703180.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 8318..9487 product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674763.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 9546..10994 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642454.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene rlmD CDS 11079..11783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475562.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(11823..12413) product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385065.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(12697..14208) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643227.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(14349..15284) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138506.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(15284..16336) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410286.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(16347..17369) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262738.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(17380..18297) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262739.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(18486..20126) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262740.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(20355..21881) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642739.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 22043..22372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 tRNA 22481..22554 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 22937..24001 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101969.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 note possible pseudo, internal stop codon CDS complement(24044..24451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(24448..24666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(24777..25301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 26088..26519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 note possible pseudo, frameshifted CDS complement(26548..27546) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566813.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 27624..28580 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644692.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(28619..29260) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641239.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(29379..30521) product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475476.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(30590..32467) product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641656.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene walK CDS complement(32513..33226) product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100856.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene yycF CDS complement(33406..34389) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567718.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(34517..35335) product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377829.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene yidA CDS complement(35451..37904) product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906007.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(38115..38843) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546381.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 38937..39434 product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131680.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(39486..40970) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230635.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene dnaB CDS complement(40973..41425) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641637.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene rplI CDS complement(41506..43539) product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643610.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(43676..43939) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568467.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene rpsR CDS complement(43970..44494) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100851.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene ssb CDS complement(44526..44822) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637271.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene rpsF CDS complement(45004..46380) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476000.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(46387..47601) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645896.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 47805..49265 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644713.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene zwf CDS complement(49317..49835) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775170.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(49842..50522) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254070.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(50565..50864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(50983..51477) product DUF1440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642103.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 51669..52214 product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641932.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 52449..52958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(52984..53394) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090101.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 53500..55164 product alpha-keto acid decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003297558.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(55276..55905) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641616.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene lepB CDS complement(55951..56259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(56275..57228) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182746.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene rbsK CDS 57372..58049 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706781.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene rpiA CDS 58176..59537 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567335.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 59561..60160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(60242..60853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(61040..61783) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101262.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 note possible pseudo, frameshifted CDS complement(61783..61998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 note possible pseudo, frameshifted CDS complement(62172..63794) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601491.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 63996..64913 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101881.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 64913..65821 product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643364.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 65970..66407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 66587..67309 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003604400.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 67306..68604 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681529.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(68680..70065) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568204.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene argH CDS complement(70077..71291) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568202.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(71310..72056) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701149.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(72049..73509) product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640791.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(74129..82813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(82860..83840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(84218..84895) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476313.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(84900..85952) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476312.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(85955..86470) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583259.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(86588..87748) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642221.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(88036..89199) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642221.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(89524..91191) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101546.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(91201..92463) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051230.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene purD CDS complement(92482..94008) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101892.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene purH CDS complement(94005..94610) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101893.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene purN CDS complement(94595..95653) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081095.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene purM CDS complement(95667..97196) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642591.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene purF CDS complement(97209..99452) product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288015.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene purL CDS complement(99485..100159) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666774.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene purQ CDS complement(100174..100422) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594884.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene purS CDS complement(100438..101190) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016386618.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(101209..102333) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101896.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene purK CDS complement(102330..102818) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565990.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene purE CDS complement(103058..104374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 104742..107039 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674593.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 107141..107854 product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377790.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(107901..108806) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101869.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(108853..111033) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101835.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 111179..111952 product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701519.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(111982..113193) product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674878.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 tRNA complement(113256..113331) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA complement(113352..113422) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(113446..113520) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA complement(113542..113617) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA complement(113618..113693) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA complement(113721..113810) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA complement(113826..113899) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(113910..113986) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(114010..114083) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(114123..114198) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(114204..114289) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(114294..114365) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(114373..114445) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(114484..114558) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 sequence06 source 1..102009 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 293..1048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(1133..3697) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703396.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene gyrA CDS complement(3730..5724) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641632.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene gyrB CDS complement(5748..6866) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641631.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene recF CDS complement(6857..7225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(7428..8561) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568447.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene dnaN CDS complement(8741..10123) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641628.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene dnaA CDS 10629..10763 product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640225.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene rpmH CDS 10855..11217 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701410.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene rnpA CDS 11201..12049 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641627.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene yidC CDS 12166..13089 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294163.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 13165..13668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 13688..13852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 13973..14860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(14885..16738) product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674013.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 17174..18421 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701368.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene tyrS CDS 18802..19713 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287087.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 19731..20495 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485509.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 20570..20872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 assembly_gap 20911..20965 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(20979..21734) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101822.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(21727..22629) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642727.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(22629..23630) product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101821.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene trpX CDS complement(23946..24548) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707008.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 24632..25060 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191904.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 25124..25543 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969203.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene crcB CDS 25536..25886 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712071.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene crcB CDS 25923..26816 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549336.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(26899..27246) product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701399.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 27405..28052 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642505.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 28068..28715 product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642580.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 28847..30235 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530836.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 30353..32242 product endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914455.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 tRNA 32412..32496 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 assembly_gap 32575..32653 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 32817..33299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 33340..34680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 34877..36094 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641045.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 36291..38660 product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641150.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene helD CDS 38657..39361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 39516..41030 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208365.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 41032..41700 product DUF4811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548152.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 41920..42120 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701233.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 42243..42956 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703418.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 43037..44320 product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641437.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 44524..45246 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641438.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene atpB CDS 45352..45579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 45605..46114 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674409.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene atpF CDS 46124..46666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 46679..48193 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101724.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene atpA CDS 48205..49116 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641442.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 49178..50578 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641443.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene atpD CDS 50590..51033 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641444.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 51187..52074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 tRNA 52165..52237 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS complement(52322..53302) product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994499.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 53429..54445 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699680.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene trpS CDS 54605..55183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 55463..56920 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475571.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(56953..57477) product mutanobactin A biosynthesis transcriptional regulator MubR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266732.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene mubR CDS 58217..61837 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644088.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 61861..65517 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641247.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene rpoC CDS 65609..66058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 66234..66644 product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700685.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 66637..67386 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643931.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene rlmB CDS 67434..67994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 68209..68385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 68464..69048 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643932.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene nusG CDS 69211..69675 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640942.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene rplK CDS 69675..70367 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640943.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene rplA CDS 70547..71065 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643933.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene rplJ CDS 71117..71485 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476232.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene rplL CDS 71561..72178 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674837.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 72171..72701 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703380.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene tadA CDS 72906..74834 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101139.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene dnaX CDS 74841..75446 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700665.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene recR CDS 75446..75712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 75721..76353 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294039.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene tmk CDS 76357..76680 product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640965.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 76680..77642 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640966.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene holB CDS 77649..78566 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643942.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene rsmI CDS 78559..79317 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640969.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 79318..80313 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643943.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene galE CDS 80476..81354 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476352.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 tRNA 81443..81518 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS 81577..82326 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644084.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 82917..83396 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028058.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene rlmH CDS complement(83424..84077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 84154..84483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 tRNA 84529..84618 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 84851..86017 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101621619.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(87591..88253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 88395..88592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 88604..88804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 89037..89420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 89413..89736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 89733..90551 product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296494.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 90544..91971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 92334..92675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 92821..93951 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027822226.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 94260..94550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 note possible pseudo, frameshifted CDS 95662..96024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 96093..97082 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130890.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 97598..98479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 98490..99218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 99232..99534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(99601..101166) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262784.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 assembly_gap 101276..101364 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(101374..101901) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262785.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 sequence07 source 1..55627 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(392..1351) product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254608.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(1479..2768) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837602.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 2979..4277 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102100.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene purB CDS 4542..6296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 6321..11252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 11282..17707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 note possible pseudo, internal stop codon, frameshifted CDS 17704..20013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 assembly_gap 20100..20195 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 20334..21242 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563571.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 21261..21797 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101932.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 21942..23741 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102049.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene lepA CDS 23890..25575 product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700881.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene alsS CDS complement(25665..26276) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643398.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 26387..27127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 note possible pseudo, internal stop codon CDS 27215..27766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 note possible pseudo, internal stop codon CDS 28104..28772 product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763696.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene tenA CDS 28940..29992 product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831524.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 30177..30611 product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549441.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 30675..31046 product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642310.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 31072..31341 product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642309.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 31352..33289 product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102022.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 33459..34001 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675006.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 34001..35563 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675007.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 35847..35999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(36169..36918) product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645047.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 37155..39179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 39356..39868 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382303.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 40217..40960 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567413.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 40953..41801 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567411.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 41873..42814 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674889.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 43019..43927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 43932..44771 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905879.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 assembly_gap 44687..44758 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(44917..46470) product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003585581.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 46586..46747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 47155..48540 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288744.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene brnQ CDS 48764..50824 product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476610.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(51363..51863) product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428667.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(52400..52846) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942966.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 53066..53380 product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563849.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(53747..54214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 54394..54723 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566205.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 54725..55570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027519.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 sequence08 source 1..22849 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1230 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082831.1:MSCRAMM family adhesin SdrF note possible pseudo, internal stop codon locus_tag LOCUS_13000 assembly_gap 978..1055 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1234..1626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(3176..4225) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836741.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(4228..5298) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836741.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(5314..6069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(6062..7666) product accessory Sec system protein Asp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032114.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene asp2 CDS complement(7645..9234) product accessory Sec system protein Asp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468347.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene asp1 CDS complement(9231..10469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(10484..12850) product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560050.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene secA2 CDS complement(12869..13075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(13110..14441) product accessory Sec system glycosylation chaperone GtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609042.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene gtfB CDS complement(14441..15907) product accessory Sec system glycosyltransferase GtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158445.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene gtfA CDS complement(16137..16676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(16832..17131) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700607.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene secG CDS complement(17212..18657) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371124.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene cls CDS complement(19136..19285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(20244..20423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 21283..21495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 21476..21649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 22066..22431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 sequence09 source 1..5343 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(40..115) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 63 percent of the 5S ribosomal RNA locus_tag LOCUS_r00010 rRNA complement(201..3104) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 tRNA complement(3301..3375) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 rRNA complement(3472..5017) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 sequence10 source 1..3384 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 108..950 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475539.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(1031..2977) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674605.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 sequence11 source 1..3145 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(865..984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(1085..1483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(1494..2561) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643457.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 sequence12 source 1..2781 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 316..576 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566536.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 855..1418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(2095..2379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 sequence13 source 1..1402 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence14 source 1..1032 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 97..1017 product IS30-like element ISLpl1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003561810.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 sequence15 source 1..465 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@