>Feature sequence01 712 3099 gene locus_tag LOCUS_00010 712 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3200 6832 gene locus_tag LOCUS_00020 3200 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 6841 10563 gene locus_tag LOCUS_00030 6841 10563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 10602 11507 gene locus_tag LOCUS_00040 10602 11507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 11564 14491 gene locus_tag LOCUS_00050 11564 14491 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_00050 14772 14978 gene locus_tag LOCUS_00060 14772 14978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 15788 15018 gene locus_tag LOCUS_00070 15788 15018 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973082.1 protein_id gnl|my_center|LOCUS_00070 19191 15922 gene locus_tag LOCUS_00080 19191 15922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 19722 20276 gene locus_tag LOCUS_00090 19722 20276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 20273 21949 gene locus_tag LOCUS_00100 20273 21949 CDS product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120965.1 protein_id gnl|my_center|LOCUS_00100 25130 22632 gene locus_tag LOCUS_00110 25130 22632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 26884 25130 gene locus_tag LOCUS_00120 26884 25130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 30549 26962 gene locus_tag LOCUS_00130 30549 26962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 31548 33395 gene locus_tag LOCUS_00140 31548 33395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 33573 36593 gene locus_tag LOCUS_00150 33573 36593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 36645 39512 gene locus_tag LOCUS_00160 36645 39512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 39542 42382 gene locus_tag LOCUS_00170 39542 42382 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671005.1 protein_id gnl|my_center|LOCUS_00170 42450 43895 gene locus_tag LOCUS_00180 42450 43895 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922160.1 protein_id gnl|my_center|LOCUS_00180 44174 44752 gene locus_tag LOCUS_00190 44174 44752 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105333325.1 protein_id gnl|my_center|LOCUS_00190 44749 46368 gene locus_tag LOCUS_00200 44749 46368 CDS product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120965.1 protein_id gnl|my_center|LOCUS_00200 47800 46457 gene locus_tag LOCUS_00210 47800 46457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 49392 47929 gene locus_tag LOCUS_00220 49392 47929 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767199.1 protein_id gnl|my_center|LOCUS_00220 50287 49409 gene locus_tag LOCUS_00230 50287 49409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 51827 50358 gene locus_tag LOCUS_00240 51827 50358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 52446 53309 gene locus_tag LOCUS_00250 52446 53309 CDS product heparin lyase I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091287825.1 protein_id gnl|my_center|LOCUS_00250 53299 54771 gene locus_tag LOCUS_00260 53299 54771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 54813 56486 gene locus_tag LOCUS_00270 54813 56486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 56629 59655 gene locus_tag LOCUS_00280 56629 59655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 61370 59784 gene locus_tag LOCUS_00290 61370 59784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 61936 65328 gene locus_tag LOCUS_00300 61936 65328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 65418 67073 gene locus_tag LOCUS_00310 65418 67073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 67111 69900 gene locus_tag LOCUS_00320 67111 69900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 70164 69982 gene locus_tag LOCUS_00330 70164 69982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 72948 70519 gene locus_tag LOCUS_00340 72948 70519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 75289 73415 gene locus_tag LOCUS_00350 75289 73415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 77325 75763 gene locus_tag LOCUS_00360 77325 75763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 77542 77381 gene locus_tag LOCUS_00370 77542 77381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 77785 79209 gene locus_tag LOCUS_00380 77785 79209 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_00380 79290 80864 gene locus_tag LOCUS_00390 79290 80864 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 protein_id gnl|my_center|LOCUS_00390 81066 82577 gene locus_tag LOCUS_00400 81066 82577 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615503.1 protein_id gnl|my_center|LOCUS_00400 83138 82821 gene locus_tag LOCUS_00410 83138 82821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 83306 84139 gene locus_tag LOCUS_00420 83306 84139 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168756122.1 protein_id gnl|my_center|LOCUS_00420 84805 84302 gene locus_tag LOCUS_00430 84805 84302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 85426 85010 gene locus_tag LOCUS_00440 85426 85010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 86657 86424 gene locus_tag LOCUS_00450 86657 86424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 86824 88260 gene locus_tag LOCUS_00460 gene sbcB 86824 88260 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262068.1 protein_id gnl|my_center|LOCUS_00460 88346 88864 gene locus_tag LOCUS_00470 88346 88864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 88925 89923 gene locus_tag LOCUS_00480 88925 89923 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693834.1 protein_id gnl|my_center|LOCUS_00480 90022 90285 gene locus_tag LOCUS_00490 90022 90285 CDS product DUF3081 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262059.1 protein_id gnl|my_center|LOCUS_00490 90290 90505 gene locus_tag LOCUS_00500 90290 90505 CDS product TIGR02450 family Trp-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478080.1 protein_id gnl|my_center|LOCUS_00500 90587 90907 gene locus_tag LOCUS_00510 90587 90907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 90945 91358 gene locus_tag LOCUS_00520 90945 91358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 91364 92152 gene locus_tag LOCUS_00530 91364 92152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 92864 92157 gene locus_tag LOCUS_00540 92864 92157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 93078 95105 gene locus_tag LOCUS_00550 93078 95105 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160066.1 protein_id gnl|my_center|LOCUS_00550 95901 95188 gene locus_tag LOCUS_00560 95901 95188 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918668.1 protein_id gnl|my_center|LOCUS_00560 99400 96251 gene locus_tag LOCUS_00570 99400 96251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 99608 100684 gene locus_tag LOCUS_00580 99608 100684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 101630 100767 gene locus_tag LOCUS_00590 101630 100767 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_00590 102949 101876 gene locus_tag LOCUS_00600 102949 101876 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764572.1 protein_id gnl|my_center|LOCUS_00600 103090 104394 gene locus_tag LOCUS_00610 103090 104394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 105126 104560 gene locus_tag LOCUS_00620 105126 104560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 107645 105303 gene locus_tag LOCUS_00630 107645 105303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 111679 107720 gene locus_tag LOCUS_00640 111679 107720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 113284 111836 gene locus_tag LOCUS_00650 113284 111836 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921292.1 protein_id gnl|my_center|LOCUS_00650 113608 114315 gene locus_tag LOCUS_00660 113608 114315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 114509 116428 gene locus_tag LOCUS_00670 114509 116428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 117708 116500 gene locus_tag LOCUS_00680 117708 116500 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209743.1 protein_id gnl|my_center|LOCUS_00680 118799 117810 gene locus_tag LOCUS_00690 118799 117810 CDS product family 16 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118992.1 protein_id gnl|my_center|LOCUS_00690 120689 119286 gene locus_tag LOCUS_00700 120689 119286 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921292.1 protein_id gnl|my_center|LOCUS_00700 123004 120824 gene locus_tag LOCUS_00710 123004 120824 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_00710 123594 123100 gene locus_tag LOCUS_00720 123594 123100 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920131.1 protein_id gnl|my_center|LOCUS_00720 125535 125311 gene locus_tag LOCUS_00730 125535 125311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 128521 125828 gene locus_tag LOCUS_00740 128521 125828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 132276 128593 gene locus_tag LOCUS_00750 132276 128593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 132781 133809 gene locus_tag LOCUS_00760 132781 133809 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072950.1 protein_id gnl|my_center|LOCUS_00760 133806 134414 gene locus_tag LOCUS_00770 133806 134414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 134415 134900 gene locus_tag LOCUS_00780 134415 134900 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038959.1 protein_id gnl|my_center|LOCUS_00780 134893 137085 gene locus_tag LOCUS_00790 134893 137085 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072947.1 protein_id gnl|my_center|LOCUS_00790 137727 137401 gene locus_tag LOCUS_00800 137727 137401 CDS product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400923.1 protein_id gnl|my_center|LOCUS_00800 139002 138049 gene locus_tag LOCUS_00810 139002 138049 CDS product ParB/RepB/Spo0J family plasmid partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817031.1 protein_id gnl|my_center|LOCUS_00810 140228 139002 gene locus_tag LOCUS_00820 140228 139002 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074409.1 protein_id gnl|my_center|LOCUS_00820 140934 140953 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 142449 141109 gene locus_tag LOCUS_00830 142449 141109 CDS product DASH family cryptochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479934.1 protein_id gnl|my_center|LOCUS_00830 142961 142659 gene locus_tag LOCUS_00840 142961 142659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 143414 143007 gene locus_tag LOCUS_00850 143414 143007 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464876.1 protein_id gnl|my_center|LOCUS_00850 143737 144054 gene locus_tag LOCUS_00860 143737 144054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 145557 144139 gene locus_tag LOCUS_00870 145557 144139 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147744042.1 protein_id gnl|my_center|LOCUS_00870 146611 145673 gene locus_tag LOCUS_00880 146611 145673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 147279 148754 gene locus_tag LOCUS_00890 147279 148754 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921292.1 protein_id gnl|my_center|LOCUS_00890 149406 149080 gene locus_tag LOCUS_00900 149406 149080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 150388 149579 gene locus_tag LOCUS_00910 150388 149579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 153736 150590 gene locus_tag LOCUS_00920 153736 150590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 154243 154052 gene locus_tag LOCUS_00930 154243 154052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 154215 155771 gene locus_tag LOCUS_00940 154215 155771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 155841 157094 gene locus_tag LOCUS_00950 155841 157094 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767198.1 protein_id gnl|my_center|LOCUS_00950 157997 157446 gene locus_tag LOCUS_00960 157997 157446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 158555 158013 gene locus_tag LOCUS_00970 158555 158013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 158771 159451 gene locus_tag LOCUS_00980 158771 159451 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070665.1 protein_id gnl|my_center|LOCUS_00980 160980 159463 gene locus_tag LOCUS_00990 160980 159463 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455312.1 protein_id gnl|my_center|LOCUS_00990 161101 162294 gene locus_tag LOCUS_01000 161101 162294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 162895 162332 gene locus_tag LOCUS_01010 162895 162332 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263635.1 protein_id gnl|my_center|LOCUS_01010 163290 163024 gene locus_tag LOCUS_01020 163290 163024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 163458 163853 gene locus_tag LOCUS_01030 163458 163853 CDS product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478908.1 protein_id gnl|my_center|LOCUS_01030 165225 163891 gene locus_tag LOCUS_01040 165225 163891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 165591 165271 gene locus_tag LOCUS_01050 165591 165271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 165786 166463 gene locus_tag LOCUS_01060 gene pdxH 165786 166463 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365910.1 protein_id gnl|my_center|LOCUS_01060 166486 167400 gene locus_tag LOCUS_01070 166486 167400 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072205.1 protein_id gnl|my_center|LOCUS_01070 167544 168362 gene locus_tag LOCUS_01080 167544 168362 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706923.1 protein_id gnl|my_center|LOCUS_01080 168365 170392 gene locus_tag LOCUS_01090 168365 170392 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925867.1 protein_id gnl|my_center|LOCUS_01090 170568 170933 gene locus_tag LOCUS_01100 170568 170933 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190980.1 protein_id gnl|my_center|LOCUS_01100 170930 171544 gene locus_tag LOCUS_01110 170930 171544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01110 171546 172490 gene locus_tag LOCUS_01120 171546 172490 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 protein_id gnl|my_center|LOCUS_01120 172775 175234 gene locus_tag LOCUS_01130 gene thrA 172775 175234 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706816.1 protein_id gnl|my_center|LOCUS_01130 175252 176205 gene locus_tag LOCUS_01140 gene thrB 175252 176205 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479586.1 protein_id gnl|my_center|LOCUS_01140 176206 177489 gene locus_tag LOCUS_01150 gene thrC 176206 177489 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781061.1 protein_id gnl|my_center|LOCUS_01150 177752 178438 gene locus_tag LOCUS_01160 gene ung 177752 178438 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262567.1 protein_id gnl|my_center|LOCUS_01160 179150 178524 gene locus_tag LOCUS_01170 179150 178524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 179285 181096 gene locus_tag LOCUS_01180 gene ggt 179285 181096 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042987999.1 protein_id gnl|my_center|LOCUS_01180 182029 181106 gene locus_tag LOCUS_01190 182029 181106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707800.1 protein_id gnl|my_center|LOCUS_01190 182538 182098 gene locus_tag LOCUS_01200 182538 182098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 183700 182735 gene locus_tag LOCUS_01210 gene cysK 183700 182735 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222180.1 protein_id gnl|my_center|LOCUS_01210 184195 183881 gene locus_tag LOCUS_01220 184195 183881 CDS product isoamylase early set domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704632.1 protein_id gnl|my_center|LOCUS_01220 184570 185757 gene locus_tag LOCUS_01230 184570 185757 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_01230 185767 188916 gene locus_tag LOCUS_01240 185767 188916 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_01240 189190 189265 gene locus_tag LOCUS_t00010 189190 189265 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 189320 189895 gene locus_tag LOCUS_01250 189320 189895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 190727 189945 gene locus_tag LOCUS_01260 190727 189945 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114424.1 protein_id gnl|my_center|LOCUS_01260 191008 193239 gene locus_tag LOCUS_01270 191008 193239 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706617.1 protein_id gnl|my_center|LOCUS_01270 193256 194893 gene locus_tag LOCUS_01280 gene pstA 193256 194893 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706616.1 protein_id gnl|my_center|LOCUS_01280 194915 195736 gene locus_tag LOCUS_01290 gene pstB 194915 195736 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706615.1 protein_id gnl|my_center|LOCUS_01290 195820 196527 gene locus_tag LOCUS_01300 gene phoU 195820 196527 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071865.1 protein_id gnl|my_center|LOCUS_01300 196791 197741 gene locus_tag LOCUS_01310 196791 197741 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925663.1 protein_id gnl|my_center|LOCUS_01310 198106 199074 gene locus_tag LOCUS_01320 198106 199074 CDS product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705170.1 protein_id gnl|my_center|LOCUS_01320 199308 200741 gene locus_tag LOCUS_01330 199308 200741 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073116.1 protein_id gnl|my_center|LOCUS_01330 200893 201984 gene locus_tag LOCUS_01340 200893 201984 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706627.1 protein_id gnl|my_center|LOCUS_01340 201996 203324 gene locus_tag LOCUS_01350 201996 203324 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457658.1 protein_id gnl|my_center|LOCUS_01350 203363 204268 gene locus_tag LOCUS_01360 203363 204268 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114256.1 protein_id gnl|my_center|LOCUS_01360 206714 204246 gene locus_tag LOCUS_01370 gene galB 206714 204246 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107279.1 protein_id gnl|my_center|LOCUS_01370 207061 209895 gene locus_tag LOCUS_01380 207061 209895 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036452.1 protein_id gnl|my_center|LOCUS_01380 209988 212375 gene locus_tag LOCUS_01390 209988 212375 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765772.1 protein_id gnl|my_center|LOCUS_01390 212443 215019 gene locus_tag LOCUS_01400 212443 215019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 215024 216412 gene locus_tag LOCUS_01410 215024 216412 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966721.1 protein_id gnl|my_center|LOCUS_01410 216413 217423 gene locus_tag LOCUS_01420 gene galS 216413 217423 CDS product HTH-type transcriptional regulator GalS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706108.1 protein_id gnl|my_center|LOCUS_01420 217546 218451 gene locus_tag LOCUS_01430 217546 218451 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072706.1 protein_id gnl|my_center|LOCUS_01430 218516 219172 gene locus_tag LOCUS_01440 218516 219172 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416612.1 protein_id gnl|my_center|LOCUS_01440 220129 219173 gene locus_tag LOCUS_01450 220129 219173 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766711.1 protein_id gnl|my_center|LOCUS_01450 220373 221161 gene locus_tag LOCUS_01460 gene truA 220373 221161 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706174.1 protein_id gnl|my_center|LOCUS_01460 221312 222172 gene locus_tag LOCUS_01470 gene accD 221312 222172 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118383.1 protein_id gnl|my_center|LOCUS_01470 222172 223461 gene locus_tag LOCUS_01480 gene folC 222172 223461 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043123896.1 protein_id gnl|my_center|LOCUS_01480 223464 224054 gene locus_tag LOCUS_01490 223464 224054 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262247.1 protein_id gnl|my_center|LOCUS_01490 224106 224615 gene locus_tag LOCUS_01500 gene cvpA 224106 224615 CDS product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420022.1 protein_id gnl|my_center|LOCUS_01500 224630 226138 gene locus_tag LOCUS_01510 gene purF 224630 226138 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705746.1 protein_id gnl|my_center|LOCUS_01510 226235 227005 gene locus_tag LOCUS_01520 226235 227005 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124872.1 protein_id gnl|my_center|LOCUS_01520 227351 228166 gene locus_tag LOCUS_01530 227351 228166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 228397 230052 gene locus_tag LOCUS_01540 228397 230052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 231826 230174 gene locus_tag LOCUS_01550 231826 230174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 233340 231895 gene locus_tag LOCUS_01560 233340 231895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 233771 236695 gene locus_tag LOCUS_01570 233771 236695 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036923.1 protein_id gnl|my_center|LOCUS_01570 236837 237688 gene locus_tag LOCUS_01580 236837 237688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 240206 238506 gene locus_tag LOCUS_01590 240206 238506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 241662 240574 gene locus_tag LOCUS_01600 241662 240574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 241938 242945 gene locus_tag LOCUS_01610 241938 242945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 243755 243024 gene locus_tag LOCUS_01620 243755 243024 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918870.1 protein_id gnl|my_center|LOCUS_01620 243997 247056 gene locus_tag LOCUS_01630 243997 247056 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918330.1 protein_id gnl|my_center|LOCUS_01630 247223 247558 gene locus_tag LOCUS_01640 247223 247558 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108621.1 protein_id gnl|my_center|LOCUS_01640 247567 248838 gene locus_tag LOCUS_01650 247567 248838 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_01650 249225 250412 gene locus_tag LOCUS_01660 249225 250412 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870366.1 protein_id gnl|my_center|LOCUS_01660 253873 250976 gene locus_tag LOCUS_01670 253873 250976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 254774 254565 gene locus_tag LOCUS_01680 254774 254565 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707209.1 protein_id gnl|my_center|LOCUS_01680 255100 255234 gene locus_tag LOCUS_01690 255100 255234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01690 256135 255446 gene locus_tag LOCUS_01700 256135 255446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 256926 256132 gene locus_tag LOCUS_01710 256926 256132 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530212.1 protein_id gnl|my_center|LOCUS_01710 257266 256916 gene locus_tag LOCUS_01720 257266 256916 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530211.1 protein_id gnl|my_center|LOCUS_01720 258569 257256 gene locus_tag LOCUS_01730 258569 257256 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947022.1 protein_id gnl|my_center|LOCUS_01730 259229 258570 gene locus_tag LOCUS_01740 259229 258570 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958089.1 protein_id gnl|my_center|LOCUS_01740 259453 259935 gene locus_tag LOCUS_01750 259453 259935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 259966 260190 gene locus_tag LOCUS_01760 259966 260190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 260181 261425 gene locus_tag LOCUS_01770 260181 261425 CDS product DUF3570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072166.1 protein_id gnl|my_center|LOCUS_01770 261429 262325 gene locus_tag LOCUS_01780 261429 262325 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072167.1 protein_id gnl|my_center|LOCUS_01780 262564 263331 gene locus_tag LOCUS_01790 262564 263331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 263361 264386 gene locus_tag LOCUS_01800 gene arsB 263361 264386 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 protein_id gnl|my_center|LOCUS_01800 264418 264906 gene locus_tag LOCUS_01810 264418 264906 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167492899.1 protein_id gnl|my_center|LOCUS_01810 264962 265972 gene locus_tag LOCUS_01820 264962 265972 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070877.1 protein_id gnl|my_center|LOCUS_01820 265978 267189 gene locus_tag LOCUS_01830 gene arsJ 265978 267189 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070878.1 protein_id gnl|my_center|LOCUS_01830 267719 268750 gene locus_tag LOCUS_01840 267719 268750 CDS product putative urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764738.1 protein_id gnl|my_center|LOCUS_01840 268766 269590 gene locus_tag LOCUS_01850 268766 269590 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764735.1 protein_id gnl|my_center|LOCUS_01850 269587 270369 gene locus_tag LOCUS_01860 269587 270369 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096805.1 protein_id gnl|my_center|LOCUS_01860 270366 271076 gene locus_tag LOCUS_01870 270366 271076 CDS product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206332.1 protein_id gnl|my_center|LOCUS_01870 271088 271726 gene locus_tag LOCUS_01880 271088 271726 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_01880 271904 275509 gene locus_tag LOCUS_01890 gene uca 271904 275509 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045751776.1 protein_id gnl|my_center|LOCUS_01890 275512 277299 gene locus_tag LOCUS_01900 gene atzF 275512 277299 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104918.1 protein_id gnl|my_center|LOCUS_01900 277612 277914 gene locus_tag LOCUS_01910 277612 277914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 279430 277970 gene locus_tag LOCUS_01920 279430 277970 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208000.1 protein_id gnl|my_center|LOCUS_01920 279619 280545 gene locus_tag LOCUS_01930 279619 280545 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207004.1 protein_id gnl|my_center|LOCUS_01930 281111 280737 gene locus_tag LOCUS_01940 281111 280737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 282507 281101 gene locus_tag LOCUS_01950 gene creD 282507 281101 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113266.1 protein_id gnl|my_center|LOCUS_01950 284037 282595 gene locus_tag LOCUS_01960 gene creC 284037 282595 CDS product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113267.1 protein_id gnl|my_center|LOCUS_01960 284743 284027 gene locus_tag LOCUS_01970 gene creB 284743 284027 CDS product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208148.1 protein_id gnl|my_center|LOCUS_01970 285539 284922 gene locus_tag LOCUS_01980 285539 284922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 285748 285548 gene locus_tag LOCUS_01990 285748 285548 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920812.1 protein_id gnl|my_center|LOCUS_01990 286143 285736 gene locus_tag LOCUS_02000 286143 285736 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920811.1 protein_id gnl|my_center|LOCUS_02000 286215 287126 gene locus_tag LOCUS_02010 286215 287126 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529052.1 protein_id gnl|my_center|LOCUS_02010 288107 287199 gene locus_tag LOCUS_02020 288107 287199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 288719 290230 gene locus_tag LOCUS_02030 288719 290230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 290283 292631 gene locus_tag LOCUS_02040 290283 292631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 294148 292697 gene locus_tag LOCUS_02050 294148 292697 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108601603.1 protein_id gnl|my_center|LOCUS_02050 295331 294759 gene locus_tag LOCUS_02060 295331 294759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 295680 295381 gene locus_tag LOCUS_02070 295680 295381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 296352 296903 gene locus_tag LOCUS_02080 296352 296903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 297546 297103 gene locus_tag LOCUS_02090 297546 297103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 298063 298701 gene locus_tag LOCUS_02100 298063 298701 CDS product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792797.1 protein_id gnl|my_center|LOCUS_02100 299016 299480 gene locus_tag LOCUS_02110 299016 299480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 299704 301572 gene locus_tag LOCUS_02120 299704 301572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 302569 302354 gene locus_tag LOCUS_02130 302569 302354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 304063 303431 gene locus_tag LOCUS_02140 gene cas6f 304063 303431 CDS product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478386.1 protein_id gnl|my_center|LOCUS_02140 305080 304067 gene locus_tag LOCUS_02150 gene csy3 305080 304067 CDS product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478111.1 protein_id gnl|my_center|LOCUS_02150 306989 305067 gene locus_tag LOCUS_02160 306989 305067 CDS product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478157.1 protein_id gnl|my_center|LOCUS_02160 308173 306989 gene locus_tag LOCUS_02170 308173 306989 CDS product TniQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478335.1 protein_id gnl|my_center|LOCUS_02170 311875 308744 gene locus_tag LOCUS_02180 311875 308744 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 protein_id gnl|my_center|LOCUS_02180 312967 311921 gene locus_tag LOCUS_02190 312967 311921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 314235 312967 gene locus_tag LOCUS_02200 314235 312967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 314727 314377 gene locus_tag LOCUS_02210 314727 314377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 315670 314774 gene locus_tag LOCUS_02220 315670 314774 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011235810.1 protein_id gnl|my_center|LOCUS_02220 316391 315663 gene locus_tag LOCUS_02230 316391 315663 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813919.1 protein_id gnl|my_center|LOCUS_02230 317032 316403 gene locus_tag LOCUS_02240 317032 316403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 317115 317510 gene locus_tag LOCUS_02250 gene cadR 317115 317510 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103716.1 protein_id gnl|my_center|LOCUS_02250 318009 317602 gene locus_tag LOCUS_02260 318009 317602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 318135 318341 gene locus_tag LOCUS_02270 318135 318341 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463131.1 protein_id gnl|my_center|LOCUS_02270 318927 319307 gene locus_tag LOCUS_02280 318927 319307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 319415 319912 gene locus_tag LOCUS_02290 319415 319912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 319912 321339 gene locus_tag LOCUS_02300 319912 321339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 321339 323111 gene locus_tag LOCUS_02310 321339 323111 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482717.1 protein_id gnl|my_center|LOCUS_02310 323126 326305 gene locus_tag LOCUS_02320 323126 326305 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_02320 326360 326707 gene locus_tag LOCUS_02330 326360 326707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 326726 327610 gene locus_tag LOCUS_02340 326726 327610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 327626 327985 gene locus_tag LOCUS_02350 327626 327985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 328083 328505 gene locus_tag LOCUS_02360 328083 328505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 328815 329228 gene locus_tag LOCUS_02370 gene cueR 328815 329228 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528067.1 protein_id gnl|my_center|LOCUS_02370 329330 331573 gene locus_tag LOCUS_02380 329330 331573 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958271.1 protein_id gnl|my_center|LOCUS_02380 331599 331952 gene locus_tag LOCUS_02390 331599 331952 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642310.1 protein_id gnl|my_center|LOCUS_02390 331962 332297 gene locus_tag LOCUS_02400 331962 332297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 332290 332955 gene locus_tag LOCUS_02410 332290 332955 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946775.1 protein_id gnl|my_center|LOCUS_02410 332939 333361 gene locus_tag LOCUS_02420 332939 333361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 333372 333743 gene locus_tag LOCUS_02430 333372 333743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 334029 334184 gene locus_tag LOCUS_02440 334029 334184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 334563 334327 gene locus_tag LOCUS_02450 334563 334327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 334666 335187 gene locus_tag LOCUS_02460 gene vspR 334666 335187 CDS product transcriptional regulator VspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001901324.1 protein_id gnl|my_center|LOCUS_02460 335184 336623 gene locus_tag LOCUS_02470 335184 336623 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478369.1 protein_id gnl|my_center|LOCUS_02470 339096 337372 gene locus_tag LOCUS_02480 339096 337372 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046961.1 protein_id gnl|my_center|LOCUS_02480 339536 339381 gene locus_tag LOCUS_02490 339536 339381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02490 339978 339487 gene locus_tag LOCUS_02500 339978 339487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02500 340215 343988 gene locus_tag LOCUS_02510 340215 343988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086952.1 protein_id gnl|my_center|LOCUS_02510 344174 344551 gene locus_tag LOCUS_02520 gene merR 344174 344551 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429838.1 protein_id gnl|my_center|LOCUS_02520 344608 344997 gene locus_tag LOCUS_02530 gene merC 344608 344997 CDS product organomercurial transporter MerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001340589.1 protein_id gnl|my_center|LOCUS_02530 346415 345405 gene locus_tag LOCUS_02540 346415 345405 CDS product TniB family NTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463118.1 protein_id gnl|my_center|LOCUS_02540 348225 346408 gene locus_tag LOCUS_02550 348225 346408 CDS product Mu transposase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478346.1 protein_id gnl|my_center|LOCUS_02550 348769 348209 gene locus_tag LOCUS_02560 348769 348209 CDS product TnsA endonuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478373.1 protein_id gnl|my_center|LOCUS_02560 349265 350554 gene locus_tag LOCUS_02570 gene aroA 349265 350554 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262299.1 protein_id gnl|my_center|LOCUS_02570 352844 350649 gene locus_tag LOCUS_02580 352844 350649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 355748 352914 gene locus_tag LOCUS_02590 355748 352914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 356369 355857 gene locus_tag LOCUS_02600 356369 355857 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105246.1 protein_id gnl|my_center|LOCUS_02600 356368 356931 gene locus_tag LOCUS_02610 gene ampD 356368 356931 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051592.1 protein_id gnl|my_center|LOCUS_02610 356982 357983 gene locus_tag LOCUS_02620 356982 357983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 358504 361590 gene locus_tag LOCUS_02630 358504 361590 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 protein_id gnl|my_center|LOCUS_02630 361654 368367 gene locus_tag LOCUS_02640 361654 368367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 368862 369161 gene locus_tag LOCUS_02650 368862 369161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 370046 369429 gene locus_tag LOCUS_02660 370046 369429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02660 370119 370472 gene locus_tag LOCUS_02670 370119 370472 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 protein_id gnl|my_center|LOCUS_02670 371672 370575 gene locus_tag LOCUS_02680 371672 370575 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331752.1 protein_id gnl|my_center|LOCUS_02680 373401 371908 gene locus_tag LOCUS_02690 373401 371908 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_02690 373727 375265 gene locus_tag LOCUS_02700 373727 375265 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706890.1 protein_id gnl|my_center|LOCUS_02700 375397 376335 gene locus_tag LOCUS_02710 375397 376335 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055032204.1 protein_id gnl|my_center|LOCUS_02710 376637 377377 gene locus_tag LOCUS_02720 376637 377377 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972695.1 protein_id gnl|my_center|LOCUS_02720 378313 377570 gene locus_tag LOCUS_02730 378313 377570 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918870.1 protein_id gnl|my_center|LOCUS_02730 378719 380968 gene locus_tag LOCUS_02740 378719 380968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 380984 383206 gene locus_tag LOCUS_02750 380984 383206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 383367 384293 gene locus_tag LOCUS_02760 383367 384293 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267733.1 protein_id gnl|my_center|LOCUS_02760 384312 384932 gene locus_tag LOCUS_02770 384312 384932 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266838.1 protein_id gnl|my_center|LOCUS_02770 385017 385790 gene locus_tag LOCUS_02780 gene tpiA 385017 385790 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071430.1 protein_id gnl|my_center|LOCUS_02780 385806 386912 gene locus_tag LOCUS_02790 gene fbaA 385806 386912 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704732.1 protein_id gnl|my_center|LOCUS_02790 386914 387882 gene locus_tag LOCUS_02800 386914 387882 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073720.1 protein_id gnl|my_center|LOCUS_02800 387971 389089 gene locus_tag LOCUS_02810 387971 389089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 389457 390284 gene locus_tag LOCUS_02820 389457 390284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707800.1 protein_id gnl|my_center|LOCUS_02820 390896 392035 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tagcacaaaggtgtagtattttacttg 392425 394011 gene locus_tag LOCUS_02830 392425 394011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 394128 394442 gene locus_tag LOCUS_02840 394128 394442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 396720 394504 gene locus_tag LOCUS_02850 396720 394504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 397140 397421 gene locus_tag LOCUS_02860 397140 397421 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455023.1 protein_id gnl|my_center|LOCUS_02860 397462 398688 gene locus_tag LOCUS_02870 397462 398688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 398856 400742 gene locus_tag LOCUS_02880 398856 400742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 400930 403347 gene locus_tag LOCUS_02890 400930 403347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 403475 405205 gene locus_tag LOCUS_02900 403475 405205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 405417 408872 gene locus_tag LOCUS_02910 405417 408872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 409172 410839 gene locus_tag LOCUS_02920 409172 410839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 412343 410922 gene locus_tag LOCUS_02930 412343 410922 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295834.1 protein_id gnl|my_center|LOCUS_02930 413576 412677 gene locus_tag LOCUS_02940 413576 412677 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974693.1 protein_id gnl|my_center|LOCUS_02940 414341 413679 gene locus_tag LOCUS_02950 414341 413679 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_02950 414770 417625 gene locus_tag LOCUS_02960 414770 417625 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039035.1 protein_id gnl|my_center|LOCUS_02960 417768 419354 gene locus_tag LOCUS_02970 417768 419354 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073349.1 protein_id gnl|my_center|LOCUS_02970 421036 419438 gene locus_tag LOCUS_02980 421036 419438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 423360 421729 gene locus_tag LOCUS_02990 423360 421729 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123644.1 protein_id gnl|my_center|LOCUS_02990 423627 425153 gene locus_tag LOCUS_03000 423627 425153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 425270 427639 gene locus_tag LOCUS_03010 425270 427639 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033404426.1 protein_id gnl|my_center|LOCUS_03010 427877 428752 gene locus_tag LOCUS_03020 427877 428752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 429614 430549 gene locus_tag LOCUS_03030 429614 430549 CDS product reverse transcriptase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112701.1 protein_id gnl|my_center|LOCUS_03030 430551 431945 gene locus_tag LOCUS_03040 430551 431945 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112700.1 protein_id gnl|my_center|LOCUS_03040 432485 434092 gene locus_tag LOCUS_03050 432485 434092 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105048.1 protein_id gnl|my_center|LOCUS_03050 438061 434393 gene locus_tag LOCUS_03060 438061 434393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 438522 438058 gene locus_tag LOCUS_03070 438522 438058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 438946 439833 gene locus_tag LOCUS_03080 438946 439833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 441005 439968 gene locus_tag LOCUS_03090 441005 439968 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922558.1 protein_id gnl|my_center|LOCUS_03090 441661 441011 gene locus_tag LOCUS_03100 441661 441011 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906064.1 protein_id gnl|my_center|LOCUS_03100 442996 441662 gene locus_tag LOCUS_03110 442996 441662 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769658.1 protein_id gnl|my_center|LOCUS_03110 444195 443041 gene locus_tag LOCUS_03120 gene dgoD 444195 443041 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_03120 444413 446683 gene locus_tag LOCUS_03130 444413 446683 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033404426.1 protein_id gnl|my_center|LOCUS_03130 446915 447472 gene locus_tag LOCUS_03140 446915 447472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 448868 447834 gene locus_tag LOCUS_03150 448868 447834 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262762.1 protein_id gnl|my_center|LOCUS_03150 449549 449154 gene locus_tag LOCUS_03160 449549 449154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 450486 449983 gene locus_tag LOCUS_03170 450486 449983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 450733 451962 gene locus_tag LOCUS_03180 450733 451962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 454391 452076 gene locus_tag LOCUS_03190 454391 452076 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684941.1 protein_id gnl|my_center|LOCUS_03190 454624 455214 gene locus_tag LOCUS_03200 454624 455214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 456473 455268 gene locus_tag LOCUS_03210 456473 455268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 456720 460538 gene locus_tag LOCUS_03220 gene putA 456720 460538 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946659.1 protein_id gnl|my_center|LOCUS_03220 460653 461585 gene locus_tag LOCUS_03230 gene metA 460653 461585 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122786.1 protein_id gnl|my_center|LOCUS_03230 461745 465443 gene locus_tag LOCUS_03240 gene metH 461745 465443 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453805.1 protein_id gnl|my_center|LOCUS_03240 465656 466462 gene locus_tag LOCUS_03250 gene hag 465656 466462 CDS product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166847803.1 protein_id gnl|my_center|LOCUS_03250 466554 467663 gene locus_tag LOCUS_03260 466554 467663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 468809 467697 gene locus_tag LOCUS_03270 468809 467697 CDS product DUF3083 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072833.1 protein_id gnl|my_center|LOCUS_03270 469432 469016 gene locus_tag LOCUS_03280 469432 469016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 471408 469774 gene locus_tag LOCUS_03290 471408 469774 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707374.1 protein_id gnl|my_center|LOCUS_03290 472037 473101 gene locus_tag LOCUS_03300 gene queA 472037 473101 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705623.1 protein_id gnl|my_center|LOCUS_03300 473115 474245 gene locus_tag LOCUS_03310 gene tgt 473115 474245 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634306.1 protein_id gnl|my_center|LOCUS_03310 474283 474618 gene locus_tag LOCUS_03320 gene yajC 474283 474618 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460204.1 protein_id gnl|my_center|LOCUS_03320 474648 476501 gene locus_tag LOCUS_03330 gene secD 474648 476501 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482962.1 protein_id gnl|my_center|LOCUS_03330 476514 477449 gene locus_tag LOCUS_03340 gene secF 476514 477449 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486403.1 protein_id gnl|my_center|LOCUS_03340 478014 477733 gene locus_tag LOCUS_03350 478014 477733 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087375.1 protein_id gnl|my_center|LOCUS_03350 478252 479562 gene locus_tag LOCUS_03360 gene fadI 478252 479562 CDS product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706012.1 protein_id gnl|my_center|LOCUS_03360 479562 481718 gene locus_tag LOCUS_03370 gene fadJ 479562 481718 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706013.1 protein_id gnl|my_center|LOCUS_03370 481891 483495 gene locus_tag LOCUS_03380 481891 483495 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704658.1 protein_id gnl|my_center|LOCUS_03380 483512 483850 gene locus_tag LOCUS_03390 gene glnB 483512 483850 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717795.1 protein_id gnl|my_center|LOCUS_03390 483875 484255 gene locus_tag LOCUS_03400 483875 484255 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705627.1 protein_id gnl|my_center|LOCUS_03400 485195 484395 gene locus_tag LOCUS_03410 gene tpiA 485195 484395 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121241.1 protein_id gnl|my_center|LOCUS_03410 486900 485455 gene locus_tag LOCUS_03420 486900 485455 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073366.1 protein_id gnl|my_center|LOCUS_03420 487334 488542 gene locus_tag LOCUS_03430 487334 488542 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767206.1 protein_id gnl|my_center|LOCUS_03430 488969 490093 gene locus_tag LOCUS_03440 488969 490093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 491646 490333 gene locus_tag LOCUS_03450 491646 490333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 492116 495085 gene locus_tag LOCUS_03460 492116 495085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 495100 495630 gene locus_tag LOCUS_03470 495100 495630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 497464 495758 gene locus_tag LOCUS_03480 497464 495758 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050547433.1 protein_id gnl|my_center|LOCUS_03480 497682 499262 gene locus_tag LOCUS_03490 497682 499262 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_03490 500275 499259 gene locus_tag LOCUS_03500 500275 499259 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530819.1 protein_id gnl|my_center|LOCUS_03500 500621 502468 gene locus_tag LOCUS_03510 500621 502468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 502736 504214 gene locus_tag LOCUS_03520 502736 504214 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039202.1 protein_id gnl|my_center|LOCUS_03520 505285 504359 gene locus_tag LOCUS_03530 505285 504359 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_03530 506528 505635 gene locus_tag LOCUS_03540 506528 505635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 506704 508776 gene locus_tag LOCUS_03550 506704 508776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 509453 513166 gene locus_tag LOCUS_03560 509453 513166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 513185 515491 gene locus_tag LOCUS_03570 513185 515491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 515594 517405 gene locus_tag LOCUS_03580 515594 517405 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_03580 517851 519848 gene locus_tag LOCUS_03590 517851 519848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 521533 520598 gene locus_tag LOCUS_03600 521533 520598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 523989 521704 gene locus_tag LOCUS_03610 523989 521704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 526361 523995 gene locus_tag LOCUS_03620 526361 523995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 526986 526405 gene locus_tag LOCUS_03630 526986 526405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 527265 529841 gene locus_tag LOCUS_03640 527265 529841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 530070 531086 gene locus_tag LOCUS_03650 530070 531086 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201011.1 protein_id gnl|my_center|LOCUS_03650 531103 532122 gene locus_tag LOCUS_03660 gene galR 531103 532122 CDS product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816990.1 protein_id gnl|my_center|LOCUS_03660 532855 538305 gene locus_tag LOCUS_03670 532855 538305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 538324 538893 gene locus_tag LOCUS_03680 538324 538893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 541106 539118 gene locus_tag LOCUS_03690 541106 539118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 541915 546315 gene locus_tag LOCUS_03700 541915 546315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 546515 547003 gene locus_tag LOCUS_03710 546515 547003 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788990.1 protein_id gnl|my_center|LOCUS_03710 547019 547663 gene locus_tag LOCUS_03720 547019 547663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 549040 548213 gene locus_tag LOCUS_03730 549040 548213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 549606 549238 gene locus_tag LOCUS_03740 549606 549238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 550865 551764 gene locus_tag LOCUS_03750 550865 551764 CDS product IS982-like element ISSod20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071273.1 protein_id gnl|my_center|LOCUS_03750 553260 551803 gene locus_tag LOCUS_03760 553260 551803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 554576 553320 gene locus_tag LOCUS_03770 554576 553320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 554822 556237 gene locus_tag LOCUS_03780 554822 556237 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922160.1 protein_id gnl|my_center|LOCUS_03780 556314 558545 gene locus_tag LOCUS_03790 556314 558545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 558753 559829 gene locus_tag LOCUS_03800 558753 559829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 560019 562025 gene locus_tag LOCUS_03810 560019 562025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 564532 562142 gene locus_tag LOCUS_03820 564532 562142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 565159 564935 gene locus_tag LOCUS_03830 565159 564935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 565329 566216 gene locus_tag LOCUS_03840 565329 566216 CDS product aspartoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124406.1 protein_id gnl|my_center|LOCUS_03840 566904 566248 gene locus_tag LOCUS_03850 566904 566248 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073014.1 protein_id gnl|my_center|LOCUS_03850 567823 567065 gene locus_tag LOCUS_03860 567823 567065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 567995 568714 gene locus_tag LOCUS_03870 gene pdsR 567995 568714 CDS product proteobacterial dedicated sortase system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 protein_id gnl|my_center|LOCUS_03870 568771 570858 gene locus_tag LOCUS_03880 gene pdsS 568771 570858 CDS product proteobacterial dedicated sortase system histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072224.1 protein_id gnl|my_center|LOCUS_03880 570940 573333 gene locus_tag LOCUS_03890 570940 573333 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071453.1 protein_id gnl|my_center|LOCUS_03890 574884 573427 gene locus_tag LOCUS_03900 574884 573427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 576309 575104 gene locus_tag LOCUS_03910 576309 575104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 576579 576893 gene locus_tag LOCUS_03920 gene rhaM 576579 576893 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391995.1 protein_id gnl|my_center|LOCUS_03920 577431 578846 gene locus_tag LOCUS_03930 577431 578846 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664224.1 protein_id gnl|my_center|LOCUS_03930 579078 580313 gene locus_tag LOCUS_03940 579078 580313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 580332 583112 gene locus_tag LOCUS_03950 580332 583112 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_03950 583532 584410 gene locus_tag LOCUS_03960 583532 584410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 585296 584514 gene locus_tag LOCUS_03970 585296 584514 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973082.1 protein_id gnl|my_center|LOCUS_03970 585912 585724 gene locus_tag LOCUS_03980 585912 585724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 585815 586810 gene locus_tag LOCUS_03990 585815 586810 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_03990 586813 587298 gene locus_tag LOCUS_04000 586813 587298 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577041.1 protein_id gnl|my_center|LOCUS_04000 587329 588621 gene locus_tag LOCUS_04010 587329 588621 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345269.1 protein_id gnl|my_center|LOCUS_04010 588863 589636 gene locus_tag LOCUS_04020 gene kduD 588863 589636 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919366.1 protein_id gnl|my_center|LOCUS_04020 589746 590576 gene locus_tag LOCUS_04030 gene kduI 589746 590576 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010741491.1 protein_id gnl|my_center|LOCUS_04030 591014 593206 gene locus_tag LOCUS_04040 591014 593206 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258146.1 protein_id gnl|my_center|LOCUS_04040 593330 594589 gene locus_tag LOCUS_04050 gene rhaA 593330 594589 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602491.1 protein_id gnl|my_center|LOCUS_04050 594882 596591 gene locus_tag LOCUS_04060 594882 596591 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118830.1 protein_id gnl|my_center|LOCUS_04060 596673 597452 gene locus_tag LOCUS_04070 596673 597452 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706380.1 protein_id gnl|my_center|LOCUS_04070 597454 598914 gene locus_tag LOCUS_04080 597454 598914 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706379.1 protein_id gnl|my_center|LOCUS_04080 598924 599631 gene locus_tag LOCUS_04090 598924 599631 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389165.1 protein_id gnl|my_center|LOCUS_04090 599651 601051 gene locus_tag LOCUS_04100 599651 601051 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973088.1 protein_id gnl|my_center|LOCUS_04100 601980 601123 gene locus_tag LOCUS_04110 601980 601123 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704173.1 protein_id gnl|my_center|LOCUS_04110 603076 602171 gene locus_tag LOCUS_04120 603076 602171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 604521 604117 gene locus_tag LOCUS_04130 604521 604117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 606319 604514 gene locus_tag LOCUS_04140 606319 604514 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491831.1 protein_id gnl|my_center|LOCUS_04140 607968 606316 gene locus_tag LOCUS_04150 607968 606316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124433836.1 protein_id gnl|my_center|LOCUS_04150 609109 607976 gene locus_tag LOCUS_04160 609109 607976 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226992642.1 protein_id gnl|my_center|LOCUS_04160 609971 609315 gene locus_tag LOCUS_04170 609971 609315 CDS product Qnr family pentapeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261921.1 protein_id gnl|my_center|LOCUS_04170 611263 611517 gene locus_tag LOCUS_04180 611263 611517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 611507 611791 gene locus_tag LOCUS_04190 611507 611791 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221352.1 protein_id gnl|my_center|LOCUS_04190 612117 612314 gene locus_tag LOCUS_04200 612117 612314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 612332 613765 gene locus_tag LOCUS_04210 612332 613765 CDS product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560455.1 protein_id gnl|my_center|LOCUS_04210 613776 614798 gene locus_tag LOCUS_04220 613776 614798 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680669.1 protein_id gnl|my_center|LOCUS_04220 614795 615184 gene locus_tag LOCUS_04230 614795 615184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 615197 615409 gene locus_tag LOCUS_04240 615197 615409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 615491 615745 gene locus_tag LOCUS_04250 615491 615745 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009890.1 protein_id gnl|my_center|LOCUS_04250 615943 616914 gene locus_tag LOCUS_04260 615943 616914 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_04260 616915 618582 gene locus_tag LOCUS_04270 616915 618582 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_04270 618572 619999 gene locus_tag LOCUS_04280 618572 619999 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694527.1 protein_id gnl|my_center|LOCUS_04280 619999 621054 gene locus_tag LOCUS_04290 619999 621054 CDS product DUF4917 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119745.1 protein_id gnl|my_center|LOCUS_04290 621236 626197 gene locus_tag LOCUS_04300 621236 626197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 626203 627588 gene locus_tag LOCUS_04310 626203 627588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 627739 628713 gene locus_tag LOCUS_04320 gene rhuM 627739 628713 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_04320 628718 632014 gene locus_tag LOCUS_04330 628718 632014 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_04330 632023 632283 gene locus_tag LOCUS_04340 632023 632283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04340 632723 633265 gene locus_tag LOCUS_04350 632723 633265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 633345 633815 gene locus_tag LOCUS_04360 633345 633815 CDS product DUF6194 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434115.1 protein_id gnl|my_center|LOCUS_04360 634144 635424 gene locus_tag LOCUS_04370 634144 635424 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071339.1 protein_id gnl|my_center|LOCUS_04370 635437 636714 gene locus_tag LOCUS_04380 635437 636714 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071339.1 protein_id gnl|my_center|LOCUS_04380 638614 636818 gene locus_tag LOCUS_04390 638614 636818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 638568 638771 gene locus_tag LOCUS_04400 638568 638771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 640537 638903 gene locus_tag LOCUS_04410 640537 638903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 640830 640582 gene locus_tag LOCUS_04420 640830 640582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 642892 640991 gene locus_tag LOCUS_04430 642892 640991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 643452 642889 gene locus_tag LOCUS_04440 643452 642889 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119049.1 protein_id gnl|my_center|LOCUS_04440 646173 643834 gene locus_tag LOCUS_04450 646173 643834 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033404426.1 protein_id gnl|my_center|LOCUS_04450 647626 646820 gene locus_tag LOCUS_04460 647626 646820 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071542.1 protein_id gnl|my_center|LOCUS_04460 647870 648850 gene locus_tag LOCUS_04470 647870 648850 CDS product DUF1852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457949.1 protein_id gnl|my_center|LOCUS_04470 648936 649982 gene locus_tag LOCUS_04480 648936 649982 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735359.1 protein_id gnl|my_center|LOCUS_04480 650234 650524 gene locus_tag LOCUS_04490 650234 650524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 651997 650651 gene locus_tag LOCUS_04500 651997 650651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 654704 652302 gene locus_tag LOCUS_04510 654704 652302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 657048 655162 gene locus_tag LOCUS_04520 657048 655162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 657465 657842 gene locus_tag LOCUS_04530 657465 657842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 658014 658310 gene locus_tag LOCUS_04540 658014 658310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 658320 658913 gene locus_tag LOCUS_04550 658320 658913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 658969 659658 gene locus_tag LOCUS_04560 658969 659658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 659652 659900 gene locus_tag LOCUS_04570 659652 659900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 661775 660666 gene locus_tag LOCUS_04580 661775 660666 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 protein_id gnl|my_center|LOCUS_04580 661982 663457 gene locus_tag LOCUS_04590 661982 663457 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 protein_id gnl|my_center|LOCUS_04590 663447 664025 gene locus_tag LOCUS_04600 663447 664025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 664032 666026 gene locus_tag LOCUS_04610 664032 666026 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074381.1 protein_id gnl|my_center|LOCUS_04610 667185 666115 gene locus_tag LOCUS_04620 667185 666115 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303290.1 protein_id gnl|my_center|LOCUS_04620 667482 668780 gene locus_tag LOCUS_04630 667482 668780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 668795 670492 gene locus_tag LOCUS_04640 668795 670492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 670479 671714 gene locus_tag LOCUS_04650 670479 671714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 671708 673993 gene locus_tag LOCUS_04660 671708 673993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 673998 674552 gene locus_tag LOCUS_04670 673998 674552 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931266.1 protein_id gnl|my_center|LOCUS_04670 674552 676111 gene locus_tag LOCUS_04680 674552 676111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 676238 676831 gene locus_tag LOCUS_04690 676238 676831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 676848 677213 gene locus_tag LOCUS_04700 676848 677213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 677457 678029 gene locus_tag LOCUS_04710 677457 678029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 680474 678192 gene locus_tag LOCUS_04720 680474 678192 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033404426.1 protein_id gnl|my_center|LOCUS_04720 681425 680664 gene locus_tag LOCUS_04730 681425 680664 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_04730 682568 681426 gene locus_tag LOCUS_04740 682568 681426 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263562.1 protein_id gnl|my_center|LOCUS_04740 682869 686156 gene locus_tag LOCUS_04750 682869 686156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 686462 688426 gene locus_tag LOCUS_04760 686462 688426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 691559 688548 gene locus_tag LOCUS_04770 691559 688548 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640062.1 protein_id gnl|my_center|LOCUS_04770 694137 691789 gene locus_tag LOCUS_04780 694137 691789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 694617 695261 gene locus_tag LOCUS_04790 694617 695261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 695281 699165 gene locus_tag LOCUS_04800 695281 699165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 700789 699398 gene locus_tag LOCUS_04810 700789 699398 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_04810 701466 700786 gene locus_tag LOCUS_04820 701466 700786 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815117.1 protein_id gnl|my_center|LOCUS_04820 701676 704813 gene locus_tag LOCUS_04830 701676 704813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 705894 705163 gene locus_tag LOCUS_04840 705894 705163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 706793 706269 gene locus_tag LOCUS_04850 706793 706269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 707108 708160 gene locus_tag LOCUS_04860 707108 708160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 708571 708495 gene locus_tag LOCUS_t00020 708571 708495 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 710175 708652 gene locus_tag LOCUS_04870 710175 708652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 710397 710182 gene locus_tag LOCUS_04880 710397 710182 CDS product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072212.1 protein_id gnl|my_center|LOCUS_04880 710611 711600 gene locus_tag LOCUS_04890 gene yejK 710611 711600 CDS product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419943.1 protein_id gnl|my_center|LOCUS_04890 711635 712777 gene locus_tag LOCUS_04900 gene rnd 711635 712777 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169218.1 protein_id gnl|my_center|LOCUS_04900 714042 713164 gene locus_tag LOCUS_04910 714042 713164 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256476.1 protein_id gnl|my_center|LOCUS_04910 715313 714093 gene locus_tag LOCUS_04920 715313 714093 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919017.1 protein_id gnl|my_center|LOCUS_04920 717799 715388 gene locus_tag LOCUS_04930 717799 715388 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919020.1 protein_id gnl|my_center|LOCUS_04930 719818 718343 gene locus_tag LOCUS_04940 gene gtfA 719818 718343 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974901.1 protein_id gnl|my_center|LOCUS_04940 721106 720042 gene locus_tag LOCUS_04950 721106 720042 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208596183.1 protein_id gnl|my_center|LOCUS_04950 721447 721965 gene locus_tag LOCUS_04960 721447 721965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 723305 721974 gene locus_tag LOCUS_04970 723305 721974 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418379.1 protein_id gnl|my_center|LOCUS_04970 724285 723305 gene locus_tag LOCUS_04980 724285 723305 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010219554.1 protein_id gnl|my_center|LOCUS_04980 725508 724282 gene locus_tag LOCUS_04990 725508 724282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 727060 725498 gene locus_tag LOCUS_05000 727060 725498 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768668.1 protein_id gnl|my_center|LOCUS_05000 727991 727050 gene locus_tag LOCUS_05010 727991 727050 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268793.1 protein_id gnl|my_center|LOCUS_05010 728677 727988 gene locus_tag LOCUS_05020 728677 727988 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123273.1 protein_id gnl|my_center|LOCUS_05020 728846 729193 gene locus_tag LOCUS_05030 728846 729193 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262907.1 protein_id gnl|my_center|LOCUS_05030 729308 730234 gene locus_tag LOCUS_05040 729308 730234 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728485.1 protein_id gnl|my_center|LOCUS_05040 730488 734243 gene locus_tag LOCUS_05050 730488 734243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 >Feature sequence02 1166 2980 gene locus_tag LOCUS_05060 1166 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 3311 3030 gene locus_tag LOCUS_05070 3311 3030 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816960.1 protein_id gnl|my_center|LOCUS_05070 3568 4572 gene locus_tag LOCUS_05080 3568 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 4961 4569 gene locus_tag LOCUS_05090 4961 4569 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933794.1 protein_id gnl|my_center|LOCUS_05090 5184 7412 gene locus_tag LOCUS_05100 5184 7412 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262307.1 protein_id gnl|my_center|LOCUS_05100 7575 7796 gene locus_tag LOCUS_05110 7575 7796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 8781 7774 gene locus_tag LOCUS_05120 8781 7774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 10607 8790 gene locus_tag LOCUS_05130 10607 8790 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_05130 11348 10620 gene locus_tag LOCUS_05140 11348 10620 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_05140 12283 11348 gene locus_tag LOCUS_05150 12283 11348 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_05150 13417 12452 gene locus_tag LOCUS_05160 13417 12452 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 protein_id gnl|my_center|LOCUS_05160 14037 13417 gene locus_tag LOCUS_05170 14037 13417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05170 14427 14062 gene locus_tag LOCUS_05180 14427 14062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05180 14777 15676 gene locus_tag LOCUS_05190 14777 15676 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970872.1 protein_id gnl|my_center|LOCUS_05190 15685 16422 gene locus_tag LOCUS_05200 15685 16422 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970873.1 protein_id gnl|my_center|LOCUS_05200 16494 17354 gene locus_tag LOCUS_05210 16494 17354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 18335 17403 gene locus_tag LOCUS_05220 18335 17403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 19956 18340 gene locus_tag LOCUS_05230 19956 18340 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818860.1 protein_id gnl|my_center|LOCUS_05230 20029 21255 gene locus_tag LOCUS_05240 20029 21255 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071509.1 protein_id gnl|my_center|LOCUS_05240 21669 22868 gene locus_tag LOCUS_05250 21669 22868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 22880 23278 gene locus_tag LOCUS_05260 22880 23278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 23330 23566 gene locus_tag LOCUS_05270 23330 23566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 23566 23976 gene locus_tag LOCUS_05280 23566 23976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 23997 24980 gene locus_tag LOCUS_05290 23997 24980 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071169.1 protein_id gnl|my_center|LOCUS_05290 26150 25077 gene locus_tag LOCUS_05300 26150 25077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945895.1 protein_id gnl|my_center|LOCUS_05300 26312 27148 gene locus_tag LOCUS_05310 26312 27148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 27220 32136 gene locus_tag LOCUS_05320 27220 32136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 32529 33410 gene locus_tag LOCUS_05330 gene panE 32529 33410 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482324.1 protein_id gnl|my_center|LOCUS_05330 34839 33382 gene locus_tag LOCUS_05340 gene thiI 34839 33382 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261436.1 protein_id gnl|my_center|LOCUS_05340 35918 34992 gene locus_tag LOCUS_05350 35918 34992 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071708.1 protein_id gnl|my_center|LOCUS_05350 36686 35928 gene locus_tag LOCUS_05360 gene pomA 36686 35928 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418107.1 protein_id gnl|my_center|LOCUS_05360 37084 37329 gene locus_tag LOCUS_05370 gene xseB 37084 37329 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483079.1 protein_id gnl|my_center|LOCUS_05370 37330 38214 gene locus_tag LOCUS_05380 gene ispA 37330 38214 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012533019.1 protein_id gnl|my_center|LOCUS_05380 38222 40090 gene locus_tag LOCUS_05390 gene dxs 38222 40090 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483016.1 protein_id gnl|my_center|LOCUS_05390 41910 40285 gene locus_tag LOCUS_05400 41910 40285 CDS product alpha glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072238.1 protein_id gnl|my_center|LOCUS_05400 42320 43792 gene locus_tag LOCUS_05410 42320 43792 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072433.1 protein_id gnl|my_center|LOCUS_05410 43817 45496 gene locus_tag LOCUS_05420 43817 45496 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994018.1 protein_id gnl|my_center|LOCUS_05420 46547 45519 gene locus_tag LOCUS_05430 46547 45519 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072259.1 protein_id gnl|my_center|LOCUS_05430 47345 46707 gene locus_tag LOCUS_05440 gene kdgA 47345 46707 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800516.1 protein_id gnl|my_center|LOCUS_05440 48302 47358 gene locus_tag LOCUS_05450 gene glk 48302 47358 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815870.1 protein_id gnl|my_center|LOCUS_05450 50131 48302 gene locus_tag LOCUS_05460 gene edd 50131 48302 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069450.1 protein_id gnl|my_center|LOCUS_05460 50839 50153 gene locus_tag LOCUS_05470 gene pgl 50839 50153 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 protein_id gnl|my_center|LOCUS_05470 52313 50850 gene locus_tag LOCUS_05480 gene zwf 52313 50850 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072454.1 protein_id gnl|my_center|LOCUS_05480 52614 53471 gene locus_tag LOCUS_05490 52614 53471 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298732.1 protein_id gnl|my_center|LOCUS_05490 53574 55010 gene locus_tag LOCUS_05500 gene pyk 53574 55010 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705256.1 protein_id gnl|my_center|LOCUS_05500 56272 55088 gene locus_tag LOCUS_05510 56272 55088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 57175 56423 gene locus_tag LOCUS_05520 57175 56423 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262415.1 protein_id gnl|my_center|LOCUS_05520 57258 58022 gene locus_tag LOCUS_05530 gene gloB 57258 58022 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262416.1 protein_id gnl|my_center|LOCUS_05530 58091 59704 gene locus_tag LOCUS_05540 58091 59704 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262417.1 protein_id gnl|my_center|LOCUS_05540 60987 59776 gene locus_tag LOCUS_05550 60987 59776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 61801 60980 gene locus_tag LOCUS_05560 gene natA 61801 60980 CDS product sodium ABC transporter ATP-binding protein NatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234757.1 protein_id gnl|my_center|LOCUS_05560 61871 62557 gene locus_tag LOCUS_05570 61871 62557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 63474 62677 gene locus_tag LOCUS_05580 63474 62677 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477606.1 protein_id gnl|my_center|LOCUS_05580 64745 63501 gene locus_tag LOCUS_05590 64745 63501 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458682.1 protein_id gnl|my_center|LOCUS_05590 65061 65555 gene locus_tag LOCUS_05600 gene purE 65061 65555 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073383.1 protein_id gnl|my_center|LOCUS_05600 65555 66643 gene locus_tag LOCUS_05610 gene purK 65555 66643 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073384.1 protein_id gnl|my_center|LOCUS_05610 66823 67221 gene locus_tag LOCUS_05620 gene yciA 66823 67221 CDS product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299258.1 protein_id gnl|my_center|LOCUS_05620 69325 67286 gene locus_tag LOCUS_05630 69325 67286 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261900.1 protein_id gnl|my_center|LOCUS_05630 69528 70460 gene locus_tag LOCUS_05640 69528 70460 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072338.1 protein_id gnl|my_center|LOCUS_05640 70828 70457 gene locus_tag LOCUS_05650 70828 70457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 70830 71846 gene locus_tag LOCUS_05660 70830 71846 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263836.1 protein_id gnl|my_center|LOCUS_05660 73424 71868 gene locus_tag LOCUS_05670 73424 71868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 74990 73476 gene locus_tag LOCUS_05680 74990 73476 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263833.1 protein_id gnl|my_center|LOCUS_05680 75731 75003 gene locus_tag LOCUS_05690 75731 75003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 77860 75728 gene locus_tag LOCUS_05700 77860 75728 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263831.1 protein_id gnl|my_center|LOCUS_05700 79043 77847 gene locus_tag LOCUS_05710 79043 77847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 79419 79084 gene locus_tag LOCUS_05720 79419 79084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 81121 79919 gene locus_tag LOCUS_05730 81121 79919 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483424.1 protein_id gnl|my_center|LOCUS_05730 82352 81162 gene locus_tag LOCUS_05740 82352 81162 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263844.1 protein_id gnl|my_center|LOCUS_05740 83980 82424 gene locus_tag LOCUS_05750 83980 82424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 84167 84715 gene locus_tag LOCUS_05760 84167 84715 CDS product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490721.1 protein_id gnl|my_center|LOCUS_05760 84741 85703 gene locus_tag LOCUS_05770 84741 85703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 86211 85711 gene locus_tag LOCUS_05780 86211 85711 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072525.1 protein_id gnl|my_center|LOCUS_05780 86875 86213 gene locus_tag LOCUS_05790 86875 86213 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162993.1 protein_id gnl|my_center|LOCUS_05790 87912 86875 gene locus_tag LOCUS_05800 87912 86875 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262256.1 protein_id gnl|my_center|LOCUS_05800 88201 87905 gene locus_tag LOCUS_05810 88201 87905 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882652.1 protein_id gnl|my_center|LOCUS_05810 88488 89216 gene locus_tag LOCUS_05820 gene minC 88488 89216 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105734.1 protein_id gnl|my_center|LOCUS_05820 89233 90042 gene locus_tag LOCUS_05830 gene minD 89233 90042 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705992.1 protein_id gnl|my_center|LOCUS_05830 90049 90312 gene locus_tag LOCUS_05840 gene minE 90049 90312 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366053.1 protein_id gnl|my_center|LOCUS_05840 90981 90625 gene locus_tag LOCUS_05850 gene raiA 90981 90625 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073262.1 protein_id gnl|my_center|LOCUS_05850 91680 91162 gene locus_tag LOCUS_05860 91680 91162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 92519 91809 gene locus_tag LOCUS_05870 gene pyrF 92519 91809 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420156.1 protein_id gnl|my_center|LOCUS_05870 93672 92521 gene locus_tag LOCUS_05880 gene lapB 93672 92521 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705693.1 protein_id gnl|my_center|LOCUS_05880 93959 93672 gene locus_tag LOCUS_05890 93959 93672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 94263 93982 gene locus_tag LOCUS_05900 gene ihfB 94263 93982 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858233.1 protein_id gnl|my_center|LOCUS_05900 96032 94353 gene locus_tag LOCUS_05910 gene rpsA 96032 94353 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140324.1 protein_id gnl|my_center|LOCUS_05910 96814 96125 gene locus_tag LOCUS_05920 gene cmk 96814 96125 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367471.1 protein_id gnl|my_center|LOCUS_05920 97925 96840 gene locus_tag LOCUS_05930 gene serC 97925 96840 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456169.1 protein_id gnl|my_center|LOCUS_05930 100530 97918 gene locus_tag LOCUS_05940 gene gyrA 100530 97918 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261823.1 protein_id gnl|my_center|LOCUS_05940 100714 101412 gene locus_tag LOCUS_05950 100714 101412 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815973.1 protein_id gnl|my_center|LOCUS_05950 101394 102080 gene locus_tag LOCUS_05960 101394 102080 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222833.1 protein_id gnl|my_center|LOCUS_05960 102490 104766 gene locus_tag LOCUS_05970 gene nrdA 102490 104766 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815972.1 protein_id gnl|my_center|LOCUS_05970 104836 105966 gene locus_tag LOCUS_05980 gene nrdB 104836 105966 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650087.1 protein_id gnl|my_center|LOCUS_05980 105978 106244 gene locus_tag LOCUS_05990 gene yfaE 105978 106244 CDS product class I ribonucleotide reductase maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082045.1 protein_id gnl|my_center|LOCUS_05990 106293 107213 gene locus_tag LOCUS_06000 gene rdgC 106293 107213 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706841.1 protein_id gnl|my_center|LOCUS_06000 107904 107404 gene locus_tag LOCUS_06010 107904 107404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 108735 108202 gene locus_tag LOCUS_06020 108735 108202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 110812 108746 gene locus_tag LOCUS_06030 110812 108746 CDS product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263020.1 protein_id gnl|my_center|LOCUS_06030 112315 111137 gene locus_tag LOCUS_06040 112315 111137 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263842.1 protein_id gnl|my_center|LOCUS_06040 113048 112308 gene locus_tag LOCUS_06050 113048 112308 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263841.1 protein_id gnl|my_center|LOCUS_06050 114439 113045 gene locus_tag LOCUS_06060 114439 113045 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483419.1 protein_id gnl|my_center|LOCUS_06060 115860 114451 gene locus_tag LOCUS_06070 115860 114451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 117026 115857 gene locus_tag LOCUS_06080 117026 115857 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142460.1 protein_id gnl|my_center|LOCUS_06080 117327 118265 gene locus_tag LOCUS_06090 117327 118265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 118270 118683 gene locus_tag LOCUS_06100 118270 118683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 118693 119997 gene locus_tag LOCUS_06110 118693 119997 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177846.1 protein_id gnl|my_center|LOCUS_06110 120005 121504 gene locus_tag LOCUS_06120 120005 121504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 124242 121810 gene locus_tag LOCUS_06130 124242 121810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 126049 124535 gene locus_tag LOCUS_06140 126049 124535 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944465.1 protein_id gnl|my_center|LOCUS_06140 126225 127601 gene locus_tag LOCUS_06150 gene pabB 126225 127601 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483132.1 protein_id gnl|my_center|LOCUS_06150 127621 128208 gene locus_tag LOCUS_06160 127621 128208 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706269.1 protein_id gnl|my_center|LOCUS_06160 129168 128194 gene locus_tag LOCUS_06170 gene cysB 129168 128194 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634254.1 protein_id gnl|my_center|LOCUS_06170 129419 131014 gene locus_tag LOCUS_06180 129419 131014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 131019 131708 gene locus_tag LOCUS_06190 131019 131708 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771596.1 protein_id gnl|my_center|LOCUS_06190 131834 132601 gene locus_tag LOCUS_06200 131834 132601 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705685.1 protein_id gnl|my_center|LOCUS_06200 133795 132659 gene locus_tag LOCUS_06210 133795 132659 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816139.1 protein_id gnl|my_center|LOCUS_06210 134861 133803 gene locus_tag LOCUS_06220 134861 133803 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071117.1 protein_id gnl|my_center|LOCUS_06220 135257 134871 gene locus_tag LOCUS_06230 135257 134871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 136011 135265 gene locus_tag LOCUS_06240 136011 135265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 136415 136029 gene locus_tag LOCUS_06250 136415 136029 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263155.1 protein_id gnl|my_center|LOCUS_06250 137120 136425 gene locus_tag LOCUS_06260 gene tsaB 137120 136425 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211184.1 protein_id gnl|my_center|LOCUS_06260 139050 137128 gene locus_tag LOCUS_06270 139050 137128 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262264.1 protein_id gnl|my_center|LOCUS_06270 139431 139162 gene locus_tag LOCUS_06280 139431 139162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 139756 139535 gene locus_tag LOCUS_06290 139756 139535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 139847 140518 gene locus_tag LOCUS_06300 139847 140518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 140543 142018 gene locus_tag LOCUS_06310 140543 142018 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072785.1 protein_id gnl|my_center|LOCUS_06310 142021 142377 gene locus_tag LOCUS_06320 gene arsC 142021 142377 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123113.1 protein_id gnl|my_center|LOCUS_06320 142370 142948 gene locus_tag LOCUS_06330 gene wrbA 142370 142948 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193704.1 protein_id gnl|my_center|LOCUS_06330 142948 143358 gene locus_tag LOCUS_06340 142948 143358 CDS product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705569.1 protein_id gnl|my_center|LOCUS_06340 143351 144034 gene locus_tag LOCUS_06350 143351 144034 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693879.1 protein_id gnl|my_center|LOCUS_06350 144063 144578 gene locus_tag LOCUS_06360 144063 144578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 145232 144633 gene locus_tag LOCUS_06370 gene plsY 145232 144633 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188027.1 protein_id gnl|my_center|LOCUS_06370 145348 145698 gene locus_tag LOCUS_06380 gene folB 145348 145698 CDS product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465889.1 protein_id gnl|my_center|LOCUS_06380 145698 146207 gene locus_tag LOCUS_06390 gene folK 145698 146207 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071505.1 protein_id gnl|my_center|LOCUS_06390 146204 146998 gene locus_tag LOCUS_06400 146204 146998 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119813.1 protein_id gnl|my_center|LOCUS_06400 147550 147152 gene locus_tag LOCUS_06410 147550 147152 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352231.1 protein_id gnl|my_center|LOCUS_06410 148604 147621 gene locus_tag LOCUS_06420 148604 147621 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077130071.1 protein_id gnl|my_center|LOCUS_06420 149083 148634 gene locus_tag LOCUS_06430 149083 148634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 149232 150101 gene locus_tag LOCUS_06440 149232 150101 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036777.1 protein_id gnl|my_center|LOCUS_06440 152145 150202 gene locus_tag LOCUS_06450 152145 150202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 153162 152182 gene locus_tag LOCUS_06460 153162 152182 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083685838.1 protein_id gnl|my_center|LOCUS_06460 153344 154426 gene locus_tag LOCUS_06470 153344 154426 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287289.1 protein_id gnl|my_center|LOCUS_06470 154960 154496 gene locus_tag LOCUS_06480 154960 154496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 157611 155071 gene locus_tag LOCUS_06490 157611 155071 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072830.1 protein_id gnl|my_center|LOCUS_06490 158404 157598 gene locus_tag LOCUS_06500 158404 157598 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_06500 158403 159080 gene locus_tag LOCUS_06510 gene tesA 158403 159080 CDS product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208573.1 protein_id gnl|my_center|LOCUS_06510 159227 159901 gene locus_tag LOCUS_06520 159227 159901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 160425 159946 gene locus_tag LOCUS_06530 160425 159946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 163384 160409 gene locus_tag LOCUS_06540 163384 160409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 164073 163414 gene locus_tag LOCUS_06550 164073 163414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 164766 164176 gene locus_tag LOCUS_06560 164766 164176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 165355 164882 gene locus_tag LOCUS_06570 165355 164882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 166396 167586 gene locus_tag LOCUS_06580 166396 167586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 167613 168911 gene locus_tag LOCUS_06590 gene hisD 167613 168911 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261646.1 protein_id gnl|my_center|LOCUS_06590 169007 170071 gene locus_tag LOCUS_06600 gene hisC 169007 170071 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168372.1 protein_id gnl|my_center|LOCUS_06600 170073 171143 gene locus_tag LOCUS_06610 gene hisB 170073 171143 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460048.1 protein_id gnl|my_center|LOCUS_06610 171143 171760 gene locus_tag LOCUS_06620 gene hisH 171143 171760 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193249.1 protein_id gnl|my_center|LOCUS_06620 171757 172494 gene locus_tag LOCUS_06630 gene hisA 171757 172494 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261650.1 protein_id gnl|my_center|LOCUS_06630 172476 173252 gene locus_tag LOCUS_06640 gene hisF 172476 173252 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880146.1 protein_id gnl|my_center|LOCUS_06640 173246 173866 gene locus_tag LOCUS_06650 gene hisIE 173246 173866 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460001.1 protein_id gnl|my_center|LOCUS_06650 174149 174655 gene locus_tag LOCUS_06660 174149 174655 CDS product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263183.1 protein_id gnl|my_center|LOCUS_06660 177928 174815 gene locus_tag LOCUS_06670 177928 174815 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_06670 179097 177925 gene locus_tag LOCUS_06680 179097 177925 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966871.1 protein_id gnl|my_center|LOCUS_06680 180547 179099 gene locus_tag LOCUS_06690 gene cusC 180547 179099 CDS product Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074186.1 protein_id gnl|my_center|LOCUS_06690 180728 181456 gene locus_tag LOCUS_06700 gene cmoA 180728 181456 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072410.1 protein_id gnl|my_center|LOCUS_06700 181463 182422 gene locus_tag LOCUS_06710 gene cmoB 181463 182422 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365980.1 protein_id gnl|my_center|LOCUS_06710 182597 183004 gene locus_tag LOCUS_06720 182597 183004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 184374 183061 gene locus_tag LOCUS_06730 184374 183061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 184532 184717 gene locus_tag LOCUS_06740 184532 184717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 185928 184939 gene locus_tag LOCUS_06750 185928 184939 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383609.1 protein_id gnl|my_center|LOCUS_06750 186875 185925 gene locus_tag LOCUS_06760 186875 185925 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143781.1 protein_id gnl|my_center|LOCUS_06760 187387 186875 gene locus_tag LOCUS_06770 gene rfbC 187387 186875 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_06770 188385 187387 gene locus_tag LOCUS_06780 188385 187387 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143781.1 protein_id gnl|my_center|LOCUS_06780 189471 188398 gene locus_tag LOCUS_06790 189471 188398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 190210 189488 gene locus_tag LOCUS_06800 190210 189488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 190947 190231 gene locus_tag LOCUS_06810 190947 190231 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459933.1 protein_id gnl|my_center|LOCUS_06810 192222 191020 gene locus_tag LOCUS_06820 192222 191020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 193302 192229 gene locus_tag LOCUS_06830 193302 192229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 194279 193329 gene locus_tag LOCUS_06840 194279 193329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 195334 194279 gene locus_tag LOCUS_06850 195334 194279 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257218.1 protein_id gnl|my_center|LOCUS_06850 196273 195344 gene locus_tag LOCUS_06860 196273 195344 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957741.1 protein_id gnl|my_center|LOCUS_06860 196838 196281 gene locus_tag LOCUS_06870 196838 196281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 197860 196847 gene locus_tag LOCUS_06880 197860 196847 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194087.1 protein_id gnl|my_center|LOCUS_06880 198577 197870 gene locus_tag LOCUS_06890 198577 197870 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966337.1 protein_id gnl|my_center|LOCUS_06890 199728 198562 gene locus_tag LOCUS_06900 199728 198562 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125975.1 protein_id gnl|my_center|LOCUS_06900 200523 199819 gene locus_tag LOCUS_06910 200523 199819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 201557 200550 gene locus_tag LOCUS_06920 201557 200550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 205126 201557 gene locus_tag LOCUS_06930 205126 201557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 206103 205147 gene locus_tag LOCUS_06940 206103 205147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 207269 206100 gene locus_tag LOCUS_06950 gene glf 207269 206100 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875983.1 protein_id gnl|my_center|LOCUS_06950 208237 207266 gene locus_tag LOCUS_06960 208237 207266 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306711.1 protein_id gnl|my_center|LOCUS_06960 209411 208224 gene locus_tag LOCUS_06970 209411 208224 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222164.1 protein_id gnl|my_center|LOCUS_06970 210468 209395 gene locus_tag LOCUS_06980 210468 209395 CDS product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707830.1 protein_id gnl|my_center|LOCUS_06980 212014 210455 gene locus_tag LOCUS_06990 212014 210455 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707831.1 protein_id gnl|my_center|LOCUS_06990 212786 212034 gene locus_tag LOCUS_07000 212786 212034 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284930.1 protein_id gnl|my_center|LOCUS_07000 213153 212914 gene locus_tag LOCUS_07010 213153 212914 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707833.1 protein_id gnl|my_center|LOCUS_07010 213706 213155 gene locus_tag LOCUS_07020 213706 213155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 214874 213711 gene locus_tag LOCUS_07030 gene pseG 214874 213711 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986989.1 protein_id gnl|my_center|LOCUS_07030 216029 214968 gene locus_tag LOCUS_07040 gene pseI 216029 214968 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965486.1 protein_id gnl|my_center|LOCUS_07040 217109 216135 gene locus_tag LOCUS_07050 217109 216135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 217824 217129 gene locus_tag LOCUS_07060 gene pseF 217824 217129 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097862.1 protein_id gnl|my_center|LOCUS_07060 218966 217821 gene locus_tag LOCUS_07070 gene pseC 218966 217821 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 protein_id gnl|my_center|LOCUS_07070 219961 218966 gene locus_tag LOCUS_07080 gene pseB 219961 218966 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073154.1 protein_id gnl|my_center|LOCUS_07080 220338 219991 gene locus_tag LOCUS_07090 220338 219991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 220732 220301 gene locus_tag LOCUS_07100 gene fliS 220732 220301 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082192.1 protein_id gnl|my_center|LOCUS_07100 222239 220746 gene locus_tag LOCUS_07110 gene fliD 222239 220746 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073119.1 protein_id gnl|my_center|LOCUS_07110 222704 222258 gene locus_tag LOCUS_07120 222704 222258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 223603 222779 gene locus_tag LOCUS_07130 gene flaB 223603 222779 CDS product flagellin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705589.1 protein_id gnl|my_center|LOCUS_07130 223835 224560 gene locus_tag LOCUS_07140 223835 224560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216595971.1 protein_id gnl|my_center|LOCUS_07140 224458 224477 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 225624 224797 gene locus_tag LOCUS_07150 gene flaB 225624 224797 CDS product flagellin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705589.1 protein_id gnl|my_center|LOCUS_07150 226902 226078 gene locus_tag LOCUS_07160 gene flaB 226902 226078 CDS product flagellin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705589.1 protein_id gnl|my_center|LOCUS_07160 229475 228651 gene locus_tag LOCUS_07170 gene flaA 229475 228651 CDS product flagellin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705588.1 protein_id gnl|my_center|LOCUS_07170 231237 230011 gene locus_tag LOCUS_07180 gene flgL 231237 230011 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706634.1 protein_id gnl|my_center|LOCUS_07180 233298 231241 gene locus_tag LOCUS_07190 233298 231241 CDS product flagellar basal body rod C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706635.1 protein_id gnl|my_center|LOCUS_07190 234314 233355 gene locus_tag LOCUS_07200 gene flgJ 234314 233355 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609502.1 protein_id gnl|my_center|LOCUS_07200 235438 234332 gene locus_tag LOCUS_07210 235438 234332 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706637.1 protein_id gnl|my_center|LOCUS_07210 236089 235448 gene locus_tag LOCUS_07220 gene flgH 236089 235448 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706638.1 protein_id gnl|my_center|LOCUS_07220 236956 236168 gene locus_tag LOCUS_07230 gene flgG 236956 236168 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073128.1 protein_id gnl|my_center|LOCUS_07230 237749 236985 gene locus_tag LOCUS_07240 gene flgF 237749 236985 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373284.1 protein_id gnl|my_center|LOCUS_07240 238465 237905 gene locus_tag LOCUS_07250 238465 237905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 238748 240142 gene locus_tag LOCUS_07260 gene dgt 238748 240142 CDS product dNTP triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003513.1 protein_id gnl|my_center|LOCUS_07260 240135 240956 gene locus_tag LOCUS_07270 240135 240956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 240949 241374 gene locus_tag LOCUS_07280 240949 241374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 242928 241498 gene locus_tag LOCUS_07290 242928 241498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 244656 243376 gene locus_tag LOCUS_07300 gene ccmI 244656 243376 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266864.1 protein_id gnl|my_center|LOCUS_07300 245164 244658 gene locus_tag LOCUS_07310 245164 244658 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705303.1 protein_id gnl|my_center|LOCUS_07310 245765 245178 gene locus_tag LOCUS_07320 245765 245178 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268401.1 protein_id gnl|my_center|LOCUS_07320 247741 245762 gene locus_tag LOCUS_07330 247741 245762 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209698.1 protein_id gnl|my_center|LOCUS_07330 248233 247745 gene locus_tag LOCUS_07340 gene ccmE 248233 247745 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262347.1 protein_id gnl|my_center|LOCUS_07340 248439 248230 gene locus_tag LOCUS_07350 248439 248230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 249240 248509 gene locus_tag LOCUS_07360 249240 248509 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457654.1 protein_id gnl|my_center|LOCUS_07360 249959 249285 gene locus_tag LOCUS_07370 gene ccmB 249959 249285 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971730.1 protein_id gnl|my_center|LOCUS_07370 250561 249962 gene locus_tag LOCUS_07380 gene ccmA 250561 249962 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895172.1 protein_id gnl|my_center|LOCUS_07380 250665 252983 gene locus_tag LOCUS_07390 250665 252983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 252980 253291 gene locus_tag LOCUS_07400 252980 253291 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073086.1 protein_id gnl|my_center|LOCUS_07400 253877 253320 gene locus_tag LOCUS_07410 253877 253320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 255687 254026 gene locus_tag LOCUS_07420 gene glnS 255687 254026 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097566.1 protein_id gnl|my_center|LOCUS_07420 255995 258133 gene locus_tag LOCUS_07430 255995 258133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 258559 258125 gene locus_tag LOCUS_07440 258559 258125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 259740 258547 gene locus_tag LOCUS_07450 259740 258547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 263077 259988 gene locus_tag LOCUS_07460 263077 259988 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_07460 264411 263077 gene locus_tag LOCUS_07470 gene vmeY 264411 263077 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477351.1 protein_id gnl|my_center|LOCUS_07470 265822 264404 gene locus_tag LOCUS_07480 265822 264404 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106233.1 protein_id gnl|my_center|LOCUS_07480 266570 268036 gene locus_tag LOCUS_07490 gene nhaD 266570 268036 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_07490 268526 268251 gene locus_tag LOCUS_07500 268526 268251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 268426 268956 gene locus_tag LOCUS_07510 268426 268956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 268953 269687 gene locus_tag LOCUS_07520 268953 269687 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082451.1 protein_id gnl|my_center|LOCUS_07520 269786 270739 gene locus_tag LOCUS_07530 gene trxB 269786 270739 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483581.1 protein_id gnl|my_center|LOCUS_07530 270915 271544 gene locus_tag LOCUS_07540 gene aat 270915 271544 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262300.1 protein_id gnl|my_center|LOCUS_07540 271534 272247 gene locus_tag LOCUS_07550 271534 272247 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705735.1 protein_id gnl|my_center|LOCUS_07550 273884 272244 gene locus_tag LOCUS_07560 273884 272244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 274533 274003 gene locus_tag LOCUS_07570 274533 274003 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700187.1 protein_id gnl|my_center|LOCUS_07570 274794 275012 gene locus_tag LOCUS_07580 gene infA 274794 275012 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005627617.1 protein_id gnl|my_center|LOCUS_07580 276681 275110 gene locus_tag LOCUS_07590 276681 275110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 277164 276934 gene locus_tag LOCUS_07600 277164 276934 CDS product DUF2835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110339.1 protein_id gnl|my_center|LOCUS_07600 279851 277224 gene locus_tag LOCUS_07610 gene pepN 279851 277224 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816045.1 protein_id gnl|my_center|LOCUS_07610 281272 279899 gene locus_tag LOCUS_07620 281272 279899 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958644.1 protein_id gnl|my_center|LOCUS_07620 283406 281364 gene locus_tag LOCUS_07630 gene prc 283406 281364 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706142.1 protein_id gnl|my_center|LOCUS_07630 284232 283531 gene locus_tag LOCUS_07640 gene proQ 284232 283531 CDS product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706143.1 protein_id gnl|my_center|LOCUS_07640 284526 284251 gene locus_tag LOCUS_07650 284526 284251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 285361 284657 gene locus_tag LOCUS_07660 285361 284657 CDS product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307333.1 protein_id gnl|my_center|LOCUS_07660 286377 285367 gene locus_tag LOCUS_07670 286377 285367 CDS product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706622.1 protein_id gnl|my_center|LOCUS_07670 286688 287740 gene locus_tag LOCUS_07680 gene purM 286688 287740 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262407.1 protein_id gnl|my_center|LOCUS_07680 287745 288395 gene locus_tag LOCUS_07690 gene purN 287745 288395 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028614.1 protein_id gnl|my_center|LOCUS_07690 288385 289131 gene locus_tag LOCUS_07700 288385 289131 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072491.1 protein_id gnl|my_center|LOCUS_07700 290284 289139 gene locus_tag LOCUS_07710 290284 289139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 291077 290322 gene locus_tag LOCUS_07720 291077 290322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 292149 291286 gene locus_tag LOCUS_07730 gene prmC 292149 291286 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481360.1 protein_id gnl|my_center|LOCUS_07730 293243 292158 gene locus_tag LOCUS_07740 gene prfA 293243 292158 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073597.1 protein_id gnl|my_center|LOCUS_07740 294523 293264 gene locus_tag LOCUS_07750 gene hemA 294523 293264 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490531.1 protein_id gnl|my_center|LOCUS_07750 294599 295195 gene locus_tag LOCUS_07760 gene lolB 294599 295195 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958471.1 protein_id gnl|my_center|LOCUS_07760 295192 296046 gene locus_tag LOCUS_07770 gene ispE 295192 296046 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711524.1 protein_id gnl|my_center|LOCUS_07770 296166 297119 gene locus_tag LOCUS_07780 296166 297119 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298464.1 protein_id gnl|my_center|LOCUS_07780 298305 297433 gene locus_tag LOCUS_07790 298305 297433 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925869.1 protein_id gnl|my_center|LOCUS_07790 299233 298286 gene locus_tag LOCUS_07800 299233 298286 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072215.1 protein_id gnl|my_center|LOCUS_07800 299984 299394 gene locus_tag LOCUS_07810 299984 299394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 301272 300082 gene locus_tag LOCUS_07820 301272 300082 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137167153.1 protein_id gnl|my_center|LOCUS_07820 301796 303769 gene locus_tag LOCUS_07830 301796 303769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 303771 304955 gene locus_tag LOCUS_07840 303771 304955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 305603 305253 gene locus_tag LOCUS_07850 305603 305253 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705537.1 protein_id gnl|my_center|LOCUS_07850 308567 305898 gene locus_tag LOCUS_07860 gene topA 308567 305898 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297122.1 protein_id gnl|my_center|LOCUS_07860 308756 309940 gene locus_tag LOCUS_07870 gene astB 308756 309940 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072652.1 protein_id gnl|my_center|LOCUS_07870 313750 309896 gene locus_tag LOCUS_07880 313750 309896 CDS product invasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072046.1 protein_id gnl|my_center|LOCUS_07880 313884 315188 gene locus_tag LOCUS_07890 313884 315188 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458380.1 protein_id gnl|my_center|LOCUS_07890 315940 315332 gene locus_tag LOCUS_07900 315940 315332 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905122.1 protein_id gnl|my_center|LOCUS_07900 316949 315978 gene locus_tag LOCUS_07910 316949 315978 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836403.1 protein_id gnl|my_center|LOCUS_07910 317905 317048 gene locus_tag LOCUS_07920 317905 317048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 319062 317917 gene locus_tag LOCUS_07930 319062 317917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 319600 320529 gene locus_tag LOCUS_07940 gene metR 319600 320529 CDS product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571234.1 protein_id gnl|my_center|LOCUS_07940 320560 321117 gene locus_tag LOCUS_07950 320560 321117 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054768.1 protein_id gnl|my_center|LOCUS_07950 321192 321632 gene locus_tag LOCUS_07960 gene ruvX 321192 321632 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706917.1 protein_id gnl|my_center|LOCUS_07960 321760 322560 gene locus_tag LOCUS_07970 321760 322560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 323570 322800 gene locus_tag LOCUS_07980 323570 322800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 324003 323533 gene locus_tag LOCUS_07990 gene flgP 324003 323533 CDS product flagellar assembly lipoprotein FlgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881911.1 protein_id gnl|my_center|LOCUS_07990 324662 324000 gene locus_tag LOCUS_08000 324662 324000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 324849 326051 gene locus_tag LOCUS_08010 324849 326051 CDS product flagellar assembly protein FlgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420415.1 protein_id gnl|my_center|LOCUS_08010 326426 326052 gene locus_tag LOCUS_08020 326426 326052 CDS product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189860.1 protein_id gnl|my_center|LOCUS_08020 326585 327688 gene locus_tag LOCUS_08030 326585 327688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 327685 330567 gene locus_tag LOCUS_08040 327685 330567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 331638 330571 gene locus_tag LOCUS_08050 gene lptG 331638 330571 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071579.1 protein_id gnl|my_center|LOCUS_08050 332747 331638 gene locus_tag LOCUS_08060 gene lptF 332747 331638 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071578.1 protein_id gnl|my_center|LOCUS_08060 333010 334521 gene locus_tag LOCUS_08070 gene pepA 333010 334521 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707422.1 protein_id gnl|my_center|LOCUS_08070 334521 334991 gene locus_tag LOCUS_08080 334521 334991 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073281.1 protein_id gnl|my_center|LOCUS_08080 335013 337862 gene locus_tag LOCUS_08090 335013 337862 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416450.1 protein_id gnl|my_center|LOCUS_08090 338282 337938 gene locus_tag LOCUS_08100 338282 337938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 340115 338289 gene locus_tag LOCUS_08110 340115 338289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 340311 340973 gene locus_tag LOCUS_08120 340311 340973 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070729.1 protein_id gnl|my_center|LOCUS_08120 341198 342022 gene locus_tag LOCUS_08130 341198 342022 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895674.1 protein_id gnl|my_center|LOCUS_08130 343386 342121 gene locus_tag LOCUS_08140 343386 342121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 343652 345193 gene locus_tag LOCUS_08150 343652 345193 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_08150 345282 346769 gene locus_tag LOCUS_08160 345282 346769 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_08160 348137 346893 gene locus_tag LOCUS_08170 gene argJ 348137 346893 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549958.1 protein_id gnl|my_center|LOCUS_08170 348193 348360 gene locus_tag LOCUS_08180 348193 348360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 350125 348368 gene locus_tag LOCUS_08190 350125 348368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 351870 350860 gene locus_tag LOCUS_08200 gene galE 351870 350860 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455290.1 protein_id gnl|my_center|LOCUS_08200 353068 351926 gene locus_tag LOCUS_08210 gene galK 353068 351926 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263235.1 protein_id gnl|my_center|LOCUS_08210 354113 353070 gene locus_tag LOCUS_08220 gene galT 354113 353070 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367649.1 protein_id gnl|my_center|LOCUS_08220 354530 355222 gene locus_tag LOCUS_08230 354530 355222 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384321.1 protein_id gnl|my_center|LOCUS_08230 355737 355309 gene locus_tag LOCUS_08240 355737 355309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 355987 357426 gene locus_tag LOCUS_08250 gene ccoN 355987 357426 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 protein_id gnl|my_center|LOCUS_08250 357436 358044 gene locus_tag LOCUS_08260 gene ccoO 357436 358044 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261904.1 protein_id gnl|my_center|LOCUS_08260 358046 358228 gene locus_tag LOCUS_08270 358046 358228 CDS product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300779.1 protein_id gnl|my_center|LOCUS_08270 358238 359200 gene locus_tag LOCUS_08280 gene ccoP 358238 359200 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706147.1 protein_id gnl|my_center|LOCUS_08280 359286 359783 gene locus_tag LOCUS_08290 359286 359783 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240593.1 protein_id gnl|my_center|LOCUS_08290 359785 362124 gene locus_tag LOCUS_08300 359785 362124 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261908.1 protein_id gnl|my_center|LOCUS_08300 362124 362288 gene locus_tag LOCUS_08310 362124 362288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 362281 362928 gene locus_tag LOCUS_08320 362281 362928 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412360.1 protein_id gnl|my_center|LOCUS_08320 362973 363710 gene locus_tag LOCUS_08330 362973 363710 CDS product FNR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300768.1 protein_id gnl|my_center|LOCUS_08330 363908 364840 gene locus_tag LOCUS_08340 gene uspE 363908 364840 CDS product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072342.1 protein_id gnl|my_center|LOCUS_08340 366590 366111 gene locus_tag LOCUS_08350 366590 366111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 366888 367862 gene locus_tag LOCUS_08360 366888 367862 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072446.1 protein_id gnl|my_center|LOCUS_08360 >Feature sequence03 151 1230 gene locus_tag LOCUS_08370 151 1230 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303290.1 protein_id gnl|my_center|LOCUS_08370 2057 1263 gene locus_tag LOCUS_08380 gene cysE 2057 1263 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704210.1 protein_id gnl|my_center|LOCUS_08380 3005 2118 gene locus_tag LOCUS_08390 3005 2118 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444000.1 protein_id gnl|my_center|LOCUS_08390 3275 4843 gene locus_tag LOCUS_08400 3275 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 5319 4906 gene locus_tag LOCUS_08410 5319 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 5566 6396 gene locus_tag LOCUS_08420 gene dapF 5566 6396 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459097.1 protein_id gnl|my_center|LOCUS_08420 6393 7091 gene locus_tag LOCUS_08430 6393 7091 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349251.1 protein_id gnl|my_center|LOCUS_08430 7099 7998 gene locus_tag LOCUS_08440 gene xerC 7099 7998 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141123.1 protein_id gnl|my_center|LOCUS_08440 8000 8704 gene locus_tag LOCUS_08450 8000 8704 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073964.1 protein_id gnl|my_center|LOCUS_08450 8771 9952 gene locus_tag LOCUS_08460 8771 9952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 10274 11197 gene locus_tag LOCUS_08470 gene glyQ 10274 11197 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070431.1 protein_id gnl|my_center|LOCUS_08470 11201 13267 gene locus_tag LOCUS_08480 gene glyS 11201 13267 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070430.1 protein_id gnl|my_center|LOCUS_08480 13359 13805 gene locus_tag LOCUS_08490 13359 13805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 14101 15570 gene locus_tag LOCUS_08500 14101 15570 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_08500 16288 15806 gene locus_tag LOCUS_08510 16288 15806 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457116.1 protein_id gnl|my_center|LOCUS_08510 17116 16346 gene locus_tag LOCUS_08520 17116 16346 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074252.1 protein_id gnl|my_center|LOCUS_08520 17816 17121 gene locus_tag LOCUS_08530 17816 17121 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454984.1 protein_id gnl|my_center|LOCUS_08530 18022 18510 gene locus_tag LOCUS_08540 18022 18510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 18515 20251 gene locus_tag LOCUS_08550 18515 20251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 20832 23597 gene locus_tag LOCUS_08560 gene polA 20832 23597 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074260.1 protein_id gnl|my_center|LOCUS_08560 23911 24189 gene locus_tag LOCUS_08570 23911 24189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 24173 24676 gene locus_tag LOCUS_08580 24173 24676 CDS product DUF3016 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070894.1 protein_id gnl|my_center|LOCUS_08580 24751 25248 gene locus_tag LOCUS_08590 24751 25248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 25966 25301 gene locus_tag LOCUS_08600 25966 25301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 26742 26059 gene locus_tag LOCUS_08610 26742 26059 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546865.1 protein_id gnl|my_center|LOCUS_08610 28186 26705 gene locus_tag LOCUS_08620 gene baeS 28186 26705 CDS product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706068.1 protein_id gnl|my_center|LOCUS_08620 28374 28751 gene locus_tag LOCUS_08630 28374 28751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 28876 29412 gene locus_tag LOCUS_08640 28876 29412 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066380.1 protein_id gnl|my_center|LOCUS_08640 29873 29601 gene locus_tag LOCUS_08650 29873 29601 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140124.1 protein_id gnl|my_center|LOCUS_08650 30597 29878 gene locus_tag LOCUS_08660 gene trmH 30597 29878 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042026804.1 protein_id gnl|my_center|LOCUS_08660 31264 30878 gene locus_tag LOCUS_08670 31264 30878 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070722.1 protein_id gnl|my_center|LOCUS_08670 33399 31297 gene locus_tag LOCUS_08680 gene spoT 33399 31297 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704079.1 protein_id gnl|my_center|LOCUS_08680 33973 33692 gene locus_tag LOCUS_08690 gene rpoZ 33973 33692 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307060.1 protein_id gnl|my_center|LOCUS_08690 34730 34107 gene locus_tag LOCUS_08700 gene gmk 34730 34107 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458969.1 protein_id gnl|my_center|LOCUS_08700 34879 37632 gene locus_tag LOCUS_08710 34879 37632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 37694 38056 gene locus_tag LOCUS_08720 37694 38056 CDS product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072081.1 protein_id gnl|my_center|LOCUS_08720 38104 38958 gene locus_tag LOCUS_08730 38104 38958 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895438.1 protein_id gnl|my_center|LOCUS_08730 41409 38950 gene locus_tag LOCUS_08740 41409 38950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 42684 41425 gene locus_tag LOCUS_08750 42684 41425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 43019 42681 gene locus_tag LOCUS_08760 43019 42681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 44266 43409 gene locus_tag LOCUS_08770 gene panC 44266 43409 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071159.1 protein_id gnl|my_center|LOCUS_08770 44768 44286 gene locus_tag LOCUS_08780 gene folK 44768 44286 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978983.1 protein_id gnl|my_center|LOCUS_08780 46111 44765 gene locus_tag LOCUS_08790 gene pcnB 46111 44765 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295781.1 protein_id gnl|my_center|LOCUS_08790 47118 46252 gene locus_tag LOCUS_08800 gene gluQRS 47118 46252 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262609.1 protein_id gnl|my_center|LOCUS_08800 47616 47164 gene locus_tag LOCUS_08810 gene dksA 47616 47164 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490361.1 protein_id gnl|my_center|LOCUS_08810 49618 48335 gene locus_tag LOCUS_08820 49618 48335 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103711.1 protein_id gnl|my_center|LOCUS_08820 50319 49615 gene locus_tag LOCUS_08830 50319 49615 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947167.1 protein_id gnl|my_center|LOCUS_08830 50689 51525 gene locus_tag LOCUS_08840 gene galU 50689 51525 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364457.1 protein_id gnl|my_center|LOCUS_08840 53312 51609 gene locus_tag LOCUS_08850 gene hsbR 53312 51609 CDS product two-component system response regulator HsbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098751.1 protein_id gnl|my_center|LOCUS_08850 53642 53337 gene locus_tag LOCUS_08860 gene hsbA 53642 53337 CDS product anti-anti sigma factor HsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_08860 54092 54895 gene locus_tag LOCUS_08870 54092 54895 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070889.1 protein_id gnl|my_center|LOCUS_08870 55571 54963 gene locus_tag LOCUS_08880 55571 54963 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456055.1 protein_id gnl|my_center|LOCUS_08880 57090 55588 gene locus_tag LOCUS_08890 57090 55588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 57065 57337 gene locus_tag LOCUS_08900 57065 57337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 57977 57795 gene locus_tag LOCUS_08910 57977 57795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 58425 58183 gene locus_tag LOCUS_08920 gene tusA 58425 58183 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070435.1 protein_id gnl|my_center|LOCUS_08920 58581 60461 gene locus_tag LOCUS_08930 58581 60461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 60472 61440 gene locus_tag LOCUS_08940 60472 61440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 61513 62727 gene locus_tag LOCUS_08950 61513 62727 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201417625.1 protein_id gnl|my_center|LOCUS_08950 62755 63159 gene locus_tag LOCUS_08960 62755 63159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 63854 63489 gene locus_tag LOCUS_tm00010 63854 63489 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 66378 63913 gene locus_tag LOCUS_08970 66378 63913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 66669 68840 gene locus_tag LOCUS_08980 66669 68840 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705203.1 protein_id gnl|my_center|LOCUS_08980 70168 68936 gene locus_tag LOCUS_08990 70168 68936 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096390.1 protein_id gnl|my_center|LOCUS_08990 71315 70185 gene locus_tag LOCUS_09000 71315 70185 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260937.1 protein_id gnl|my_center|LOCUS_09000 72049 71324 gene locus_tag LOCUS_09010 72049 71324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 72965 72039 gene locus_tag LOCUS_09020 gene hemC 72965 72039 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459122.1 protein_id gnl|my_center|LOCUS_09020 73106 73600 gene locus_tag LOCUS_09030 73106 73600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 73601 74443 gene locus_tag LOCUS_09040 73601 74443 CDS product DUF6279 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477260.1 protein_id gnl|my_center|LOCUS_09040 75964 74471 gene locus_tag LOCUS_09050 gene gppA 75964 74471 CDS product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704128.1 protein_id gnl|my_center|LOCUS_09050 77263 75995 gene locus_tag LOCUS_09060 gene rhlB 77263 75995 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070767.1 protein_id gnl|my_center|LOCUS_09060 77359 77688 gene locus_tag LOCUS_09070 gene trxA 77359 77688 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070766.1 protein_id gnl|my_center|LOCUS_09070 77883 79145 gene locus_tag LOCUS_09080 gene rho 77883 79145 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054524.1 protein_id gnl|my_center|LOCUS_09080 79296 79372 gene locus_tag LOCUS_t00030 79296 79372 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 79860 80498 gene locus_tag LOCUS_09090 79860 80498 CDS product YqiJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071585.1 protein_id gnl|my_center|LOCUS_09090 80520 82271 gene locus_tag LOCUS_09100 80520 82271 CDS product flotillin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071586.1 protein_id gnl|my_center|LOCUS_09100 83878 82313 gene locus_tag LOCUS_09110 83878 82313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 84747 83941 gene locus_tag LOCUS_09120 gene djlA 84747 83941 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073436.1 protein_id gnl|my_center|LOCUS_09120 85420 84758 gene locus_tag LOCUS_09130 85420 84758 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237801.1 protein_id gnl|my_center|LOCUS_09130 86412 85417 gene locus_tag LOCUS_09140 86412 85417 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958577.1 protein_id gnl|my_center|LOCUS_09140 86614 88932 gene locus_tag LOCUS_09150 gene lptD 86614 88932 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073439.1 protein_id gnl|my_center|LOCUS_09150 88941 90242 gene locus_tag LOCUS_09160 gene surA 88941 90242 CDS product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073440.1 protein_id gnl|my_center|LOCUS_09160 90242 91234 gene locus_tag LOCUS_09170 gene pdxA 90242 91234 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073441.1 protein_id gnl|my_center|LOCUS_09170 91227 92030 gene locus_tag LOCUS_09180 gene rsmA 91227 92030 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073442.1 protein_id gnl|my_center|LOCUS_09180 92046 92435 gene locus_tag LOCUS_09190 gene apaG 92046 92435 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156966.1 protein_id gnl|my_center|LOCUS_09190 92445 93257 gene locus_tag LOCUS_09200 92445 93257 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704877.1 protein_id gnl|my_center|LOCUS_09200 94736 93288 gene locus_tag LOCUS_09210 94736 93288 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922975.1 protein_id gnl|my_center|LOCUS_09210 95338 95027 gene locus_tag LOCUS_09220 95338 95027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 95757 96779 gene locus_tag LOCUS_09230 95757 96779 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071514.1 protein_id gnl|my_center|LOCUS_09230 96781 98067 gene locus_tag LOCUS_09240 gene hemL 96781 98067 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707264.1 protein_id gnl|my_center|LOCUS_09240 98432 100252 gene locus_tag LOCUS_09250 gene nrdD 98432 100252 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083208.1 protein_id gnl|my_center|LOCUS_09250 100903 100268 gene locus_tag LOCUS_09260 gene pdxH 100903 100268 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072804.1 protein_id gnl|my_center|LOCUS_09260 101002 101454 gene locus_tag LOCUS_09270 101002 101454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 104449 101708 gene locus_tag LOCUS_09280 104449 101708 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073740.1 protein_id gnl|my_center|LOCUS_09280 105199 104501 gene locus_tag LOCUS_09290 105199 104501 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072071.1 protein_id gnl|my_center|LOCUS_09290 105416 106291 gene locus_tag LOCUS_09300 105416 106291 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206822.1 protein_id gnl|my_center|LOCUS_09300 106301 107941 gene locus_tag LOCUS_09310 106301 107941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 108359 108204 gene locus_tag LOCUS_09320 108359 108204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 109803 108544 gene locus_tag LOCUS_09330 109803 108544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 110825 109884 gene locus_tag LOCUS_09340 110825 109884 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615657.1 protein_id gnl|my_center|LOCUS_09340 111784 110822 gene locus_tag LOCUS_09350 111784 110822 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056892.1 protein_id gnl|my_center|LOCUS_09350 112822 111854 gene locus_tag LOCUS_09360 112822 111854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 113904 112873 gene locus_tag LOCUS_09370 113904 112873 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119543.1 protein_id gnl|my_center|LOCUS_09370 114801 114124 gene locus_tag LOCUS_09380 114801 114124 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243016.1 protein_id gnl|my_center|LOCUS_09380 115174 115338 gene locus_tag LOCUS_09390 115174 115338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 115350 115634 gene locus_tag LOCUS_09400 115350 115634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 115723 118494 gene locus_tag LOCUS_09410 115723 118494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 119461 118649 gene locus_tag LOCUS_09420 119461 118649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 119717 120523 gene locus_tag LOCUS_09430 119717 120523 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478913.1 protein_id gnl|my_center|LOCUS_09430 120568 121080 gene locus_tag LOCUS_09440 120568 121080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 121287 128180 gene locus_tag LOCUS_09450 121287 128180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 128367 129095 gene locus_tag LOCUS_09460 128367 129095 CDS product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262707.1 protein_id gnl|my_center|LOCUS_09460 130579 129092 gene locus_tag LOCUS_09470 130579 129092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 131685 130828 gene locus_tag LOCUS_09480 gene folD 131685 130828 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705731.1 protein_id gnl|my_center|LOCUS_09480 132757 131855 gene locus_tag LOCUS_09490 132757 131855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 133496 133086 gene locus_tag LOCUS_09500 133496 133086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 136262 133632 gene locus_tag LOCUS_09510 gene mutS 136262 133632 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073287.1 protein_id gnl|my_center|LOCUS_09510 136289 136822 gene locus_tag LOCUS_09520 gene pncC 136289 136822 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853811.1 protein_id gnl|my_center|LOCUS_09520 136898 137929 gene locus_tag LOCUS_09530 gene recA 136898 137929 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707431.1 protein_id gnl|my_center|LOCUS_09530 138242 140026 gene locus_tag LOCUS_09540 138242 140026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 140219 142054 gene locus_tag LOCUS_09550 140219 142054 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001914695.1 protein_id gnl|my_center|LOCUS_09550 142076 143173 gene locus_tag LOCUS_09560 142076 143173 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171436.1 protein_id gnl|my_center|LOCUS_09560 143177 144202 gene locus_tag LOCUS_09570 143177 144202 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 protein_id gnl|my_center|LOCUS_09570 144202 145824 gene locus_tag LOCUS_09580 144202 145824 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087940.1 protein_id gnl|my_center|LOCUS_09580 145840 146421 gene locus_tag LOCUS_09590 145840 146421 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004415847.1 protein_id gnl|my_center|LOCUS_09590 146510 147661 gene locus_tag LOCUS_09600 146510 147661 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070945.1 protein_id gnl|my_center|LOCUS_09600 148332 147658 gene locus_tag LOCUS_09610 gene mutH 148332 147658 CDS product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261234.1 protein_id gnl|my_center|LOCUS_09610 149168 148329 gene locus_tag LOCUS_09620 gene rlmA 149168 148329 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460128.1 protein_id gnl|my_center|LOCUS_09620 149516 150235 gene locus_tag LOCUS_09630 149516 150235 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944588.1 protein_id gnl|my_center|LOCUS_09630 150667 150260 gene locus_tag LOCUS_09640 150667 150260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 150698 151243 gene locus_tag LOCUS_09650 150698 151243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 152453 151263 gene locus_tag LOCUS_09660 152453 151263 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186349.1 protein_id gnl|my_center|LOCUS_09660 153769 152618 gene locus_tag LOCUS_09670 gene metK 153769 152618 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071209.1 protein_id gnl|my_center|LOCUS_09670 154546 153971 gene locus_tag LOCUS_09680 154546 153971 CDS product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073354.1 protein_id gnl|my_center|LOCUS_09680 155228 154641 gene locus_tag LOCUS_09690 155228 154641 CDS product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073354.1 protein_id gnl|my_center|LOCUS_09690 158106 155338 gene locus_tag LOCUS_09700 158106 155338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 158309 158234 gene locus_tag LOCUS_t00040 158309 158234 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 158444 158369 gene locus_tag LOCUS_t00050 158444 158369 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 158579 158504 gene locus_tag LOCUS_t00060 158579 158504 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 158639 158658 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 158796 158721 gene locus_tag LOCUS_t00070 158796 158721 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 160346 158931 gene locus_tag LOCUS_09710 gene gltX 160346 158931 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695634.1 protein_id gnl|my_center|LOCUS_09710 160619 160694 gene locus_tag LOCUS_t00080 160619 160694 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 160725 160800 gene locus_tag LOCUS_t00090 160725 160800 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 160885 162219 gene locus_tag LOCUS_09720 gene rlmD 160885 162219 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694340.1 protein_id gnl|my_center|LOCUS_09720 162249 164444 gene locus_tag LOCUS_09730 gene relA 162249 164444 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098518.1 protein_id gnl|my_center|LOCUS_09730 164554 165372 gene locus_tag LOCUS_09740 gene mazG 164554 165372 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704767.1 protein_id gnl|my_center|LOCUS_09740 165437 166093 gene locus_tag LOCUS_09750 165437 166093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 166210 166782 gene locus_tag LOCUS_09760 166210 166782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 166854 167162 gene locus_tag LOCUS_09770 gene glpE 166854 167162 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460380.1 protein_id gnl|my_center|LOCUS_09770 167172 168014 gene locus_tag LOCUS_09780 gene glpG 167172 168014 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074262.1 protein_id gnl|my_center|LOCUS_09780 168413 168018 gene locus_tag LOCUS_09790 168413 168018 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070537.1 protein_id gnl|my_center|LOCUS_09790 168612 169163 gene locus_tag LOCUS_09800 gene ubiC 168612 169163 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817301.1 protein_id gnl|my_center|LOCUS_09800 169156 170031 gene locus_tag LOCUS_09810 gene ubiA 169156 170031 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245012.1 protein_id gnl|my_center|LOCUS_09810 170404 170174 gene locus_tag LOCUS_09820 gene yacG 170404 170174 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070771.1 protein_id gnl|my_center|LOCUS_09820 171184 170438 gene locus_tag LOCUS_09830 gene zapD 171184 170438 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818895.1 protein_id gnl|my_center|LOCUS_09830 171847 171233 gene locus_tag LOCUS_09840 gene coaE 171847 171233 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480887.1 protein_id gnl|my_center|LOCUS_09840 172740 171847 gene locus_tag LOCUS_09850 172740 171847 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070774.1 protein_id gnl|my_center|LOCUS_09850 173985 172744 gene locus_tag LOCUS_09860 173985 172744 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070775.1 protein_id gnl|my_center|LOCUS_09860 175779 174088 gene locus_tag LOCUS_09870 gene pilB 175779 174088 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070776.1 protein_id gnl|my_center|LOCUS_09870 176371 175895 gene locus_tag LOCUS_09880 gene tapA 176371 175895 CDS product type IVa pilus major pilin TapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707568.1 protein_id gnl|my_center|LOCUS_09880 176867 177841 gene locus_tag LOCUS_09890 gene moaA 176867 177841 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106017.1 protein_id gnl|my_center|LOCUS_09890 177846 178418 gene locus_tag LOCUS_09900 177846 178418 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037164.1 protein_id gnl|my_center|LOCUS_09900 178418 178963 gene locus_tag LOCUS_09910 gene moaB 178418 178963 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091240.1 protein_id gnl|my_center|LOCUS_09910 178965 179444 gene locus_tag LOCUS_09920 gene moaC 178965 179444 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074083.1 protein_id gnl|my_center|LOCUS_09920 179444 179689 gene locus_tag LOCUS_09930 gene moaD 179444 179689 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001575835.1 protein_id gnl|my_center|LOCUS_09930 179845 181470 gene locus_tag LOCUS_09940 179845 181470 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_09940 182531 181560 gene locus_tag LOCUS_09950 182531 181560 CDS product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073652.1 protein_id gnl|my_center|LOCUS_09950 182993 182541 gene locus_tag LOCUS_09960 182993 182541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 184658 183027 gene locus_tag LOCUS_09970 184658 183027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 185543 184719 gene locus_tag LOCUS_09980 185543 184719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 185786 186703 gene locus_tag LOCUS_09990 185786 186703 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073874.1 protein_id gnl|my_center|LOCUS_09990 186829 187680 gene locus_tag LOCUS_10000 gene purU 186829 187680 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101174.1 protein_id gnl|my_center|LOCUS_10000 188671 187730 gene locus_tag LOCUS_10010 188671 187730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 188857 189588 gene locus_tag LOCUS_10020 gene rsmE 188857 189588 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461719.1 protein_id gnl|my_center|LOCUS_10020 189610 190026 gene locus_tag LOCUS_10030 189610 190026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015694.1 protein_id gnl|my_center|LOCUS_10030 191001 190042 gene locus_tag LOCUS_10040 191001 190042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 191445 191023 gene locus_tag LOCUS_10050 191445 191023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 192620 191448 gene locus_tag LOCUS_10060 gene ubiF 192620 191448 CDS product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210347.1 protein_id gnl|my_center|LOCUS_10060 194208 192697 gene locus_tag LOCUS_10070 194208 192697 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707862.1 protein_id gnl|my_center|LOCUS_10070 194422 195204 gene locus_tag LOCUS_10080 194422 195204 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462636.1 protein_id gnl|my_center|LOCUS_10080 195244 197589 gene locus_tag LOCUS_10090 195244 197589 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_10090 197555 198361 gene locus_tag LOCUS_10100 197555 198361 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_10100 198453 199643 gene locus_tag LOCUS_10110 198453 199643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490227.1 protein_id gnl|my_center|LOCUS_10110 199653 200033 gene locus_tag LOCUS_10120 199653 200033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 202301 200130 gene locus_tag LOCUS_10130 202301 200130 CDS product DUF6351 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 protein_id gnl|my_center|LOCUS_10130 204736 202826 gene locus_tag LOCUS_10140 204736 202826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 205947 204733 gene locus_tag LOCUS_10150 205947 204733 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026469785.1 protein_id gnl|my_center|LOCUS_10150 206436 206152 gene locus_tag LOCUS_10160 206436 206152 CDS product YebG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764221.1 protein_id gnl|my_center|LOCUS_10160 206651 208288 gene locus_tag LOCUS_10170 gene panP 206651 208288 CDS product putative pyridoxal-dependent aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261555.1 protein_id gnl|my_center|LOCUS_10170 208969 208319 gene locus_tag LOCUS_10180 208969 208319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 209108 211615 gene locus_tag LOCUS_10190 gene rnr 209108 211615 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262718.1 protein_id gnl|my_center|LOCUS_10190 211709 212452 gene locus_tag LOCUS_10200 gene rlmB 211709 212452 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655733.1 protein_id gnl|my_center|LOCUS_10200 212470 212703 gene locus_tag LOCUS_10210 212470 212703 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419964.1 protein_id gnl|my_center|LOCUS_10210 213743 212892 gene locus_tag LOCUS_10220 gene rpoH 213743 212892 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704351.1 protein_id gnl|my_center|LOCUS_10220 214071 215291 gene locus_tag LOCUS_10230 214071 215291 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262170.1 protein_id gnl|my_center|LOCUS_10230 217227 215347 gene locus_tag LOCUS_10240 gene speA 217227 215347 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071982.1 protein_id gnl|my_center|LOCUS_10240 217375 218229 gene locus_tag LOCUS_10250 gene speE 217375 218229 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038944.1 protein_id gnl|my_center|LOCUS_10250 219479 218316 gene locus_tag LOCUS_10260 219479 218316 CDS product GAK system CofD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938386.1 protein_id gnl|my_center|LOCUS_10260 219609 220709 gene locus_tag LOCUS_10270 gene proB 219609 220709 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404004.1 protein_id gnl|my_center|LOCUS_10270 220721 221971 gene locus_tag LOCUS_10280 220721 221971 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_10280 222398 224440 gene locus_tag LOCUS_10290 gene prlC 222398 224440 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704124.1 protein_id gnl|my_center|LOCUS_10290 225068 224514 gene locus_tag LOCUS_10300 225068 224514 CDS product YfaZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071735.1 protein_id gnl|my_center|LOCUS_10300 226704 225250 gene locus_tag LOCUS_10310 226704 225250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 228075 226921 gene locus_tag LOCUS_10320 228075 226921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 228227 228676 gene locus_tag LOCUS_10330 gene moaE 228227 228676 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074081.1 protein_id gnl|my_center|LOCUS_10330 228895 229596 gene locus_tag LOCUS_10340 228895 229596 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072741.1 protein_id gnl|my_center|LOCUS_10340 229547 229882 gene locus_tag LOCUS_10350 229547 229882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 229996 230709 gene locus_tag LOCUS_10360 gene rph 229996 230709 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073930.1 protein_id gnl|my_center|LOCUS_10360 230719 231363 gene locus_tag LOCUS_10370 gene pyrE 230719 231363 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884129.1 protein_id gnl|my_center|LOCUS_10370 232463 231456 gene locus_tag LOCUS_10380 232463 231456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 232758 232498 gene locus_tag LOCUS_10390 232758 232498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 233599 232826 gene locus_tag LOCUS_10400 gene bioH 233599 232826 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060070.1 protein_id gnl|my_center|LOCUS_10400 233624 234310 gene locus_tag LOCUS_10410 gene gntX 233624 234310 CDS product DNA utilization protein GntX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703681.1 protein_id gnl|my_center|LOCUS_10410 236844 234319 gene locus_tag LOCUS_10420 236844 234319 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838916.1 protein_id gnl|my_center|LOCUS_10420 237016 237615 gene locus_tag LOCUS_10430 gene nfuA 237016 237615 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704302.1 protein_id gnl|my_center|LOCUS_10430 237631 237906 gene locus_tag LOCUS_10440 237631 237906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 237918 239018 gene locus_tag LOCUS_10450 237918 239018 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_10450 239934 239050 gene locus_tag LOCUS_10460 239934 239050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704818.1 protein_id gnl|my_center|LOCUS_10460 240102 242972 gene locus_tag LOCUS_10470 240102 242972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 243087 244358 gene locus_tag LOCUS_10480 243087 244358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 244368 245618 gene locus_tag LOCUS_10490 244368 245618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 245924 246730 gene locus_tag LOCUS_10500 245924 246730 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_10500 246730 248970 gene locus_tag LOCUS_10510 246730 248970 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444419.1 protein_id gnl|my_center|LOCUS_10510 249039 250703 gene locus_tag LOCUS_10520 249039 250703 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_10520 250713 250940 gene locus_tag LOCUS_10530 250713 250940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 251433 250951 gene locus_tag LOCUS_10540 251433 250951 CDS product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261461.1 protein_id gnl|my_center|LOCUS_10540 251649 254237 gene locus_tag LOCUS_10550 gene leuS 251649 254237 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454506.1 protein_id gnl|my_center|LOCUS_10550 254237 254752 gene locus_tag LOCUS_10560 254237 254752 CDS product LPS exporter LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071404.1 protein_id gnl|my_center|LOCUS_10560 254752 255807 gene locus_tag LOCUS_10570 gene holA 254752 255807 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071403.1 protein_id gnl|my_center|LOCUS_10570 255800 256456 gene locus_tag LOCUS_10580 gene nadD 255800 256456 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210330.1 protein_id gnl|my_center|LOCUS_10580 256490 256807 gene locus_tag LOCUS_10590 gene rsfS 256490 256807 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707026.1 protein_id gnl|my_center|LOCUS_10590 256807 257277 gene locus_tag LOCUS_10600 gene rlmH 256807 257277 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210328.1 protein_id gnl|my_center|LOCUS_10600 257280 259163 gene locus_tag LOCUS_10610 gene mrdA 257280 259163 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071399.1 protein_id gnl|my_center|LOCUS_10610 259160 260272 gene locus_tag LOCUS_10620 gene rodA 259160 260272 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818663.1 protein_id gnl|my_center|LOCUS_10620 260274 261041 gene locus_tag LOCUS_10630 260274 261041 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261453.1 protein_id gnl|my_center|LOCUS_10630 261315 261094 gene locus_tag LOCUS_10640 261315 261094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 261212 262363 gene locus_tag LOCUS_10650 261212 262363 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071395.1 protein_id gnl|my_center|LOCUS_10650 262387 262650 gene locus_tag LOCUS_10660 gene ybeD 262387 262650 CDS product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850547.1 protein_id gnl|my_center|LOCUS_10660 262660 263322 gene locus_tag LOCUS_10670 gene lipB 262660 263322 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071393.1 protein_id gnl|my_center|LOCUS_10670 263315 264280 gene locus_tag LOCUS_10680 gene lipA 263315 264280 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707035.1 protein_id gnl|my_center|LOCUS_10680 264400 266580 gene locus_tag LOCUS_10690 264400 266580 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639902.1 protein_id gnl|my_center|LOCUS_10690 266737 266812 gene locus_tag LOCUS_t00100 266737 266812 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 266834 266909 gene locus_tag LOCUS_t00110 266834 266909 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 266956 267031 gene locus_tag LOCUS_t00120 266956 267031 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 267144 267219 gene locus_tag LOCUS_t00130 267144 267219 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 267358 268980 gene locus_tag LOCUS_10700 267358 268980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence04 2180 831 gene locus_tag LOCUS_10710 2180 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 2473 2973 gene locus_tag LOCUS_10720 2473 2973 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967076.1 protein_id gnl|my_center|LOCUS_10720 2960 3703 gene locus_tag LOCUS_10730 2960 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 3738 4286 gene locus_tag LOCUS_10740 3738 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919164.1 protein_id gnl|my_center|LOCUS_10740 4352 4888 gene locus_tag LOCUS_10750 4352 4888 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112334.1 protein_id gnl|my_center|LOCUS_10750 5691 4984 gene locus_tag LOCUS_10760 5691 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 5965 6387 gene locus_tag LOCUS_10770 5965 6387 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707313.1 protein_id gnl|my_center|LOCUS_10770 8500 6419 gene locus_tag LOCUS_10780 gene recG 8500 6419 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080593.1 protein_id gnl|my_center|LOCUS_10780 8952 9425 gene locus_tag LOCUS_10790 8952 9425 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073331.1 protein_id gnl|my_center|LOCUS_10790 9925 9437 gene locus_tag LOCUS_10800 9925 9437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 11317 9926 gene locus_tag LOCUS_10810 11317 9926 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070440.1 protein_id gnl|my_center|LOCUS_10810 12039 11383 gene locus_tag LOCUS_10820 12039 11383 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001308167.1 protein_id gnl|my_center|LOCUS_10820 12103 12507 gene locus_tag LOCUS_10830 12103 12507 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706544.1 protein_id gnl|my_center|LOCUS_10830 12538 13458 gene locus_tag LOCUS_10840 12538 13458 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011235810.1 protein_id gnl|my_center|LOCUS_10840 13517 14209 gene locus_tag LOCUS_10850 13517 14209 CDS product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207944.1 protein_id gnl|my_center|LOCUS_10850 16992 14206 gene locus_tag LOCUS_10860 16992 14206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 17282 17923 gene locus_tag LOCUS_10870 17282 17923 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478649.1 protein_id gnl|my_center|LOCUS_10870 20573 19695 gene locus_tag LOCUS_10880 20573 19695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 22577 20577 gene locus_tag LOCUS_10890 22577 20577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 23176 22577 gene locus_tag LOCUS_10900 23176 22577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 23613 24149 gene locus_tag LOCUS_10910 23613 24149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 24454 24203 gene locus_tag LOCUS_10920 24454 24203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 25946 24600 gene locus_tag LOCUS_10930 25946 24600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 26154 25999 gene locus_tag LOCUS_10940 26154 25999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263388.1 protein_id gnl|my_center|LOCUS_10940 26403 27347 gene locus_tag LOCUS_10950 26403 27347 CDS product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554540.1 protein_id gnl|my_center|LOCUS_10950 27359 30199 gene locus_tag LOCUS_10960 27359 30199 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022108.1 protein_id gnl|my_center|LOCUS_10960 30199 31749 gene locus_tag LOCUS_10970 30199 31749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 31815 33305 gene locus_tag LOCUS_10980 31815 33305 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022102.1 protein_id gnl|my_center|LOCUS_10980 33318 34787 gene locus_tag LOCUS_10990 33318 34787 CDS product anti-phage dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102963.1 protein_id gnl|my_center|LOCUS_10990 34780 34932 gene locus_tag LOCUS_11000 34780 34932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 35144 35971 gene locus_tag LOCUS_11010 35144 35971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 35979 36602 gene locus_tag LOCUS_11020 35979 36602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055319536.1 protein_id gnl|my_center|LOCUS_11020 37292 37828 gene locus_tag LOCUS_11030 37292 37828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 37828 38304 gene locus_tag LOCUS_11040 37828 38304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 38535 40139 gene locus_tag LOCUS_11050 38535 40139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 40139 40462 gene locus_tag LOCUS_11060 40139 40462 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704337.1 protein_id gnl|my_center|LOCUS_11060 40478 41065 gene locus_tag LOCUS_11070 40478 41065 CDS product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073305.1 protein_id gnl|my_center|LOCUS_11070 41218 42159 gene locus_tag LOCUS_11080 41218 42159 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811759.1 protein_id gnl|my_center|LOCUS_11080 42159 42623 gene locus_tag LOCUS_11090 42159 42623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 42634 43458 gene locus_tag LOCUS_11100 42634 43458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 43792 44730 gene locus_tag LOCUS_11110 43792 44730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 44727 45176 gene locus_tag LOCUS_11120 44727 45176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 46503 45256 gene locus_tag LOCUS_11130 46503 45256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 47553 47038 gene locus_tag LOCUS_11140 47553 47038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072209.1 protein_id gnl|my_center|LOCUS_11140 47872 49053 gene locus_tag LOCUS_11150 47872 49053 CDS product RNA ligase RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114117.1 protein_id gnl|my_center|LOCUS_11150 49050 49688 gene locus_tag LOCUS_11160 gene prfH 49050 49688 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602086.1 protein_id gnl|my_center|LOCUS_11160 49712 50047 gene locus_tag LOCUS_11170 49712 50047 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122463.1 protein_id gnl|my_center|LOCUS_11170 50833 50240 gene locus_tag LOCUS_11180 50833 50240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 52220 50844 gene locus_tag LOCUS_11190 52220 50844 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073745.1 protein_id gnl|my_center|LOCUS_11190 52406 55234 gene locus_tag LOCUS_11200 gene uvrA 52406 55234 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490537.1 protein_id gnl|my_center|LOCUS_11200 55985 55314 gene locus_tag LOCUS_11210 gene rpe 55985 55314 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503032.1 protein_id gnl|my_center|LOCUS_11210 56400 57074 gene locus_tag LOCUS_11220 56400 57074 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 protein_id gnl|my_center|LOCUS_11220 57188 57367 gene locus_tag LOCUS_11230 57188 57367 CDS product DUF2970 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070662.1 protein_id gnl|my_center|LOCUS_11230 58181 57357 gene locus_tag LOCUS_11240 58181 57357 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706963.1 protein_id gnl|my_center|LOCUS_11240 59470 58184 gene locus_tag LOCUS_11250 59470 58184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 60552 59479 gene locus_tag LOCUS_11260 gene aroB 60552 59479 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439805.1 protein_id gnl|my_center|LOCUS_11260 61084 60566 gene locus_tag LOCUS_11270 gene aroK 61084 60566 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070658.1 protein_id gnl|my_center|LOCUS_11270 63326 61275 gene locus_tag LOCUS_11280 63326 61275 CDS product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070657.1 protein_id gnl|my_center|LOCUS_11280 63867 63328 gene locus_tag LOCUS_11290 63867 63328 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070656.1 protein_id gnl|my_center|LOCUS_11290 64469 63864 gene locus_tag LOCUS_11300 64469 63864 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070655.1 protein_id gnl|my_center|LOCUS_11300 65050 64469 gene locus_tag LOCUS_11310 gene pilN 65050 64469 CDS product type 4a pilus biogenesis protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_11310 66117 65038 gene locus_tag LOCUS_11320 66117 65038 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070653.1 protein_id gnl|my_center|LOCUS_11320 66273 68702 gene locus_tag LOCUS_11330 66273 68702 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668733.1 protein_id gnl|my_center|LOCUS_11330 68841 70379 gene locus_tag LOCUS_11340 68841 70379 CDS product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776921.1 protein_id gnl|my_center|LOCUS_11340 71107 70499 gene locus_tag LOCUS_11350 gene yihA 71107 70499 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416925.1 protein_id gnl|my_center|LOCUS_11350 71269 71865 gene locus_tag LOCUS_11360 71269 71865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 74056 71978 gene locus_tag LOCUS_11370 74056 71978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 76573 74078 gene locus_tag LOCUS_11380 76573 74078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 78928 76622 gene locus_tag LOCUS_11390 78928 76622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 80998 79028 gene locus_tag LOCUS_11400 80998 79028 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100176370.1 protein_id gnl|my_center|LOCUS_11400 81191 81913 gene locus_tag LOCUS_11410 81191 81913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 82623 81931 gene locus_tag LOCUS_11420 gene fre 82623 81931 CDS product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459134.1 protein_id gnl|my_center|LOCUS_11420 84164 82695 gene locus_tag LOCUS_11430 gene ubiD 84164 82695 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161496900.1 protein_id gnl|my_center|LOCUS_11430 84312 87041 gene locus_tag LOCUS_11440 84312 87041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 87042 87497 gene locus_tag LOCUS_11450 87042 87497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 87575 88687 gene locus_tag LOCUS_11460 87575 88687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 88762 89340 gene locus_tag LOCUS_11470 88762 89340 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082631.1 protein_id gnl|my_center|LOCUS_11470 89407 91218 gene locus_tag LOCUS_11480 gene recQ 89407 91218 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707789.1 protein_id gnl|my_center|LOCUS_11480 91449 92258 gene locus_tag LOCUS_11490 91449 92258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 93704 92340 gene locus_tag LOCUS_11500 gene hemN 93704 92340 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074316.1 protein_id gnl|my_center|LOCUS_11500 96875 94455 gene locus_tag LOCUS_11510 gene gyrB 96875 94455 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458663.1 protein_id gnl|my_center|LOCUS_11510 97990 96890 gene locus_tag LOCUS_11520 gene recF 97990 96890 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097265.1 protein_id gnl|my_center|LOCUS_11520 99119 98001 gene locus_tag LOCUS_11530 gene dnaN 99119 98001 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070425.1 protein_id gnl|my_center|LOCUS_11530 100531 99125 gene locus_tag LOCUS_11540 gene dnaA 100531 99125 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059116.1 protein_id gnl|my_center|LOCUS_11540 100866 101000 gene locus_tag LOCUS_11550 gene rpmH 100866 101000 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005539760.1 protein_id gnl|my_center|LOCUS_11550 101014 101373 gene locus_tag LOCUS_11560 gene rnpA 101014 101373 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070422.1 protein_id gnl|my_center|LOCUS_11560 101610 103253 gene locus_tag LOCUS_11570 gene yidC 101610 103253 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070420.1 protein_id gnl|my_center|LOCUS_11570 103365 104729 gene locus_tag LOCUS_11580 gene mnmE 103365 104729 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205962.1 protein_id gnl|my_center|LOCUS_11580 104736 105386 gene locus_tag LOCUS_11590 gene bluB 104736 105386 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731004.1 protein_id gnl|my_center|LOCUS_11590 105984 105445 gene locus_tag LOCUS_11600 105984 105445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 107202 105997 gene locus_tag LOCUS_11610 107202 105997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 108613 107273 gene locus_tag LOCUS_11620 108613 107273 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705398.1 protein_id gnl|my_center|LOCUS_11620 108795 109352 gene locus_tag LOCUS_11630 108795 109352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 109378 110025 gene locus_tag LOCUS_11640 109378 110025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 110086 110562 gene locus_tag LOCUS_11650 110086 110562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 110763 112073 gene locus_tag LOCUS_11660 110763 112073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 112499 112086 gene locus_tag LOCUS_11670 112499 112086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 113621 112500 gene locus_tag LOCUS_11680 gene hemH 113621 112500 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073218.1 protein_id gnl|my_center|LOCUS_11680 114298 116190 gene locus_tag LOCUS_11690 gene mnmG 114298 116190 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262905.1 protein_id gnl|my_center|LOCUS_11690 116190 116834 gene locus_tag LOCUS_11700 gene rsmG 116190 116834 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161183.1 protein_id gnl|my_center|LOCUS_11700 116850 117638 gene locus_tag LOCUS_11710 116850 117638 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074338.1 protein_id gnl|my_center|LOCUS_11710 117661 118563 gene locus_tag LOCUS_11720 117661 118563 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707915.1 protein_id gnl|my_center|LOCUS_11720 118742 119116 gene locus_tag LOCUS_11730 118742 119116 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074336.1 protein_id gnl|my_center|LOCUS_11730 119133 119996 gene locus_tag LOCUS_11740 gene atpB 119133 119996 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074335.1 protein_id gnl|my_center|LOCUS_11740 120049 120270 gene locus_tag LOCUS_11750 120049 120270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 120325 120795 gene locus_tag LOCUS_11760 gene atpF 120325 120795 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707912.1 protein_id gnl|my_center|LOCUS_11760 120806 121339 gene locus_tag LOCUS_11770 gene atpH 120806 121339 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481164.1 protein_id gnl|my_center|LOCUS_11770 121351 122892 gene locus_tag LOCUS_11780 gene atpA 121351 122892 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074332.1 protein_id gnl|my_center|LOCUS_11780 122939 123799 gene locus_tag LOCUS_11790 gene atpG 122939 123799 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074331.1 protein_id gnl|my_center|LOCUS_11790 123828 125213 gene locus_tag LOCUS_11800 gene atpD 123828 125213 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307215.1 protein_id gnl|my_center|LOCUS_11800 125232 125657 gene locus_tag LOCUS_11810 125232 125657 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175169.1 protein_id gnl|my_center|LOCUS_11810 126591 125728 gene locus_tag LOCUS_11820 126591 125728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 126830 128197 gene locus_tag LOCUS_11830 gene glmU 126830 128197 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074328.1 protein_id gnl|my_center|LOCUS_11830 130895 128556 gene locus_tag LOCUS_11840 130895 128556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 131092 131664 gene locus_tag LOCUS_11850 131092 131664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 131808 132572 gene locus_tag LOCUS_11860 131808 132572 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074326.1 protein_id gnl|my_center|LOCUS_11860 132599 134428 gene locus_tag LOCUS_11870 gene glmS 132599 134428 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707902.1 protein_id gnl|my_center|LOCUS_11870 134520 134768 gene locus_tag LOCUS_11880 134520 134768 CDS product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048897891.1 protein_id gnl|my_center|LOCUS_11880 135145 134825 gene locus_tag LOCUS_11890 135145 134825 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639894.1 protein_id gnl|my_center|LOCUS_11890 136183 135401 gene locus_tag LOCUS_11900 136183 135401 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073304.1 protein_id gnl|my_center|LOCUS_11900 136140 137195 gene locus_tag LOCUS_11910 136140 137195 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920210.1 protein_id gnl|my_center|LOCUS_11910 137270 137491 gene locus_tag LOCUS_11920 137270 137491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 137677 137997 gene locus_tag LOCUS_11930 137677 137997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 138155 140275 gene locus_tag LOCUS_11940 138155 140275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 141240 140374 gene locus_tag LOCUS_11950 141240 140374 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114256.1 protein_id gnl|my_center|LOCUS_11950 142396 141644 gene locus_tag LOCUS_11960 142396 141644 CDS product ceramidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771218.1 protein_id gnl|my_center|LOCUS_11960 144834 142834 gene locus_tag LOCUS_11970 144834 142834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 145217 146335 gene locus_tag LOCUS_11980 145217 146335 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529158.1 protein_id gnl|my_center|LOCUS_11980 146551 147720 gene locus_tag LOCUS_11990 146551 147720 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490229.1 protein_id gnl|my_center|LOCUS_11990 147803 150583 gene locus_tag LOCUS_12000 147803 150583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 150642 151748 gene locus_tag LOCUS_12010 150642 151748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 152444 151812 gene locus_tag LOCUS_12020 152444 151812 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114764.1 protein_id gnl|my_center|LOCUS_12020 152743 152471 gene locus_tag LOCUS_12030 152743 152471 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073237.1 protein_id gnl|my_center|LOCUS_12030 153811 152762 gene locus_tag LOCUS_12040 gene mutY 153811 152762 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693157.1 protein_id gnl|my_center|LOCUS_12040 154006 154320 gene locus_tag LOCUS_12050 154006 154320 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043123987.1 protein_id gnl|my_center|LOCUS_12050 156534 154525 gene locus_tag LOCUS_12060 156534 154525 CDS product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104453.1 protein_id gnl|my_center|LOCUS_12060 157595 156543 gene locus_tag LOCUS_12070 157595 156543 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797170.1 protein_id gnl|my_center|LOCUS_12070 160309 157595 gene locus_tag LOCUS_12080 160309 157595 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 protein_id gnl|my_center|LOCUS_12080 160528 161598 gene locus_tag LOCUS_12090 160528 161598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 161600 162613 gene locus_tag LOCUS_12100 161600 162613 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104456.1 protein_id gnl|my_center|LOCUS_12100 163565 162639 gene locus_tag LOCUS_12110 163565 162639 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_12110 164616 163567 gene locus_tag LOCUS_12120 164616 163567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 164695 165000 gene locus_tag LOCUS_12130 164695 165000 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079176.1 protein_id gnl|my_center|LOCUS_12130 165003 165839 gene locus_tag LOCUS_12140 165003 165839 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088499789.1 protein_id gnl|my_center|LOCUS_12140 166164 165865 gene locus_tag LOCUS_12150 166164 165865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 166505 166278 gene locus_tag LOCUS_12160 166505 166278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 170749 166622 gene locus_tag LOCUS_12170 170749 166622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 171183 170746 gene locus_tag LOCUS_12180 171183 170746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 172030 171173 gene locus_tag LOCUS_12190 172030 171173 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073804.1 protein_id gnl|my_center|LOCUS_12190 172617 172030 gene locus_tag LOCUS_12200 172617 172030 CDS product MSHA biogenesis protein MshD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262980.1 protein_id gnl|my_center|LOCUS_12200 173099 172614 gene locus_tag LOCUS_12210 gene mshC 173099 172614 CDS product MSHA fimbrial minor subunit MshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704372.1 protein_id gnl|my_center|LOCUS_12210 173563 173129 gene locus_tag LOCUS_12220 173563 173129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 174308 173694 gene locus_tag LOCUS_12230 174308 173694 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073808.1 protein_id gnl|my_center|LOCUS_12230 174820 174326 gene locus_tag LOCUS_12240 174820 174326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 176049 174823 gene locus_tag LOCUS_12250 176049 174823 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073810.1 protein_id gnl|my_center|LOCUS_12250 177809 176049 gene locus_tag LOCUS_12260 gene mshE 177809 176049 CDS product MSHA fimbrial ATPase MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 protein_id gnl|my_center|LOCUS_12260 178906 177806 gene locus_tag LOCUS_12270 178906 177806 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819183.1 protein_id gnl|my_center|LOCUS_12270 179829 178903 gene locus_tag LOCUS_12280 179829 178903 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073813.1 protein_id gnl|my_center|LOCUS_12280 181480 179837 gene locus_tag LOCUS_12290 gene mshL 181480 179837 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073814.1 protein_id gnl|my_center|LOCUS_12290 181847 181470 gene locus_tag LOCUS_12300 181847 181470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 182530 181844 gene locus_tag LOCUS_12310 gene mshJ 182530 181844 CDS product MSHA fimbrial biogenesis protein MshJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704364.1 protein_id gnl|my_center|LOCUS_12310 183174 182527 gene locus_tag LOCUS_12320 183174 182527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 184109 183171 gene locus_tag LOCUS_12330 184109 183171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 184347 185264 gene locus_tag LOCUS_12340 184347 185264 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819958.1 protein_id gnl|my_center|LOCUS_12340 187079 185283 gene locus_tag LOCUS_12350 187079 185283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 187786 187382 gene locus_tag LOCUS_12360 187786 187382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 187913 188506 gene locus_tag LOCUS_12370 187913 188506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 188514 189017 gene locus_tag LOCUS_12380 gene coaD 188514 189017 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074274.1 protein_id gnl|my_center|LOCUS_12380 190322 190894 gene locus_tag LOCUS_12390 190322 190894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 190963 191559 gene locus_tag LOCUS_12400 190963 191559 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113995.1 protein_id gnl|my_center|LOCUS_12400 191569 193473 gene locus_tag LOCUS_12410 191569 193473 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477111.1 protein_id gnl|my_center|LOCUS_12410 193466 193984 gene locus_tag LOCUS_12420 193466 193984 CDS product DUF2937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082681.1 protein_id gnl|my_center|LOCUS_12420 195986 194061 gene locus_tag LOCUS_12430 195986 194061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 196863 196222 gene locus_tag LOCUS_12440 196863 196222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 197603 197229 gene locus_tag LOCUS_12450 197603 197229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 198498 197728 gene locus_tag LOCUS_12460 gene ppk2 198498 197728 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086042.1 protein_id gnl|my_center|LOCUS_12460 199041 198508 gene locus_tag LOCUS_12470 199041 198508 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423707.1 protein_id gnl|my_center|LOCUS_12470 199155 199751 gene locus_tag LOCUS_12480 199155 199751 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122936.1 protein_id gnl|my_center|LOCUS_12480 201352 199805 gene locus_tag LOCUS_12490 gene ilvA 201352 199805 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481158.1 protein_id gnl|my_center|LOCUS_12490 203284 201443 gene locus_tag LOCUS_12500 gene ilvD 203284 201443 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481171.1 protein_id gnl|my_center|LOCUS_12500 204394 203465 gene locus_tag LOCUS_12510 204394 203465 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707859.1 protein_id gnl|my_center|LOCUS_12510 204679 204413 gene locus_tag LOCUS_12520 gene ilvM 204679 204413 CDS product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001576447.1 protein_id gnl|my_center|LOCUS_12520 206322 204679 gene locus_tag LOCUS_12530 gene ilvG 206322 204679 CDS product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099288.1 protein_id gnl|my_center|LOCUS_12530 206795 207523 gene locus_tag LOCUS_12540 206795 207523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 207586 209838 gene locus_tag LOCUS_12550 207586 209838 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444419.1 protein_id gnl|my_center|LOCUS_12550 210378 209857 gene locus_tag LOCUS_12560 210378 209857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 211313 210423 gene locus_tag LOCUS_12570 211313 210423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 213776 211401 gene locus_tag LOCUS_12580 213776 211401 CDS product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489176.1 protein_id gnl|my_center|LOCUS_12580 213986 222196 gene locus_tag LOCUS_12590 213986 222196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 222256 222960 gene locus_tag LOCUS_12600 222256 222960 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639909.1 protein_id gnl|my_center|LOCUS_12600 222981 224429 gene locus_tag LOCUS_12610 222981 224429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 224571 226586 gene locus_tag LOCUS_12620 224571 226586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 226723 228642 gene locus_tag LOCUS_12630 226723 228642 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074214.1 protein_id gnl|my_center|LOCUS_12630 229121 229354 gene locus_tag LOCUS_12640 229121 229354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 229365 232505 gene locus_tag LOCUS_12650 229365 232505 CDS product DUF3427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070731.1 protein_id gnl|my_center|LOCUS_12650 233349 233035 gene locus_tag LOCUS_12660 233349 233035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 233603 233484 gene locus_tag LOCUS_12670 233603 233484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 233945 234235 gene locus_tag LOCUS_12680 233945 234235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 234225 235535 gene locus_tag LOCUS_12690 234225 235535 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_12690 236487 235615 gene locus_tag LOCUS_12700 236487 235615 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707879.1 protein_id gnl|my_center|LOCUS_12700 238212 236581 gene locus_tag LOCUS_12710 gene ubiB 238212 236581 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211535.1 protein_id gnl|my_center|LOCUS_12710 238832 238209 gene locus_tag LOCUS_12720 238832 238209 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478696.1 protein_id gnl|my_center|LOCUS_12720 239587 238832 gene locus_tag LOCUS_12730 gene ubiE 239587 238832 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416847.1 protein_id gnl|my_center|LOCUS_12730 239857 241017 gene locus_tag LOCUS_12740 239857 241017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 241267 241755 gene locus_tag LOCUS_12750 241267 241755 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072083.1 protein_id gnl|my_center|LOCUS_12750 241844 242350 gene locus_tag LOCUS_12760 241844 242350 CDS product DUF3087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071687.1 protein_id gnl|my_center|LOCUS_12760 243051 242347 gene locus_tag LOCUS_12770 243051 242347 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705830.1 protein_id gnl|my_center|LOCUS_12770 244778 243048 gene locus_tag LOCUS_12780 244778 243048 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269005.1 protein_id gnl|my_center|LOCUS_12780 244967 245392 gene locus_tag LOCUS_12790 244967 245392 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037208.1 protein_id gnl|my_center|LOCUS_12790 245471 246691 gene locus_tag LOCUS_12800 245471 246691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 247375 246710 gene locus_tag LOCUS_12810 247375 246710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 247436 248395 gene locus_tag LOCUS_12820 247436 248395 CDS product bifunctional GNAT family N-acetyltransferase/hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456791.1 protein_id gnl|my_center|LOCUS_12820 248402 249586 gene locus_tag LOCUS_12830 248402 249586 CDS product DUF3095 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616634.1 protein_id gnl|my_center|LOCUS_12830 251125 249662 gene locus_tag LOCUS_12840 251125 249662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 252833 251448 gene locus_tag LOCUS_12850 gene trkA 252833 251448 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421528.1 protein_id gnl|my_center|LOCUS_12850 254152 252851 gene locus_tag LOCUS_12860 gene rsmB 254152 252851 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421526.1 protein_id gnl|my_center|LOCUS_12860 255087 254149 gene locus_tag LOCUS_12870 gene fmt 255087 254149 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070447.1 protein_id gnl|my_center|LOCUS_12870 255624 255118 gene locus_tag LOCUS_12880 gene def 255624 255118 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461416.1 protein_id gnl|my_center|LOCUS_12880 255744 256847 gene locus_tag LOCUS_12890 255744 256847 CDS product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070449.1 protein_id gnl|my_center|LOCUS_12890 256890 257987 gene locus_tag LOCUS_12900 gene dprA 256890 257987 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948297.1 protein_id gnl|my_center|LOCUS_12900 257993 258469 gene locus_tag LOCUS_12910 257993 258469 CDS product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070451.1 protein_id gnl|my_center|LOCUS_12910 258505 259083 gene locus_tag LOCUS_12920 258505 259083 CDS product topoisomerase DNA-binding C4 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070452.1 protein_id gnl|my_center|LOCUS_12920 259109 259681 gene locus_tag LOCUS_12930 259109 259681 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070453.1 protein_id gnl|my_center|LOCUS_12930 259681 260619 gene locus_tag LOCUS_12940 gene hemF 259681 260619 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704273.1 protein_id gnl|my_center|LOCUS_12940 260999 260616 gene locus_tag LOCUS_12950 260999 260616 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526443.1 protein_id gnl|my_center|LOCUS_12950 261216 262022 gene locus_tag LOCUS_12960 gene aroE 261216 262022 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168154.1 protein_id gnl|my_center|LOCUS_12960 262604 262077 gene locus_tag LOCUS_12970 262604 262077 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070458.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence05 909 154 gene locus_tag LOCUS_12980 gene pssA 909 154 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073396.1 protein_id gnl|my_center|LOCUS_12980 3567 985 gene locus_tag LOCUS_12990 gene clpB 3567 985 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707734.1 protein_id gnl|my_center|LOCUS_12990 4377 3655 gene locus_tag LOCUS_13000 gene yfiH 4377 3655 CDS product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815687.1 protein_id gnl|my_center|LOCUS_13000 5369 4395 gene locus_tag LOCUS_13010 gene rluD 5369 4395 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460300.1 protein_id gnl|my_center|LOCUS_13010 5553 6311 gene locus_tag LOCUS_13020 5553 6311 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017409782.1 protein_id gnl|my_center|LOCUS_13020 7170 6445 gene locus_tag LOCUS_13030 7170 6445 CDS product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073551.1 protein_id gnl|my_center|LOCUS_13030 7328 7696 gene locus_tag LOCUS_13040 7328 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 9123 8011 gene locus_tag LOCUS_13050 9123 8011 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073220.1 protein_id gnl|my_center|LOCUS_13050 10167 9133 gene locus_tag LOCUS_13060 10167 9133 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073221.1 protein_id gnl|my_center|LOCUS_13060 10410 11084 gene locus_tag LOCUS_13070 10410 11084 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261215.1 protein_id gnl|my_center|LOCUS_13070 11173 11994 gene locus_tag LOCUS_13080 gene proC 11173 11994 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707387.1 protein_id gnl|my_center|LOCUS_13080 12120 12650 gene locus_tag LOCUS_13090 12120 12650 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073224.1 protein_id gnl|my_center|LOCUS_13090 12650 13123 gene locus_tag LOCUS_13100 12650 13123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 13320 15548 gene locus_tag LOCUS_13110 13320 15548 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388417.1 protein_id gnl|my_center|LOCUS_13110 17242 15647 gene locus_tag LOCUS_13120 17242 15647 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921866.1 protein_id gnl|my_center|LOCUS_13120 17780 19339 gene locus_tag LOCUS_13130 gene leuA 17780 19339 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704822.1 protein_id gnl|my_center|LOCUS_13130 19371 20471 gene locus_tag LOCUS_13140 gene leuB 19371 20471 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073915.1 protein_id gnl|my_center|LOCUS_13140 20535 21944 gene locus_tag LOCUS_13150 gene leuC 20535 21944 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167044.1 protein_id gnl|my_center|LOCUS_13150 21944 22546 gene locus_tag LOCUS_13160 gene leuD 21944 22546 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818262.1 protein_id gnl|my_center|LOCUS_13160 22647 23411 gene locus_tag LOCUS_13170 22647 23411 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073756.1 protein_id gnl|my_center|LOCUS_13170 23742 23449 gene locus_tag LOCUS_13180 23742 23449 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262427.1 protein_id gnl|my_center|LOCUS_13180 25074 23923 gene locus_tag LOCUS_13190 25074 23923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 25237 25557 gene locus_tag LOCUS_13200 25237 25557 CDS product DUF2956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073471.1 protein_id gnl|my_center|LOCUS_13200 26552 25551 gene locus_tag LOCUS_13210 26552 25551 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984106.1 protein_id gnl|my_center|LOCUS_13210 27928 26549 gene locus_tag LOCUS_13220 27928 26549 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887578.1 protein_id gnl|my_center|LOCUS_13220 28592 28044 gene locus_tag LOCUS_13230 28592 28044 CDS product GbsR/MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815169.1 protein_id gnl|my_center|LOCUS_13230 29061 28753 gene locus_tag LOCUS_13240 29061 28753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 29199 30338 gene locus_tag LOCUS_13250 gene rlmG 29199 30338 CDS product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703562.1 protein_id gnl|my_center|LOCUS_13250 30351 30944 gene locus_tag LOCUS_13260 30351 30944 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073582.1 protein_id gnl|my_center|LOCUS_13260 30992 31315 gene locus_tag LOCUS_13270 30992 31315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073583.1 protein_id gnl|my_center|LOCUS_13270 31674 32714 gene locus_tag LOCUS_13280 31674 32714 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 protein_id gnl|my_center|LOCUS_13280 32724 32900 gene locus_tag LOCUS_13290 32724 32900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 33107 32958 gene locus_tag LOCUS_13300 33107 32958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 33456 34745 gene locus_tag LOCUS_13310 33456 34745 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463736.1 protein_id gnl|my_center|LOCUS_13310 34776 36698 gene locus_tag LOCUS_13320 34776 36698 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115754.1 protein_id gnl|my_center|LOCUS_13320 37949 36753 gene locus_tag LOCUS_13330 gene tyrS 37949 36753 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071526.1 protein_id gnl|my_center|LOCUS_13330 38205 39614 gene locus_tag LOCUS_13340 38205 39614 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071525.1 protein_id gnl|my_center|LOCUS_13340 39614 40711 gene locus_tag LOCUS_13350 39614 40711 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071524.1 protein_id gnl|my_center|LOCUS_13350 41009 40680 gene locus_tag LOCUS_13360 41009 40680 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970501.1 protein_id gnl|my_center|LOCUS_13360 41856 41146 gene locus_tag LOCUS_13370 41856 41146 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103932.1 protein_id gnl|my_center|LOCUS_13370 43877 41961 gene locus_tag LOCUS_13380 gene htpG 43877 41961 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706320.1 protein_id gnl|my_center|LOCUS_13380 44716 44108 gene locus_tag LOCUS_13390 gene recR 44716 44108 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633741.1 protein_id gnl|my_center|LOCUS_13390 44954 46813 gene locus_tag LOCUS_13400 44954 46813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 47017 47967 gene locus_tag LOCUS_13410 47017 47967 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072569.1 protein_id gnl|my_center|LOCUS_13410 48164 47985 gene locus_tag LOCUS_13420 48164 47985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 48569 48183 gene locus_tag LOCUS_13430 48569 48183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 49099 48770 gene locus_tag LOCUS_13440 49099 48770 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706069.1 protein_id gnl|my_center|LOCUS_13440 52076 49131 gene locus_tag LOCUS_13450 gene dnaX 52076 49131 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072097.1 protein_id gnl|my_center|LOCUS_13450 52633 52085 gene locus_tag LOCUS_13460 gene apt 52633 52085 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072096.1 protein_id gnl|my_center|LOCUS_13460 53122 52754 gene locus_tag LOCUS_13470 53122 52754 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545197.1 protein_id gnl|my_center|LOCUS_13470 53388 53263 gene locus_tag LOCUS_13480 53388 53263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 54238 53513 gene locus_tag LOCUS_13490 54238 53513 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072093.1 protein_id gnl|my_center|LOCUS_13490 55081 54239 gene locus_tag LOCUS_13500 55081 54239 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072092.1 protein_id gnl|my_center|LOCUS_13500 55639 55148 gene locus_tag LOCUS_13510 55639 55148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 55814 56176 gene locus_tag LOCUS_13520 55814 56176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 57049 56204 gene locus_tag LOCUS_13530 gene rlmJ 57049 56204 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707316.1 protein_id gnl|my_center|LOCUS_13530 57347 57811 gene locus_tag LOCUS_13540 57347 57811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 59248 57896 gene locus_tag LOCUS_13550 gene lysC 59248 57896 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073717.1 protein_id gnl|my_center|LOCUS_13550 60617 60879 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 61154 61822 gene locus_tag LOCUS_13560 61154 61822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 62848 61922 gene locus_tag LOCUS_13570 gene ylqF 62848 61922 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072540.1 protein_id gnl|my_center|LOCUS_13570 64141 63002 gene locus_tag LOCUS_13580 64141 63002 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348847.1 protein_id gnl|my_center|LOCUS_13580 65942 64152 gene locus_tag LOCUS_13590 gene oadA 65942 64152 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_13590 66218 65961 gene locus_tag LOCUS_13600 66218 65961 CDS product oxaloacetate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106067.1 protein_id gnl|my_center|LOCUS_13600 66720 66644 gene locus_tag LOCUS_t00140 66720 66644 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 66819 66743 gene locus_tag LOCUS_t00150 66819 66743 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 66932 66840 gene locus_tag LOCUS_t00160 66932 66840 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 67356 67174 gene locus_tag LOCUS_13610 67356 67174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 69171 67744 gene locus_tag LOCUS_13620 69171 67744 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_13620 71177 69207 gene locus_tag LOCUS_13630 71177 69207 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261723.1 protein_id gnl|my_center|LOCUS_13630 72488 71802 gene locus_tag LOCUS_13640 72488 71802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 72691 73284 gene locus_tag LOCUS_13650 72691 73284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 75260 73317 gene locus_tag LOCUS_13660 gene acs 75260 73317 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287249.1 protein_id gnl|my_center|LOCUS_13660 75691 76029 gene locus_tag LOCUS_13670 gene glnK 75691 76029 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_13670 76063 77343 gene locus_tag LOCUS_13680 76063 77343 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344468.1 protein_id gnl|my_center|LOCUS_13680 78938 77775 gene locus_tag LOCUS_13690 78938 77775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 79449 79081 gene locus_tag LOCUS_13700 79449 79081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 79579 79854 gene locus_tag LOCUS_13710 79579 79854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 80708 79881 gene locus_tag LOCUS_13720 80708 79881 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070950.1 protein_id gnl|my_center|LOCUS_13720 82186 80717 gene locus_tag LOCUS_13730 gene astD 82186 80717 CDS product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418134.1 protein_id gnl|my_center|LOCUS_13730 83246 82197 gene locus_tag LOCUS_13740 gene astA 83246 82197 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262693.1 protein_id gnl|my_center|LOCUS_13740 84368 83310 gene locus_tag LOCUS_13750 84368 83310 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_13750 84458 84823 gene locus_tag LOCUS_13760 gene folX 84458 84823 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365570.1 protein_id gnl|my_center|LOCUS_13760 84862 85752 gene locus_tag LOCUS_13770 84862 85752 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707235.1 protein_id gnl|my_center|LOCUS_13770 87751 85850 gene locus_tag LOCUS_13780 gene ppiD 87751 85850 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817666.1 protein_id gnl|my_center|LOCUS_13780 88162 87887 gene locus_tag LOCUS_13790 gene hupB 88162 87887 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005315375.1 protein_id gnl|my_center|LOCUS_13790 90744 88396 gene locus_tag LOCUS_13800 gene lon 90744 88396 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005493728.1 protein_id gnl|my_center|LOCUS_13800 92282 90993 gene locus_tag LOCUS_13810 gene clpX 92282 90993 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301524.1 protein_id gnl|my_center|LOCUS_13810 92963 92340 gene locus_tag LOCUS_13820 gene clpP 92963 92340 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071916.1 protein_id gnl|my_center|LOCUS_13820 94357 93059 gene locus_tag LOCUS_13830 gene tig 94357 93059 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071915.1 protein_id gnl|my_center|LOCUS_13830 94731 94655 gene locus_tag LOCUS_t00170 94731 94655 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 94826 94751 gene locus_tag LOCUS_t00180 94826 94751 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 94925 94849 gene locus_tag LOCUS_t00190 94925 94849 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 95040 94964 gene locus_tag LOCUS_t00200 95040 94964 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 95293 96138 gene locus_tag LOCUS_13840 95293 96138 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941571.1 protein_id gnl|my_center|LOCUS_13840 98074 96197 gene locus_tag LOCUS_13850 98074 96197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 98941 98552 gene locus_tag LOCUS_13860 98941 98552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 99679 99431 gene locus_tag LOCUS_13870 99679 99431 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071548.1 protein_id gnl|my_center|LOCUS_13870 99786 100694 gene locus_tag LOCUS_13880 gene ygfZ 99786 100694 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704740.1 protein_id gnl|my_center|LOCUS_13880 100703 101230 gene locus_tag LOCUS_13890 gene slyD 100703 101230 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099037.1 protein_id gnl|my_center|LOCUS_13890 102065 101334 gene locus_tag LOCUS_13900 102065 101334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 102180 102782 gene locus_tag LOCUS_13910 102180 102782 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261211.1 protein_id gnl|my_center|LOCUS_13910 102785 103921 gene locus_tag LOCUS_13920 gene hemW 102785 103921 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704790.1 protein_id gnl|my_center|LOCUS_13920 103942 104502 gene locus_tag LOCUS_13930 103942 104502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 105025 104672 gene locus_tag LOCUS_13940 105025 104672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 105639 105097 gene locus_tag LOCUS_13950 105639 105097 CDS product DUF1566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462950.1 protein_id gnl|my_center|LOCUS_13950 107390 105642 gene locus_tag LOCUS_13960 107390 105642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 107682 110186 gene locus_tag LOCUS_13970 107682 110186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 112330 110621 gene locus_tag LOCUS_13980 112330 110621 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 protein_id gnl|my_center|LOCUS_13980 112613 114847 gene locus_tag LOCUS_13990 112613 114847 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943246.1 protein_id gnl|my_center|LOCUS_13990 115054 115983 gene locus_tag LOCUS_14000 gene folE2 115054 115983 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099665.1 protein_id gnl|my_center|LOCUS_14000 116339 120808 gene locus_tag LOCUS_14010 gene gltB 116339 120808 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706515.1 protein_id gnl|my_center|LOCUS_14010 120818 122233 gene locus_tag LOCUS_14020 120818 122233 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461217.1 protein_id gnl|my_center|LOCUS_14020 125535 122635 gene locus_tag LOCUS_14030 125535 122635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 125673 127076 gene locus_tag LOCUS_14040 125673 127076 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_14040 127092 127565 gene locus_tag LOCUS_14050 127092 127565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 127644 128441 gene locus_tag LOCUS_14060 127644 128441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14060 128577 130307 gene locus_tag LOCUS_14070 128577 130307 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071465.1 protein_id gnl|my_center|LOCUS_14070 130498 131238 gene locus_tag LOCUS_14080 130498 131238 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350202.1 protein_id gnl|my_center|LOCUS_14080 131238 132755 gene locus_tag LOCUS_14090 131238 132755 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705413.1 protein_id gnl|my_center|LOCUS_14090 132757 133698 gene locus_tag LOCUS_14100 132757 133698 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705412.1 protein_id gnl|my_center|LOCUS_14100 135689 133704 gene locus_tag LOCUS_14110 135689 133704 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072362.1 protein_id gnl|my_center|LOCUS_14110 136621 135695 gene locus_tag LOCUS_14120 136621 135695 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_14120 136762 137694 gene locus_tag LOCUS_14130 136762 137694 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306982.1 protein_id gnl|my_center|LOCUS_14130 137703 140264 gene locus_tag LOCUS_14140 gene ppc 137703 140264 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262715.1 protein_id gnl|my_center|LOCUS_14140 141332 140457 gene locus_tag LOCUS_14150 141332 140457 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464103.1 protein_id gnl|my_center|LOCUS_14150 141446 142606 gene locus_tag LOCUS_14160 141446 142606 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464060.1 protein_id gnl|my_center|LOCUS_14160 142777 144183 gene locus_tag LOCUS_14170 142777 144183 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073049.1 protein_id gnl|my_center|LOCUS_14170 144586 144164 gene locus_tag LOCUS_14180 144586 144164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 145480 144620 gene locus_tag LOCUS_14190 145480 144620 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114805.1 protein_id gnl|my_center|LOCUS_14190 146082 145483 gene locus_tag LOCUS_14200 146082 145483 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549943.1 protein_id gnl|my_center|LOCUS_14200 146183 147073 gene locus_tag LOCUS_14210 146183 147073 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091534.1 protein_id gnl|my_center|LOCUS_14210 147165 150851 gene locus_tag LOCUS_14220 147165 150851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 151523 150951 gene locus_tag LOCUS_14230 151523 150951 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 protein_id gnl|my_center|LOCUS_14230 152192 151536 gene locus_tag LOCUS_14240 152192 151536 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877137.1 protein_id gnl|my_center|LOCUS_14240 152386 153561 gene locus_tag LOCUS_14250 152386 153561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 153883 153617 gene locus_tag LOCUS_14260 153883 153617 CDS product DUF2999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261206.1 protein_id gnl|my_center|LOCUS_14260 154910 154029 gene locus_tag LOCUS_14270 154910 154029 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454103.1 protein_id gnl|my_center|LOCUS_14270 155669 155082 gene locus_tag LOCUS_14280 155669 155082 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104401.1 protein_id gnl|my_center|LOCUS_14280 156260 155688 gene locus_tag LOCUS_14290 gene lepB 156260 155688 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072829.1 protein_id gnl|my_center|LOCUS_14290 156868 157410 gene locus_tag LOCUS_14300 156868 157410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 157469 158092 gene locus_tag LOCUS_14310 157469 158092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 158086 159057 gene locus_tag LOCUS_14320 gene cbiB 158086 159057 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038177.1 protein_id gnl|my_center|LOCUS_14320 159062 160114 gene locus_tag LOCUS_14330 gene cobD 159062 160114 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268580.1 protein_id gnl|my_center|LOCUS_14330 160663 160094 gene locus_tag LOCUS_14340 160663 160094 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_14340 160833 162614 gene locus_tag LOCUS_14350 160833 162614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 163635 162685 gene locus_tag LOCUS_14360 163635 162685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 165477 163789 gene locus_tag LOCUS_14370 165477 163789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 165741 167936 gene locus_tag LOCUS_14380 165741 167936 CDS product OsmC domain/YcaO domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071092.1 protein_id gnl|my_center|LOCUS_14380 168624 168094 gene locus_tag LOCUS_14390 168624 168094 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_14390 171173 169083 gene locus_tag LOCUS_14400 171173 169083 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815838.1 protein_id gnl|my_center|LOCUS_14400 172081 171164 gene locus_tag LOCUS_14410 172081 171164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 172412 172074 gene locus_tag LOCUS_14420 172412 172074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 175787 172881 gene locus_tag LOCUS_14430 gene gcvP 175787 172881 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705609.1 protein_id gnl|my_center|LOCUS_14430 176326 175937 gene locus_tag LOCUS_14440 gene gcvH 176326 175937 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454126.1 protein_id gnl|my_center|LOCUS_14440 177406 176378 gene locus_tag LOCUS_14450 gene gcvT 177406 176378 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068693.1 protein_id gnl|my_center|LOCUS_14450 179658 177559 gene locus_tag LOCUS_14460 179658 177559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 180669 179848 gene locus_tag LOCUS_14470 180669 179848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 180807 183584 gene locus_tag LOCUS_14480 gene barA 180807 183584 CDS product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262546.1 protein_id gnl|my_center|LOCUS_14480 183691 185481 gene locus_tag LOCUS_14490 183691 185481 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103469.1 protein_id gnl|my_center|LOCUS_14490 185481 187181 gene locus_tag LOCUS_14500 gene cysI 185481 187181 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073520.1 protein_id gnl|my_center|LOCUS_14500 187153 187914 gene locus_tag LOCUS_14510 187153 187914 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133791.1 protein_id gnl|my_center|LOCUS_14510 188891 188343 gene locus_tag LOCUS_14520 188891 188343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 189347 190000 gene locus_tag LOCUS_14530 189347 190000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 190273 191244 gene locus_tag LOCUS_14540 190273 191244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 191345 191656 gene locus_tag LOCUS_14550 191345 191656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 192893 192213 gene locus_tag LOCUS_14560 gene ybiX 192893 192213 CDS product PKHD-type hydroxylase YbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990159.1 protein_id gnl|my_center|LOCUS_14560 195172 192905 gene locus_tag LOCUS_14570 195172 192905 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221892407.1 protein_id gnl|my_center|LOCUS_14570 196854 195481 gene locus_tag LOCUS_14580 gene aztD 196854 195481 CDS product metallochaperone AztD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383481.1 protein_id gnl|my_center|LOCUS_14580 199283 196893 gene locus_tag LOCUS_14590 gene znuD 199283 196893 CDS product zinc piracy TonB-dependent receptor ZnuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207628.1 protein_id gnl|my_center|LOCUS_14590 199511 200923 gene locus_tag LOCUS_14600 gene cysG 199511 200923 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207488.1 protein_id gnl|my_center|LOCUS_14600 201152 201682 gene locus_tag LOCUS_14610 201152 201682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 201766 202332 gene locus_tag LOCUS_14620 gene yeiP 201766 202332 CDS product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261881.1 protein_id gnl|my_center|LOCUS_14620 203711 202440 gene locus_tag LOCUS_14630 203711 202440 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_14630 204455 203901 gene locus_tag LOCUS_14640 204455 203901 CDS product DUF6436 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352065.1 protein_id gnl|my_center|LOCUS_14640 205929 204433 gene locus_tag LOCUS_14650 205929 204433 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103057.1 protein_id gnl|my_center|LOCUS_14650 206633 206094 gene locus_tag LOCUS_14660 206633 206094 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033534649.1 protein_id gnl|my_center|LOCUS_14660 206793 207749 gene locus_tag LOCUS_14670 206793 207749 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072987.1 protein_id gnl|my_center|LOCUS_14670 207783 208709 gene locus_tag LOCUS_14680 207783 208709 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072988.1 protein_id gnl|my_center|LOCUS_14680 208706 209263 gene locus_tag LOCUS_14690 208706 209263 CDS product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021659.1 protein_id gnl|my_center|LOCUS_14690 209256 210281 gene locus_tag LOCUS_14700 209256 210281 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072990.1 protein_id gnl|my_center|LOCUS_14700 210274 212229 gene locus_tag LOCUS_14710 210274 212229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 212223 213944 gene locus_tag LOCUS_14720 212223 213944 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072992.1 protein_id gnl|my_center|LOCUS_14720 214172 214741 gene locus_tag LOCUS_14730 214172 214741 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706006.1 protein_id gnl|my_center|LOCUS_14730 214734 215453 gene locus_tag LOCUS_14740 214734 215453 CDS product DUF3379 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457663.1 protein_id gnl|my_center|LOCUS_14740 215720 216046 gene locus_tag LOCUS_14750 215720 216046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 216070 216777 gene locus_tag LOCUS_14760 216070 216777 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479958.1 protein_id gnl|my_center|LOCUS_14760 217058 216846 gene locus_tag LOCUS_14770 217058 216846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 218512 217367 gene locus_tag LOCUS_14780 gene nagA 218512 217367 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073344.1 protein_id gnl|my_center|LOCUS_14780 218670 218515 gene locus_tag LOCUS_14790 218670 218515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 218789 219826 gene locus_tag LOCUS_14800 218789 219826 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073351.1 protein_id gnl|my_center|LOCUS_14800 221290 219866 gene locus_tag LOCUS_14810 221290 219866 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119251.1 protein_id gnl|my_center|LOCUS_14810 221986 221330 gene locus_tag LOCUS_14820 221986 221330 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141283.1 protein_id gnl|my_center|LOCUS_14820 222194 223036 gene locus_tag LOCUS_14830 222194 223036 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925699.1 protein_id gnl|my_center|LOCUS_14830 223208 223636 gene locus_tag LOCUS_14840 223208 223636 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463837.1 protein_id gnl|my_center|LOCUS_14840 224398 223763 gene locus_tag LOCUS_14850 224398 223763 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074052.1 protein_id gnl|my_center|LOCUS_14850 224598 224401 gene locus_tag LOCUS_14860 224598 224401 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990233.1 protein_id gnl|my_center|LOCUS_14860 224804 225832 gene locus_tag LOCUS_14870 224804 225832 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108031.1 protein_id gnl|my_center|LOCUS_14870 227337 226060 gene locus_tag LOCUS_14880 gene srmB 227337 226060 CDS product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597951.1 protein_id gnl|my_center|LOCUS_14880 227502 230615 gene locus_tag LOCUS_14890 227502 230615 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071804.1 protein_id gnl|my_center|LOCUS_14890 231963 230662 gene locus_tag LOCUS_14900 gene murD 231963 230662 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037868.1 protein_id gnl|my_center|LOCUS_14900 233317 231956 gene locus_tag LOCUS_14910 gene murL 233317 231956 CDS product UDP-N-acetyl-alpha-D-muramoyl-L-alanyl-L-glutamate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037869.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence06 586 511 gene locus_tag LOCUS_t00210 586 511 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 665 591 gene locus_tag LOCUS_t00220 665 591 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 778 694 gene locus_tag LOCUS_t00230 778 694 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 875 800 gene locus_tag LOCUS_t00240 875 800 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1413 1015 gene locus_tag LOCUS_14920 1413 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 1513 2565 gene locus_tag LOCUS_14930 1513 2565 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263655.1 protein_id gnl|my_center|LOCUS_14930 3179 2547 gene locus_tag LOCUS_14940 3179 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 5055 3337 gene locus_tag LOCUS_14950 5055 3337 CDS product GGDEF domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070885.1 protein_id gnl|my_center|LOCUS_14950 6074 5322 gene locus_tag LOCUS_14960 6074 5322 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093768.1 protein_id gnl|my_center|LOCUS_14960 7126 6071 gene locus_tag LOCUS_14970 gene birA 7126 6071 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707707.1 protein_id gnl|my_center|LOCUS_14970 8177 7134 gene locus_tag LOCUS_14980 gene murB 8177 7134 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694036.1 protein_id gnl|my_center|LOCUS_14980 9448 8177 gene locus_tag LOCUS_14990 9448 8177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 9975 9544 gene locus_tag LOCUS_15000 9975 9544 CDS product DUF3859 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123965.1 protein_id gnl|my_center|LOCUS_15000 10213 10401 gene locus_tag LOCUS_15010 10213 10401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 10714 11688 gene locus_tag LOCUS_15020 gene dusB 10714 11688 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421284.1 protein_id gnl|my_center|LOCUS_15020 11704 11997 gene locus_tag LOCUS_15030 gene fis 11704 11997 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462905.1 protein_id gnl|my_center|LOCUS_15030 12083 13669 gene locus_tag LOCUS_15040 gene purH 12083 13669 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456445.1 protein_id gnl|my_center|LOCUS_15040 13805 14707 gene locus_tag LOCUS_15050 13805 14707 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246274.1 protein_id gnl|my_center|LOCUS_15050 14757 16043 gene locus_tag LOCUS_15060 gene purD 14757 16043 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456447.1 protein_id gnl|my_center|LOCUS_15060 16368 19262 gene locus_tag LOCUS_15070 16368 19262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 19272 20486 gene locus_tag LOCUS_15080 19272 20486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 20473 21705 gene locus_tag LOCUS_15090 20473 21705 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244185.1 protein_id gnl|my_center|LOCUS_15090 22455 21754 gene locus_tag LOCUS_15100 gene rsuA 22455 21754 CDS product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073606.1 protein_id gnl|my_center|LOCUS_15100 22737 23798 gene locus_tag LOCUS_15110 22737 23798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 23975 25360 gene locus_tag LOCUS_15120 gene yegD 23975 25360 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261827.1 protein_id gnl|my_center|LOCUS_15120 27171 25696 gene locus_tag LOCUS_15130 27171 25696 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_15130 27928 27605 gene locus_tag LOCUS_15140 gene nirD 27928 27605 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 protein_id gnl|my_center|LOCUS_15140 30499 27947 gene locus_tag LOCUS_15150 gene nirB 30499 27947 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480247.1 protein_id gnl|my_center|LOCUS_15150 31316 30513 gene locus_tag LOCUS_15160 gene cobA 31316 30513 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479657.1 protein_id gnl|my_center|LOCUS_15160 32929 31610 gene locus_tag LOCUS_15170 32929 31610 CDS product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776921.1 protein_id gnl|my_center|LOCUS_15170 34761 32992 gene locus_tag LOCUS_15180 34761 32992 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403056.1 protein_id gnl|my_center|LOCUS_15180 36335 35115 gene locus_tag LOCUS_15190 36335 35115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 36814 37371 gene locus_tag LOCUS_15200 36814 37371 CDS product SEL1-like repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349413.1 protein_id gnl|my_center|LOCUS_15200 38329 37445 gene locus_tag LOCUS_15210 38329 37445 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261480.1 protein_id gnl|my_center|LOCUS_15210 39487 38444 gene locus_tag LOCUS_15220 39487 38444 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037036.1 protein_id gnl|my_center|LOCUS_15220 40123 39500 gene locus_tag LOCUS_15230 gene cheD 40123 39500 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 protein_id gnl|my_center|LOCUS_15230 40954 40133 gene locus_tag LOCUS_15240 40954 40133 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811915.1 protein_id gnl|my_center|LOCUS_15240 42181 41207 gene locus_tag LOCUS_15250 gene dusA 42181 41207 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073658.1 protein_id gnl|my_center|LOCUS_15250 44503 42263 gene locus_tag LOCUS_15260 gene vpsO 44503 42263 CDS product exopolysaccharide regulatory tyrosine autokinase VpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_15260 45022 44507 gene locus_tag LOCUS_15270 gene vpsN 45022 44507 CDS product exopolysaccharide export protein VpsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978825.1 protein_id gnl|my_center|LOCUS_15270 46186 45026 gene locus_tag LOCUS_15280 46186 45026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 47217 46489 gene locus_tag LOCUS_15290 47217 46489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 48051 47227 gene locus_tag LOCUS_15300 gene mscS 48051 47227 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 protein_id gnl|my_center|LOCUS_15300 48286 48921 gene locus_tag LOCUS_15310 gene crp 48286 48921 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085214.1 protein_id gnl|my_center|LOCUS_15310 49109 49915 gene locus_tag LOCUS_15320 49109 49915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 49927 51336 gene locus_tag LOCUS_15330 49927 51336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 51333 52370 gene locus_tag LOCUS_15340 51333 52370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 52370 53077 gene locus_tag LOCUS_15350 52370 53077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 53085 53822 gene locus_tag LOCUS_15360 53085 53822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 53812 54603 gene locus_tag LOCUS_15370 53812 54603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 54600 55250 gene locus_tag LOCUS_15380 54600 55250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948859.1 protein_id gnl|my_center|LOCUS_15380 55250 56224 gene locus_tag LOCUS_15390 55250 56224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 56337 57320 gene locus_tag LOCUS_15400 56337 57320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 57342 59318 gene locus_tag LOCUS_15410 57342 59318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 59332 62181 gene locus_tag LOCUS_15420 59332 62181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 63342 62575 gene locus_tag LOCUS_15430 63342 62575 CDS product TIGR04219 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208017.1 protein_id gnl|my_center|LOCUS_15430 63860 63501 gene locus_tag LOCUS_15440 63860 63501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 64155 63862 gene locus_tag LOCUS_15450 64155 63862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 65011 64289 gene locus_tag LOCUS_15460 65011 64289 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073261.1 protein_id gnl|my_center|LOCUS_15460 66007 65105 gene locus_tag LOCUS_15470 66007 65105 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932752.1 protein_id gnl|my_center|LOCUS_15470 67176 66007 gene locus_tag LOCUS_15480 67176 66007 CDS product DUF3570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072166.1 protein_id gnl|my_center|LOCUS_15480 67413 67195 gene locus_tag LOCUS_15490 67413 67195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 67911 67423 gene locus_tag LOCUS_15500 67911 67423 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072164.1 protein_id gnl|my_center|LOCUS_15500 69247 67913 gene locus_tag LOCUS_15510 69247 67913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 72693 69259 gene locus_tag LOCUS_15520 72693 69259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 73096 74490 gene locus_tag LOCUS_15530 gene miaB 73096 74490 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649877.1 protein_id gnl|my_center|LOCUS_15530 74553 75596 gene locus_tag LOCUS_15540 74553 75596 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490838.1 protein_id gnl|my_center|LOCUS_15540 75593 76084 gene locus_tag LOCUS_15550 gene ybeY 75593 76084 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418185.1 protein_id gnl|my_center|LOCUS_15550 76106 76975 gene locus_tag LOCUS_15560 gene corC 76106 76975 CDS product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707019.1 protein_id gnl|my_center|LOCUS_15560 76975 78540 gene locus_tag LOCUS_15570 gene lnt 76975 78540 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071408.1 protein_id gnl|my_center|LOCUS_15570 78527 79492 gene locus_tag LOCUS_15580 78527 79492 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_15580 80024 79506 gene locus_tag LOCUS_15590 80024 79506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 80665 80012 gene locus_tag LOCUS_15600 gene rluA 80665 80012 CDS product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002888348.1 protein_id gnl|my_center|LOCUS_15600 82767 80788 gene locus_tag LOCUS_15610 82767 80788 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261424.1 protein_id gnl|my_center|LOCUS_15610 83284 82904 gene locus_tag LOCUS_15620 83284 82904 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073594.1 protein_id gnl|my_center|LOCUS_15620 83722 83384 gene locus_tag LOCUS_15630 83722 83384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072363.1 protein_id gnl|my_center|LOCUS_15630 84663 83800 gene locus_tag LOCUS_15640 84663 83800 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918705.1 protein_id gnl|my_center|LOCUS_15640 85433 84660 gene locus_tag LOCUS_15650 85433 84660 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201787933.1 protein_id gnl|my_center|LOCUS_15650 85617 86339 gene locus_tag LOCUS_15660 85617 86339 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918668.1 protein_id gnl|my_center|LOCUS_15660 87506 86394 gene locus_tag LOCUS_15670 87506 86394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 89334 87832 gene locus_tag LOCUS_15680 gene araA 89334 87832 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477429.1 protein_id gnl|my_center|LOCUS_15680 90081 89389 gene locus_tag LOCUS_15690 90081 89389 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704178.1 protein_id gnl|my_center|LOCUS_15690 91793 90081 gene locus_tag LOCUS_15700 gene araB 91793 90081 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951864.1 protein_id gnl|my_center|LOCUS_15700 93075 92164 gene locus_tag LOCUS_15710 gene lpxC 93075 92164 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262630.1 protein_id gnl|my_center|LOCUS_15710 94420 93239 gene locus_tag LOCUS_15720 gene ftsZ 94420 93239 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073896.1 protein_id gnl|my_center|LOCUS_15720 95686 94457 gene locus_tag LOCUS_15730 gene ftsA 95686 94457 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073897.1 protein_id gnl|my_center|LOCUS_15730 96451 95705 gene locus_tag LOCUS_15740 96451 95705 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073898.1 protein_id gnl|my_center|LOCUS_15740 97373 96444 gene locus_tag LOCUS_15750 97373 96444 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815570.1 protein_id gnl|my_center|LOCUS_15750 98827 97373 gene locus_tag LOCUS_15760 gene murC 98827 97373 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635950.1 protein_id gnl|my_center|LOCUS_15760 99890 98829 gene locus_tag LOCUS_15770 gene murG 99890 98829 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707580.1 protein_id gnl|my_center|LOCUS_15770 101112 99883 gene locus_tag LOCUS_15780 gene ftsW 101112 99883 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480004.1 protein_id gnl|my_center|LOCUS_15780 102226 101141 gene locus_tag LOCUS_15790 gene mraY 102226 101141 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458164.1 protein_id gnl|my_center|LOCUS_15790 103611 102226 gene locus_tag LOCUS_15800 gene murF 103611 102226 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458188.1 protein_id gnl|my_center|LOCUS_15800 105119 103608 gene locus_tag LOCUS_15810 gene murE 105119 103608 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262636.1 protein_id gnl|my_center|LOCUS_15810 106911 105109 gene locus_tag LOCUS_15820 106911 105109 CDS product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073906.1 protein_id gnl|my_center|LOCUS_15820 107258 106908 gene locus_tag LOCUS_15830 gene ftsL 107258 106908 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305726.1 protein_id gnl|my_center|LOCUS_15830 108186 107245 gene locus_tag LOCUS_15840 gene rsmH 108186 107245 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073908.1 protein_id gnl|my_center|LOCUS_15840 108668 108210 gene locus_tag LOCUS_15850 gene mraZ 108668 108210 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305730.1 protein_id gnl|my_center|LOCUS_15850 109686 109141 gene locus_tag LOCUS_15860 gene gmhB 109686 109141 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072769.1 protein_id gnl|my_center|LOCUS_15860 110785 109679 gene locus_tag LOCUS_15870 110785 109679 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074269.1 protein_id gnl|my_center|LOCUS_15870 110805 111524 gene locus_tag LOCUS_15880 110805 111524 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704082.1 protein_id gnl|my_center|LOCUS_15880 112366 111551 gene locus_tag LOCUS_15890 112366 111551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 114243 112804 gene locus_tag LOCUS_15900 gene hldE 114243 112804 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693548.1 protein_id gnl|my_center|LOCUS_15900 114847 114266 gene locus_tag LOCUS_15910 114847 114266 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880554.1 protein_id gnl|my_center|LOCUS_15910 115620 115351 gene locus_tag LOCUS_15920 gene yoeB 115620 115351 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_15920 115873 115601 gene locus_tag LOCUS_15930 115873 115601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 116098 117486 gene locus_tag LOCUS_15940 116098 117486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074956823.1 protein_id gnl|my_center|LOCUS_15940 117977 117887 gene locus_tag LOCUS_t00250 117977 117887 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 118168 120162 gene locus_tag LOCUS_15950 118168 120162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 120845 120231 gene locus_tag LOCUS_15960 120845 120231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946301.1 protein_id gnl|my_center|LOCUS_15960 124299 121174 gene locus_tag LOCUS_15970 124299 121174 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263309.1 protein_id gnl|my_center|LOCUS_15970 125828 124296 gene locus_tag LOCUS_15980 125828 124296 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190973259.1 protein_id gnl|my_center|LOCUS_15980 127230 125821 gene locus_tag LOCUS_15990 127230 125821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 127685 127329 gene locus_tag LOCUS_16000 127685 127329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 127881 127702 gene locus_tag LOCUS_16010 127881 127702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 127880 130216 gene locus_tag LOCUS_16020 127880 130216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 130217 130639 gene locus_tag LOCUS_16030 130217 130639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 130632 131912 gene locus_tag LOCUS_16040 130632 131912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 132850 131909 gene locus_tag LOCUS_16050 132850 131909 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262928.1 protein_id gnl|my_center|LOCUS_16050 133192 134376 gene locus_tag LOCUS_16060 133192 134376 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073334.1 protein_id gnl|my_center|LOCUS_16060 134387 137572 gene locus_tag LOCUS_16070 gene mexF 134387 137572 CDS product multidrug efflux RND transporter permease subunit MexF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089834.1 protein_id gnl|my_center|LOCUS_16070 137565 138941 gene locus_tag LOCUS_16080 137565 138941 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268124.1 protein_id gnl|my_center|LOCUS_16080 140031 139039 gene locus_tag LOCUS_16090 140031 139039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 141778 140120 gene locus_tag LOCUS_16100 141778 140120 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055228983.1 protein_id gnl|my_center|LOCUS_16100 142858 141998 gene locus_tag LOCUS_16110 142858 141998 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080622.1 protein_id gnl|my_center|LOCUS_16110 143050 143916 gene locus_tag LOCUS_16120 143050 143916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 144781 144170 gene locus_tag LOCUS_16130 144781 144170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 146127 144778 gene locus_tag LOCUS_16140 146127 144778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 147118 147034 gene locus_tag LOCUS_t00260 147118 147034 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 147479 147991 gene locus_tag LOCUS_16150 147479 147991 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104962.1 protein_id gnl|my_center|LOCUS_16150 148306 149889 gene locus_tag LOCUS_16160 148306 149889 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036949.1 protein_id gnl|my_center|LOCUS_16160 150209 152194 gene locus_tag LOCUS_16170 150209 152194 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036303.1 protein_id gnl|my_center|LOCUS_16170 153438 152266 gene locus_tag LOCUS_16180 153438 152266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 156801 153508 gene locus_tag LOCUS_16190 156801 153508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 158314 157097 gene locus_tag LOCUS_16200 gene moeA 158314 157097 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477201.1 protein_id gnl|my_center|LOCUS_16200 158406 160286 gene locus_tag LOCUS_16210 158406 160286 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707784.1 protein_id gnl|my_center|LOCUS_16210 161334 160375 gene locus_tag LOCUS_16220 161334 160375 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_16220 161807 161469 gene locus_tag LOCUS_16230 161807 161469 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010673955.1 protein_id gnl|my_center|LOCUS_16230 162078 162659 gene locus_tag LOCUS_16240 gene sodB 162078 162659 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863548.1 protein_id gnl|my_center|LOCUS_16240 162961 164883 gene locus_tag LOCUS_16250 162961 164883 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706273.1 protein_id gnl|my_center|LOCUS_16250 164980 166254 gene locus_tag LOCUS_16260 164980 166254 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072794.1 protein_id gnl|my_center|LOCUS_16260 166264 167793 gene locus_tag LOCUS_16270 166264 167793 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456192.1 protein_id gnl|my_center|LOCUS_16270 167849 168727 gene locus_tag LOCUS_16280 gene prmA 167849 168727 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070755.1 protein_id gnl|my_center|LOCUS_16280 169110 168778 gene locus_tag LOCUS_16290 169110 168778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 169488 169165 gene locus_tag LOCUS_16300 169488 169165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070896.1 protein_id gnl|my_center|LOCUS_16300 169640 169834 gene locus_tag LOCUS_16310 169640 169834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 170952 169957 gene locus_tag LOCUS_16320 gene epmB 170952 169957 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482201.1 protein_id gnl|my_center|LOCUS_16320 171108 171674 gene locus_tag LOCUS_16330 gene efp 171108 171674 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456976.1 protein_id gnl|my_center|LOCUS_16330 171879 172751 gene locus_tag LOCUS_16340 gene epmA 171879 172751 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456968.1 protein_id gnl|my_center|LOCUS_16340 174964 173006 gene locus_tag LOCUS_16350 174964 173006 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187268144.1 protein_id gnl|my_center|LOCUS_16350 175252 176160 gene locus_tag LOCUS_16360 175252 176160 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705126.1 protein_id gnl|my_center|LOCUS_16360 176289 176606 gene locus_tag LOCUS_16370 176289 176606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 177027 176599 gene locus_tag LOCUS_16380 gene syd 177027 176599 CDS product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459156.1 protein_id gnl|my_center|LOCUS_16380 177187 178035 gene locus_tag LOCUS_16390 gene queF 177187 178035 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049898.1 protein_id gnl|my_center|LOCUS_16390 178248 179816 gene locus_tag LOCUS_16400 178248 179816 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071723.1 protein_id gnl|my_center|LOCUS_16400 180213 181571 gene locus_tag LOCUS_16410 gene ppnN 180213 181571 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705076.1 protein_id gnl|my_center|LOCUS_16410 181579 182277 gene locus_tag LOCUS_16420 181579 182277 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262216.1 protein_id gnl|my_center|LOCUS_16420 182398 184140 gene locus_tag LOCUS_16430 182398 184140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 184172 185179 gene locus_tag LOCUS_16440 184172 185179 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071715.1 protein_id gnl|my_center|LOCUS_16440 185500 186414 gene locus_tag LOCUS_16450 gene yedA 185500 186414 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097747.1 protein_id gnl|my_center|LOCUS_16450 187852 186773 gene locus_tag LOCUS_16460 gene fbaA 187852 186773 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034368.1 protein_id gnl|my_center|LOCUS_16460 188645 187872 gene locus_tag LOCUS_16470 gene tpiA 188645 187872 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121241.1 protein_id gnl|my_center|LOCUS_16470 189271 188978 gene locus_tag LOCUS_16480 189271 188978 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070442.1 protein_id gnl|my_center|LOCUS_16480 189705 189289 gene locus_tag LOCUS_16490 189705 189289 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479357.1 protein_id gnl|my_center|LOCUS_16490 190117 189707 gene locus_tag LOCUS_16500 190117 189707 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144305.1 protein_id gnl|my_center|LOCUS_16500 191000 190110 gene locus_tag LOCUS_16510 191000 190110 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266170.1 protein_id gnl|my_center|LOCUS_16510 191200 191955 gene locus_tag LOCUS_16520 191200 191955 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228232.1 protein_id gnl|my_center|LOCUS_16520 195583 191981 gene locus_tag LOCUS_16530 195583 191981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 196773 195706 gene locus_tag LOCUS_16540 196773 195706 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037962.1 protein_id gnl|my_center|LOCUS_16540 197099 197389 gene locus_tag LOCUS_16550 197099 197389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 198695 197454 gene locus_tag LOCUS_16560 198695 197454 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465132.1 protein_id gnl|my_center|LOCUS_16560 199431 198730 gene locus_tag LOCUS_16570 199431 198730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 202589 199698 gene locus_tag LOCUS_16580 202589 199698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 202999 202706 gene locus_tag LOCUS_16590 202999 202706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 204420 202987 gene locus_tag LOCUS_16600 204420 202987 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114563.1 protein_id gnl|my_center|LOCUS_16600 205350 204466 gene locus_tag LOCUS_16610 gene ilvY 205350 204466 CDS product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074007.1 protein_id gnl|my_center|LOCUS_16610 205539 207029 gene locus_tag LOCUS_16620 gene ilvC 205539 207029 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074006.1 protein_id gnl|my_center|LOCUS_16620 207112 207981 gene locus_tag LOCUS_16630 207112 207981 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_16630 208797 208003 gene locus_tag LOCUS_16640 208797 208003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 208908 209657 gene locus_tag LOCUS_16650 208908 209657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 209685 210752 gene locus_tag LOCUS_16660 209685 210752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 210745 211521 gene locus_tag LOCUS_16670 210745 211521 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946557.1 protein_id gnl|my_center|LOCUS_16670 211563 212381 gene locus_tag LOCUS_16680 211563 212381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 213868 212390 gene locus_tag LOCUS_16690 213868 212390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 214003 216015 gene locus_tag LOCUS_16700 gene rep 214003 216015 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707891.1 protein_id gnl|my_center|LOCUS_16700 218585 215982 gene locus_tag LOCUS_16710 218585 215982 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073983.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence07 1068 103 gene locus_tag LOCUS_16720 gene rpoS 1068 103 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209397.1 protein_id gnl|my_center|LOCUS_16720 1955 1143 gene locus_tag LOCUS_16730 gene nlpD 1955 1143 CDS product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080440.1 protein_id gnl|my_center|LOCUS_16730 2942 1998 gene locus_tag LOCUS_16740 2942 1998 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_16740 3593 2946 gene locus_tag LOCUS_16750 3593 2946 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455562.1 protein_id gnl|my_center|LOCUS_16750 4429 3677 gene locus_tag LOCUS_16760 gene surE 4429 3677 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073291.1 protein_id gnl|my_center|LOCUS_16760 5460 4426 gene locus_tag LOCUS_16770 gene truD 5460 4426 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704773.1 protein_id gnl|my_center|LOCUS_16770 5939 5460 gene locus_tag LOCUS_16780 gene ispF 5939 5460 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073293.1 protein_id gnl|my_center|LOCUS_16780 6650 5943 gene locus_tag LOCUS_16790 gene ispD 6650 5943 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478544.1 protein_id gnl|my_center|LOCUS_16790 6933 6652 gene locus_tag LOCUS_16800 gene ftsB 6933 6652 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073295.1 protein_id gnl|my_center|LOCUS_16800 7568 6936 gene locus_tag LOCUS_16810 7568 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 9023 7728 gene locus_tag LOCUS_16820 gene eno 9023 7728 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036723.1 protein_id gnl|my_center|LOCUS_16820 10722 9097 gene locus_tag LOCUS_16830 10722 9097 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262542.1 protein_id gnl|my_center|LOCUS_16830 11228 12514 gene locus_tag LOCUS_16840 11228 12514 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706614.1 protein_id gnl|my_center|LOCUS_16840 12557 14812 gene locus_tag LOCUS_16850 12557 14812 CDS product arginine/lysine/ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191939.1 protein_id gnl|my_center|LOCUS_16850 15004 17160 gene locus_tag LOCUS_16860 15004 17160 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263215.1 protein_id gnl|my_center|LOCUS_16860 17719 17213 gene locus_tag LOCUS_16870 gene rraA 17719 17213 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457192.1 protein_id gnl|my_center|LOCUS_16870 17887 19500 gene locus_tag LOCUS_16880 17887 19500 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140233811.1 protein_id gnl|my_center|LOCUS_16880 19500 20528 gene locus_tag LOCUS_16890 19500 20528 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973574.1 protein_id gnl|my_center|LOCUS_16890 20518 21408 gene locus_tag LOCUS_16900 20518 21408 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071924.1 protein_id gnl|my_center|LOCUS_16900 21408 22394 gene locus_tag LOCUS_16910 21408 22394 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705749.1 protein_id gnl|my_center|LOCUS_16910 22395 23177 gene locus_tag LOCUS_16920 22395 23177 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071922.1 protein_id gnl|my_center|LOCUS_16920 23219 23686 gene locus_tag LOCUS_16930 gene argR 23219 23686 CDS product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098972.1 protein_id gnl|my_center|LOCUS_16930 23718 24413 gene locus_tag LOCUS_16940 gene mtnN 23718 24413 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461186.1 protein_id gnl|my_center|LOCUS_16940 24429 25409 gene locus_tag LOCUS_16950 24429 25409 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071531.1 protein_id gnl|my_center|LOCUS_16950 25534 26529 gene locus_tag LOCUS_16960 25534 26529 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_16960 26597 27961 gene locus_tag LOCUS_16970 gene ahcY 26597 27961 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099900.1 protein_id gnl|my_center|LOCUS_16970 29205 28231 gene locus_tag LOCUS_16980 29205 28231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 29391 31001 gene locus_tag LOCUS_16990 29391 31001 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104804.1 protein_id gnl|my_center|LOCUS_16990 31240 31022 gene locus_tag LOCUS_17000 31240 31022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 31182 31832 gene locus_tag LOCUS_17010 gene rhgT 31182 31832 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233825.1 protein_id gnl|my_center|LOCUS_17010 32113 31949 gene locus_tag LOCUS_17020 32113 31949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 32108 33523 gene locus_tag LOCUS_17030 32108 33523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 34863 33613 gene locus_tag LOCUS_17040 34863 33613 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074352.1 protein_id gnl|my_center|LOCUS_17040 35267 34851 gene locus_tag LOCUS_17050 gene umuD 35267 34851 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419177.1 protein_id gnl|my_center|LOCUS_17050 40233 35776 gene locus_tag LOCUS_17060 40233 35776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 40821 40745 gene locus_tag LOCUS_t00270 40821 40745 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 41739 40894 gene locus_tag LOCUS_17070 41739 40894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 42608 41823 gene locus_tag LOCUS_17080 42608 41823 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365615.1 protein_id gnl|my_center|LOCUS_17080 44140 42611 gene locus_tag LOCUS_17090 gene thiE 44140 42611 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704414.1 protein_id gnl|my_center|LOCUS_17090 45081 44269 gene locus_tag LOCUS_17100 45081 44269 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444472.1 protein_id gnl|my_center|LOCUS_17100 45281 45084 gene locus_tag LOCUS_17110 gene thiS 45281 45084 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199938.1 protein_id gnl|my_center|LOCUS_17110 46405 45311 gene locus_tag LOCUS_17120 46405 45311 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202820.1 protein_id gnl|my_center|LOCUS_17120 48464 46548 gene locus_tag LOCUS_17130 gene thiC 48464 46548 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260913.1 protein_id gnl|my_center|LOCUS_17130 48930 50543 gene locus_tag LOCUS_17140 48930 50543 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290511.1 protein_id gnl|my_center|LOCUS_17140 50567 50989 gene locus_tag LOCUS_17150 50567 50989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 51379 51017 gene locus_tag LOCUS_17160 51379 51017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 52447 51827 gene locus_tag LOCUS_17170 52447 51827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073386.1 protein_id gnl|my_center|LOCUS_17170 53976 52450 gene locus_tag LOCUS_17180 gene gshA 53976 52450 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704677.1 protein_id gnl|my_center|LOCUS_17180 54182 58396 gene locus_tag LOCUS_17190 54182 58396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 58471 58896 gene locus_tag LOCUS_17200 58471 58896 CDS product DUF3010 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263360.1 protein_id gnl|my_center|LOCUS_17200 59845 58976 gene locus_tag LOCUS_17210 gene motY 59845 58976 CDS product flagellar protein MotY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072693.1 protein_id gnl|my_center|LOCUS_17210 59987 60652 gene locus_tag LOCUS_17220 gene rnt 59987 60652 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490636.1 protein_id gnl|my_center|LOCUS_17220 61332 60727 gene locus_tag LOCUS_17230 61332 60727 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072695.1 protein_id gnl|my_center|LOCUS_17230 61661 61858 gene locus_tag LOCUS_17240 61661 61858 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035730.1 protein_id gnl|my_center|LOCUS_17240 62160 62366 gene locus_tag LOCUS_17250 62160 62366 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106983.1 protein_id gnl|my_center|LOCUS_17250 62674 65736 gene locus_tag LOCUS_17260 62674 65736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 65916 67115 gene locus_tag LOCUS_17270 65916 67115 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706654.1 protein_id gnl|my_center|LOCUS_17270 67162 67731 gene locus_tag LOCUS_17280 67162 67731 CDS product maltose acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721782.1 protein_id gnl|my_center|LOCUS_17280 68201 67788 gene locus_tag LOCUS_17290 gene arfB 68201 67788 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314723.1 protein_id gnl|my_center|LOCUS_17290 69552 68209 gene locus_tag LOCUS_17300 gene tilS 69552 68209 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176516.1 protein_id gnl|my_center|LOCUS_17300 70595 69636 gene locus_tag LOCUS_17310 gene accA 70595 69636 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349878.1 protein_id gnl|my_center|LOCUS_17310 74191 70712 gene locus_tag LOCUS_17320 gene dnaE 74191 70712 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705106.1 protein_id gnl|my_center|LOCUS_17320 74798 74184 gene locus_tag LOCUS_17330 gene rnhB 74798 74184 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480979.1 protein_id gnl|my_center|LOCUS_17330 75999 74788 gene locus_tag LOCUS_17340 gene lpxB 75999 74788 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480975.1 protein_id gnl|my_center|LOCUS_17340 76802 76014 gene locus_tag LOCUS_17350 gene lpxA 76802 76014 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071796.1 protein_id gnl|my_center|LOCUS_17350 77287 76820 gene locus_tag LOCUS_17360 gene fabZ 77287 76820 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420541.1 protein_id gnl|my_center|LOCUS_17360 78401 77373 gene locus_tag LOCUS_17370 gene lpxD 78401 77373 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262426.1 protein_id gnl|my_center|LOCUS_17370 78920 78405 gene locus_tag LOCUS_17380 78920 78405 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037416754.1 protein_id gnl|my_center|LOCUS_17380 81441 78949 gene locus_tag LOCUS_17390 gene bamA 81441 78949 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071792.1 protein_id gnl|my_center|LOCUS_17390 82810 81464 gene locus_tag LOCUS_17400 gene rseP 82810 81464 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705099.1 protein_id gnl|my_center|LOCUS_17400 83994 82810 gene locus_tag LOCUS_17410 gene ispC 83994 82810 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071790.1 protein_id gnl|my_center|LOCUS_17410 84681 83995 gene locus_tag LOCUS_17420 84681 83995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17420 85621 84878 gene locus_tag LOCUS_17430 85621 84878 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420551.1 protein_id gnl|my_center|LOCUS_17430 86219 85662 gene locus_tag LOCUS_17440 gene frr 86219 85662 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456723.1 protein_id gnl|my_center|LOCUS_17440 86982 86239 gene locus_tag LOCUS_17450 gene pyrH 86982 86239 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705095.1 protein_id gnl|my_center|LOCUS_17450 87896 87051 gene locus_tag LOCUS_17460 gene tsf 87896 87051 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456729.1 protein_id gnl|my_center|LOCUS_17460 88711 87983 gene locus_tag LOCUS_17470 gene rpsB 88711 87983 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456727.1 protein_id gnl|my_center|LOCUS_17470 88942 89760 gene locus_tag LOCUS_17480 gene map 88942 89760 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092395.1 protein_id gnl|my_center|LOCUS_17480 89775 92405 gene locus_tag LOCUS_17490 gene glnD 89775 92405 CDS product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705092.1 protein_id gnl|my_center|LOCUS_17490 92409 93233 gene locus_tag LOCUS_17500 gene dapD 92409 93233 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303473.1 protein_id gnl|my_center|LOCUS_17500 94998 93334 gene locus_tag LOCUS_17510 94998 93334 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071119.1 protein_id gnl|my_center|LOCUS_17510 95733 95062 gene locus_tag LOCUS_17520 95733 95062 CDS product DUF2982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071810.1 protein_id gnl|my_center|LOCUS_17520 96836 95934 gene locus_tag LOCUS_17530 96836 95934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 97470 98870 gene locus_tag LOCUS_17540 97470 98870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 98877 99749 gene locus_tag LOCUS_17550 98877 99749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 99754 100515 gene locus_tag LOCUS_17560 99754 100515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 100604 101485 gene locus_tag LOCUS_17570 100604 101485 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028849.1 protein_id gnl|my_center|LOCUS_17570 101486 102709 gene locus_tag LOCUS_17580 gene eboE 101486 102709 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031018.1 protein_id gnl|my_center|LOCUS_17580 102725 104101 gene locus_tag LOCUS_17590 102725 104101 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_17590 104477 107449 gene locus_tag LOCUS_17600 104477 107449 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919622.1 protein_id gnl|my_center|LOCUS_17600 107600 109084 gene locus_tag LOCUS_17610 107600 109084 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919623.1 protein_id gnl|my_center|LOCUS_17610 109416 109168 gene locus_tag LOCUS_17620 109416 109168 CDS product DUF2960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071581.1 protein_id gnl|my_center|LOCUS_17620 109630 109555 gene locus_tag LOCUS_t00280 109630 109555 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 109737 109662 gene locus_tag LOCUS_t00290 109737 109662 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 109837 109762 gene locus_tag LOCUS_t00300 109837 109762 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 110794 110015 gene locus_tag LOCUS_17630 gene ybgF 110794 110015 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351957.1 protein_id gnl|my_center|LOCUS_17630 111374 110814 gene locus_tag LOCUS_17640 gene pal 111374 110814 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304908.1 protein_id gnl|my_center|LOCUS_17640 112865 111519 gene locus_tag LOCUS_17650 gene tolB 112865 111519 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459807.1 protein_id gnl|my_center|LOCUS_17650 113847 112897 gene locus_tag LOCUS_17660 gene tolA 113847 112897 CDS product cell envelope integrity protein TolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072688.1 protein_id gnl|my_center|LOCUS_17660 114271 113849 gene locus_tag LOCUS_17670 gene tolR 114271 113849 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126827401.1 protein_id gnl|my_center|LOCUS_17670 114979 114278 gene locus_tag LOCUS_17680 gene tolQ 114979 114278 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483599.1 protein_id gnl|my_center|LOCUS_17680 115373 114969 gene locus_tag LOCUS_17690 gene ybgC 115373 114969 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707367.1 protein_id gnl|my_center|LOCUS_17690 116535 115531 gene locus_tag LOCUS_17700 gene ruvB 116535 115531 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707371.1 protein_id gnl|my_center|LOCUS_17700 117161 116541 gene locus_tag LOCUS_17710 gene ruvA 117161 116541 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418603.1 protein_id gnl|my_center|LOCUS_17710 117712 117191 gene locus_tag LOCUS_17720 gene ruvC 117712 117191 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298649.1 protein_id gnl|my_center|LOCUS_17720 119539 117746 gene locus_tag LOCUS_17730 gene aspS 119539 117746 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072408.1 protein_id gnl|my_center|LOCUS_17730 123413 119769 gene locus_tag LOCUS_17740 123413 119769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 128174 123681 gene locus_tag LOCUS_17750 128174 123681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 131160 128278 gene locus_tag LOCUS_17760 131160 128278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 134062 131210 gene locus_tag LOCUS_17770 134062 131210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 137383 134090 gene locus_tag LOCUS_17780 137383 134090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 137981 141961 gene locus_tag LOCUS_17790 137981 141961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 143655 142090 gene locus_tag LOCUS_17800 143655 142090 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_17800 144090 143755 gene locus_tag LOCUS_17810 144090 143755 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705345.1 protein_id gnl|my_center|LOCUS_17810 144521 144087 gene locus_tag LOCUS_17820 144521 144087 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420637.1 protein_id gnl|my_center|LOCUS_17820 144807 145292 gene locus_tag LOCUS_17830 gene smpB 144807 145292 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162689.1 protein_id gnl|my_center|LOCUS_17830 147657 145390 gene locus_tag LOCUS_17840 gene clpA 147657 145390 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705733.1 protein_id gnl|my_center|LOCUS_17840 148014 147697 gene locus_tag LOCUS_17850 gene clpS 148014 147697 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300028.1 protein_id gnl|my_center|LOCUS_17850 148240 148455 gene locus_tag LOCUS_17860 gene cspD 148240 148455 CDS product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420186.1 protein_id gnl|my_center|LOCUS_17860 150047 148626 gene locus_tag LOCUS_17870 gene flgE 150047 148626 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073130.1 protein_id gnl|my_center|LOCUS_17870 150812 150078 gene locus_tag LOCUS_17880 gene flgD 150812 150078 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420404.1 protein_id gnl|my_center|LOCUS_17880 151250 150825 gene locus_tag LOCUS_17890 gene flgC 151250 150825 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073132.1 protein_id gnl|my_center|LOCUS_17890 151648 151247 gene locus_tag LOCUS_17900 gene flgB 151648 151247 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706644.1 protein_id gnl|my_center|LOCUS_17900 152666 151836 gene locus_tag LOCUS_17910 152666 151836 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706645.1 protein_id gnl|my_center|LOCUS_17910 153600 152677 gene locus_tag LOCUS_17920 153600 152677 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073135.1 protein_id gnl|my_center|LOCUS_17920 153766 154461 gene locus_tag LOCUS_17930 gene flgA 153766 154461 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946643.1 protein_id gnl|my_center|LOCUS_17930 154545 154868 gene locus_tag LOCUS_17940 154545 154868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 154872 155294 gene locus_tag LOCUS_17950 154872 155294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 155758 155309 gene locus_tag LOCUS_17960 155758 155309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 155937 156287 gene locus_tag LOCUS_17970 155937 156287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 156539 156342 gene locus_tag LOCUS_17980 156539 156342 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420090.1 protein_id gnl|my_center|LOCUS_17980 156752 157723 gene locus_tag LOCUS_17990 156752 157723 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073720.1 protein_id gnl|my_center|LOCUS_17990 157844 159247 gene locus_tag LOCUS_18000 157844 159247 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417345.1 protein_id gnl|my_center|LOCUS_18000 159258 160343 gene locus_tag LOCUS_18010 gene alr 159258 160343 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106087.1 protein_id gnl|my_center|LOCUS_18010 160741 160340 gene locus_tag LOCUS_18020 160741 160340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 161236 160745 gene locus_tag LOCUS_18030 161236 160745 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073088.1 protein_id gnl|my_center|LOCUS_18030 162123 161257 gene locus_tag LOCUS_18040 162123 161257 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705295.1 protein_id gnl|my_center|LOCUS_18040 162897 162124 gene locus_tag LOCUS_18050 162897 162124 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073090.1 protein_id gnl|my_center|LOCUS_18050 164009 162909 gene locus_tag LOCUS_18060 164009 162909 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705291.1 protein_id gnl|my_center|LOCUS_18060 166242 164026 gene locus_tag LOCUS_18070 166242 164026 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073093.1 protein_id gnl|my_center|LOCUS_18070 167016 166258 gene locus_tag LOCUS_18080 167016 166258 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073094.1 protein_id gnl|my_center|LOCUS_18080 167424 167041 gene locus_tag LOCUS_18090 gene cheY 167424 167041 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007649667.1 protein_id gnl|my_center|LOCUS_18090 168182 167463 gene locus_tag LOCUS_18100 168182 167463 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073095.1 protein_id gnl|my_center|LOCUS_18100 169055 168189 gene locus_tag LOCUS_18110 169055 168189 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634619.1 protein_id gnl|my_center|LOCUS_18110 170486 169062 gene locus_tag LOCUS_18120 gene flhF 170486 169062 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262353.1 protein_id gnl|my_center|LOCUS_18120 172703 170550 gene locus_tag LOCUS_18130 gene flhA 172703 170550 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481069.1 protein_id gnl|my_center|LOCUS_18130 173271 172789 gene locus_tag LOCUS_18140 173271 172789 CDS product VC2046/SO_2500 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196007.1 protein_id gnl|my_center|LOCUS_18140 173390 173474 gene locus_tag LOCUS_t00310 173390 173474 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 173560 175209 gene locus_tag LOCUS_18150 173560 175209 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945060.1 protein_id gnl|my_center|LOCUS_18150 175306 176310 gene locus_tag LOCUS_18160 175306 176310 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707764.1 protein_id gnl|my_center|LOCUS_18160 177039 176563 gene locus_tag LOCUS_18170 gene greA 177039 176563 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210184.1 protein_id gnl|my_center|LOCUS_18170 180257 177039 gene locus_tag LOCUS_18180 gene carB 180257 177039 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261248.1 protein_id gnl|my_center|LOCUS_18180 181407 180271 gene locus_tag LOCUS_18190 gene carA 181407 180271 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706536.1 protein_id gnl|my_center|LOCUS_18190 182438 181635 gene locus_tag LOCUS_18200 gene dapB 182438 181635 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071373.1 protein_id gnl|my_center|LOCUS_18200 183126 182515 gene locus_tag LOCUS_18210 183126 182515 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173662.1 protein_id gnl|my_center|LOCUS_18210 183285 184064 gene locus_tag LOCUS_18220 gene tcdA 183285 184064 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073641.1 protein_id gnl|my_center|LOCUS_18220 184206 184424 gene locus_tag LOCUS_18230 184206 184424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 184844 184506 gene locus_tag LOCUS_18240 gene fdx 184844 184506 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460237.1 protein_id gnl|my_center|LOCUS_18240 186712 184847 gene locus_tag LOCUS_18250 gene hscA 186712 184847 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196613.1 protein_id gnl|my_center|LOCUS_18250 187251 186733 gene locus_tag LOCUS_18260 gene hscB 187251 186733 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705637.1 protein_id gnl|my_center|LOCUS_18260 187590 187267 gene locus_tag LOCUS_18270 gene iscA 187590 187267 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417916.1 protein_id gnl|my_center|LOCUS_18270 187988 187608 gene locus_tag LOCUS_18280 gene iscU 187988 187608 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299770.1 protein_id gnl|my_center|LOCUS_18280 189223 188009 gene locus_tag LOCUS_18290 189223 188009 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460179.1 protein_id gnl|my_center|LOCUS_18290 189751 189245 gene locus_tag LOCUS_18300 gene iscR 189751 189245 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222202.1 protein_id gnl|my_center|LOCUS_18300 190183 192036 gene locus_tag LOCUS_18310 gene sppA 190183 192036 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072397.1 protein_id gnl|my_center|LOCUS_18310 192374 192171 gene locus_tag LOCUS_18320 192374 192171 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222289.1 protein_id gnl|my_center|LOCUS_18320 193849 192737 gene locus_tag LOCUS_18330 gene asd 193849 192737 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188178.1 protein_id gnl|my_center|LOCUS_18330 194467 193943 gene locus_tag LOCUS_18340 gene def 194467 193943 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071316.1 protein_id gnl|my_center|LOCUS_18340 196092 194641 gene locus_tag LOCUS_18350 196092 194641 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921496.1 protein_id gnl|my_center|LOCUS_18350 198181 196550 gene locus_tag LOCUS_18360 198181 196550 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484911.1 protein_id gnl|my_center|LOCUS_18360 198388 199020 gene locus_tag LOCUS_18370 198388 199020 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414103.1 protein_id gnl|my_center|LOCUS_18370 199204 199656 gene locus_tag LOCUS_18380 199204 199656 CDS product VF530 family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262954.1 protein_id gnl|my_center|LOCUS_18380 200627 199668 gene locus_tag LOCUS_18390 gene rluF 200627 199668 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419811.1 protein_id gnl|my_center|LOCUS_18390 200806 201543 gene locus_tag LOCUS_18400 200806 201543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 201669 203609 gene locus_tag LOCUS_18410 201669 203609 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707540.1 protein_id gnl|my_center|LOCUS_18410 203611 204189 gene locus_tag LOCUS_18420 203611 204189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 204414 204315 gene locus_tag LOCUS_r00010 204414 204315 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence08 109 1089 gene locus_tag LOCUS_18430 109 1089 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071843.1 protein_id gnl|my_center|LOCUS_18430 1689 2621 gene locus_tag LOCUS_18440 1689 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 2958 2701 gene locus_tag LOCUS_18450 2958 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 3462 3386 gene locus_tag LOCUS_t00320 3462 3386 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3659 7261 gene locus_tag LOCUS_18460 3659 7261 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022279.1 protein_id gnl|my_center|LOCUS_18460 7266 7982 gene locus_tag LOCUS_18470 7266 7982 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828382.1 protein_id gnl|my_center|LOCUS_18470 8429 8133 gene locus_tag LOCUS_18480 8429 8133 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707245.1 protein_id gnl|my_center|LOCUS_18480 8983 8429 gene locus_tag LOCUS_18490 8983 8429 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707244.1 protein_id gnl|my_center|LOCUS_18490 9830 9021 gene locus_tag LOCUS_18500 gene trpA 9830 9021 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022758.1 protein_id gnl|my_center|LOCUS_18500 11040 9823 gene locus_tag LOCUS_18510 gene trpB 11040 9823 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261660.1 protein_id gnl|my_center|LOCUS_18510 12443 11058 gene locus_tag LOCUS_18520 gene trpCF 12443 11058 CDS product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488526.1 protein_id gnl|my_center|LOCUS_18520 13458 12436 gene locus_tag LOCUS_18530 gene trpD 13458 12436 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706725.1 protein_id gnl|my_center|LOCUS_18530 14090 13461 gene locus_tag LOCUS_18540 14090 13461 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706724.1 protein_id gnl|my_center|LOCUS_18540 15637 14090 gene locus_tag LOCUS_18550 15637 14090 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706723.1 protein_id gnl|my_center|LOCUS_18550 16159 17007 gene locus_tag LOCUS_18560 16159 17007 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261667.1 protein_id gnl|my_center|LOCUS_18560 17078 17698 gene locus_tag LOCUS_18570 17078 17698 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465083.1 protein_id gnl|my_center|LOCUS_18570 17701 18585 gene locus_tag LOCUS_18580 17701 18585 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072920.1 protein_id gnl|my_center|LOCUS_18580 18647 19135 gene locus_tag LOCUS_18590 gene recX 18647 19135 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225089.1 protein_id gnl|my_center|LOCUS_18590 19260 21884 gene locus_tag LOCUS_18600 gene alaS 19260 21884 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073284.1 protein_id gnl|my_center|LOCUS_18600 22039 22233 gene locus_tag LOCUS_18610 gene csrA 22039 22233 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004415691.1 protein_id gnl|my_center|LOCUS_18610 22401 23936 gene locus_tag LOCUS_18620 22401 23936 CDS product DUF3369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705467.1 protein_id gnl|my_center|LOCUS_18620 24045 24833 gene locus_tag LOCUS_18630 24045 24833 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933144.1 protein_id gnl|my_center|LOCUS_18630 24941 25795 gene locus_tag LOCUS_18640 gene kdsA 24941 25795 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400335.1 protein_id gnl|my_center|LOCUS_18640 26065 25814 gene locus_tag LOCUS_18650 26065 25814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 26266 27159 gene locus_tag LOCUS_18660 26266 27159 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303519.1 protein_id gnl|my_center|LOCUS_18660 27156 27770 gene locus_tag LOCUS_18670 27156 27770 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010207888.1 protein_id gnl|my_center|LOCUS_18670 27757 28143 gene locus_tag LOCUS_18680 27757 28143 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071713.1 protein_id gnl|my_center|LOCUS_18680 28156 29205 gene locus_tag LOCUS_18690 gene rlmM 28156 29205 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816972.1 protein_id gnl|my_center|LOCUS_18690 29334 29660 gene locus_tag LOCUS_18700 29334 29660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 29737 29907 gene locus_tag LOCUS_18710 29737 29907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 32688 30187 gene locus_tag LOCUS_18720 32688 30187 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158196641.1 protein_id gnl|my_center|LOCUS_18720 32854 34212 gene locus_tag LOCUS_18730 gene radA 32854 34212 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707405.1 protein_id gnl|my_center|LOCUS_18730 34473 34288 gene locus_tag LOCUS_18740 34473 34288 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072299.1 protein_id gnl|my_center|LOCUS_18740 35638 34775 gene locus_tag LOCUS_18750 35638 34775 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455078.1 protein_id gnl|my_center|LOCUS_18750 36139 35729 gene locus_tag LOCUS_18760 36139 35729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 37359 36136 gene locus_tag LOCUS_18770 37359 36136 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707892.1 protein_id gnl|my_center|LOCUS_18770 39672 37495 gene locus_tag LOCUS_18780 39672 37495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 39978 40676 gene locus_tag LOCUS_18790 39978 40676 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705252.1 protein_id gnl|my_center|LOCUS_18790 40678 42975 gene locus_tag LOCUS_18800 40678 42975 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705253.1 protein_id gnl|my_center|LOCUS_18800 44818 43106 gene locus_tag LOCUS_18810 44818 43106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880803.1 protein_id gnl|my_center|LOCUS_18810 46743 44896 gene locus_tag LOCUS_18820 46743 44896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 48850 46781 gene locus_tag LOCUS_18830 48850 46781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 52109 49083 gene locus_tag LOCUS_18840 52109 49083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 52396 56859 gene locus_tag LOCUS_18850 52396 56859 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113014.1 protein_id gnl|my_center|LOCUS_18850 56849 57793 gene locus_tag LOCUS_18860 56849 57793 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136856750.1 protein_id gnl|my_center|LOCUS_18860 58004 57849 gene locus_tag LOCUS_18870 58004 57849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 57961 58665 gene locus_tag LOCUS_18880 57961 58665 CDS product DUF3334 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742113.1 protein_id gnl|my_center|LOCUS_18880 58823 59284 gene locus_tag LOCUS_18890 58823 59284 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072063.1 protein_id gnl|my_center|LOCUS_18890 59294 61327 gene locus_tag LOCUS_18900 gene ligA 59294 61327 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478506.1 protein_id gnl|my_center|LOCUS_18900 61474 61995 gene locus_tag LOCUS_18910 61474 61995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 61982 62572 gene locus_tag LOCUS_18920 61982 62572 CDS product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478780.1 protein_id gnl|my_center|LOCUS_18920 62572 63459 gene locus_tag LOCUS_18930 62572 63459 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817435.1 protein_id gnl|my_center|LOCUS_18930 64323 63511 gene locus_tag LOCUS_18940 64323 63511 CDS product DUF2989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707125.1 protein_id gnl|my_center|LOCUS_18940 64373 64897 gene locus_tag LOCUS_18950 64373 64897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 64899 65291 gene locus_tag LOCUS_18960 64899 65291 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070678.1 protein_id gnl|my_center|LOCUS_18960 65306 65590 gene locus_tag LOCUS_18970 65306 65590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 65657 65899 gene locus_tag LOCUS_18980 65657 65899 CDS product VF530 family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076091.1 protein_id gnl|my_center|LOCUS_18980 65911 67299 gene locus_tag LOCUS_18990 gene dbpA 65911 67299 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071179.1 protein_id gnl|my_center|LOCUS_18990 67300 67719 gene locus_tag LOCUS_19000 67300 67719 CDS product DUF5522 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963580.1 protein_id gnl|my_center|LOCUS_19000 68033 68731 gene locus_tag LOCUS_19010 68033 68731 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957920.1 protein_id gnl|my_center|LOCUS_19010 69950 68799 gene locus_tag LOCUS_19020 69950 68799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 72252 70465 gene locus_tag LOCUS_19030 72252 70465 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072668.1 protein_id gnl|my_center|LOCUS_19030 72364 73458 gene locus_tag LOCUS_19040 72364 73458 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245976.1 protein_id gnl|my_center|LOCUS_19040 73464 74177 gene locus_tag LOCUS_19050 73464 74177 CDS product rRNA large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116956690.1 protein_id gnl|my_center|LOCUS_19050 74189 74635 gene locus_tag LOCUS_19060 74189 74635 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072579.1 protein_id gnl|my_center|LOCUS_19060 74730 75845 gene locus_tag LOCUS_19070 gene mnmA 74730 75845 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072580.1 protein_id gnl|my_center|LOCUS_19070 75852 76484 gene locus_tag LOCUS_19080 gene hflD 75852 76484 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262317.1 protein_id gnl|my_center|LOCUS_19080 76498 77865 gene locus_tag LOCUS_19090 gene purB 76498 77865 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460028.1 protein_id gnl|my_center|LOCUS_19090 78170 78027 gene locus_tag LOCUS_19100 78170 78027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 78613 78305 gene locus_tag LOCUS_19110 78613 78305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 79052 78705 gene locus_tag LOCUS_19120 79052 78705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 79471 80739 gene locus_tag LOCUS_19130 79471 80739 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921546.1 protein_id gnl|my_center|LOCUS_19130 80739 83456 gene locus_tag LOCUS_19140 80739 83456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 84007 83471 gene locus_tag LOCUS_19150 84007 83471 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422477.1 protein_id gnl|my_center|LOCUS_19150 84334 84023 gene locus_tag LOCUS_19160 84334 84023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 85358 84318 gene locus_tag LOCUS_19170 85358 84318 CDS product DUF3549 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261355.1 protein_id gnl|my_center|LOCUS_19170 85503 85826 gene locus_tag LOCUS_19180 85503 85826 CDS product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071775.1 protein_id gnl|my_center|LOCUS_19180 85820 86542 gene locus_tag LOCUS_19190 gene truC 85820 86542 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063386.1 protein_id gnl|my_center|LOCUS_19190 86592 87053 gene locus_tag LOCUS_19200 gene mioC 86592 87053 CDS product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352400.1 protein_id gnl|my_center|LOCUS_19200 87172 87591 gene locus_tag LOCUS_19210 87172 87591 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461138.1 protein_id gnl|my_center|LOCUS_19210 87655 91548 gene locus_tag LOCUS_19220 gene hrpA 87655 91548 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483469.1 protein_id gnl|my_center|LOCUS_19220 91653 91952 gene locus_tag LOCUS_19230 91653 91952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 91973 92848 gene locus_tag LOCUS_19240 91973 92848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 94261 92930 gene locus_tag LOCUS_19250 gene xylA 94261 92930 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039169.1 protein_id gnl|my_center|LOCUS_19250 95835 94351 gene locus_tag LOCUS_19260 95835 94351 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202802.1 protein_id gnl|my_center|LOCUS_19260 97177 95981 gene locus_tag LOCUS_19270 97177 95981 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301722.1 protein_id gnl|my_center|LOCUS_19270 97327 98424 gene locus_tag LOCUS_19280 gene pgl 97327 98424 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244689.1 protein_id gnl|my_center|LOCUS_19280 100249 98468 gene locus_tag LOCUS_19290 100249 98468 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706440.1 protein_id gnl|my_center|LOCUS_19290 100828 100256 gene locus_tag LOCUS_19300 100828 100256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 101971 100997 gene locus_tag LOCUS_19310 101971 100997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 102488 102261 gene locus_tag LOCUS_19320 102488 102261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 102607 104277 gene locus_tag LOCUS_19330 102607 104277 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453777.1 protein_id gnl|my_center|LOCUS_19330 104990 104280 gene locus_tag LOCUS_19340 104990 104280 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337288.1 protein_id gnl|my_center|LOCUS_19340 105484 104990 gene locus_tag LOCUS_19350 105484 104990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962860.1 protein_id gnl|my_center|LOCUS_19350 106341 105604 gene locus_tag LOCUS_19360 106341 105604 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072839.1 protein_id gnl|my_center|LOCUS_19360 106587 107978 gene locus_tag LOCUS_19370 106587 107978 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188537.1 protein_id gnl|my_center|LOCUS_19370 108074 109303 gene locus_tag LOCUS_19380 108074 109303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 109293 112418 gene locus_tag LOCUS_19390 109293 112418 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_19390 112683 113507 gene locus_tag LOCUS_19400 112683 113507 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483526.1 protein_id gnl|my_center|LOCUS_19400 114382 113504 gene locus_tag LOCUS_19410 gene nadK 114382 113504 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071702.1 protein_id gnl|my_center|LOCUS_19410 114564 115175 gene locus_tag LOCUS_19420 gene grpE 114564 115175 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706782.1 protein_id gnl|my_center|LOCUS_19420 115256 115687 gene locus_tag LOCUS_19430 gene gpt 115256 115687 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037415.1 protein_id gnl|my_center|LOCUS_19430 116820 115690 gene locus_tag LOCUS_19440 116820 115690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 118427 117090 gene locus_tag LOCUS_19450 gene hmrM 118427 117090 CDS product sodium-coupled multidrug efflux MATE transporter HmrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693623.1 protein_id gnl|my_center|LOCUS_19450 119789 118509 gene locus_tag LOCUS_19460 119789 118509 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455487.1 protein_id gnl|my_center|LOCUS_19460 120309 120587 gene locus_tag LOCUS_19470 120309 120587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 120581 120928 gene locus_tag LOCUS_19480 gene sdhD 120581 120928 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072027.1 protein_id gnl|my_center|LOCUS_19480 120929 122692 gene locus_tag LOCUS_19490 gene sdhA 120929 122692 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705797.1 protein_id gnl|my_center|LOCUS_19490 122707 123417 gene locus_tag LOCUS_19500 122707 123417 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072029.1 protein_id gnl|my_center|LOCUS_19500 123512 126337 gene locus_tag LOCUS_19510 123512 126337 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046518780.1 protein_id gnl|my_center|LOCUS_19510 126342 127847 gene locus_tag LOCUS_19520 gene odhB 126342 127847 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072031.1 protein_id gnl|my_center|LOCUS_19520 128187 129353 gene locus_tag LOCUS_19530 gene sucC 128187 129353 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087425.1 protein_id gnl|my_center|LOCUS_19530 129356 130228 gene locus_tag LOCUS_19540 gene sucD 129356 130228 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087428.1 protein_id gnl|my_center|LOCUS_19540 131033 130278 gene locus_tag LOCUS_19550 gene panB 131033 130278 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230652.1 protein_id gnl|my_center|LOCUS_19550 131184 132371 gene locus_tag LOCUS_19560 131184 132371 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819957.1 protein_id gnl|my_center|LOCUS_19560 132847 135207 gene locus_tag LOCUS_19570 132847 135207 CDS product glycosyl hydrolase 53 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583222.1 protein_id gnl|my_center|LOCUS_19570 136153 135296 gene locus_tag LOCUS_19580 gene fghA 136153 135296 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464966.1 protein_id gnl|my_center|LOCUS_19580 137333 136209 gene locus_tag LOCUS_19590 137333 136209 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072127.1 protein_id gnl|my_center|LOCUS_19590 137687 138568 gene locus_tag LOCUS_19600 137687 138568 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074451.1 protein_id gnl|my_center|LOCUS_19600 139252 138581 gene locus_tag LOCUS_19610 139252 138581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 139402 139854 gene locus_tag LOCUS_19620 139402 139854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 141569 139896 gene locus_tag LOCUS_19630 141569 139896 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311972.1 protein_id gnl|my_center|LOCUS_19630 143342 141585 gene locus_tag LOCUS_19640 143342 141585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 143662 144435 gene locus_tag LOCUS_19650 143662 144435 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092173.1 protein_id gnl|my_center|LOCUS_19650 144428 145414 gene locus_tag LOCUS_19660 144428 145414 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071293.1 protein_id gnl|my_center|LOCUS_19660 145411 146496 gene locus_tag LOCUS_19670 gene cobT 145411 146496 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480702.1 protein_id gnl|my_center|LOCUS_19670 146501 147271 gene locus_tag LOCUS_19680 146501 147271 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031778770.1 protein_id gnl|my_center|LOCUS_19680 147268 147822 gene locus_tag LOCUS_19690 gene cobU 147268 147822 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206639.1 protein_id gnl|my_center|LOCUS_19690 147815 148468 gene locus_tag LOCUS_19700 gene cobC 147815 148468 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480583.1 protein_id gnl|my_center|LOCUS_19700 148468 149943 gene locus_tag LOCUS_19710 148468 149943 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479326.1 protein_id gnl|my_center|LOCUS_19710 149950 150555 gene locus_tag LOCUS_19720 gene cobO 149950 150555 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894344.1 protein_id gnl|my_center|LOCUS_19720 150552 151391 gene locus_tag LOCUS_19730 150552 151391 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073501.1 protein_id gnl|my_center|LOCUS_19730 151943 152227 gene locus_tag LOCUS_19740 151943 152227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 153949 152294 gene locus_tag LOCUS_19750 gene fadD 153949 152294 CDS product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706061.1 protein_id gnl|my_center|LOCUS_19750 154680 154081 gene locus_tag LOCUS_19760 154680 154081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 155064 154726 gene locus_tag LOCUS_19770 gene rplS 155064 154726 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116654.1 protein_id gnl|my_center|LOCUS_19770 155863 155096 gene locus_tag LOCUS_19780 gene trmD 155863 155096 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264777.1 protein_id gnl|my_center|LOCUS_19780 156397 155867 gene locus_tag LOCUS_19790 gene rimM 156397 155867 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704630.1 protein_id gnl|my_center|LOCUS_19790 156674 156426 gene locus_tag LOCUS_19800 gene rpsP 156674 156426 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653865.1 protein_id gnl|my_center|LOCUS_19800 158303 156894 gene locus_tag LOCUS_19810 gene ffh 158303 156894 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704629.1 protein_id gnl|my_center|LOCUS_19810 158580 159368 gene locus_tag LOCUS_19820 gene ccsA 158580 159368 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704628.1 protein_id gnl|my_center|LOCUS_19820 159434 160714 gene locus_tag LOCUS_19830 159434 160714 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704627.1 protein_id gnl|my_center|LOCUS_19830 160852 163107 gene locus_tag LOCUS_19840 160852 163107 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085445.1 protein_id gnl|my_center|LOCUS_19840 164093 163188 gene locus_tag LOCUS_19850 164093 163188 CDS product PhzF family phenazine biosynthesis isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849327.1 protein_id gnl|my_center|LOCUS_19850 165076 164366 gene locus_tag LOCUS_19860 gene queE 165076 164366 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072466.1 protein_id gnl|my_center|LOCUS_19860 165101 165757 gene locus_tag LOCUS_19870 gene queC 165101 165757 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061849.1 protein_id gnl|my_center|LOCUS_19870 166419 165778 gene locus_tag LOCUS_19880 166419 165778 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071771.1 protein_id gnl|my_center|LOCUS_19880 167641 166490 gene locus_tag LOCUS_19890 167641 166490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 168604 167681 gene locus_tag LOCUS_19900 gene oxyR 168604 167681 CDS product hydrogen peroxide-inducible genes transcriptional activator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071537.1 protein_id gnl|my_center|LOCUS_19900 168904 169593 gene locus_tag LOCUS_19910 168904 169593 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074105.1 protein_id gnl|my_center|LOCUS_19910 169593 171008 gene locus_tag LOCUS_19920 169593 171008 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356901.1 protein_id gnl|my_center|LOCUS_19920 171266 171727 gene locus_tag LOCUS_19930 171266 171727 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937552.1 protein_id gnl|my_center|LOCUS_19930 172131 171976 gene locus_tag LOCUS_19940 172131 171976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 173174 172365 gene locus_tag LOCUS_19950 173174 172365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 174175 173321 gene locus_tag LOCUS_19960 gene rluB 174175 173321 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706718.1 protein_id gnl|my_center|LOCUS_19960 174740 174144 gene locus_tag LOCUS_19970 gene scpB 174740 174144 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072919.1 protein_id gnl|my_center|LOCUS_19970 174968 175957 gene locus_tag LOCUS_19980 174968 175957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 176265 176005 gene locus_tag LOCUS_19990 176265 176005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 177044 176268 gene locus_tag LOCUS_20000 gene yaaA 177044 176268 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487639.1 protein_id gnl|my_center|LOCUS_20000 177202 178407 gene locus_tag LOCUS_20010 177202 178407 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889226.1 protein_id gnl|my_center|LOCUS_20010 178409 180511 gene locus_tag LOCUS_20020 gene pta 178409 180511 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706164.1 protein_id gnl|my_center|LOCUS_20020 181507 180788 gene locus_tag LOCUS_20030 181507 180788 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088499789.1 protein_id gnl|my_center|LOCUS_20030 181816 182814 gene locus_tag LOCUS_20040 181816 182814 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072446.1 protein_id gnl|my_center|LOCUS_20040 183072 183091 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 183801 183361 gene locus_tag LOCUS_20050 183801 183361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 184374 183919 gene locus_tag LOCUS_20060 184374 183919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 >Feature sequence09 46 1116 gene locus_tag LOCUS_20070 gene dinB 46 1116 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071357.1 protein_id gnl|my_center|LOCUS_20070 1340 3919 gene locus_tag LOCUS_20080 1340 3919 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 protein_id gnl|my_center|LOCUS_20080 5690 3990 gene locus_tag LOCUS_20090 5690 3990 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 protein_id gnl|my_center|LOCUS_20090 7245 5962 gene locus_tag LOCUS_20100 7245 5962 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480646.1 protein_id gnl|my_center|LOCUS_20100 8095 7349 gene locus_tag LOCUS_20110 8095 7349 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118984.1 protein_id gnl|my_center|LOCUS_20110 8336 9502 gene locus_tag LOCUS_20120 8336 9502 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919503.1 protein_id gnl|my_center|LOCUS_20120 9526 10581 gene locus_tag LOCUS_20130 9526 10581 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973787.1 protein_id gnl|my_center|LOCUS_20130 10687 11913 gene locus_tag LOCUS_20140 10687 11913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 13011 12001 gene locus_tag LOCUS_20150 gene pfkA 13011 12001 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173968.1 protein_id gnl|my_center|LOCUS_20150 13671 13159 gene locus_tag LOCUS_20160 gene fldB 13671 13159 CDS product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707047.1 protein_id gnl|my_center|LOCUS_20160 13776 14267 gene locus_tag LOCUS_20170 13776 14267 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957577.1 protein_id gnl|my_center|LOCUS_20170 14236 15159 gene locus_tag LOCUS_20180 gene xerD 14236 15159 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806650.1 protein_id gnl|my_center|LOCUS_20180 17204 15156 gene locus_tag LOCUS_20190 gene mnmC 17204 15156 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683785.1 protein_id gnl|my_center|LOCUS_20190 17388 18602 gene locus_tag LOCUS_20200 gene fabB 17388 18602 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460738.1 protein_id gnl|my_center|LOCUS_20200 18678 19823 gene locus_tag LOCUS_20210 gene pdxB 18678 19823 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209725.1 protein_id gnl|my_center|LOCUS_20210 20027 23797 gene locus_tag LOCUS_20220 20027 23797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 23756 23775 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24298 25263 gene locus_tag LOCUS_20230 24298 25263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 25693 25382 gene locus_tag LOCUS_20240 25693 25382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 25941 26783 gene locus_tag LOCUS_20250 25941 26783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223047.1 protein_id gnl|my_center|LOCUS_20250 28264 26780 gene locus_tag LOCUS_20260 28264 26780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 29381 28827 gene locus_tag LOCUS_20270 gene ybcL 29381 28827 CDS product Raf kinase inhibitor-like protein YbcL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306955.1 protein_id gnl|my_center|LOCUS_20270 30309 29470 gene locus_tag LOCUS_20280 30309 29470 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482660.1 protein_id gnl|my_center|LOCUS_20280 33479 30312 gene locus_tag LOCUS_20290 33479 30312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 35029 33695 gene locus_tag LOCUS_20300 gene waaA 35029 33695 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172601538.1 protein_id gnl|my_center|LOCUS_20300 35634 36329 gene locus_tag LOCUS_20310 35634 36329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 36614 36348 gene locus_tag LOCUS_20320 36614 36348 CDS product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559749.1 protein_id gnl|my_center|LOCUS_20320 37747 36617 gene locus_tag LOCUS_20330 37747 36617 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 protein_id gnl|my_center|LOCUS_20330 38306 37767 gene locus_tag LOCUS_20340 38306 37767 CDS product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365544.1 protein_id gnl|my_center|LOCUS_20340 38466 39488 gene locus_tag LOCUS_20350 38466 39488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 40164 39520 gene locus_tag LOCUS_20360 40164 39520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 40438 42495 gene locus_tag LOCUS_20370 40438 42495 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073602.1 protein_id gnl|my_center|LOCUS_20370 43432 42617 gene locus_tag LOCUS_20380 gene lpxL 43432 42617 CDS product LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707479.1 protein_id gnl|my_center|LOCUS_20380 44953 43613 gene locus_tag LOCUS_20390 gene xseA 44953 43613 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693773.1 protein_id gnl|my_center|LOCUS_20390 45140 46609 gene locus_tag LOCUS_20400 gene guaB 45140 46609 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694071.1 protein_id gnl|my_center|LOCUS_20400 46685 48262 gene locus_tag LOCUS_20410 gene guaA 46685 48262 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705860.1 protein_id gnl|my_center|LOCUS_20410 49844 48417 gene locus_tag LOCUS_20420 49844 48417 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922487.1 protein_id gnl|my_center|LOCUS_20420 50364 50215 gene locus_tag LOCUS_20430 50364 50215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 51029 50352 gene locus_tag LOCUS_20440 51029 50352 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262398.1 protein_id gnl|my_center|LOCUS_20440 52201 51044 gene locus_tag LOCUS_20450 gene dapE 52201 51044 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072438.1 protein_id gnl|my_center|LOCUS_20450 52554 52207 gene locus_tag LOCUS_20460 52554 52207 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012533673.1 protein_id gnl|my_center|LOCUS_20460 53056 52556 gene locus_tag LOCUS_20470 53056 52556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 53873 54910 gene locus_tag LOCUS_20480 gene sohB 53873 54910 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394900.1 protein_id gnl|my_center|LOCUS_20480 54999 55217 gene locus_tag LOCUS_20490 54999 55217 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375557.1 protein_id gnl|my_center|LOCUS_20490 55940 55305 gene locus_tag LOCUS_20500 55940 55305 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705578.1 protein_id gnl|my_center|LOCUS_20500 56837 56028 gene locus_tag LOCUS_20510 gene xthA 56837 56028 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072940.1 protein_id gnl|my_center|LOCUS_20510 57294 59219 gene locus_tag LOCUS_20520 gene dnaK 57294 59219 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071367.1 protein_id gnl|my_center|LOCUS_20520 59402 60538 gene locus_tag LOCUS_20530 gene dnaJ 59402 60538 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071368.1 protein_id gnl|my_center|LOCUS_20530 60656 61438 gene locus_tag LOCUS_20540 60656 61438 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455384.1 protein_id gnl|my_center|LOCUS_20540 61463 61930 gene locus_tag LOCUS_20550 61463 61930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 62189 62575 gene locus_tag LOCUS_20560 62189 62575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 65614 62834 gene locus_tag LOCUS_20570 65614 62834 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072980.1 protein_id gnl|my_center|LOCUS_20570 65837 66313 gene locus_tag LOCUS_20580 gene sixA 65837 66313 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195817.1 protein_id gnl|my_center|LOCUS_20580 66853 66323 gene locus_tag LOCUS_20590 gene smrB 66853 66323 CDS product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457721.1 protein_id gnl|my_center|LOCUS_20590 66912 67841 gene locus_tag LOCUS_20600 gene prmB 66912 67841 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457652.1 protein_id gnl|my_center|LOCUS_20600 67868 68962 gene locus_tag LOCUS_20610 gene aroC 67868 68962 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706197.1 protein_id gnl|my_center|LOCUS_20610 68981 70147 gene locus_tag LOCUS_20620 68981 70147 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267283.1 protein_id gnl|my_center|LOCUS_20620 70740 70150 gene locus_tag LOCUS_20630 gene yfbR 70740 70150 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098110.1 protein_id gnl|my_center|LOCUS_20630 71963 70743 gene locus_tag LOCUS_20640 71963 70743 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456922.1 protein_id gnl|my_center|LOCUS_20640 72356 72880 gene locus_tag LOCUS_20650 72356 72880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 72908 73699 gene locus_tag LOCUS_20660 72908 73699 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461722.1 protein_id gnl|my_center|LOCUS_20660 74430 73780 gene locus_tag LOCUS_20670 74430 73780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 75393 74440 gene locus_tag LOCUS_20680 gene rlmF 75393 74440 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109384.1 protein_id gnl|my_center|LOCUS_20680 76998 75595 gene locus_tag LOCUS_20690 gene rimO 76998 75595 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218156.1 protein_id gnl|my_center|LOCUS_20690 78056 77331 gene locus_tag LOCUS_20700 gene trmB 78056 77331 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005584.1 protein_id gnl|my_center|LOCUS_20700 78256 79728 gene locus_tag LOCUS_20710 78256 79728 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031712.1 protein_id gnl|my_center|LOCUS_20710 79725 80750 gene locus_tag LOCUS_20720 79725 80750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 81718 80765 gene locus_tag LOCUS_20730 gene gshB 81718 80765 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482451.1 protein_id gnl|my_center|LOCUS_20730 82721 81852 gene locus_tag LOCUS_20740 82721 81852 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118789.1 protein_id gnl|my_center|LOCUS_20740 84638 82842 gene locus_tag LOCUS_20750 84638 82842 CDS product choice-of-anchor I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106299.1 protein_id gnl|my_center|LOCUS_20750 84801 85166 gene locus_tag LOCUS_20760 84801 85166 CDS product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263557.1 protein_id gnl|my_center|LOCUS_20760 85201 87051 gene locus_tag LOCUS_20770 85201 87051 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073024.1 protein_id gnl|my_center|LOCUS_20770 87309 89159 gene locus_tag LOCUS_20780 87309 89159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 89588 89229 gene locus_tag LOCUS_20790 89588 89229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 90172 89732 gene locus_tag LOCUS_20800 90172 89732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 91542 90184 gene locus_tag LOCUS_20810 gene mltF 91542 90184 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705651.1 protein_id gnl|my_center|LOCUS_20810 91948 95856 gene locus_tag LOCUS_20820 gene purL 91948 95856 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455948.1 protein_id gnl|my_center|LOCUS_20820 96300 96683 gene locus_tag LOCUS_20830 96300 96683 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479433.1 protein_id gnl|my_center|LOCUS_20830 96973 97488 gene locus_tag LOCUS_20840 96973 97488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 97835 98578 gene locus_tag LOCUS_20850 97835 98578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 98851 99624 gene locus_tag LOCUS_20860 98851 99624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 100037 100651 gene locus_tag LOCUS_20870 100037 100651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 101011 101424 gene locus_tag LOCUS_20880 101011 101424 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706203.1 protein_id gnl|my_center|LOCUS_20880 101558 101989 gene locus_tag LOCUS_20890 101558 101989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 102768 103667 gene locus_tag LOCUS_20900 gene prfB 102768 103667 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111697003.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20900 103721 105268 gene locus_tag LOCUS_20910 gene lysS 103721 105268 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261233.1 protein_id gnl|my_center|LOCUS_20910 107268 105322 gene locus_tag LOCUS_20920 107268 105322 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072959.1 protein_id gnl|my_center|LOCUS_20920 107385 108485 gene locus_tag LOCUS_20930 107385 108485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 110406 108742 gene locus_tag LOCUS_20940 gene recN 110406 108742 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706784.1 protein_id gnl|my_center|LOCUS_20940 111253 110534 gene locus_tag LOCUS_20950 111253 110534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 112504 111263 gene locus_tag LOCUS_20960 112504 111263 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073255.1 protein_id gnl|my_center|LOCUS_20960 113223 112696 gene locus_tag LOCUS_20970 gene dsbB 113223 112696 CDS product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693737.1 protein_id gnl|my_center|LOCUS_20970 114884 113295 gene locus_tag LOCUS_20980 gene nhaB 114884 113295 CDS product sodium/proton antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072797.1 protein_id gnl|my_center|LOCUS_20980 115211 116446 gene locus_tag LOCUS_20990 115211 116446 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705875.1 protein_id gnl|my_center|LOCUS_20990 116439 117143 gene locus_tag LOCUS_21000 gene lolD 116439 117143 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817672.1 protein_id gnl|my_center|LOCUS_21000 117136 118380 gene locus_tag LOCUS_21010 gene lolE 117136 118380 CDS product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263327.1 protein_id gnl|my_center|LOCUS_21010 119549 118551 gene locus_tag LOCUS_21020 gene gap 119549 118551 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479552.1 protein_id gnl|my_center|LOCUS_21020 119853 122051 gene locus_tag LOCUS_21030 gene malQ 119853 122051 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818803.1 protein_id gnl|my_center|LOCUS_21030 122203 124392 gene locus_tag LOCUS_21040 gene glgB 122203 124392 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707356.1 protein_id gnl|my_center|LOCUS_21040 124412 126541 gene locus_tag LOCUS_21050 gene glgX 124412 126541 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707355.1 protein_id gnl|my_center|LOCUS_21050 126873 128402 gene locus_tag LOCUS_21060 gene gndA 126873 128402 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072009.1 protein_id gnl|my_center|LOCUS_21060 128425 128814 gene locus_tag LOCUS_21070 gene msrB 128425 128814 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106032.1 protein_id gnl|my_center|LOCUS_21070 129103 129855 gene locus_tag LOCUS_21080 129103 129855 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073084.1 protein_id gnl|my_center|LOCUS_21080 130028 131851 gene locus_tag LOCUS_21090 130028 131851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 133736 131997 gene locus_tag LOCUS_21100 133736 131997 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288137.1 protein_id gnl|my_center|LOCUS_21100 135065 133836 gene locus_tag LOCUS_21110 135065 133836 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_21110 135950 135141 gene locus_tag LOCUS_21120 135950 135141 CDS product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097743.1 protein_id gnl|my_center|LOCUS_21120 136835 135951 gene locus_tag LOCUS_21130 136835 135951 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_21130 137185 137928 gene locus_tag LOCUS_21140 137185 137928 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922137.1 protein_id gnl|my_center|LOCUS_21140 137948 138697 gene locus_tag LOCUS_21150 137948 138697 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887613.1 protein_id gnl|my_center|LOCUS_21150 138825 140087 gene locus_tag LOCUS_21160 138825 140087 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207236.1 protein_id gnl|my_center|LOCUS_21160 140154 140609 gene locus_tag LOCUS_21170 gene nrdR 140154 140609 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010675395.1 protein_id gnl|my_center|LOCUS_21170 140700 141830 gene locus_tag LOCUS_21180 gene ribD 140700 141830 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167588.1 protein_id gnl|my_center|LOCUS_21180 141905 142552 gene locus_tag LOCUS_21190 141905 142552 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073315.1 protein_id gnl|my_center|LOCUS_21190 142616 143728 gene locus_tag LOCUS_21200 gene ribBA 142616 143728 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707098.1 protein_id gnl|my_center|LOCUS_21200 143827 144291 gene locus_tag LOCUS_21210 gene ribE 143827 144291 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005440184.1 protein_id gnl|my_center|LOCUS_21210 144301 144720 gene locus_tag LOCUS_21220 gene nusB 144301 144720 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809908.1 protein_id gnl|my_center|LOCUS_21220 144735 145721 gene locus_tag LOCUS_21230 gene thiL 144735 145721 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707094.1 protein_id gnl|my_center|LOCUS_21230 145714 146217 gene locus_tag LOCUS_21240 145714 146217 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073310.1 protein_id gnl|my_center|LOCUS_21240 146227 147075 gene locus_tag LOCUS_21250 146227 147075 CDS product 2OG-Fe(II) oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262215.1 protein_id gnl|my_center|LOCUS_21250 147205 148272 gene locus_tag LOCUS_21260 147205 148272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 148275 148850 gene locus_tag LOCUS_21270 148275 148850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 148939 150417 gene locus_tag LOCUS_21280 148939 150417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 151453 150443 gene locus_tag LOCUS_21290 151453 150443 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206011.1 protein_id gnl|my_center|LOCUS_21290 151709 152632 gene locus_tag LOCUS_21300 151709 152632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 152663 153901 gene locus_tag LOCUS_21310 152663 153901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 153918 154955 gene locus_tag LOCUS_21320 153918 154955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 157026 155023 gene locus_tag LOCUS_21330 157026 155023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 160475 157023 gene locus_tag LOCUS_21340 160475 157023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 161032 166149 gene locus_tag LOCUS_21350 161032 166149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 166160 166777 gene locus_tag LOCUS_21360 166160 166777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 166770 167330 gene locus_tag LOCUS_21370 166770 167330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 167333 167800 gene locus_tag LOCUS_21380 167333 167800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 167878 178149 gene locus_tag LOCUS_21390 167878 178149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 178208 178642 gene locus_tag LOCUS_21400 178208 178642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 178652 179521 gene locus_tag LOCUS_21410 178652 179521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 180184 179768 gene locus_tag LOCUS_21420 180184 179768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 >Feature sequence10 135 1331 gene locus_tag LOCUS_21430 gene chrA 135 1331 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184001.1 protein_id gnl|my_center|LOCUS_21430 2171 1359 gene locus_tag LOCUS_21440 gene mutM 2171 1359 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704183.1 protein_id gnl|my_center|LOCUS_21440 2674 3012 gene locus_tag LOCUS_21450 gene glnK 2674 3012 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704615.1 protein_id gnl|my_center|LOCUS_21450 3042 4310 gene locus_tag LOCUS_21460 3042 4310 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_21460 5032 4457 gene locus_tag LOCUS_21470 5032 4457 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073862.1 protein_id gnl|my_center|LOCUS_21470 6311 5034 gene locus_tag LOCUS_21480 6311 5034 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268907.1 protein_id gnl|my_center|LOCUS_21480 7537 6401 gene locus_tag LOCUS_21490 7537 6401 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815218.1 protein_id gnl|my_center|LOCUS_21490 7727 9193 gene locus_tag LOCUS_21500 7727 9193 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464136.1 protein_id gnl|my_center|LOCUS_21500 9442 11997 gene locus_tag LOCUS_21510 gene znuD 9442 11997 CDS product zinc piracy TonB-dependent receptor ZnuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207628.1 protein_id gnl|my_center|LOCUS_21510 14892 12829 gene locus_tag LOCUS_21520 14892 12829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 16184 15405 gene locus_tag LOCUS_21530 16184 15405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 17118 16474 gene locus_tag LOCUS_21540 17118 16474 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_21540 18271 17132 gene locus_tag LOCUS_21550 18271 17132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 18934 18308 gene locus_tag LOCUS_21560 18934 18308 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552112.1 protein_id gnl|my_center|LOCUS_21560 19043 19927 gene locus_tag LOCUS_21570 19043 19927 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529752.1 protein_id gnl|my_center|LOCUS_21570 21228 20638 gene locus_tag LOCUS_21580 21228 20638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 21604 21341 gene locus_tag LOCUS_21590 21604 21341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 22044 21718 gene locus_tag LOCUS_21600 22044 21718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 23725 22415 gene locus_tag LOCUS_21610 23725 22415 CDS product family 16 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119196.1 protein_id gnl|my_center|LOCUS_21610 24045 24428 gene locus_tag LOCUS_21620 24045 24428 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194120.1 protein_id gnl|my_center|LOCUS_21620 24822 24481 gene locus_tag LOCUS_21630 24822 24481 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704081.1 protein_id gnl|my_center|LOCUS_21630 25168 26106 gene locus_tag LOCUS_21640 25168 26106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 26099 26476 gene locus_tag LOCUS_21650 26099 26476 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464887.1 protein_id gnl|my_center|LOCUS_21650 26473 27345 gene locus_tag LOCUS_21660 26473 27345 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957795.1 protein_id gnl|my_center|LOCUS_21660 27338 28333 gene locus_tag LOCUS_21670 27338 28333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 28426 31389 gene locus_tag LOCUS_21680 28426 31389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 31462 31800 gene locus_tag LOCUS_21690 31462 31800 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070807.1 protein_id gnl|my_center|LOCUS_21690 32136 33314 gene locus_tag LOCUS_21700 32136 33314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 34825 33428 gene locus_tag LOCUS_21710 gene modF 34825 33428 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482730.1 protein_id gnl|my_center|LOCUS_21710 34895 35698 gene locus_tag LOCUS_21720 34895 35698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072480.1 protein_id gnl|my_center|LOCUS_21720 37009 35759 gene locus_tag LOCUS_21730 gene lysA 37009 35759 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262842.1 protein_id gnl|my_center|LOCUS_21730 37183 37022 gene locus_tag LOCUS_21740 37183 37022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 37275 37628 gene locus_tag LOCUS_21750 gene cyaY 37275 37628 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211469.1 protein_id gnl|my_center|LOCUS_21750 37640 38311 gene locus_tag LOCUS_21760 37640 38311 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925860.1 protein_id gnl|my_center|LOCUS_21760 38327 39775 gene locus_tag LOCUS_21770 38327 39775 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074089.1 protein_id gnl|my_center|LOCUS_21770 40227 39790 gene locus_tag LOCUS_21780 gene dtd 40227 39790 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704287.1 protein_id gnl|my_center|LOCUS_21780 41202 40231 gene locus_tag LOCUS_21790 gene pip 41202 40231 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765551.1 protein_id gnl|my_center|LOCUS_21790 42090 41209 gene locus_tag LOCUS_21800 42090 41209 CDS product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704286.1 protein_id gnl|my_center|LOCUS_21800 42243 42872 gene locus_tag LOCUS_21810 42243 42872 CDS product ceramidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528827.1 protein_id gnl|my_center|LOCUS_21810 44445 42883 gene locus_tag LOCUS_21820 44445 42883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 45382 44636 gene locus_tag LOCUS_21830 45382 44636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 45619 46536 gene locus_tag LOCUS_21840 45619 46536 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071047.1 protein_id gnl|my_center|LOCUS_21840 47669 46641 gene locus_tag LOCUS_21850 47669 46641 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261072.1 protein_id gnl|my_center|LOCUS_21850 48226 47636 gene locus_tag LOCUS_21860 gene slmA 48226 47636 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073926.1 protein_id gnl|my_center|LOCUS_21860 49459 48266 gene locus_tag LOCUS_21870 gene coaBC 49459 48266 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478613.1 protein_id gnl|my_center|LOCUS_21870 49716 50390 gene locus_tag LOCUS_21880 gene radC 49716 50390 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 protein_id gnl|my_center|LOCUS_21880 50552 50788 gene locus_tag LOCUS_21890 gene rpmB 50552 50788 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467944.1 protein_id gnl|my_center|LOCUS_21890 50800 50955 gene locus_tag LOCUS_21900 gene rpmG 50800 50955 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051801.1 protein_id gnl|my_center|LOCUS_21900 51037 51507 gene locus_tag LOCUS_21910 51037 51507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 52520 51504 gene locus_tag LOCUS_21920 52520 51504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 53162 52629 gene locus_tag LOCUS_21930 gene yjgA 53162 52629 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457057.1 protein_id gnl|my_center|LOCUS_21930 53303 54628 gene locus_tag LOCUS_21940 gene pmbA 53303 54628 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095347.1 protein_id gnl|my_center|LOCUS_21940 56106 54748 gene locus_tag LOCUS_21950 gene mgtE 56106 54748 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417489.1 protein_id gnl|my_center|LOCUS_21950 56505 56227 gene locus_tag LOCUS_21960 56505 56227 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417490.1 protein_id gnl|my_center|LOCUS_21960 57364 56507 gene locus_tag LOCUS_21970 gene rapZ 57364 56507 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237199.1 protein_id gnl|my_center|LOCUS_21970 57815 57369 gene locus_tag LOCUS_21980 gene ptsN 57815 57369 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261179.1 protein_id gnl|my_center|LOCUS_21980 58102 57815 gene locus_tag LOCUS_21990 gene hpf 58102 57815 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_21990 59627 58131 gene locus_tag LOCUS_22000 59627 58131 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261181.1 protein_id gnl|my_center|LOCUS_22000 60368 59643 gene locus_tag LOCUS_22010 gene lptB 60368 59643 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467801.1 protein_id gnl|my_center|LOCUS_22010 60884 60369 gene locus_tag LOCUS_22020 60884 60369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 61407 60856 gene locus_tag LOCUS_22030 gene lptC 61407 60856 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070181.1 protein_id gnl|my_center|LOCUS_22030 61955 61404 gene locus_tag LOCUS_22040 gene kdsC 61955 61404 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228203.1 protein_id gnl|my_center|LOCUS_22040 62926 61952 gene locus_tag LOCUS_22050 gene kdsD 62926 61952 CDS product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455124.1 protein_id gnl|my_center|LOCUS_22050 63903 62923 gene locus_tag LOCUS_22060 63903 62923 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455122.1 protein_id gnl|my_center|LOCUS_22060 64178 64990 gene locus_tag LOCUS_22070 gene mlaF 64178 64990 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534228.1 protein_id gnl|my_center|LOCUS_22070 64984 65763 gene locus_tag LOCUS_22080 gene mlaE 64984 65763 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707619.1 protein_id gnl|my_center|LOCUS_22080 65770 66240 gene locus_tag LOCUS_22090 gene mlaD 65770 66240 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073691.1 protein_id gnl|my_center|LOCUS_22090 66256 66918 gene locus_tag LOCUS_22100 gene mlaC 66256 66918 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265516.1 protein_id gnl|my_center|LOCUS_22100 66919 67212 gene locus_tag LOCUS_22110 66919 67212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 67216 67470 gene locus_tag LOCUS_22120 67216 67470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 67491 68753 gene locus_tag LOCUS_22130 gene murA 67491 68753 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073687.1 protein_id gnl|my_center|LOCUS_22130 69805 68828 gene locus_tag LOCUS_22140 gene degS 69805 68828 CDS product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210128.1 protein_id gnl|my_center|LOCUS_22140 71380 70013 gene locus_tag LOCUS_22150 71380 70013 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743136.1 protein_id gnl|my_center|LOCUS_22150 71911 71477 gene locus_tag LOCUS_22160 71911 71477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 72022 73125 gene locus_tag LOCUS_22170 gene zapE 72022 73125 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707598.1 protein_id gnl|my_center|LOCUS_22170 73304 73732 gene locus_tag LOCUS_22180 gene rplM 73304 73732 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005336289.1 protein_id gnl|my_center|LOCUS_22180 73744 74136 gene locus_tag LOCUS_22190 gene rpsI 73744 74136 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458217.1 protein_id gnl|my_center|LOCUS_22190 74518 75108 gene locus_tag LOCUS_22200 gene petA 74518 75108 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070938.1 protein_id gnl|my_center|LOCUS_22200 75111 76379 gene locus_tag LOCUS_22210 75111 76379 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479717.1 protein_id gnl|my_center|LOCUS_22210 76376 77116 gene locus_tag LOCUS_22220 76376 77116 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758871.1 protein_id gnl|my_center|LOCUS_22220 77328 77960 gene locus_tag LOCUS_22230 gene sspA 77328 77960 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210135.1 protein_id gnl|my_center|LOCUS_22230 77972 78403 gene locus_tag LOCUS_22240 77972 78403 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650453.1 protein_id gnl|my_center|LOCUS_22240 78995 78645 gene locus_tag LOCUS_22250 gene hinT 78995 78645 CDS product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461572.1 protein_id gnl|my_center|LOCUS_22250 79164 80510 gene locus_tag LOCUS_22260 gene gorA 79164 80510 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704063.1 protein_id gnl|my_center|LOCUS_22260 81047 82777 gene locus_tag LOCUS_22270 81047 82777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 83090 84667 gene locus_tag LOCUS_22280 83090 84667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 84932 87805 gene locus_tag LOCUS_22290 84932 87805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 87873 90746 gene locus_tag LOCUS_22300 87873 90746 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_22300 92158 90878 gene locus_tag LOCUS_22310 92158 90878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 93991 92465 gene locus_tag LOCUS_22320 93991 92465 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 protein_id gnl|my_center|LOCUS_22320 94647 94000 gene locus_tag LOCUS_22330 94647 94000 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263283.1 protein_id gnl|my_center|LOCUS_22330 95600 94653 gene locus_tag LOCUS_22340 95600 94653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 97150 95618 gene locus_tag LOCUS_22350 97150 95618 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123415.1 protein_id gnl|my_center|LOCUS_22350 100214 97155 gene locus_tag LOCUS_22360 100214 97155 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037253593.1 protein_id gnl|my_center|LOCUS_22360 101445 100375 gene locus_tag LOCUS_22370 101445 100375 CDS product peptidylglycine monooxygenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663621.1 protein_id gnl|my_center|LOCUS_22370 102221 101796 gene locus_tag LOCUS_22380 102221 101796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 102713 104761 gene locus_tag LOCUS_22390 102713 104761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 104771 106066 gene locus_tag LOCUS_22400 104771 106066 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_22400 106078 107046 gene locus_tag LOCUS_22410 106078 107046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 107717 107097 gene locus_tag LOCUS_22420 107717 107097 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073392.1 protein_id gnl|my_center|LOCUS_22420 107908 108561 gene locus_tag LOCUS_22430 107908 108561 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036109.1 protein_id gnl|my_center|LOCUS_22430 108583 109170 gene locus_tag LOCUS_22440 gene pth 108583 109170 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081944.1 protein_id gnl|my_center|LOCUS_22440 109181 110272 gene locus_tag LOCUS_22450 gene ychF 109181 110272 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505850.1 protein_id gnl|my_center|LOCUS_22450 110932 111008 gene locus_tag LOCUS_t00330 110932 111008 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 111016 111100 gene locus_tag LOCUS_t00340 111016 111100 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 111116 111190 gene locus_tag LOCUS_t00350 111116 111190 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 111222 111296 gene locus_tag LOCUS_t00360 111222 111296 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 113328 111994 gene locus_tag LOCUS_22460 gene hslU 113328 111994 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073857.1 protein_id gnl|my_center|LOCUS_22460 113864 113334 gene locus_tag LOCUS_22470 gene hslV 113864 113334 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455873.1 protein_id gnl|my_center|LOCUS_22470 114554 114012 gene locus_tag LOCUS_22480 114554 114012 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884022.1 protein_id gnl|my_center|LOCUS_22480 116891 114711 gene locus_tag LOCUS_22490 gene priA 116891 114711 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170066715.1 protein_id gnl|my_center|LOCUS_22490 117169 117381 gene locus_tag LOCUS_22500 gene rpmE 117169 117381 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073821.1 protein_id gnl|my_center|LOCUS_22500 117609 118079 gene locus_tag LOCUS_22510 117609 118079 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381269.1 protein_id gnl|my_center|LOCUS_22510 118086 118505 gene locus_tag LOCUS_22520 118086 118505 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_22520 118672 120171 gene locus_tag LOCUS_22530 118672 120171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 120304 121308 gene locus_tag LOCUS_22540 gene trpS 120304 121308 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706960.1 protein_id gnl|my_center|LOCUS_22540 121574 122782 gene locus_tag LOCUS_22550 121574 122782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 122785 123207 gene locus_tag LOCUS_22560 122785 123207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 123231 123872 gene locus_tag LOCUS_22570 123231 123872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 125359 123896 gene locus_tag LOCUS_22580 125359 123896 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704858.1 protein_id gnl|my_center|LOCUS_22580 126114 125422 gene locus_tag LOCUS_22590 126114 125422 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_22590 126912 126217 gene locus_tag LOCUS_22600 126912 126217 CDS product spondin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478024.1 protein_id gnl|my_center|LOCUS_22600 127624 126923 gene locus_tag LOCUS_22610 127624 126923 CDS product spondin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478233.1 protein_id gnl|my_center|LOCUS_22610 127828 129993 gene locus_tag LOCUS_22620 gene uvrD 127828 129993 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704228.1 protein_id gnl|my_center|LOCUS_22620 130029 131294 gene locus_tag LOCUS_22630 130029 131294 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438097.1 protein_id gnl|my_center|LOCUS_22630 131297 132544 gene locus_tag LOCUS_22640 131297 132544 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438097.1 protein_id gnl|my_center|LOCUS_22640 132666 133490 gene locus_tag LOCUS_22650 132666 133490 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119048.1 protein_id gnl|my_center|LOCUS_22650 133968 133456 gene locus_tag LOCUS_22660 133968 133456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 135887 133971 gene locus_tag LOCUS_22670 135887 133971 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480039.1 protein_id gnl|my_center|LOCUS_22670 136030 136230 gene locus_tag LOCUS_22680 136030 136230 CDS product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704934.1 protein_id gnl|my_center|LOCUS_22680 136486 136238 gene locus_tag LOCUS_22690 136486 136238 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261071.1 protein_id gnl|my_center|LOCUS_22690 137451 136468 gene locus_tag LOCUS_22700 137451 136468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 137566 138336 gene locus_tag LOCUS_22710 gene fkpA 137566 138336 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704938.1 protein_id gnl|my_center|LOCUS_22710 138636 139061 gene locus_tag LOCUS_22720 138636 139061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 140731 139271 gene locus_tag LOCUS_22730 140731 139271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 141101 141709 gene locus_tag LOCUS_22740 141101 141709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 142450 141992 gene locus_tag LOCUS_22750 142450 141992 CDS product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707403.1 protein_id gnl|my_center|LOCUS_22750 142639 143460 gene locus_tag LOCUS_22760 gene nudC 142639 143460 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373941.1 protein_id gnl|my_center|LOCUS_22760 143689 144756 gene locus_tag LOCUS_22770 gene hemE 143689 144756 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635049.1 protein_id gnl|my_center|LOCUS_22770 146305 144872 gene locus_tag LOCUS_22780 gene sthA 146305 144872 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460367.1 protein_id gnl|my_center|LOCUS_22780 147606 146485 gene locus_tag LOCUS_22790 147606 146485 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070593.1 protein_id gnl|my_center|LOCUS_22790 148960 147863 gene locus_tag LOCUS_22800 gene trmA 148960 147863 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421342.1 protein_id gnl|my_center|LOCUS_22800 149210 150469 gene locus_tag LOCUS_22810 149210 150469 CDS product DUF5610 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707847.1 protein_id gnl|my_center|LOCUS_22810 153256 150647 gene locus_tag LOCUS_22820 153256 150647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 154028 155560 gene locus_tag LOCUS_22830 154028 155560 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704452.1 protein_id gnl|my_center|LOCUS_22830 >Feature sequence11 96 2663 gene locus_tag LOCUS_22840 96 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 3188 2769 gene locus_tag LOCUS_22850 3188 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 3500 5959 gene locus_tag LOCUS_22860 3500 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 6924 6250 gene locus_tag LOCUS_22870 6924 6250 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193030647.1 protein_id gnl|my_center|LOCUS_22870 7052 7939 gene locus_tag LOCUS_22880 7052 7939 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307641.1 protein_id gnl|my_center|LOCUS_22880 8604 8266 gene locus_tag LOCUS_22890 8604 8266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 10250 9900 gene locus_tag LOCUS_22900 10250 9900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 10819 10250 gene locus_tag LOCUS_22910 10819 10250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 11337 11137 gene locus_tag LOCUS_22920 11337 11137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 12842 12210 gene locus_tag LOCUS_22930 gene nth 12842 12210 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210602.1 protein_id gnl|my_center|LOCUS_22930 13570 12863 gene locus_tag LOCUS_22940 13570 12863 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480817.1 protein_id gnl|my_center|LOCUS_22940 14186 13557 gene locus_tag LOCUS_22950 gene rsxG 14186 13557 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480816.1 protein_id gnl|my_center|LOCUS_22950 15242 14190 gene locus_tag LOCUS_22960 gene rsxD 15242 14190 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061001934.1 protein_id gnl|my_center|LOCUS_22960 17660 15243 gene locus_tag LOCUS_22970 gene rsxC 17660 15243 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261587.1 protein_id gnl|my_center|LOCUS_22970 18242 17682 gene locus_tag LOCUS_22980 gene rsxB 18242 17682 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706450.1 protein_id gnl|my_center|LOCUS_22980 18823 18239 gene locus_tag LOCUS_22990 gene rsxA 18823 18239 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418573.1 protein_id gnl|my_center|LOCUS_22990 20865 18940 gene locus_tag LOCUS_23000 20865 18940 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072470.1 protein_id gnl|my_center|LOCUS_23000 21098 21022 gene locus_tag LOCUS_t00370 21098 21022 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 21203 21127 gene locus_tag LOCUS_t00380 21203 21127 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 22258 22028 gene locus_tag LOCUS_23010 22258 22028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 22161 23429 gene locus_tag LOCUS_23020 22161 23429 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 protein_id gnl|my_center|LOCUS_23020 23435 25453 gene locus_tag LOCUS_23030 gene uvrB 23435 25453 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706281.1 protein_id gnl|my_center|LOCUS_23030 25485 26558 gene locus_tag LOCUS_23040 25485 26558 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457764.1 protein_id gnl|my_center|LOCUS_23040 27382 26690 gene locus_tag LOCUS_23050 27382 26690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 27969 27379 gene locus_tag LOCUS_23060 27969 27379 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_23060 28711 28028 gene locus_tag LOCUS_23070 28711 28028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 29889 28807 gene locus_tag LOCUS_23080 29889 28807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 31584 30394 gene locus_tag LOCUS_23090 gene pheA 31584 30394 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130282.1 protein_id gnl|my_center|LOCUS_23090 32039 34621 gene locus_tag LOCUS_23100 gene pdeB 32039 34621 CDS product cyclic di-GMP phosphodiesterase PdeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070793.1 protein_id gnl|my_center|LOCUS_23100 36267 34645 gene locus_tag LOCUS_23110 36267 34645 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706481.1 protein_id gnl|my_center|LOCUS_23110 36486 38162 gene locus_tag LOCUS_23120 36486 38162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 38165 38488 gene locus_tag LOCUS_23130 38165 38488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 38490 38768 gene locus_tag LOCUS_23140 38490 38768 CDS product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046791.1 protein_id gnl|my_center|LOCUS_23140 38758 41550 gene locus_tag LOCUS_23150 38758 41550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 41735 42046 gene locus_tag LOCUS_23160 41735 42046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 41775 41794 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43846 42452 gene locus_tag LOCUS_23170 gene asnS 43846 42452 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220370.1 protein_id gnl|my_center|LOCUS_23170 44026 44400 gene locus_tag LOCUS_23180 44026 44400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 44518 45156 gene locus_tag LOCUS_23190 44518 45156 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096040.1 protein_id gnl|my_center|LOCUS_23190 45999 45211 gene locus_tag LOCUS_23200 gene thiK 45999 45211 CDS product thiamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261769.1 protein_id gnl|my_center|LOCUS_23200 46573 46001 gene locus_tag LOCUS_23210 gene pnuC 46573 46001 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_23210 46841 46581 gene locus_tag LOCUS_23220 46841 46581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072659.1 protein_id gnl|my_center|LOCUS_23220 49000 46907 gene locus_tag LOCUS_23230 49000 46907 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 protein_id gnl|my_center|LOCUS_23230 49692 49234 gene locus_tag LOCUS_23240 49692 49234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 50151 49891 gene locus_tag LOCUS_23250 gene rpsT 50151 49891 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308808.1 protein_id gnl|my_center|LOCUS_23250 50443 52005 gene locus_tag LOCUS_23260 gene murJ 50443 52005 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477919.1 protein_id gnl|my_center|LOCUS_23260 52121 53047 gene locus_tag LOCUS_23270 gene ribF 52121 53047 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704642.1 protein_id gnl|my_center|LOCUS_23270 53085 55895 gene locus_tag LOCUS_23280 gene ileS 53085 55895 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488695.1 protein_id gnl|my_center|LOCUS_23280 55916 56437 gene locus_tag LOCUS_23290 gene lspA 55916 56437 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073364.1 protein_id gnl|my_center|LOCUS_23290 56439 56873 gene locus_tag LOCUS_23300 gene fkpB 56439 56873 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704645.1 protein_id gnl|my_center|LOCUS_23300 56894 57823 gene locus_tag LOCUS_23310 gene ispH 56894 57823 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261246.1 protein_id gnl|my_center|LOCUS_23310 58158 58703 gene locus_tag LOCUS_23320 58158 58703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 58714 59775 gene locus_tag LOCUS_23330 58714 59775 CDS product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073360.1 protein_id gnl|my_center|LOCUS_23330 59763 60248 gene locus_tag LOCUS_23340 59763 60248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 60260 63973 gene locus_tag LOCUS_23350 60260 63973 CDS product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073358.1 protein_id gnl|my_center|LOCUS_23350 63973 64416 gene locus_tag LOCUS_23360 63973 64416 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103296.1 protein_id gnl|my_center|LOCUS_23360 64388 64702 gene locus_tag LOCUS_23370 64388 64702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 65081 67075 gene locus_tag LOCUS_23380 gene tkt 65081 67075 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071210.1 protein_id gnl|my_center|LOCUS_23380 67130 68158 gene locus_tag LOCUS_23390 gene epd 67130 68158 CDS product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218338.1 protein_id gnl|my_center|LOCUS_23390 68217 69392 gene locus_tag LOCUS_23400 gene pgk 68217 69392 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209963.1 protein_id gnl|my_center|LOCUS_23400 69568 70212 gene locus_tag LOCUS_23410 gene adk 69568 70212 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072102.1 protein_id gnl|my_center|LOCUS_23410 72361 70295 gene locus_tag LOCUS_23420 72361 70295 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871078.1 protein_id gnl|my_center|LOCUS_23420 72595 73488 gene locus_tag LOCUS_23430 72595 73488 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073410.1 protein_id gnl|my_center|LOCUS_23430 73478 73882 gene locus_tag LOCUS_23440 73478 73882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 73884 74582 gene locus_tag LOCUS_23450 73884 74582 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073412.1 protein_id gnl|my_center|LOCUS_23450 74585 75850 gene locus_tag LOCUS_23460 74585 75850 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073413.1 protein_id gnl|my_center|LOCUS_23460 75955 76293 gene locus_tag LOCUS_23470 gene fliE 75955 76293 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073113.1 protein_id gnl|my_center|LOCUS_23470 76314 78026 gene locus_tag LOCUS_23480 gene fliF 76314 78026 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925897.1 protein_id gnl|my_center|LOCUS_23480 78019 79047 gene locus_tag LOCUS_23490 gene fliG 78019 79047 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073111.1 protein_id gnl|my_center|LOCUS_23490 79090 79881 gene locus_tag LOCUS_23500 gene fliH 79090 79881 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012402.1 protein_id gnl|my_center|LOCUS_23500 79995 81317 gene locus_tag LOCUS_23510 gene fliI 79995 81317 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705275.1 protein_id gnl|my_center|LOCUS_23510 81317 81751 gene locus_tag LOCUS_23520 81317 81751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 81883 84213 gene locus_tag LOCUS_23530 81883 84213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 84297 84839 gene locus_tag LOCUS_23540 gene fliL 84297 84839 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073106.1 protein_id gnl|my_center|LOCUS_23540 84870 85943 gene locus_tag LOCUS_23550 gene fliM 84870 85943 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705279.1 protein_id gnl|my_center|LOCUS_23550 85971 86375 gene locus_tag LOCUS_23560 gene fliN 85971 86375 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705280.1 protein_id gnl|my_center|LOCUS_23560 86522 86328 gene locus_tag LOCUS_23570 86522 86328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 86485 86754 gene locus_tag LOCUS_23580 86485 86754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 86751 87491 gene locus_tag LOCUS_23590 gene fliP 86751 87491 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481091.1 protein_id gnl|my_center|LOCUS_23590 87530 87799 gene locus_tag LOCUS_23600 gene fliQ 87530 87799 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073101.1 protein_id gnl|my_center|LOCUS_23600 87799 88572 gene locus_tag LOCUS_23610 gene fliR 87799 88572 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073100.1 protein_id gnl|my_center|LOCUS_23610 88576 89709 gene locus_tag LOCUS_23620 gene flhB 88576 89709 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840982.1 protein_id gnl|my_center|LOCUS_23620 91465 89858 gene locus_tag LOCUS_23630 91465 89858 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364240.1 protein_id gnl|my_center|LOCUS_23630 93728 91641 gene locus_tag LOCUS_23640 93728 91641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 95739 94306 gene locus_tag LOCUS_23650 gene lpdA 95739 94306 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707561.1 protein_id gnl|my_center|LOCUS_23650 97720 95804 gene locus_tag LOCUS_23660 gene aceF 97720 95804 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070783.1 protein_id gnl|my_center|LOCUS_23660 100406 97737 gene locus_tag LOCUS_23670 gene aceE 100406 97737 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070782.1 protein_id gnl|my_center|LOCUS_23670 101300 100542 gene locus_tag LOCUS_23680 gene pdhR 101300 100542 CDS product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462576.1 protein_id gnl|my_center|LOCUS_23680 102137 101541 gene locus_tag LOCUS_23690 102137 101541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 102563 103486 gene locus_tag LOCUS_23700 102563 103486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 105085 103820 gene locus_tag LOCUS_23710 gene bioA 105085 103820 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263576.1 protein_id gnl|my_center|LOCUS_23710 105197 106243 gene locus_tag LOCUS_23720 gene bioB 105197 106243 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705387.1 protein_id gnl|my_center|LOCUS_23720 106256 107506 gene locus_tag LOCUS_23730 gene bioF 106256 107506 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705388.1 protein_id gnl|my_center|LOCUS_23730 107497 108312 gene locus_tag LOCUS_23740 gene bioC 107497 108312 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705389.1 protein_id gnl|my_center|LOCUS_23740 109247 108366 gene locus_tag LOCUS_23750 109247 108366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 109456 109710 gene locus_tag LOCUS_23760 109456 109710 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262767.1 protein_id gnl|my_center|LOCUS_23760 109712 111448 gene locus_tag LOCUS_23770 109712 111448 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106103.1 protein_id gnl|my_center|LOCUS_23770 111622 112308 gene locus_tag LOCUS_23780 gene bioD 111622 112308 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705390.1 protein_id gnl|my_center|LOCUS_23780 112483 114126 gene locus_tag LOCUS_23790 gene pgm 112483 114126 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705434.1 protein_id gnl|my_center|LOCUS_23790 114291 116816 gene locus_tag LOCUS_23800 114291 116816 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706264.1 protein_id gnl|my_center|LOCUS_23800 118531 116999 gene locus_tag LOCUS_23810 118531 116999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 122012 118542 gene locus_tag LOCUS_23820 gene mfd 122012 118542 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705873.1 protein_id gnl|my_center|LOCUS_23820 122537 123757 gene locus_tag LOCUS_23830 122537 123757 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706957.1 protein_id gnl|my_center|LOCUS_23830 124241 125662 gene locus_tag LOCUS_23840 gene uxaC 124241 125662 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039186.1 protein_id gnl|my_center|LOCUS_23840 126013 126471 gene locus_tag LOCUS_23850 126013 126471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 126472 126933 gene locus_tag LOCUS_23860 gene rimI 126472 126933 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092460.1 protein_id gnl|my_center|LOCUS_23860 127045 127971 gene locus_tag LOCUS_23870 127045 127971 CDS product TIGR03899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417387.1 protein_id gnl|my_center|LOCUS_23870 128982 127993 gene locus_tag LOCUS_23880 128982 127993 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252564.1 protein_id gnl|my_center|LOCUS_23880 129098 130000 gene locus_tag LOCUS_23890 129098 130000 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481663.1 protein_id gnl|my_center|LOCUS_23890 129993 130319 gene locus_tag LOCUS_23900 129993 130319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 131281 130349 gene locus_tag LOCUS_23910 gene ttcA 131281 130349 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693987.1 protein_id gnl|my_center|LOCUS_23910 131947 132660 gene locus_tag LOCUS_23920 gene bla2 131947 132660 CDS product BcII family subclass B1 metallo-beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016124981.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence12 1331 195 gene locus_tag LOCUS_23930 gene lldD 1331 195 CDS product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478054.1 protein_id gnl|my_center|LOCUS_23930 1484 2404 gene locus_tag LOCUS_23940 1484 2404 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462891.1 protein_id gnl|my_center|LOCUS_23940 2800 2724 gene locus_tag LOCUS_t00390 2800 2724 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2895 2947 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3028 2952 gene locus_tag LOCUS_t00400 3028 2952 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3281 3205 gene locus_tag LOCUS_t00410 3281 3205 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3652 5769 gene locus_tag LOCUS_23950 3652 5769 CDS product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072547.1 protein_id gnl|my_center|LOCUS_23950 5779 7158 gene locus_tag LOCUS_23960 5779 7158 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072546.1 protein_id gnl|my_center|LOCUS_23960 7175 8221 gene locus_tag LOCUS_23970 7175 8221 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072545.1 protein_id gnl|my_center|LOCUS_23970 8226 10541 gene locus_tag LOCUS_23980 8226 10541 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_23980 10627 15465 gene locus_tag LOCUS_23990 10627 15465 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706140.1 protein_id gnl|my_center|LOCUS_23990 15555 16574 gene locus_tag LOCUS_24000 gene pyrD 15555 16574 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261892.1 protein_id gnl|my_center|LOCUS_24000 16621 17163 gene locus_tag LOCUS_24010 16621 17163 CDS product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072541.1 protein_id gnl|my_center|LOCUS_24010 17166 17921 gene locus_tag LOCUS_24020 17166 17921 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706625.1 protein_id gnl|my_center|LOCUS_24020 18078 19469 gene locus_tag LOCUS_24030 18078 19469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 19814 19569 gene locus_tag LOCUS_24040 19814 19569 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071475.1 protein_id gnl|my_center|LOCUS_24040 21220 19823 gene locus_tag LOCUS_24050 gene yegQ 21220 19823 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704950.1 protein_id gnl|my_center|LOCUS_24050 22148 21465 gene locus_tag LOCUS_24060 22148 21465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 22425 25472 gene locus_tag LOCUS_24070 22425 25472 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262103.1 protein_id gnl|my_center|LOCUS_24070 28084 25613 gene locus_tag LOCUS_24080 28084 25613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 31043 28530 gene locus_tag LOCUS_24090 31043 28530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 31194 33656 gene locus_tag LOCUS_24100 31194 33656 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920963.1 protein_id gnl|my_center|LOCUS_24100 33715 35682 gene locus_tag LOCUS_24110 33715 35682 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_24110 37215 35923 gene locus_tag LOCUS_24120 37215 35923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 38160 37339 gene locus_tag LOCUS_24130 38160 37339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 39037 39690 gene locus_tag LOCUS_24140 39037 39690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 41699 40020 gene locus_tag LOCUS_24150 41699 40020 CDS product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120965.1 protein_id gnl|my_center|LOCUS_24150 42253 41696 gene locus_tag LOCUS_24160 42253 41696 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105333325.1 protein_id gnl|my_center|LOCUS_24160 43856 42441 gene locus_tag LOCUS_24170 43856 42441 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767366.1 protein_id gnl|my_center|LOCUS_24170 44193 46985 gene locus_tag LOCUS_24180 44193 46985 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955702.1 protein_id gnl|my_center|LOCUS_24180 47084 50455 gene locus_tag LOCUS_24190 47084 50455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 50477 54010 gene locus_tag LOCUS_24200 50477 54010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 54151 55233 gene locus_tag LOCUS_24210 gene rhaT 54151 55233 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_24210 55366 56772 gene locus_tag LOCUS_24220 55366 56772 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767194.1 protein_id gnl|my_center|LOCUS_24220 57256 58722 gene locus_tag LOCUS_24230 57256 58722 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122845.1 protein_id gnl|my_center|LOCUS_24230 59092 60789 gene locus_tag LOCUS_24240 59092 60789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 60852 63347 gene locus_tag LOCUS_24250 60852 63347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 64016 64654 gene locus_tag LOCUS_24260 64016 64654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 65422 65676 gene locus_tag LOCUS_24270 65422 65676 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483180.1 protein_id gnl|my_center|LOCUS_24270 65669 65929 gene locus_tag LOCUS_24280 65669 65929 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_24280 66679 66419 gene locus_tag LOCUS_24290 gene yoeB 66679 66419 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_24290 66927 66676 gene locus_tag LOCUS_24300 gene yefM 66927 66676 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259256.1 protein_id gnl|my_center|LOCUS_24300 67913 68365 gene locus_tag LOCUS_24310 67913 68365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 69831 68617 gene locus_tag LOCUS_24320 69831 68617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 70559 69951 gene locus_tag LOCUS_24330 70559 69951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 71196 71798 gene locus_tag LOCUS_24340 71196 71798 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105333325.1 protein_id gnl|my_center|LOCUS_24340 71795 73480 gene locus_tag LOCUS_24350 71795 73480 CDS product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120965.1 protein_id gnl|my_center|LOCUS_24350 73840 74127 gene locus_tag LOCUS_24360 73840 74127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 74359 75210 gene locus_tag LOCUS_24370 74359 75210 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445511.1 protein_id gnl|my_center|LOCUS_24370 76833 75361 gene locus_tag LOCUS_24380 76833 75361 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_24380 77915 76989 gene locus_tag LOCUS_24390 77915 76989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 81402 77926 gene locus_tag LOCUS_24400 81402 77926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 83462 81654 gene locus_tag LOCUS_24410 83462 81654 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108511.1 protein_id gnl|my_center|LOCUS_24410 84938 83493 gene locus_tag LOCUS_24420 84938 83493 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 protein_id gnl|my_center|LOCUS_24420 85396 87135 gene locus_tag LOCUS_24430 85396 87135 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_24430 87135 88073 gene locus_tag LOCUS_24440 gene hyi 87135 88073 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085951.1 protein_id gnl|my_center|LOCUS_24440 88828 92148 gene locus_tag LOCUS_24450 88828 92148 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107554.1 protein_id gnl|my_center|LOCUS_24450 92488 92790 gene locus_tag LOCUS_24460 92488 92790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 93739 92849 gene locus_tag LOCUS_24470 93739 92849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 95067 93832 gene locus_tag LOCUS_24480 95067 93832 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816770.1 protein_id gnl|my_center|LOCUS_24480 95344 96150 gene locus_tag LOCUS_24490 95344 96150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 96346 97041 gene locus_tag LOCUS_24500 96346 97041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 97062 98210 gene locus_tag LOCUS_24510 97062 98210 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_24510 98280 99683 gene locus_tag LOCUS_24520 98280 99683 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119625.1 protein_id gnl|my_center|LOCUS_24520 99683 100774 gene locus_tag LOCUS_24530 99683 100774 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803813.1 protein_id gnl|my_center|LOCUS_24530 102028 101123 gene locus_tag LOCUS_24540 102028 101123 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457564.1 protein_id gnl|my_center|LOCUS_24540 102213 102776 gene locus_tag LOCUS_24550 gene ahpC 102213 102776 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071237.1 protein_id gnl|my_center|LOCUS_24550 102887 104440 gene locus_tag LOCUS_24560 gene ahpF 102887 104440 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071236.1 protein_id gnl|my_center|LOCUS_24560 105457 104474 gene locus_tag LOCUS_24570 105457 104474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 106679 105468 gene locus_tag LOCUS_24580 106679 105468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 109592 107208 gene locus_tag LOCUS_24590 109592 107208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 110370 109681 gene locus_tag LOCUS_24600 110370 109681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 110570 111307 gene locus_tag LOCUS_24610 110570 111307 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477441.1 protein_id gnl|my_center|LOCUS_24610 112351 111383 gene locus_tag LOCUS_24620 112351 111383 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073720.1 protein_id gnl|my_center|LOCUS_24620 113454 112366 gene locus_tag LOCUS_24630 gene fbaA 113454 112366 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209962.1 protein_id gnl|my_center|LOCUS_24630 115462 113741 gene locus_tag LOCUS_24640 115462 113741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 116262 115465 gene locus_tag LOCUS_24650 116262 115465 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_24650 117990 116275 gene locus_tag LOCUS_24660 117990 116275 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973790.1 protein_id gnl|my_center|LOCUS_24660 118559 117987 gene locus_tag LOCUS_24670 118559 117987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 118850 119722 gene locus_tag LOCUS_24680 118850 119722 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_24680 119837 122626 gene locus_tag LOCUS_24690 119837 122626 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence13 254 565 gene locus_tag LOCUS_24700 gene rpsJ 254 565 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307944.1 protein_id gnl|my_center|LOCUS_24700 597 1235 gene locus_tag LOCUS_24710 gene rplC 597 1235 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010672559.1 protein_id gnl|my_center|LOCUS_24710 1247 1852 gene locus_tag LOCUS_24720 gene rplD 1247 1852 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005340616.1 protein_id gnl|my_center|LOCUS_24720 1849 2154 gene locus_tag LOCUS_24730 gene rplW 1849 2154 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037421480.1 protein_id gnl|my_center|LOCUS_24730 2171 2995 gene locus_tag LOCUS_24740 gene rplB 2171 2995 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417230.1 protein_id gnl|my_center|LOCUS_24740 3012 3290 gene locus_tag LOCUS_24750 gene rpsS 3012 3290 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004394525.1 protein_id gnl|my_center|LOCUS_24750 3300 3632 gene locus_tag LOCUS_24760 gene rplV 3300 3632 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083595.1 protein_id gnl|my_center|LOCUS_24760 3644 4360 gene locus_tag LOCUS_24770 gene rpsC 3644 4360 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417236.1 protein_id gnl|my_center|LOCUS_24770 4360 4773 gene locus_tag LOCUS_24780 gene rplP 4360 4773 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307963.1 protein_id gnl|my_center|LOCUS_24780 4773 4964 gene locus_tag LOCUS_24790 gene rpmC 4773 4964 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644429.1 protein_id gnl|my_center|LOCUS_24790 4964 5212 gene locus_tag LOCUS_24800 gene rpsQ 4964 5212 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417239.1 protein_id gnl|my_center|LOCUS_24800 5366 5734 gene locus_tag LOCUS_24810 gene rplN 5366 5734 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307975.1 protein_id gnl|my_center|LOCUS_24810 5745 6059 gene locus_tag LOCUS_24820 gene rplX 5745 6059 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070623.1 protein_id gnl|my_center|LOCUS_24820 6075 6611 gene locus_tag LOCUS_24830 gene rplE 6075 6611 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070624.1 protein_id gnl|my_center|LOCUS_24830 6622 6927 gene locus_tag LOCUS_24840 gene rpsN 6622 6927 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261079.1 protein_id gnl|my_center|LOCUS_24840 6954 7346 gene locus_tag LOCUS_24850 gene rpsH 6954 7346 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704316.1 protein_id gnl|my_center|LOCUS_24850 7358 7891 gene locus_tag LOCUS_24860 gene rplF 7358 7891 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091945.1 protein_id gnl|my_center|LOCUS_24860 7901 8254 gene locus_tag LOCUS_24870 gene rplR 7901 8254 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005435088.1 protein_id gnl|my_center|LOCUS_24870 8264 8770 gene locus_tag LOCUS_24880 gene rpsE 8264 8770 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644438.1 protein_id gnl|my_center|LOCUS_24880 8776 8958 gene locus_tag LOCUS_24890 gene rpmD 8776 8958 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201159.1 protein_id gnl|my_center|LOCUS_24890 8962 9396 gene locus_tag LOCUS_24900 gene rplO 8962 9396 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450562.1 protein_id gnl|my_center|LOCUS_24900 9404 10732 gene locus_tag LOCUS_24910 gene secY 9404 10732 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010672567.1 protein_id gnl|my_center|LOCUS_24910 10977 11333 gene locus_tag LOCUS_24920 gene rpsM 10977 11333 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648406.1 protein_id gnl|my_center|LOCUS_24920 11349 11741 gene locus_tag LOCUS_24930 gene rpsK 11349 11741 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083577.1 protein_id gnl|my_center|LOCUS_24930 11771 12391 gene locus_tag LOCUS_24940 gene rpsD 11771 12391 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919224.1 protein_id gnl|my_center|LOCUS_24940 12416 13405 gene locus_tag LOCUS_24950 gene rpoA 12416 13405 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070632.1 protein_id gnl|my_center|LOCUS_24950 13442 13846 gene locus_tag LOCUS_24960 gene rplQ 13442 13846 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644470.1 protein_id gnl|my_center|LOCUS_24960 14064 15647 gene locus_tag LOCUS_24970 gene prfC 14064 15647 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108381.1 protein_id gnl|my_center|LOCUS_24970 15659 17401 gene locus_tag LOCUS_24980 gene argS 15659 17401 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693602.1 protein_id gnl|my_center|LOCUS_24980 18006 18767 gene locus_tag LOCUS_24990 18006 18767 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459021.1 protein_id gnl|my_center|LOCUS_24990 18767 20128 gene locus_tag LOCUS_25000 18767 20128 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 protein_id gnl|my_center|LOCUS_25000 20130 20654 gene locus_tag LOCUS_25010 20130 20654 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_25010 20666 21064 gene locus_tag LOCUS_25020 20666 21064 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071947.1 protein_id gnl|my_center|LOCUS_25020 21066 21680 gene locus_tag LOCUS_25030 21066 21680 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071948.1 protein_id gnl|my_center|LOCUS_25030 21746 23047 gene locus_tag LOCUS_25040 21746 23047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 24705 24526 gene locus_tag LOCUS_25050 24705 24526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 26335 25190 gene locus_tag LOCUS_25060 26335 25190 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073043.1 protein_id gnl|my_center|LOCUS_25060 26622 27095 gene locus_tag LOCUS_25070 26622 27095 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935051.1 protein_id gnl|my_center|LOCUS_25070 27735 27211 gene locus_tag LOCUS_25080 gene fldA 27735 27211 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072322.1 protein_id gnl|my_center|LOCUS_25080 27962 27762 gene locus_tag LOCUS_25090 27962 27762 CDS product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072324.1 protein_id gnl|my_center|LOCUS_25090 28769 28005 gene locus_tag LOCUS_25100 28769 28005 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705432.1 protein_id gnl|my_center|LOCUS_25100 28953 28860 gene locus_tag LOCUS_t00420 28953 28860 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 29686 28883 gene locus_tag LOCUS_25110 gene suhB 29686 28883 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072272.1 protein_id gnl|my_center|LOCUS_25110 29907 30632 gene locus_tag LOCUS_25120 gene trmJ 29907 30632 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370313.1 protein_id gnl|my_center|LOCUS_25120 30636 31451 gene locus_tag LOCUS_25130 gene cysE 30636 31451 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072274.1 protein_id gnl|my_center|LOCUS_25130 32104 32484 gene locus_tag LOCUS_25140 32104 32484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25140 32491 32913 gene locus_tag LOCUS_25150 32491 32913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25150 33221 33799 gene locus_tag LOCUS_25160 33221 33799 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_25160 33789 33944 gene locus_tag LOCUS_25170 33789 33944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 34592 34981 gene locus_tag LOCUS_25180 34592 34981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 34974 35396 gene locus_tag LOCUS_25190 34974 35396 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021853.1 protein_id gnl|my_center|LOCUS_25190 35639 35845 gene locus_tag LOCUS_25200 35639 35845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 35827 36114 gene locus_tag LOCUS_25210 35827 36114 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942865.1 protein_id gnl|my_center|LOCUS_25210 38416 37040 gene locus_tag LOCUS_25220 38416 37040 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942487.1 protein_id gnl|my_center|LOCUS_25220 38687 39265 gene locus_tag LOCUS_25230 38687 39265 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_25230 39255 39410 gene locus_tag LOCUS_25240 39255 39410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 40887 43643 gene locus_tag LOCUS_25250 40887 43643 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925895.1 protein_id gnl|my_center|LOCUS_25250 43661 44662 gene locus_tag LOCUS_25260 43661 44662 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073078.1 protein_id gnl|my_center|LOCUS_25260 44670 45788 gene locus_tag LOCUS_25270 gene vpsA 44670 45788 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) VpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756756.1 protein_id gnl|my_center|LOCUS_25270 45891 47159 gene locus_tag LOCUS_25280 gene wecC 45891 47159 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211985.1 protein_id gnl|my_center|LOCUS_25280 47159 48349 gene locus_tag LOCUS_25290 47159 48349 CDS product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261000.1 protein_id gnl|my_center|LOCUS_25290 48361 49506 gene locus_tag LOCUS_25300 48361 49506 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261001.1 protein_id gnl|my_center|LOCUS_25300 49499 50665 gene locus_tag LOCUS_25310 gene neuC 49499 50665 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459665.1 protein_id gnl|my_center|LOCUS_25310 50667 51740 gene locus_tag LOCUS_25320 gene neuB 50667 51740 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261003.1 protein_id gnl|my_center|LOCUS_25320 51733 52383 gene locus_tag LOCUS_25330 51733 52383 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261004.1 protein_id gnl|my_center|LOCUS_25330 52396 53445 gene locus_tag LOCUS_25340 52396 53445 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261005.1 protein_id gnl|my_center|LOCUS_25340 53450 54160 gene locus_tag LOCUS_25350 53450 54160 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392279.1 protein_id gnl|my_center|LOCUS_25350 54153 55118 gene locus_tag LOCUS_25360 54153 55118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 55135 56070 gene locus_tag LOCUS_25370 55135 56070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 56499 56654 gene locus_tag LOCUS_25380 56499 56654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 56680 57423 gene locus_tag LOCUS_25390 56680 57423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 57432 58400 gene locus_tag LOCUS_25400 57432 58400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 58409 58933 gene locus_tag LOCUS_25410 58409 58933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 59671 60192 gene locus_tag LOCUS_25420 59671 60192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 60378 61505 gene locus_tag LOCUS_25430 60378 61505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 61597 62655 gene locus_tag LOCUS_25440 61597 62655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 62652 64790 gene locus_tag LOCUS_25450 62652 64790 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924817.1 protein_id gnl|my_center|LOCUS_25450 64787 66421 gene locus_tag LOCUS_25460 64787 66421 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039947.1 protein_id gnl|my_center|LOCUS_25460 66434 67612 gene locus_tag LOCUS_25470 66434 67612 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_25470 67609 68556 gene locus_tag LOCUS_25480 67609 68556 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202950643.1 protein_id gnl|my_center|LOCUS_25480 68578 69129 gene locus_tag LOCUS_25490 68578 69129 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925892.1 protein_id gnl|my_center|LOCUS_25490 69244 71178 gene locus_tag LOCUS_25500 69244 71178 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 protein_id gnl|my_center|LOCUS_25500 71990 73393 gene locus_tag LOCUS_25510 71990 73393 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167742.1 protein_id gnl|my_center|LOCUS_25510 73862 75268 gene locus_tag LOCUS_25520 73862 75268 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107284302.1 protein_id gnl|my_center|LOCUS_25520 76218 77384 gene locus_tag LOCUS_25530 76218 77384 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_25530 77406 78413 gene locus_tag LOCUS_25540 77406 78413 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706682.1 protein_id gnl|my_center|LOCUS_25540 78805 79533 gene locus_tag LOCUS_25550 78805 79533 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001900033.1 protein_id gnl|my_center|LOCUS_25550 82267 81128 gene locus_tag LOCUS_25560 82267 81128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 82863 83588 gene locus_tag LOCUS_25570 82863 83588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 84274 83705 gene locus_tag LOCUS_25580 84274 83705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 84285 84431 gene locus_tag LOCUS_25590 84285 84431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 87691 84575 gene locus_tag LOCUS_25600 gene rne 87691 84575 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262292.1 protein_id gnl|my_center|LOCUS_25600 88344 89303 gene locus_tag LOCUS_25610 gene rluC 88344 89303 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693754.1 protein_id gnl|my_center|LOCUS_25610 89303 89950 gene locus_tag LOCUS_25620 89303 89950 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408320.1 protein_id gnl|my_center|LOCUS_25620 90996 90397 gene locus_tag LOCUS_25630 90996 90397 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367195.1 protein_id gnl|my_center|LOCUS_25630 91124 91639 gene locus_tag LOCUS_25640 gene yceD 91124 91639 CDS product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210930.1 protein_id gnl|my_center|LOCUS_25640 91653 91826 gene locus_tag LOCUS_25650 gene rpmF 91653 91826 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210931.1 protein_id gnl|my_center|LOCUS_25650 91838 92860 gene locus_tag LOCUS_25660 gene plsX 91838 92860 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706103.1 protein_id gnl|my_center|LOCUS_25660 92866 93825 gene locus_tag LOCUS_25670 92866 93825 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420128.1 protein_id gnl|my_center|LOCUS_25670 93891 94835 gene locus_tag LOCUS_25680 gene fabD 93891 94835 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106014.1 protein_id gnl|my_center|LOCUS_25680 94841 95581 gene locus_tag LOCUS_25690 gene fabG 94841 95581 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918744.1 protein_id gnl|my_center|LOCUS_25690 95819 96061 gene locus_tag LOCUS_25700 gene acpP 95819 96061 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300909.1 protein_id gnl|my_center|LOCUS_25700 96128 97366 gene locus_tag LOCUS_25710 gene fabF 96128 97366 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044667.1 protein_id gnl|my_center|LOCUS_25710 97411 98214 gene locus_tag LOCUS_25720 gene pabC 97411 98214 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207375.1 protein_id gnl|my_center|LOCUS_25720 98207 99199 gene locus_tag LOCUS_25730 gene mltG 98207 99199 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700206.1 protein_id gnl|my_center|LOCUS_25730 99199 99828 gene locus_tag LOCUS_25740 gene tmk 99199 99828 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170710.1 protein_id gnl|my_center|LOCUS_25740 99840 100775 gene locus_tag LOCUS_25750 99840 100775 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868989.1 protein_id gnl|my_center|LOCUS_25750 100799 101125 gene locus_tag LOCUS_25760 100799 101125 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947130.1 protein_id gnl|my_center|LOCUS_25760 101146 101925 gene locus_tag LOCUS_25770 101146 101925 CDS product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706112.1 protein_id gnl|my_center|LOCUS_25770 102015 104303 gene locus_tag LOCUS_25780 gene parC 102015 104303 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073643.1 protein_id gnl|my_center|LOCUS_25780 104319 105038 gene locus_tag LOCUS_25790 104319 105038 CDS product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417513.1 protein_id gnl|my_center|LOCUS_25790 105050 105403 gene locus_tag LOCUS_25800 gene rraB 105050 105403 CDS product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070908.1 protein_id gnl|my_center|LOCUS_25800 105704 106132 gene locus_tag LOCUS_25810 gene ndk 105704 106132 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172605.1 protein_id gnl|my_center|LOCUS_25810 106251 107375 gene locus_tag LOCUS_25820 106251 107375 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098279.1 protein_id gnl|my_center|LOCUS_25820 107407 108177 gene locus_tag LOCUS_25830 gene pilW 107407 108177 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073190.1 protein_id gnl|my_center|LOCUS_25830 108174 109154 gene locus_tag LOCUS_25840 gene rodZ 108174 109154 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482997.1 protein_id gnl|my_center|LOCUS_25840 109159 110277 gene locus_tag LOCUS_25850 gene ispG 109159 110277 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460234.1 protein_id gnl|my_center|LOCUS_25850 110386 111660 gene locus_tag LOCUS_25860 gene hisS 110386 111660 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705646.1 protein_id gnl|my_center|LOCUS_25860 111670 112299 gene locus_tag LOCUS_25870 111670 112299 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261367.1 protein_id gnl|my_center|LOCUS_25870 112299 113495 gene locus_tag LOCUS_25880 gene bamB 112299 113495 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073185.1 protein_id gnl|my_center|LOCUS_25880 113496 114197 gene locus_tag LOCUS_25890 gene tsaA 113496 114197 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706829.1 protein_id gnl|my_center|LOCUS_25890 114969 114412 gene locus_tag LOCUS_25900 114969 114412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 115066 116103 gene locus_tag LOCUS_25910 gene serB 115066 116103 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132954.1 protein_id gnl|my_center|LOCUS_25910 >Feature sequence14 1433 3517 gene locus_tag LOCUS_25920 1433 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 4223 3891 gene locus_tag LOCUS_25930 4223 3891 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082083.1 protein_id gnl|my_center|LOCUS_25930 4495 4226 gene locus_tag LOCUS_25940 4495 4226 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082079.1 protein_id gnl|my_center|LOCUS_25940 5010 4489 gene locus_tag LOCUS_25950 5010 4489 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112515.1 protein_id gnl|my_center|LOCUS_25950 6515 5010 gene locus_tag LOCUS_25960 6515 5010 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112516.1 protein_id gnl|my_center|LOCUS_25960 6868 6518 gene locus_tag LOCUS_25970 6868 6518 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082068.1 protein_id gnl|my_center|LOCUS_25970 9192 6868 gene locus_tag LOCUS_25980 9192 6868 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082059.1 protein_id gnl|my_center|LOCUS_25980 11293 10058 gene locus_tag LOCUS_25990 gene serA 11293 10058 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071152.1 protein_id gnl|my_center|LOCUS_25990 12061 11405 gene locus_tag LOCUS_26000 gene rpiA 12061 11405 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071382.1 protein_id gnl|my_center|LOCUS_26000 12216 12818 gene locus_tag LOCUS_26010 12216 12818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 13384 12815 gene locus_tag LOCUS_26020 13384 12815 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132451.1 protein_id gnl|my_center|LOCUS_26020 13739 14911 gene locus_tag LOCUS_26030 13739 14911 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094960.1 protein_id gnl|my_center|LOCUS_26030 15497 18142 gene locus_tag LOCUS_26040 15497 18142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 18218 20845 gene locus_tag LOCUS_26050 18218 20845 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 protein_id gnl|my_center|LOCUS_26050 21078 21866 gene locus_tag LOCUS_26060 21078 21866 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_26060 21899 23275 gene locus_tag LOCUS_26070 21899 23275 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 protein_id gnl|my_center|LOCUS_26070 23286 23825 gene locus_tag LOCUS_26080 23286 23825 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_26080 23874 24281 gene locus_tag LOCUS_26090 23874 24281 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_26090 24287 24892 gene locus_tag LOCUS_26100 24287 24892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 24904 26193 gene locus_tag LOCUS_26110 24904 26193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458989.1 protein_id gnl|my_center|LOCUS_26110 26360 29458 gene locus_tag LOCUS_26120 26360 29458 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022007.1 protein_id gnl|my_center|LOCUS_26120 29774 29505 gene locus_tag LOCUS_26130 29774 29505 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125345.1 protein_id gnl|my_center|LOCUS_26130 29858 30460 gene locus_tag LOCUS_26140 gene yqaB 29858 30460 CDS product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167426.1 protein_id gnl|my_center|LOCUS_26140 31523 30585 gene locus_tag LOCUS_26150 gene mdh 31523 30585 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454639.1 protein_id gnl|my_center|LOCUS_26150 33224 31698 gene locus_tag LOCUS_26160 33224 31698 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100068.1 protein_id gnl|my_center|LOCUS_26160 33513 33716 gene locus_tag LOCUS_26170 33513 33716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 34738 33866 gene locus_tag LOCUS_26180 gene hslO 34738 33866 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070560.1 protein_id gnl|my_center|LOCUS_26180 35155 34742 gene locus_tag LOCUS_26190 gene hslR 35155 34742 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098853.1 protein_id gnl|my_center|LOCUS_26190 35432 36352 gene locus_tag LOCUS_26200 gene gspC 35432 36352 CDS product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465330.1 protein_id gnl|my_center|LOCUS_26200 36387 38552 gene locus_tag LOCUS_26210 gene gspD 36387 38552 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070563.1 protein_id gnl|my_center|LOCUS_26210 38559 40097 gene locus_tag LOCUS_26220 gene exeE 38559 40097 CDS product GspE family T2SS ATPase variant ExeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704541.1 protein_id gnl|my_center|LOCUS_26220 40101 41327 gene locus_tag LOCUS_26230 gene gspF 40101 41327 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070565.1 protein_id gnl|my_center|LOCUS_26230 41334 41762 gene locus_tag LOCUS_26240 gene gspG 41334 41762 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070566.1 protein_id gnl|my_center|LOCUS_26240 41784 42386 gene locus_tag LOCUS_26250 gene gspH 41784 42386 CDS product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262829.1 protein_id gnl|my_center|LOCUS_26250 42379 42753 gene locus_tag LOCUS_26260 gene exeI 42379 42753 CDS product GspI family T2SS minor pseudopilin variant ExeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704544.1 protein_id gnl|my_center|LOCUS_26260 42753 43370 gene locus_tag LOCUS_26270 gene gspJ 42753 43370 CDS product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465187.1 protein_id gnl|my_center|LOCUS_26270 43384 44448 gene locus_tag LOCUS_26280 gene exeK 43384 44448 CDS product GspK family T2SS minor pseudopilin variant ExeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704546.1 protein_id gnl|my_center|LOCUS_26280 44451 45668 gene locus_tag LOCUS_26290 gene exeL 44451 45668 CDS product GspL family type II secretion system protein ExeL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704547.1 protein_id gnl|my_center|LOCUS_26290 45665 46132 gene locus_tag LOCUS_26300 45665 46132 CDS product type II secretion system protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070572.1 protein_id gnl|my_center|LOCUS_26300 46129 46890 gene locus_tag LOCUS_26310 46129 46890 CDS product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070573.1 protein_id gnl|my_center|LOCUS_26310 46991 47506 gene locus_tag LOCUS_26320 46991 47506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 48918 47560 gene locus_tag LOCUS_26330 gene prsR 48918 47560 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_26330 50964 48943 gene locus_tag LOCUS_26340 gene prsK 50964 48943 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942586.1 protein_id gnl|my_center|LOCUS_26340 51237 51962 gene locus_tag LOCUS_26350 51237 51962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 52031 52234 gene locus_tag LOCUS_26360 52031 52234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 52498 53094 gene locus_tag LOCUS_26370 52498 53094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 53094 54188 gene locus_tag LOCUS_26380 53094 54188 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390849.1 protein_id gnl|my_center|LOCUS_26380 54941 54189 gene locus_tag LOCUS_26390 54941 54189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 55136 55756 gene locus_tag LOCUS_26400 55136 55756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 55769 56641 gene locus_tag LOCUS_26410 55769 56641 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940979.1 protein_id gnl|my_center|LOCUS_26410 56886 57719 gene locus_tag LOCUS_26420 56886 57719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 57762 58619 gene locus_tag LOCUS_26430 57762 58619 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412005.1 protein_id gnl|my_center|LOCUS_26430 59136 58960 gene locus_tag LOCUS_26440 59136 58960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 59321 60358 gene locus_tag LOCUS_26450 59321 60358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 60615 63380 gene locus_tag LOCUS_26460 60615 63380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 63445 64515 gene locus_tag LOCUS_26470 63445 64515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 64852 66021 gene locus_tag LOCUS_26480 64852 66021 CDS product putative O-glycosylation ligase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390842.1 protein_id gnl|my_center|LOCUS_26480 66057 67091 gene locus_tag LOCUS_26490 66057 67091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 67145 67969 gene locus_tag LOCUS_26500 67145 67969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 67999 69219 gene locus_tag LOCUS_26510 67999 69219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 69229 70725 gene locus_tag LOCUS_26520 69229 70725 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533311.1 protein_id gnl|my_center|LOCUS_26520 70725 71762 gene locus_tag LOCUS_26530 70725 71762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 71759 72697 gene locus_tag LOCUS_26540 71759 72697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390809.1 protein_id gnl|my_center|LOCUS_26540 72971 73390 gene locus_tag LOCUS_26550 72971 73390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26550 73568 74737 gene locus_tag LOCUS_26560 73568 74737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26560 77362 74819 gene locus_tag LOCUS_26570 77362 74819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 78610 77609 gene locus_tag LOCUS_26580 78610 77609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 79782 78739 gene locus_tag LOCUS_26590 79782 78739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 80232 79795 gene locus_tag LOCUS_26600 80232 79795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 81652 80816 gene locus_tag LOCUS_26610 81652 80816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 82561 81653 gene locus_tag LOCUS_26620 gene rfbD 82561 81653 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980837.1 protein_id gnl|my_center|LOCUS_26620 83118 82570 gene locus_tag LOCUS_26630 gene rfbC 83118 82570 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261024.1 protein_id gnl|my_center|LOCUS_26630 83986 83105 gene locus_tag LOCUS_26640 gene rfbA 83986 83105 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103413.1 protein_id gnl|my_center|LOCUS_26640 85084 83999 gene locus_tag LOCUS_26650 gene rffG 85084 83999 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261022.1 protein_id gnl|my_center|LOCUS_26650 86260 85100 gene locus_tag LOCUS_26660 86260 85100 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216554.1 protein_id gnl|my_center|LOCUS_26660 87490 86273 gene locus_tag LOCUS_26670 87490 86273 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 protein_id gnl|my_center|LOCUS_26670 89366 87468 gene locus_tag LOCUS_26680 89366 87468 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_26680 90524 89418 gene locus_tag LOCUS_26690 90524 89418 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_26690 91957 90521 gene locus_tag LOCUS_26700 gene xrtA 91957 90521 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 protein_id gnl|my_center|LOCUS_26700 93175 91973 gene locus_tag LOCUS_26710 93175 91973 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_26710 94214 93180 gene locus_tag LOCUS_26720 94214 93180 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_26720 95101 94253 gene locus_tag LOCUS_26730 95101 94253 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 protein_id gnl|my_center|LOCUS_26730 96130 95105 gene locus_tag LOCUS_26740 96130 95105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 96785 97408 gene locus_tag LOCUS_26750 96785 97408 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_26750 97443 99059 gene locus_tag LOCUS_26760 97443 99059 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_26760 99059 99979 gene locus_tag LOCUS_26770 99059 99979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 99945 101492 gene locus_tag LOCUS_26780 99945 101492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 102408 101494 gene locus_tag LOCUS_26790 102408 101494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 102520 102759 gene locus_tag LOCUS_26800 gene tatA 102520 102759 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073885.1 protein_id gnl|my_center|LOCUS_26800 102762 103094 gene locus_tag LOCUS_26810 gene tatB 102762 103094 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459621.1 protein_id gnl|my_center|LOCUS_26810 103097 103867 gene locus_tag LOCUS_26820 gene tatC 103097 103867 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704121.1 protein_id gnl|my_center|LOCUS_26820 103864 104667 gene locus_tag LOCUS_26830 gene tatD 103864 104667 CDS product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099235.1 protein_id gnl|my_center|LOCUS_26830 104664 105953 gene locus_tag LOCUS_26840 104664 105953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 105975 106976 gene locus_tag LOCUS_26850 gene hemB 105975 106976 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073891.1 protein_id gnl|my_center|LOCUS_26850 107057 107431 gene locus_tag LOCUS_26860 107057 107431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 107643 109088 gene locus_tag LOCUS_26870 107643 109088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 109281 109685 gene locus_tag LOCUS_26880 109281 109685 CDS product cytochrome c5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367640.1 protein_id gnl|my_center|LOCUS_26880 >Feature sequence15 1380 484 gene locus_tag LOCUS_26890 1380 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 2385 1471 gene locus_tag LOCUS_26900 2385 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 2757 2557 gene locus_tag LOCUS_26910 2757 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 2810 3736 gene locus_tag LOCUS_26920 2810 3736 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261654.1 protein_id gnl|my_center|LOCUS_26920 3865 5208 gene locus_tag LOCUS_26930 3865 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 5274 6272 gene locus_tag LOCUS_26940 5274 6272 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106139.1 protein_id gnl|my_center|LOCUS_26940 6334 6945 gene locus_tag LOCUS_26950 6334 6945 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477286.1 protein_id gnl|my_center|LOCUS_26950 7177 8862 gene locus_tag LOCUS_26960 7177 8862 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073602.1 protein_id gnl|my_center|LOCUS_26960 8876 10069 gene locus_tag LOCUS_26970 gene malE 8876 10069 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705558.1 protein_id gnl|my_center|LOCUS_26970 10448 10131 gene locus_tag LOCUS_26980 gene metJ 10448 10131 CDS product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796267.1 protein_id gnl|my_center|LOCUS_26980 10692 11849 gene locus_tag LOCUS_26990 gene metB 10692 11849 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925915.1 protein_id gnl|my_center|LOCUS_26990 12150 13166 gene locus_tag LOCUS_27000 gene argC 12150 13166 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704560.1 protein_id gnl|my_center|LOCUS_27000 13268 14077 gene locus_tag LOCUS_27010 gene argB 13268 14077 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704561.1 protein_id gnl|my_center|LOCUS_27010 14102 15013 gene locus_tag LOCUS_27020 14102 15013 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070649.1 protein_id gnl|my_center|LOCUS_27020 15099 16325 gene locus_tag LOCUS_27030 15099 16325 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070650.1 protein_id gnl|my_center|LOCUS_27030 16325 17689 gene locus_tag LOCUS_27040 16325 17689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 17793 19127 gene locus_tag LOCUS_27050 gene argA 17793 19127 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925787.1 protein_id gnl|my_center|LOCUS_27050 19658 19149 gene locus_tag LOCUS_27060 gene cosR 19658 19149 CDS product MarR family transcriptional regulator CosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494763.1 protein_id gnl|my_center|LOCUS_27060 19882 21333 gene locus_tag LOCUS_27070 gene putP 19882 21333 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687602.1 protein_id gnl|my_center|LOCUS_27070 21337 22443 gene locus_tag LOCUS_27080 gene proB 21337 22443 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404004.1 protein_id gnl|my_center|LOCUS_27080 22707 22465 gene locus_tag LOCUS_27090 22707 22465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 23022 22831 gene locus_tag LOCUS_27100 23022 22831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 23835 23176 gene locus_tag LOCUS_27110 gene dut 23835 23176 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851377.1 protein_id gnl|my_center|LOCUS_27110 24310 23981 gene locus_tag LOCUS_27120 24310 23981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 25071 24322 gene locus_tag LOCUS_27130 25071 24322 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973571.1 protein_id gnl|my_center|LOCUS_27130 26404 25391 gene locus_tag LOCUS_27140 26404 25391 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021661.1 protein_id gnl|my_center|LOCUS_27140 27850 26507 gene locus_tag LOCUS_27150 27850 26507 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477172.1 protein_id gnl|my_center|LOCUS_27150 28003 28254 gene locus_tag LOCUS_27160 28003 28254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 28251 29084 gene locus_tag LOCUS_27170 28251 29084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142339.1 protein_id gnl|my_center|LOCUS_27170 29120 29698 gene locus_tag LOCUS_27180 gene sigX 29120 29698 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406744.1 protein_id gnl|my_center|LOCUS_27180 29783 30688 gene locus_tag LOCUS_27190 gene rimK 29783 30688 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459235.1 protein_id gnl|my_center|LOCUS_27190 30693 31727 gene locus_tag LOCUS_27200 30693 31727 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 protein_id gnl|my_center|LOCUS_27200 31737 32243 gene locus_tag LOCUS_27210 31737 32243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 34977 32305 gene locus_tag LOCUS_27220 34977 32305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 36499 35033 gene locus_tag LOCUS_27230 36499 35033 CDS product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776921.1 protein_id gnl|my_center|LOCUS_27230 36718 42507 gene locus_tag LOCUS_27240 36718 42507 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100240.1 protein_id gnl|my_center|LOCUS_27240 42595 44865 gene locus_tag LOCUS_27250 gene pbpC 42595 44865 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107146.1 protein_id gnl|my_center|LOCUS_27250 44990 46540 gene locus_tag LOCUS_27260 44990 46540 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464264.1 protein_id gnl|my_center|LOCUS_27260 47327 46626 gene locus_tag LOCUS_27270 gene ompW 47327 46626 CDS product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814590.1 protein_id gnl|my_center|LOCUS_27270 48414 47530 gene locus_tag LOCUS_27280 48414 47530 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114256.1 protein_id gnl|my_center|LOCUS_27280 49744 48740 gene locus_tag LOCUS_27290 gene gpsA 49744 48740 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704301.1 protein_id gnl|my_center|LOCUS_27290 50257 49754 gene locus_tag LOCUS_27300 gene secB 50257 49754 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070466.1 protein_id gnl|my_center|LOCUS_27300 50537 50283 gene locus_tag LOCUS_27310 gene grxC 50537 50283 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369179.1 protein_id gnl|my_center|LOCUS_27310 50967 50542 gene locus_tag LOCUS_27320 50967 50542 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208978.1 protein_id gnl|my_center|LOCUS_27320 51211 52758 gene locus_tag LOCUS_27330 gene gpmM 51211 52758 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043126577.1 protein_id gnl|my_center|LOCUS_27330 52772 53947 gene locus_tag LOCUS_27340 52772 53947 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_27340 54037 56394 gene locus_tag LOCUS_27350 54037 56394 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030087.1 protein_id gnl|my_center|LOCUS_27350 56721 58076 gene locus_tag LOCUS_27360 56721 58076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 58088 59521 gene locus_tag LOCUS_27370 58088 59521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119646.1 protein_id gnl|my_center|LOCUS_27370 59628 62759 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcagccccgtgggtacggggaacac 63132 62836 gene locus_tag LOCUS_27380 gene cas2e 63132 62836 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063176.1 protein_id gnl|my_center|LOCUS_27380 64051 63134 gene locus_tag LOCUS_27390 gene cas1e 64051 63134 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220066.1 protein_id gnl|my_center|LOCUS_27390 65550 64075 gene locus_tag LOCUS_27400 65550 64075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 66184 65537 gene locus_tag LOCUS_27410 gene cas5e 66184 65537 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942037.1 protein_id gnl|my_center|LOCUS_27410 67394 66222 gene locus_tag LOCUS_27420 gene cas7e 67394 66222 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064450.1 protein_id gnl|my_center|LOCUS_27420 67853 67425 gene locus_tag LOCUS_27430 67853 67425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 68402 67857 gene locus_tag LOCUS_27440 gene cas6e 68402 67857 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281401.1 protein_id gnl|my_center|LOCUS_27440 70844 68418 gene locus_tag LOCUS_27450 gene cas3 70844 68418 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942033.1 protein_id gnl|my_center|LOCUS_27450 71140 70901 gene locus_tag LOCUS_27460 71140 70901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 72084 71230 gene locus_tag LOCUS_27470 72084 71230 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_27470 74621 72414 gene locus_tag LOCUS_27480 74621 72414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 74862 75464 gene locus_tag LOCUS_27490 74862 75464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 75555 76031 gene locus_tag LOCUS_27500 gene trmL 75555 76031 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029302634.1 protein_id gnl|my_center|LOCUS_27500 79203 76396 gene locus_tag LOCUS_27510 79203 76396 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 protein_id gnl|my_center|LOCUS_27510 79880 79473 gene locus_tag LOCUS_27520 79880 79473 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016656.1 protein_id gnl|my_center|LOCUS_27520 80996 80025 gene locus_tag LOCUS_27530 gene ispB 80996 80025 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925908.1 protein_id gnl|my_center|LOCUS_27530 81248 81559 gene locus_tag LOCUS_27540 gene rplU 81248 81559 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271393.1 protein_id gnl|my_center|LOCUS_27540 81578 81835 gene locus_tag LOCUS_27550 gene rpmA 81578 81835 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383095.1 protein_id gnl|my_center|LOCUS_27550 82008 83177 gene locus_tag LOCUS_27560 gene cgtA 82008 83177 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704870.1 protein_id gnl|my_center|LOCUS_27560 83189 83683 gene locus_tag LOCUS_27570 gene folA 83189 83683 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973535.1 protein_id gnl|my_center|LOCUS_27570 85214 84669 gene locus_tag LOCUS_27580 85214 84669 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167484.1 protein_id gnl|my_center|LOCUS_27580 85665 85330 gene locus_tag LOCUS_27590 gene erpA 85665 85330 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420796.1 protein_id gnl|my_center|LOCUS_27590 86508 85780 gene locus_tag LOCUS_27600 86508 85780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707262.1 protein_id gnl|my_center|LOCUS_27600 86582 88288 gene locus_tag LOCUS_27610 86582 88288 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 protein_id gnl|my_center|LOCUS_27610 88288 88716 gene locus_tag LOCUS_27620 gene hemJ 88288 88716 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947265.1 protein_id gnl|my_center|LOCUS_27620 89750 88752 gene locus_tag LOCUS_27630 89750 88752 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073345.1 protein_id gnl|my_center|LOCUS_27630 90771 89866 gene locus_tag LOCUS_27640 90771 89866 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073346.1 protein_id gnl|my_center|LOCUS_27640 91369 90776 gene locus_tag LOCUS_27650 gene dolP 91369 90776 CDS product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210145.1 protein_id gnl|my_center|LOCUS_27650 91955 91371 gene locus_tag LOCUS_27660 gene diaA 91955 91371 CDS product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158034.1 protein_id gnl|my_center|LOCUS_27660 92369 91998 gene locus_tag LOCUS_27670 92369 91998 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420941.1 protein_id gnl|my_center|LOCUS_27670 94200 92341 gene locus_tag LOCUS_27680 94200 92341 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070672.1 protein_id gnl|my_center|LOCUS_27680 94409 95239 gene locus_tag LOCUS_27690 gene rsmI 94409 95239 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458162.1 protein_id gnl|my_center|LOCUS_27690 95321 95797 gene locus_tag LOCUS_27700 95321 95797 CDS product DUF3015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003650547.1 protein_id gnl|my_center|LOCUS_27700 96018 97709 gene locus_tag LOCUS_27710 96018 97709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 99154 98258 gene locus_tag LOCUS_27720 99154 98258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 100170 99208 gene locus_tag LOCUS_27730 100170 99208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 101553 100573 gene locus_tag LOCUS_27740 101553 100573 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704076.1 protein_id gnl|my_center|LOCUS_27740 103086 101659 gene locus_tag LOCUS_27750 gene glnG 103086 101659 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635441.1 protein_id gnl|my_center|LOCUS_27750 104147 103098 gene locus_tag LOCUS_27760 gene glnL 104147 103098 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704282.1 protein_id gnl|my_center|LOCUS_27760 104762 104238 gene locus_tag LOCUS_27770 104762 104238 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704283.1 protein_id gnl|my_center|LOCUS_27770 106287 104881 gene locus_tag LOCUS_27780 gene glnA 106287 104881 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110151.1 protein_id gnl|my_center|LOCUS_27780 106714 108531 gene locus_tag LOCUS_27790 gene typA 106714 108531 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211151.1 protein_id gnl|my_center|LOCUS_27790 >Feature sequence16 <1 875 gene locus_tag LOCUS_27800 <1 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236616031.1:sulfatase-like hydrolase/transferase 1409 1642 gene locus_tag LOCUS_27810 1409 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 1629 1943 gene locus_tag LOCUS_27820 1629 1943 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261951.1 protein_id gnl|my_center|LOCUS_27820 3262 2375 gene locus_tag LOCUS_27830 3262 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 3788 3252 gene locus_tag LOCUS_27840 3788 3252 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008668449.1 protein_id gnl|my_center|LOCUS_27840 4133 5554 gene locus_tag LOCUS_27850 4133 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 6131 10393 gene locus_tag LOCUS_27860 6131 10393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 11141 10920 gene locus_tag LOCUS_27870 11141 10920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 11250 11558 gene locus_tag LOCUS_27880 11250 11558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 12350 11841 gene locus_tag LOCUS_27890 12350 11841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 12532 12344 gene locus_tag LOCUS_27900 12532 12344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 13042 12551 gene locus_tag LOCUS_27910 13042 12551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 13514 13029 gene locus_tag LOCUS_27920 13514 13029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 14000 13785 gene locus_tag LOCUS_27930 14000 13785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 14575 14210 gene locus_tag LOCUS_27940 14575 14210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 14962 14585 gene locus_tag LOCUS_27950 14962 14585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 15183 14959 gene locus_tag LOCUS_27960 15183 14959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 15183 15419 gene locus_tag LOCUS_27970 15183 15419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 15752 16015 gene locus_tag LOCUS_27980 15752 16015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 16232 16675 gene locus_tag LOCUS_27990 16232 16675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 16762 17106 gene locus_tag LOCUS_28000 16762 17106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 17350 17712 gene locus_tag LOCUS_28010 17350 17712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 18826 17834 gene locus_tag LOCUS_28020 18826 17834 CDS product cupin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039037.1 protein_id gnl|my_center|LOCUS_28020 19562 18831 gene locus_tag LOCUS_28030 19562 18831 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275313.1 protein_id gnl|my_center|LOCUS_28030 21147 19588 gene locus_tag LOCUS_28040 21147 19588 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073349.1 protein_id gnl|my_center|LOCUS_28040 24287 21315 gene locus_tag LOCUS_28050 24287 21315 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918883.1 protein_id gnl|my_center|LOCUS_28050 27030 24397 gene locus_tag LOCUS_28060 27030 24397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 28652 27633 gene locus_tag LOCUS_28070 28652 27633 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705456.1 protein_id gnl|my_center|LOCUS_28070 28971 30890 gene locus_tag LOCUS_28080 28971 30890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 30890 32074 gene locus_tag LOCUS_28090 30890 32074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 32084 32674 gene locus_tag LOCUS_28100 gene sigW 32084 32674 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_28100 32667 34241 gene locus_tag LOCUS_28110 32667 34241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 34251 35882 gene locus_tag LOCUS_28120 34251 35882 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921866.1 protein_id gnl|my_center|LOCUS_28120 36856 35993 gene locus_tag LOCUS_28130 36856 35993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707494.1 protein_id gnl|my_center|LOCUS_28130 38059 39288 gene locus_tag LOCUS_28140 38059 39288 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261810.1 protein_id gnl|my_center|LOCUS_28140 39405 40907 gene locus_tag LOCUS_28150 39405 40907 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_28150 41257 44022 gene locus_tag LOCUS_28160 41257 44022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 44715 46115 gene locus_tag LOCUS_28170 44715 46115 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478391.1 protein_id gnl|my_center|LOCUS_28170 46154 46924 gene locus_tag LOCUS_28180 gene uppL 46154 46924 CDS product polysaccharide biosynthesis UDP-hexose transferase UppL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972271.1 protein_id gnl|my_center|LOCUS_28180 46934 48010 gene locus_tag LOCUS_28190 46934 48010 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524118.1 protein_id gnl|my_center|LOCUS_28190 48021 49118 gene locus_tag LOCUS_28200 48021 49118 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257382.1 protein_id gnl|my_center|LOCUS_28200 49134 50042 gene locus_tag LOCUS_28210 49134 50042 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_28210 50039 51325 gene locus_tag LOCUS_28220 50039 51325 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257384.1 protein_id gnl|my_center|LOCUS_28220 51303 52595 gene locus_tag LOCUS_28230 51303 52595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 52588 53607 gene locus_tag LOCUS_28240 52588 53607 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967713.1 protein_id gnl|my_center|LOCUS_28240 53597 54847 gene locus_tag LOCUS_28250 53597 54847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 54847 55368 gene locus_tag LOCUS_28260 gene vpsN 54847 55368 CDS product exopolysaccharide export protein VpsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978825.1 protein_id gnl|my_center|LOCUS_28260 55408 57579 gene locus_tag LOCUS_28270 gene vpsO 55408 57579 CDS product exopolysaccharide regulatory tyrosine autokinase VpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_28270 57598 58365 gene locus_tag LOCUS_28280 57598 58365 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110492.1 protein_id gnl|my_center|LOCUS_28280 59150 58755 gene locus_tag LOCUS_28290 59150 58755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261145.1 protein_id gnl|my_center|LOCUS_28290 59436 59266 gene locus_tag LOCUS_28300 59436 59266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 59360 59839 gene locus_tag LOCUS_28310 59360 59839 CDS product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720566.1 protein_id gnl|my_center|LOCUS_28310 60023 61180 gene locus_tag LOCUS_28320 60023 61180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 61237 61545 gene locus_tag LOCUS_28330 61237 61545 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 protein_id gnl|my_center|LOCUS_28330 61706 62962 gene locus_tag LOCUS_28340 61706 62962 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086617.1 protein_id gnl|my_center|LOCUS_28340 63538 62999 gene locus_tag LOCUS_28350 63538 62999 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_28350 64439 63771 gene locus_tag LOCUS_28360 64439 63771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 64557 64402 gene locus_tag LOCUS_28370 64557 64402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 64680 65120 gene locus_tag LOCUS_28380 64680 65120 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074064.1 protein_id gnl|my_center|LOCUS_28380 65355 66062 gene locus_tag LOCUS_28390 65355 66062 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037253881.1 protein_id gnl|my_center|LOCUS_28390 66386 67918 gene locus_tag LOCUS_28400 66386 67918 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696793.1 protein_id gnl|my_center|LOCUS_28400 67992 69143 gene locus_tag LOCUS_28410 67992 69143 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 protein_id gnl|my_center|LOCUS_28410 69140 70573 gene locus_tag LOCUS_28420 69140 70573 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205961.1 protein_id gnl|my_center|LOCUS_28420 70648 72093 gene locus_tag LOCUS_28430 70648 72093 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921292.1 protein_id gnl|my_center|LOCUS_28430 72263 74314 gene locus_tag LOCUS_28440 72263 74314 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267588.1 protein_id gnl|my_center|LOCUS_28440 74558 75292 gene locus_tag LOCUS_28450 74558 75292 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532967.1 protein_id gnl|my_center|LOCUS_28450 75363 75608 gene locus_tag LOCUS_28460 75363 75608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 76363 79710 gene locus_tag LOCUS_28470 76363 79710 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918458.1 protein_id gnl|my_center|LOCUS_28470 79827 81338 gene locus_tag LOCUS_28480 79827 81338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 81424 83145 gene locus_tag LOCUS_28490 81424 83145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 83487 84188 gene locus_tag LOCUS_28500 83487 84188 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085988.1 protein_id gnl|my_center|LOCUS_28500 84376 85965 gene locus_tag LOCUS_28510 84376 85965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 86055 86900 gene locus_tag LOCUS_28520 86055 86900 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036918.1 protein_id gnl|my_center|LOCUS_28520 86890 87528 gene locus_tag LOCUS_28530 86890 87528 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094785.1 protein_id gnl|my_center|LOCUS_28530 87588 89582 gene locus_tag LOCUS_28540 87588 89582 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120386.1 protein_id gnl|my_center|LOCUS_28540 89869 92598 gene locus_tag LOCUS_28550 89869 92598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 92609 94996 gene locus_tag LOCUS_28560 92609 94996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 95599 98592 gene locus_tag LOCUS_28570 95599 98592 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918458.1 protein_id gnl|my_center|LOCUS_28570 99502 98786 gene locus_tag LOCUS_28580 99502 98786 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918870.1 protein_id gnl|my_center|LOCUS_28580 99872 102757 gene locus_tag LOCUS_28590 99872 102757 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920148.1 protein_id gnl|my_center|LOCUS_28590 >Feature sequence17 457 68 gene locus_tag LOCUS_28600 457 68 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462837.1 protein_id gnl|my_center|LOCUS_28600 4780 533 gene locus_tag LOCUS_28610 4780 533 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122252.1 protein_id gnl|my_center|LOCUS_28610 5707 5084 gene locus_tag LOCUS_28620 5707 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 6210 7739 gene locus_tag LOCUS_28630 6210 7739 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447090.1 protein_id gnl|my_center|LOCUS_28630 7856 9352 gene locus_tag LOCUS_28640 gene glpK 7856 9352 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015864.1 protein_id gnl|my_center|LOCUS_28640 9811 9374 gene locus_tag LOCUS_28650 gene zur 9811 9374 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707398.1 protein_id gnl|my_center|LOCUS_28650 12405 9964 gene locus_tag LOCUS_28660 gene plsB 12405 9964 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704200.1 protein_id gnl|my_center|LOCUS_28660 12593 13216 gene locus_tag LOCUS_28670 gene lexA 12593 13216 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704201.1 protein_id gnl|my_center|LOCUS_28670 13524 14672 gene locus_tag LOCUS_28680 13524 14672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 14684 16276 gene locus_tag LOCUS_28690 gene ctaD 14684 16276 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074203.1 protein_id gnl|my_center|LOCUS_28690 16285 16857 gene locus_tag LOCUS_28700 16285 16857 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 protein_id gnl|my_center|LOCUS_28700 16844 17725 gene locus_tag LOCUS_28710 16844 17725 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074205.1 protein_id gnl|my_center|LOCUS_28710 17970 18149 gene locus_tag LOCUS_28720 17970 18149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 18146 18892 gene locus_tag LOCUS_28730 18146 18892 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106290.1 protein_id gnl|my_center|LOCUS_28730 18868 19422 gene locus_tag LOCUS_28740 18868 19422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074208.1 protein_id gnl|my_center|LOCUS_28740 19422 20480 gene locus_tag LOCUS_28750 19422 20480 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462008.1 protein_id gnl|my_center|LOCUS_28750 20477 21370 gene locus_tag LOCUS_28760 gene cyoE 20477 21370 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074210.1 protein_id gnl|my_center|LOCUS_28760 21367 21972 gene locus_tag LOCUS_28770 21367 21972 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819116.1 protein_id gnl|my_center|LOCUS_28770 22139 22417 gene locus_tag LOCUS_28780 22139 22417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 22438 22800 gene locus_tag LOCUS_28790 22438 22800 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_28790 22804 24939 gene locus_tag LOCUS_28800 22804 24939 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162435.1 protein_id gnl|my_center|LOCUS_28800 24939 25424 gene locus_tag LOCUS_28810 24939 25424 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037040.1 protein_id gnl|my_center|LOCUS_28810 25673 26116 gene locus_tag LOCUS_28820 25673 26116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 26278 29421 gene locus_tag LOCUS_28830 26278 29421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 29548 33540 gene locus_tag LOCUS_28840 29548 33540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 33827 34210 gene locus_tag LOCUS_28850 33827 34210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 36604 34733 gene locus_tag LOCUS_28860 36604 34733 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770458.1 protein_id gnl|my_center|LOCUS_28860 37084 38802 gene locus_tag LOCUS_28870 37084 38802 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704827.1 protein_id gnl|my_center|LOCUS_28870 38802 39299 gene locus_tag LOCUS_28880 gene ilvN 38802 39299 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704829.1 protein_id gnl|my_center|LOCUS_28880 39405 39698 gene locus_tag LOCUS_28890 39405 39698 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527935.1 protein_id gnl|my_center|LOCUS_28890 40855 39701 gene locus_tag LOCUS_28900 gene queG 40855 39701 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704164.1 protein_id gnl|my_center|LOCUS_28900 40995 42497 gene locus_tag LOCUS_28910 40995 42497 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130880.1 protein_id gnl|my_center|LOCUS_28910 42567 43022 gene locus_tag LOCUS_28920 gene tsaE 42567 43022 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704860.1 protein_id gnl|my_center|LOCUS_28920 43019 44350 gene locus_tag LOCUS_28930 43019 44350 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070931.1 protein_id gnl|my_center|LOCUS_28930 44350 46272 gene locus_tag LOCUS_28940 gene mutL 44350 46272 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693855.1 protein_id gnl|my_center|LOCUS_28940 46272 47195 gene locus_tag LOCUS_28950 gene miaA 46272 47195 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704863.1 protein_id gnl|my_center|LOCUS_28950 47271 47525 gene locus_tag LOCUS_28960 gene hfq 47271 47525 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209151.1 protein_id gnl|my_center|LOCUS_28960 47552 48838 gene locus_tag LOCUS_28970 gene hflX 47552 48838 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460377.1 protein_id gnl|my_center|LOCUS_28970 48854 50026 gene locus_tag LOCUS_28980 gene hflK 48854 50026 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070936.1 protein_id gnl|my_center|LOCUS_28980 50027 50905 gene locus_tag LOCUS_28990 gene hflC 50027 50905 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704867.1 protein_id gnl|my_center|LOCUS_28990 51109 51339 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51483 51659 gene locus_tag LOCUS_29000 51483 51659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 51799 53115 gene locus_tag LOCUS_29010 51799 53115 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460670.1 protein_id gnl|my_center|LOCUS_29010 53188 53502 gene locus_tag LOCUS_29020 gene ppiC 53188 53502 CDS product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368892.1 protein_id gnl|my_center|LOCUS_29020 54411 53536 gene locus_tag LOCUS_29030 54411 53536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 55051 54413 gene locus_tag LOCUS_29040 55051 54413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 55266 55652 gene locus_tag LOCUS_29050 gene rpsF 55266 55652 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073674.1 protein_id gnl|my_center|LOCUS_29050 55655 55963 gene locus_tag LOCUS_29060 gene priB 55655 55963 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210154.1 protein_id gnl|my_center|LOCUS_29060 55974 56201 gene locus_tag LOCUS_29070 gene rpsR 55974 56201 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083042.1 protein_id gnl|my_center|LOCUS_29070 56234 56686 gene locus_tag LOCUS_29080 gene rplI 56234 56686 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210156.1 protein_id gnl|my_center|LOCUS_29080 56987 57373 gene locus_tag LOCUS_29090 56987 57373 CDS product MerC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037787.1 protein_id gnl|my_center|LOCUS_29090 57454 59598 gene locus_tag LOCUS_29100 57454 59598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 59730 60245 gene locus_tag LOCUS_29110 gene rppH 59730 60245 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481384.1 protein_id gnl|my_center|LOCUS_29110 60242 62506 gene locus_tag LOCUS_29120 gene ptsP 60242 62506 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704635.1 protein_id gnl|my_center|LOCUS_29120 62528 63331 gene locus_tag LOCUS_29130 62528 63331 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019422.1 protein_id gnl|my_center|LOCUS_29130 63348 64163 gene locus_tag LOCUS_29140 gene lgt 63348 64163 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481391.1 protein_id gnl|my_center|LOCUS_29140 64160 64993 gene locus_tag LOCUS_29150 64160 64993 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211826335.1 protein_id gnl|my_center|LOCUS_29150 65258 67459 gene locus_tag LOCUS_29160 65258 67459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 67470 69929 gene locus_tag LOCUS_29170 67470 69929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 70188 69949 gene locus_tag LOCUS_29180 70188 69949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 70585 70169 gene locus_tag LOCUS_29190 gene pspC 70585 70169 CDS product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462375.1 protein_id gnl|my_center|LOCUS_29190 70821 70585 gene locus_tag LOCUS_29200 gene pspB 70821 70585 CDS product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071929.1 protein_id gnl|my_center|LOCUS_29200 71524 70856 gene locus_tag LOCUS_29210 gene pspA 71524 70856 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071928.1 protein_id gnl|my_center|LOCUS_29210 71704 72750 gene locus_tag LOCUS_29220 gene pspF 71704 72750 CDS product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071927.1 protein_id gnl|my_center|LOCUS_29220 72955 72779 gene locus_tag LOCUS_29230 72955 72779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 73140 73955 gene locus_tag LOCUS_29240 73140 73955 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070889.1 protein_id gnl|my_center|LOCUS_29240 74438 74076 gene locus_tag LOCUS_29250 74438 74076 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072730.1 protein_id gnl|my_center|LOCUS_29250 74792 74598 gene locus_tag LOCUS_29260 74792 74598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 75444 74821 gene locus_tag LOCUS_29270 gene ureG 75444 74821 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095530.1 protein_id gnl|my_center|LOCUS_29270 76278 75559 gene locus_tag LOCUS_29280 76278 75559 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418029.1 protein_id gnl|my_center|LOCUS_29280 76802 76281 gene locus_tag LOCUS_29290 gene ureE 76802 76281 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261401.1 protein_id gnl|my_center|LOCUS_29290 78546 76831 gene locus_tag LOCUS_29300 gene ureC 78546 76831 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763096.1 protein_id gnl|my_center|LOCUS_29300 78902 78546 gene locus_tag LOCUS_29310 78902 78546 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206082.1 protein_id gnl|my_center|LOCUS_29310 79243 78941 gene locus_tag LOCUS_29320 gene ureA 79243 78941 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317023.1 protein_id gnl|my_center|LOCUS_29320 80196 79282 gene locus_tag LOCUS_29330 80196 79282 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261404.1 protein_id gnl|my_center|LOCUS_29330 80924 80229 gene locus_tag LOCUS_29340 gene urtE 80924 80229 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223523.1 protein_id gnl|my_center|LOCUS_29340 81770 80940 gene locus_tag LOCUS_29350 gene urtD 81770 80940 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376420.1 protein_id gnl|my_center|LOCUS_29350 82954 81767 gene locus_tag LOCUS_29360 gene urtC 82954 81767 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976303.1 protein_id gnl|my_center|LOCUS_29360 84573 82954 gene locus_tag LOCUS_29370 gene urtB 84573 82954 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976304.1 protein_id gnl|my_center|LOCUS_29370 86106 84823 gene locus_tag LOCUS_29380 gene urtA 86106 84823 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244008.1 protein_id gnl|my_center|LOCUS_29380 87110 86136 gene locus_tag LOCUS_29390 87110 86136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 87549 90857 gene locus_tag LOCUS_29400 87549 90857 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083787.1 protein_id gnl|my_center|LOCUS_29400 90847 91737 gene locus_tag LOCUS_29410 90847 91737 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161532938.1 protein_id gnl|my_center|LOCUS_29410 92091 91744 gene locus_tag LOCUS_29420 92091 91744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 92934 92353 gene locus_tag LOCUS_29430 92934 92353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 >Feature sequence18 3496 5172 gene locus_tag LOCUS_29440 gene asnB 3496 5172 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097572.1 protein_id gnl|my_center|LOCUS_29440 5668 5288 gene locus_tag LOCUS_29450 gene acpS 5668 5288 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635063.1 protein_id gnl|my_center|LOCUS_29450 6402 5668 gene locus_tag LOCUS_29460 gene pdxJ 6402 5668 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704752.1 protein_id gnl|my_center|LOCUS_29460 7109 6399 gene locus_tag LOCUS_29470 gene recO 7109 6399 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209680.1 protein_id gnl|my_center|LOCUS_29470 7995 7090 gene locus_tag LOCUS_29480 gene era 7995 7090 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704750.1 protein_id gnl|my_center|LOCUS_29480 8681 8004 gene locus_tag LOCUS_29490 gene rnc 8681 8004 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882136.1 protein_id gnl|my_center|LOCUS_29490 9625 8681 gene locus_tag LOCUS_29500 gene lepB 9625 8681 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071556.1 protein_id gnl|my_center|LOCUS_29500 11438 9639 gene locus_tag LOCUS_29510 gene lepA 11438 9639 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649880.1 protein_id gnl|my_center|LOCUS_29510 12070 11606 gene locus_tag LOCUS_29520 12070 11606 CDS product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988005.1 protein_id gnl|my_center|LOCUS_29520 13028 12174 gene locus_tag LOCUS_29530 13028 12174 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349517.1 protein_id gnl|my_center|LOCUS_29530 13749 13135 gene locus_tag LOCUS_29540 13749 13135 CDS product RseA family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704744.1 protein_id gnl|my_center|LOCUS_29540 14394 13813 gene locus_tag LOCUS_29550 gene rpoE 14394 13813 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071551.1 protein_id gnl|my_center|LOCUS_29550 14606 16225 gene locus_tag LOCUS_29560 gene nadB 14606 16225 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704743.1 protein_id gnl|my_center|LOCUS_29560 17483 16323 gene locus_tag LOCUS_29570 17483 16323 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_29570 18694 17699 gene locus_tag LOCUS_29580 18694 17699 CDS product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207217.1 protein_id gnl|my_center|LOCUS_29580 21561 18898 gene locus_tag LOCUS_29590 21561 18898 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062085955.1 protein_id gnl|my_center|LOCUS_29590 22144 22641 gene locus_tag LOCUS_29600 22144 22641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 23742 22630 gene locus_tag LOCUS_29610 gene hisC 23742 22630 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_29610 24327 23755 gene locus_tag LOCUS_29620 24327 23755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 25079 25303 gene locus_tag LOCUS_29630 25079 25303 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229888.1 protein_id gnl|my_center|LOCUS_29630 25317 26801 gene locus_tag LOCUS_29640 25317 26801 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403903.1 protein_id gnl|my_center|LOCUS_29640 26837 28153 gene locus_tag LOCUS_29650 26837 28153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 28166 29743 gene locus_tag LOCUS_29660 28166 29743 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312152.1 protein_id gnl|my_center|LOCUS_29660 30230 29931 gene locus_tag LOCUS_29670 30230 29931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 30949 31752 gene locus_tag LOCUS_29680 30949 31752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 32320 31850 gene locus_tag LOCUS_29690 32320 31850 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731152.1 protein_id gnl|my_center|LOCUS_29690 32460 33020 gene locus_tag LOCUS_29700 32460 33020 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071600.1 protein_id gnl|my_center|LOCUS_29700 33282 34586 gene locus_tag LOCUS_29710 33282 34586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 36620 34773 gene locus_tag LOCUS_29720 36620 34773 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967198.1 protein_id gnl|my_center|LOCUS_29720 37007 37447 gene locus_tag LOCUS_29730 gene cynS 37007 37447 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082956.1 protein_id gnl|my_center|LOCUS_29730 37675 38487 gene locus_tag LOCUS_29740 37675 38487 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965820.1 protein_id gnl|my_center|LOCUS_29740 38579 40321 gene locus_tag LOCUS_29750 38579 40321 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 protein_id gnl|my_center|LOCUS_29750 40610 40368 gene locus_tag LOCUS_29760 40610 40368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 41718 40717 gene locus_tag LOCUS_29770 41718 40717 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478421.1 protein_id gnl|my_center|LOCUS_29770 43409 41973 gene locus_tag LOCUS_29780 43409 41973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 44405 43533 gene locus_tag LOCUS_29790 44405 43533 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463767.1 protein_id gnl|my_center|LOCUS_29790 45465 44470 gene locus_tag LOCUS_29800 45465 44470 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480283.1 protein_id gnl|my_center|LOCUS_29800 46925 45540 gene locus_tag LOCUS_29810 46925 45540 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_29810 47288 48310 gene locus_tag LOCUS_29820 gene galE 47288 48310 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705040.1 protein_id gnl|my_center|LOCUS_29820 48478 49347 gene locus_tag LOCUS_29830 48478 49347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 50198 49344 gene locus_tag LOCUS_29840 gene nadC 50198 49344 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707567.1 protein_id gnl|my_center|LOCUS_29840 50615 50525 gene locus_tag LOCUS_t00430 50615 50525 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 51773 50709 gene locus_tag LOCUS_29850 gene nadA 51773 50709 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072333.1 protein_id gnl|my_center|LOCUS_29850 53324 51903 gene locus_tag LOCUS_29860 53324 51903 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008571269.1 protein_id gnl|my_center|LOCUS_29860 53567 54070 gene locus_tag LOCUS_29870 53567 54070 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033837886.1 protein_id gnl|my_center|LOCUS_29870 54075 55142 gene locus_tag LOCUS_29880 54075 55142 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480521.1 protein_id gnl|my_center|LOCUS_29880 55869 56321 gene locus_tag LOCUS_29890 55869 56321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 57114 56335 gene locus_tag LOCUS_29900 57114 56335 CDS product DUF3530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707004.1 protein_id gnl|my_center|LOCUS_29900 57902 57234 gene locus_tag LOCUS_29910 gene yrfG 57902 57234 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_29910 57954 58532 gene locus_tag LOCUS_29920 gene nudE 57954 58532 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017765235.1 protein_id gnl|my_center|LOCUS_29920 58522 59361 gene locus_tag LOCUS_29930 gene cysQ 58522 59361 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458987.1 protein_id gnl|my_center|LOCUS_29930 59313 59963 gene locus_tag LOCUS_29940 59313 59963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 60856 60011 gene locus_tag LOCUS_29950 60856 60011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 61870 60866 gene locus_tag LOCUS_29960 61870 60866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 63730 62081 gene locus_tag LOCUS_29970 63730 62081 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986940.1 protein_id gnl|my_center|LOCUS_29970 64786 63815 gene locus_tag LOCUS_29980 64786 63815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 65385 64783 gene locus_tag LOCUS_29990 65385 64783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 69526 65396 gene locus_tag LOCUS_30000 69526 65396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 80751 69529 gene locus_tag LOCUS_30010 80751 69529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 84736 80762 gene locus_tag LOCUS_30020 84736 80762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 85729 84749 gene locus_tag LOCUS_30030 85729 84749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 <92088 85726 gene locus_tag LOCUS_30040 <92088 85726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477759.1:tandem-95 repeat protein >Feature sequence19 2034 592 gene locus_tag LOCUS_30050 2034 592 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921292.1 protein_id gnl|my_center|LOCUS_30050 2513 2349 gene locus_tag LOCUS_30060 2513 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 2806 3672 gene locus_tag LOCUS_30070 2806 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 4763 3756 gene locus_tag LOCUS_30080 4763 3756 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918268.1 protein_id gnl|my_center|LOCUS_30080 7319 4833 gene locus_tag LOCUS_30090 7319 4833 CDS product exo 1,3/1,4-beta-D-glucan glucohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919915.1 protein_id gnl|my_center|LOCUS_30090 7428 7571 gene locus_tag LOCUS_30100 7428 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 8882 7581 gene locus_tag LOCUS_30110 8882 7581 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704413.1 protein_id gnl|my_center|LOCUS_30110 10156 8894 gene locus_tag LOCUS_30120 10156 8894 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217858.1 protein_id gnl|my_center|LOCUS_30120 10264 10473 gene locus_tag LOCUS_30130 10264 10473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 10457 11356 gene locus_tag LOCUS_30140 10457 11356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 11375 12151 gene locus_tag LOCUS_30150 11375 12151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 12290 13807 gene locus_tag LOCUS_30160 12290 13807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 15130 13961 gene locus_tag LOCUS_30170 gene nspC 15130 13961 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943174.1 protein_id gnl|my_center|LOCUS_30170 16439 15231 gene locus_tag LOCUS_30180 16439 15231 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943175.1 protein_id gnl|my_center|LOCUS_30180 17111 16857 gene locus_tag LOCUS_30190 17111 16857 CDS product DUF2164 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265623.1 protein_id gnl|my_center|LOCUS_30190 18031 17126 gene locus_tag LOCUS_30200 gene zipA 18031 17126 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139343690.1 protein_id gnl|my_center|LOCUS_30200 21584 18108 gene locus_tag LOCUS_30210 gene smc 21584 18108 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267260.1 protein_id gnl|my_center|LOCUS_30210 21711 22427 gene locus_tag LOCUS_30220 gene cysZ 21711 22427 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705142.1 protein_id gnl|my_center|LOCUS_30220 22612 22746 gene locus_tag LOCUS_30230 22612 22746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 23300 22809 gene locus_tag LOCUS_30240 gene tadA 23300 22809 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073170.1 protein_id gnl|my_center|LOCUS_30240 25029 23326 gene locus_tag LOCUS_30250 gene recJ 25029 23326 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261231.1 protein_id gnl|my_center|LOCUS_30250 25741 25031 gene locus_tag LOCUS_30260 gene dsbC 25741 25031 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071231.1 protein_id gnl|my_center|LOCUS_30260 26003 27046 gene locus_tag LOCUS_30270 26003 27046 CDS product cupin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039037.1 protein_id gnl|my_center|LOCUS_30270 27409 28131 gene locus_tag LOCUS_30280 27409 28131 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532967.1 protein_id gnl|my_center|LOCUS_30280 29504 28128 gene locus_tag LOCUS_30290 29504 28128 CDS product glycoside-pentoside-hexuronide family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703825.1 protein_id gnl|my_center|LOCUS_30290 31915 29522 gene locus_tag LOCUS_30300 31915 29522 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107211.1 protein_id gnl|my_center|LOCUS_30300 32883 31924 gene locus_tag LOCUS_30310 32883 31924 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964837.1 protein_id gnl|my_center|LOCUS_30310 34282 32921 gene locus_tag LOCUS_30320 34282 32921 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095593.1 protein_id gnl|my_center|LOCUS_30320 34521 35486 gene locus_tag LOCUS_30330 34521 35486 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107223.1 protein_id gnl|my_center|LOCUS_30330 37077 35596 gene locus_tag LOCUS_30340 37077 35596 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388051.1 protein_id gnl|my_center|LOCUS_30340 40268 37476 gene locus_tag LOCUS_30350 40268 37476 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275368.1 protein_id gnl|my_center|LOCUS_30350 43904 40374 gene locus_tag LOCUS_30360 43904 40374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 44702 44535 gene locus_tag LOCUS_30370 44702 44535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 44837 45604 gene locus_tag LOCUS_30380 44837 45604 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114256.1 protein_id gnl|my_center|LOCUS_30380 45665 46717 gene locus_tag LOCUS_30390 45665 46717 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_30390 46781 48706 gene locus_tag LOCUS_30400 46781 48706 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767043.1 protein_id gnl|my_center|LOCUS_30400 49575 48799 gene locus_tag LOCUS_30410 49575 48799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223047.1 protein_id gnl|my_center|LOCUS_30410 50577 49804 gene locus_tag LOCUS_30420 50577 49804 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975556.1 protein_id gnl|my_center|LOCUS_30420 50783 51550 gene locus_tag LOCUS_30430 50783 51550 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_30430 52959 51877 gene locus_tag LOCUS_30440 52959 51877 CDS product peptidylglycine monooxygenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663621.1 protein_id gnl|my_center|LOCUS_30440 54755 53214 gene locus_tag LOCUS_30450 54755 53214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 55088 55726 gene locus_tag LOCUS_30460 55088 55726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400369.1 protein_id gnl|my_center|LOCUS_30460 55739 56284 gene locus_tag LOCUS_30470 55739 56284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 57063 56350 gene locus_tag LOCUS_30480 57063 56350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 58638 57088 gene locus_tag LOCUS_30490 58638 57088 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073349.1 protein_id gnl|my_center|LOCUS_30490 60839 58728 gene locus_tag LOCUS_30500 60839 58728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 64614 60898 gene locus_tag LOCUS_30510 64614 60898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 65378 65986 gene locus_tag LOCUS_30520 65378 65986 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_30520 66893 66006 gene locus_tag LOCUS_30530 66893 66006 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705248.1 protein_id gnl|my_center|LOCUS_30530 67045 67776 gene locus_tag LOCUS_30540 gene fdhD 67045 67776 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042029999.1 protein_id gnl|my_center|LOCUS_30540 67791 70109 gene locus_tag LOCUS_30550 67791 70109 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705250.1 protein_id gnl|my_center|LOCUS_30550 70115 70777 gene locus_tag LOCUS_30560 70115 70777 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546772.1 protein_id gnl|my_center|LOCUS_30560 71172 70861 gene locus_tag LOCUS_30570 71172 70861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 71358 71176 gene locus_tag LOCUS_30580 71358 71176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 74000 71358 gene locus_tag LOCUS_30590 74000 71358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 74275 73997 gene locus_tag LOCUS_30600 74275 73997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 75025 74333 gene locus_tag LOCUS_30610 75025 74333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 75614 75027 gene locus_tag LOCUS_30620 75614 75027 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262855.1 protein_id gnl|my_center|LOCUS_30620 75867 76634 gene locus_tag LOCUS_30630 75867 76634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 77002 77580 gene locus_tag LOCUS_30640 77002 77580 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105333325.1 protein_id gnl|my_center|LOCUS_30640 77577 79277 gene locus_tag LOCUS_30650 77577 79277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 80251 79421 gene locus_tag LOCUS_30660 80251 79421 CDS product heparin lyase I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091287825.1 protein_id gnl|my_center|LOCUS_30660 80876 83257 gene locus_tag LOCUS_30670 80876 83257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 >Feature sequence20 1729 86 gene locus_tag LOCUS_30680 gene pgi 1729 86 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073376.1 protein_id gnl|my_center|LOCUS_30680 2760 1804 gene locus_tag LOCUS_30690 gene tal 2760 1804 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130189.1 protein_id gnl|my_center|LOCUS_30690 3131 4741 gene locus_tag LOCUS_30700 3131 4741 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268468.1 protein_id gnl|my_center|LOCUS_30700 5172 4753 gene locus_tag LOCUS_30710 5172 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 5908 5201 gene locus_tag LOCUS_30720 gene folM 5908 5201 CDS product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520812.1 protein_id gnl|my_center|LOCUS_30720 7823 5913 gene locus_tag LOCUS_30730 gene parE 7823 5913 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262649.1 protein_id gnl|my_center|LOCUS_30730 8533 7886 gene locus_tag LOCUS_30740 gene yqiA 8533 7886 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105733.1 protein_id gnl|my_center|LOCUS_30740 9276 8533 gene locus_tag LOCUS_30750 gene cpdA 9276 8533 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693770.1 protein_id gnl|my_center|LOCUS_30750 9722 9273 gene locus_tag LOCUS_30760 9722 9273 CDS product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080926.1 protein_id gnl|my_center|LOCUS_30760 10365 9730 gene locus_tag LOCUS_30770 gene nudF 10365 9730 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098743.1 protein_id gnl|my_center|LOCUS_30770 12292 10436 gene locus_tag LOCUS_30780 12292 10436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 13214 12306 gene locus_tag LOCUS_30790 gene rrp1 13214 12306 CDS product cyclic-di-GMP-producing response regulator Rrp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010256898.1 protein_id gnl|my_center|LOCUS_30790 16662 13225 gene locus_tag LOCUS_30800 16662 13225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 18388 16709 gene locus_tag LOCUS_30810 18388 16709 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902160.1 protein_id gnl|my_center|LOCUS_30810 19387 18407 gene locus_tag LOCUS_30820 19387 18407 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258602.1 protein_id gnl|my_center|LOCUS_30820 19741 22173 gene locus_tag LOCUS_30830 19741 22173 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 protein_id gnl|my_center|LOCUS_30830 23666 22263 gene locus_tag LOCUS_30840 gene phrB 23666 22263 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478177.1 protein_id gnl|my_center|LOCUS_30840 24616 23666 gene locus_tag LOCUS_30850 24616 23666 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263579.1 protein_id gnl|my_center|LOCUS_30850 25422 24874 gene locus_tag LOCUS_30860 25422 24874 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479533.1 protein_id gnl|my_center|LOCUS_30860 26180 25443 gene locus_tag LOCUS_30870 26180 25443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 26353 27399 gene locus_tag LOCUS_30880 26353 27399 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968871.1 protein_id gnl|my_center|LOCUS_30880 27406 30057 gene locus_tag LOCUS_30890 27406 30057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 30050 30457 gene locus_tag LOCUS_30900 30050 30457 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963444.1 protein_id gnl|my_center|LOCUS_30900 30900 30454 gene locus_tag LOCUS_30910 gene yfbV 30900 30454 CDS product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704832.1 protein_id gnl|my_center|LOCUS_30910 31092 31988 gene locus_tag LOCUS_30920 gene yvcK 31092 31988 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705472.1 protein_id gnl|my_center|LOCUS_30920 32589 31990 gene locus_tag LOCUS_30930 gene dcd 32589 31990 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706092.1 protein_id gnl|my_center|LOCUS_30930 33684 32608 gene locus_tag LOCUS_30940 gene apbC 33684 32608 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816717.1 protein_id gnl|my_center|LOCUS_30940 33782 35836 gene locus_tag LOCUS_30950 gene metG 33782 35836 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262296.1 protein_id gnl|my_center|LOCUS_30950 35971 37146 gene locus_tag LOCUS_30960 35971 37146 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927646.1 protein_id gnl|my_center|LOCUS_30960 37278 38069 gene locus_tag LOCUS_30970 37278 38069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 38148 39233 gene locus_tag LOCUS_30980 38148 39233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 39243 39839 gene locus_tag LOCUS_30990 39243 39839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705874.1 protein_id gnl|my_center|LOCUS_30990 39839 40897 gene locus_tag LOCUS_31000 39839 40897 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_31000 40894 41787 gene locus_tag LOCUS_31010 40894 41787 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_31010 41789 42631 gene locus_tag LOCUS_31020 41789 42631 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215243.1 protein_id gnl|my_center|LOCUS_31020 42695 43714 gene locus_tag LOCUS_31030 gene msrP 42695 43714 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210073.1 protein_id gnl|my_center|LOCUS_31030 44415 44831 gene locus_tag LOCUS_31040 44415 44831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 44895 45722 gene locus_tag LOCUS_31050 44895 45722 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261481.1 protein_id gnl|my_center|LOCUS_31050 47370 45709 gene locus_tag LOCUS_31060 47370 45709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 47534 47965 gene locus_tag LOCUS_31070 47534 47965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 51017 48021 gene locus_tag LOCUS_31080 51017 48021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 51256 52926 gene locus_tag LOCUS_31090 gene ettA 51256 52926 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852865.1 protein_id gnl|my_center|LOCUS_31090 53107 53499 gene locus_tag LOCUS_31100 53107 53499 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707404.1 protein_id gnl|my_center|LOCUS_31100 54600 53512 gene locus_tag LOCUS_31110 gene modC 54600 53512 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931293.1 protein_id gnl|my_center|LOCUS_31110 55283 54597 gene locus_tag LOCUS_31120 gene modB 55283 54597 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_31120 55942 55283 gene locus_tag LOCUS_31130 gene modA 55942 55283 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267943.1 protein_id gnl|my_center|LOCUS_31130 57768 56404 gene locus_tag LOCUS_31140 57768 56404 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104160.1 protein_id gnl|my_center|LOCUS_31140 58295 57813 gene locus_tag LOCUS_31150 58295 57813 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462468.1 protein_id gnl|my_center|LOCUS_31150 59327 58302 gene locus_tag LOCUS_31160 gene nagZ 59327 58302 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816133.1 protein_id gnl|my_center|LOCUS_31160 59508 60683 gene locus_tag LOCUS_31170 59508 60683 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122598.1 protein_id gnl|my_center|LOCUS_31170 61792 60680 gene locus_tag LOCUS_31180 gene rmuC 61792 60680 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946690.1 protein_id gnl|my_center|LOCUS_31180 62046 62246 gene locus_tag LOCUS_31190 62046 62246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 >Feature sequence21 917 1804 gene locus_tag LOCUS_31200 917 1804 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114256.1 protein_id gnl|my_center|LOCUS_31200 1975 3369 gene locus_tag LOCUS_31210 1975 3369 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095593.1 protein_id gnl|my_center|LOCUS_31210 3490 4566 gene locus_tag LOCUS_31220 3490 4566 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 protein_id gnl|my_center|LOCUS_31220 5719 4637 gene locus_tag LOCUS_31230 5719 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 6514 5783 gene locus_tag LOCUS_31240 6514 5783 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_31240 8075 6555 gene locus_tag LOCUS_31250 8075 6555 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919623.1 protein_id gnl|my_center|LOCUS_31250 9544 8084 gene locus_tag LOCUS_31260 9544 8084 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919623.1 protein_id gnl|my_center|LOCUS_31260 11091 9541 gene locus_tag LOCUS_31270 11091 9541 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920646.1 protein_id gnl|my_center|LOCUS_31270 14349 11149 gene locus_tag LOCUS_31280 14349 11149 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036923.1 protein_id gnl|my_center|LOCUS_31280 15578 14835 gene locus_tag LOCUS_31290 15578 14835 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038982.1 protein_id gnl|my_center|LOCUS_31290 17204 15588 gene locus_tag LOCUS_31300 17204 15588 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966722.1 protein_id gnl|my_center|LOCUS_31300 19250 17319 gene locus_tag LOCUS_31310 19250 17319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 20439 19240 gene locus_tag LOCUS_31320 20439 19240 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936107.1 protein_id gnl|my_center|LOCUS_31320 22072 20627 gene locus_tag LOCUS_31330 22072 20627 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477897.1 protein_id gnl|my_center|LOCUS_31330 23160 22258 gene locus_tag LOCUS_31340 23160 22258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 23455 25767 gene locus_tag LOCUS_31350 23455 25767 CDS product DUF5916 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925729.1 protein_id gnl|my_center|LOCUS_31350 26125 27651 gene locus_tag LOCUS_31360 26125 27651 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919362.1 protein_id gnl|my_center|LOCUS_31360 29412 28132 gene locus_tag LOCUS_31370 gene siaM 29412 28132 CDS product sialic acid TRAP transporter large permease SiaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233105.1 protein_id gnl|my_center|LOCUS_31370 29942 29415 gene locus_tag LOCUS_31380 29942 29415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 30862 29945 gene locus_tag LOCUS_31390 30862 29945 CDS product sialic acid TRAP transporter substrate-binding protein SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965680.1 protein_id gnl|my_center|LOCUS_31390 31108 32508 gene locus_tag LOCUS_31400 31108 32508 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103627.1 protein_id gnl|my_center|LOCUS_31400 32859 33383 gene locus_tag LOCUS_31410 32859 33383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 33944 33510 gene locus_tag LOCUS_31420 33944 33510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31420 34205 33945 gene locus_tag LOCUS_31430 34205 33945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31430 34923 34417 gene locus_tag LOCUS_31440 34923 34417 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008989681.1 protein_id gnl|my_center|LOCUS_31440 35365 37326 gene locus_tag LOCUS_31450 35365 37326 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478023.1 protein_id gnl|my_center|LOCUS_31450 37828 37463 gene locus_tag LOCUS_31460 37828 37463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 38415 37948 gene locus_tag LOCUS_31470 38415 37948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 39074 40882 gene locus_tag LOCUS_31480 39074 40882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 40887 44099 gene locus_tag LOCUS_31490 40887 44099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 44126 45352 gene locus_tag LOCUS_31500 44126 45352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 45947 45588 gene locus_tag LOCUS_31510 45947 45588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 46604 45960 gene locus_tag LOCUS_31520 46604 45960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 47125 46655 gene locus_tag LOCUS_31530 47125 46655 CDS product type II toxin-antitoxin system YhaV family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037275395.1 protein_id gnl|my_center|LOCUS_31530 47457 47128 gene locus_tag LOCUS_31540 47457 47128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 48676 47546 gene locus_tag LOCUS_31550 48676 47546 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259711.1 protein_id gnl|my_center|LOCUS_31550 50177 49218 gene locus_tag LOCUS_31560 50177 49218 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383683.1 protein_id gnl|my_center|LOCUS_31560 50712 50221 gene locus_tag LOCUS_31570 50712 50221 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073195.1 protein_id gnl|my_center|LOCUS_31570 50859 51767 gene locus_tag LOCUS_31580 50859 51767 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 protein_id gnl|my_center|LOCUS_31580 53214 51820 gene locus_tag LOCUS_31590 53214 51820 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_31590 54481 53471 gene locus_tag LOCUS_31600 54481 53471 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456547.1 protein_id gnl|my_center|LOCUS_31600 54970 56538 gene locus_tag LOCUS_31610 54970 56538 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108775.1 protein_id gnl|my_center|LOCUS_31610 57933 56974 gene locus_tag LOCUS_31620 57933 56974 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_31620 >Feature sequence22 31 1593 gene locus_tag LOCUS_31630 31 1593 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262057.1 protein_id gnl|my_center|LOCUS_31630 1617 2939 gene locus_tag LOCUS_31640 1617 2939 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477129.1 protein_id gnl|my_center|LOCUS_31640 3601 6750 gene locus_tag LOCUS_31650 3601 6750 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918458.1 protein_id gnl|my_center|LOCUS_31650 6970 7281 gene locus_tag LOCUS_31660 6970 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 7653 7231 gene locus_tag LOCUS_31670 7653 7231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 8248 7805 gene locus_tag LOCUS_31680 8248 7805 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072248.1 protein_id gnl|my_center|LOCUS_31680 8780 8286 gene locus_tag LOCUS_31690 8780 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 9109 9990 gene locus_tag LOCUS_31700 9109 9990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 10824 10240 gene locus_tag LOCUS_31710 10824 10240 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082412.1 protein_id gnl|my_center|LOCUS_31710 11301 10828 gene locus_tag LOCUS_31720 11301 10828 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967652.1 protein_id gnl|my_center|LOCUS_31720 13807 11312 gene locus_tag LOCUS_31730 gene napA 13807 11312 CDS product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784576.1 protein_id gnl|my_center|LOCUS_31730 14137 13868 gene locus_tag LOCUS_31740 14137 13868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 14666 14130 gene locus_tag LOCUS_31750 gene napF 14666 14130 CDS product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477204.1 protein_id gnl|my_center|LOCUS_31750 14828 14670 gene locus_tag LOCUS_31760 gene napE 14828 14670 CDS product periplasmic nitrate reductase, NapE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082429.1 protein_id gnl|my_center|LOCUS_31760 15272 15877 gene locus_tag LOCUS_31770 15272 15877 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037167.1 protein_id gnl|my_center|LOCUS_31770 16053 16655 gene locus_tag LOCUS_31780 16053 16655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 17108 17737 gene locus_tag LOCUS_31790 17108 17737 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072655.1 protein_id gnl|my_center|LOCUS_31790 19100 17823 gene locus_tag LOCUS_31800 19100 17823 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073547.1 protein_id gnl|my_center|LOCUS_31800 19793 19116 gene locus_tag LOCUS_31810 19793 19116 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305357.1 protein_id gnl|my_center|LOCUS_31810 21864 19897 gene locus_tag LOCUS_31820 21864 19897 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074229.1 protein_id gnl|my_center|LOCUS_31820 22031 22552 gene locus_tag LOCUS_31830 22031 22552 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 protein_id gnl|my_center|LOCUS_31830 22731 24824 gene locus_tag LOCUS_31840 gene ppk1 22731 24824 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706631.1 protein_id gnl|my_center|LOCUS_31840 24850 26352 gene locus_tag LOCUS_31850 gene ppx 24850 26352 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706632.1 protein_id gnl|my_center|LOCUS_31850 27693 26404 gene locus_tag LOCUS_31860 gene phoR 27693 26404 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460158.1 protein_id gnl|my_center|LOCUS_31860 28437 27745 gene locus_tag LOCUS_31870 gene phoB 28437 27745 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091117.1 protein_id gnl|my_center|LOCUS_31870 30142 28667 gene locus_tag LOCUS_31880 gene der 30142 28667 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261369.1 protein_id gnl|my_center|LOCUS_31880 30684 30268 gene locus_tag LOCUS_31890 30684 30268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 31840 30695 gene locus_tag LOCUS_31900 31840 30695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490755.1 protein_id gnl|my_center|LOCUS_31900 32694 31963 gene locus_tag LOCUS_31910 gene lpxH 32694 31963 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489008.1 protein_id gnl|my_center|LOCUS_31910 33290 32760 gene locus_tag LOCUS_31920 33290 32760 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478939.1 protein_id gnl|my_center|LOCUS_31920 33390 34766 gene locus_tag LOCUS_31930 gene cysS 33390 34766 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913180.1 protein_id gnl|my_center|LOCUS_31930 35714 34869 gene locus_tag LOCUS_31940 35714 34869 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071477.1 protein_id gnl|my_center|LOCUS_31940 36458 36159 gene locus_tag LOCUS_31950 gene ihfA 36458 36159 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211830.1 protein_id gnl|my_center|LOCUS_31950 38851 36461 gene locus_tag LOCUS_31960 gene pheT 38851 36461 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072150.1 protein_id gnl|my_center|LOCUS_31960 39849 38869 gene locus_tag LOCUS_31970 gene pheS 39849 38869 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072149.1 protein_id gnl|my_center|LOCUS_31970 40134 41324 gene locus_tag LOCUS_31980 40134 41324 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_31980 41773 41417 gene locus_tag LOCUS_31990 gene rplT 41773 41417 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081652.1 protein_id gnl|my_center|LOCUS_31990 41988 41791 gene locus_tag LOCUS_32000 gene rpmI 41988 41791 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005596065.1 protein_id gnl|my_center|LOCUS_32000 42527 42063 gene locus_tag LOCUS_32010 gene infC 42527 42063 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189469.1 protein_id gnl|my_center|LOCUS_32010 44536 42623 gene locus_tag LOCUS_32020 gene thrS 44536 42623 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706169.1 protein_id gnl|my_center|LOCUS_32020 44817 46448 gene locus_tag LOCUS_32030 44817 46448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 46526 47038 gene locus_tag LOCUS_32040 gene fabA 46526 47038 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706133.1 protein_id gnl|my_center|LOCUS_32040 47292 47119 gene locus_tag LOCUS_32050 gene rmf 47292 47119 CDS product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704906.1 protein_id gnl|my_center|LOCUS_32050 49202 47478 gene locus_tag LOCUS_32060 49202 47478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 51103 49205 gene locus_tag LOCUS_32070 51103 49205 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490212.1 protein_id gnl|my_center|LOCUS_32070 51338 51105 gene locus_tag LOCUS_32080 51338 51105 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071966.1 protein_id gnl|my_center|LOCUS_32080 53475 51373 gene locus_tag LOCUS_32090 gene rlmKL 53475 51373 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481936.1 protein_id gnl|my_center|LOCUS_32090 54306 53566 gene locus_tag LOCUS_32100 54306 53566 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739343.1 protein_id gnl|my_center|LOCUS_32100 55469 54381 gene locus_tag LOCUS_32110 gene bamC 55469 54381 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071989.1 protein_id gnl|my_center|LOCUS_32110 56346 55462 gene locus_tag LOCUS_32120 gene dapA 56346 55462 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481116.1 protein_id gnl|my_center|LOCUS_32120 56629 57102 gene locus_tag LOCUS_32130 gene bcp 56629 57102 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071986.1 protein_id gnl|my_center|LOCUS_32130 57229 58332 gene locus_tag LOCUS_32140 57229 58332 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462603.1 protein_id gnl|my_center|LOCUS_32140 >Feature sequence23 217 1437 gene locus_tag LOCUS_32150 217 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922607.1 protein_id gnl|my_center|LOCUS_32150 1590 2339 gene locus_tag LOCUS_32160 1590 2339 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294658.1 protein_id gnl|my_center|LOCUS_32160 2795 2409 gene locus_tag LOCUS_32170 2795 2409 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666933.1 protein_id gnl|my_center|LOCUS_32170 3443 2826 gene locus_tag LOCUS_32180 3443 2826 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262766.1 protein_id gnl|my_center|LOCUS_32180 6254 3702 gene locus_tag LOCUS_32190 6254 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 7074 6526 gene locus_tag LOCUS_32200 7074 6526 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921658.1 protein_id gnl|my_center|LOCUS_32200 7309 7893 gene locus_tag LOCUS_32210 7309 7893 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261712.1 protein_id gnl|my_center|LOCUS_32210 8290 7916 gene locus_tag LOCUS_32220 8290 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 8485 8865 gene locus_tag LOCUS_32230 gene gloA 8485 8865 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064966.1 protein_id gnl|my_center|LOCUS_32230 9193 10401 gene locus_tag LOCUS_32240 9193 10401 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_32240 11205 10504 gene locus_tag LOCUS_32250 11205 10504 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070923.1 protein_id gnl|my_center|LOCUS_32250 12100 11219 gene locus_tag LOCUS_32260 12100 11219 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_32260 12976 12104 gene locus_tag LOCUS_32270 gene asd 12976 12104 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070925.1 protein_id gnl|my_center|LOCUS_32270 14135 13089 gene locus_tag LOCUS_32280 gene rsgA 14135 13089 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815419.1 protein_id gnl|my_center|LOCUS_32280 14271 14816 gene locus_tag LOCUS_32290 gene orn 14271 14816 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456987.1 protein_id gnl|my_center|LOCUS_32290 14893 15792 gene locus_tag LOCUS_32300 14893 15792 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037440.1 protein_id gnl|my_center|LOCUS_32300 16651 15776 gene locus_tag LOCUS_32310 16651 15776 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263031.1 protein_id gnl|my_center|LOCUS_32310 17103 16654 gene locus_tag LOCUS_32320 17103 16654 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456606.1 protein_id gnl|my_center|LOCUS_32320 17429 19015 gene locus_tag LOCUS_32330 17429 19015 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961458.1 protein_id gnl|my_center|LOCUS_32330 21277 19166 gene locus_tag LOCUS_32340 gene pnp 21277 19166 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462070.1 protein_id gnl|my_center|LOCUS_32340 21701 21432 gene locus_tag LOCUS_32350 gene rpsO 21701 21432 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417682.1 protein_id gnl|my_center|LOCUS_32350 22715 21813 gene locus_tag LOCUS_32360 gene truB 22715 21813 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429261.1 protein_id gnl|my_center|LOCUS_32360 23134 22718 gene locus_tag LOCUS_32370 gene rbfA 23134 22718 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694530.1 protein_id gnl|my_center|LOCUS_32370 25973 23328 gene locus_tag LOCUS_32380 gene infB 25973 23328 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707074.1 protein_id gnl|my_center|LOCUS_32380 27501 25996 gene locus_tag LOCUS_32390 gene nusA 27501 25996 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071433.1 protein_id gnl|my_center|LOCUS_32390 27981 27526 gene locus_tag LOCUS_32400 gene rimP 27981 27526 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351719.1 protein_id gnl|my_center|LOCUS_32400 28214 28138 gene locus_tag LOCUS_t00440 28214 28138 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 28365 28384 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28983 28898 gene locus_tag LOCUS_t00450 28983 28898 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 29333 28998 gene locus_tag LOCUS_32410 gene secG 29333 28998 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861803.1 protein_id gnl|my_center|LOCUS_32410 30104 29334 gene locus_tag LOCUS_32420 gene tpiA 30104 29334 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071430.1 protein_id gnl|my_center|LOCUS_32420 31511 30174 gene locus_tag LOCUS_32430 gene glmM 31511 30174 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071169.1 protein_id gnl|my_center|LOCUS_32430 32348 31512 gene locus_tag LOCUS_32440 gene folP 32348 31512 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261254.1 protein_id gnl|my_center|LOCUS_32440 34389 32473 gene locus_tag LOCUS_32450 gene ftsH 34389 32473 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707080.1 protein_id gnl|my_center|LOCUS_32450 35036 34410 gene locus_tag LOCUS_32460 gene rlmE 35036 34410 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707081.1 protein_id gnl|my_center|LOCUS_32460 35125 35421 gene locus_tag LOCUS_32470 gene yhbY 35125 35421 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298134.1 protein_id gnl|my_center|LOCUS_32470 38372 35493 gene locus_tag LOCUS_32480 38372 35493 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275368.1 protein_id gnl|my_center|LOCUS_32480 39846 38617 gene locus_tag LOCUS_32490 39846 38617 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072557.1 protein_id gnl|my_center|LOCUS_32490 39928 41364 gene locus_tag LOCUS_32500 gene rsmF 39928 41364 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553486.1 protein_id gnl|my_center|LOCUS_32500 41730 42158 gene locus_tag LOCUS_32510 gene fur 41730 42158 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131699.1 protein_id gnl|my_center|LOCUS_32510 42219 42725 gene locus_tag LOCUS_32520 42219 42725 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263044.1 protein_id gnl|my_center|LOCUS_32520 42874 44040 gene locus_tag LOCUS_32530 42874 44040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 47533 44174 gene locus_tag LOCUS_32540 47533 44174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 50236 47591 gene locus_tag LOCUS_32550 50236 47591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 53662 50300 gene locus_tag LOCUS_32560 53662 50300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 53780 53965 gene locus_tag LOCUS_32570 53780 53965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 55568 54132 gene locus_tag LOCUS_32580 55568 54132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 56661 55672 gene locus_tag LOCUS_32590 56661 55672 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921655.1 protein_id gnl|my_center|LOCUS_32590 57508 56672 gene locus_tag LOCUS_32600 57508 56672 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_32600 >Feature sequence24 216 449 gene locus_tag LOCUS_32610 216 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 694 446 gene locus_tag LOCUS_32620 694 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 964 752 gene locus_tag LOCUS_32630 964 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 1660 1190 gene locus_tag LOCUS_32640 1660 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 1945 5658 gene locus_tag LOCUS_32650 1945 5658 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073731.1 protein_id gnl|my_center|LOCUS_32650 5655 6290 gene locus_tag LOCUS_32660 5655 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037422308.1 protein_id gnl|my_center|LOCUS_32660 6287 7504 gene locus_tag LOCUS_32670 6287 7504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073729.1 protein_id gnl|my_center|LOCUS_32670 7593 8441 gene locus_tag LOCUS_32680 7593 8441 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391255.1 protein_id gnl|my_center|LOCUS_32680 9103 8507 gene locus_tag LOCUS_32690 9103 8507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 12980 9225 gene locus_tag LOCUS_32700 12980 9225 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816917.1 protein_id gnl|my_center|LOCUS_32700 14329 12977 gene locus_tag LOCUS_32710 gene sbcD 14329 12977 CDS product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208687.1 protein_id gnl|my_center|LOCUS_32710 14672 14343 gene locus_tag LOCUS_32720 14672 14343 CDS product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704589.1 protein_id gnl|my_center|LOCUS_32720 15126 16556 gene locus_tag LOCUS_32730 15126 16556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 16722 17942 gene locus_tag LOCUS_32740 16722 17942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 17952 20177 gene locus_tag LOCUS_32750 17952 20177 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081570352.1 protein_id gnl|my_center|LOCUS_32750 20192 21190 gene locus_tag LOCUS_32760 20192 21190 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265511.1 protein_id gnl|my_center|LOCUS_32760 21274 22281 gene locus_tag LOCUS_32770 21274 22281 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071051.1 protein_id gnl|my_center|LOCUS_32770 22425 24023 gene locus_tag LOCUS_32780 22425 24023 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704617.1 protein_id gnl|my_center|LOCUS_32780 24038 25078 gene locus_tag LOCUS_32790 24038 25078 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461276.1 protein_id gnl|my_center|LOCUS_32790 28063 25166 gene locus_tag LOCUS_32800 gene glnE 28063 25166 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098759.1 protein_id gnl|my_center|LOCUS_32800 28158 29138 gene locus_tag LOCUS_32810 28158 29138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073538.1 protein_id gnl|my_center|LOCUS_32810 29163 30077 gene locus_tag LOCUS_32820 29163 30077 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073539.1 protein_id gnl|my_center|LOCUS_32820 30082 31803 gene locus_tag LOCUS_32830 30082 31803 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073540.1 protein_id gnl|my_center|LOCUS_32830 31925 32338 gene locus_tag LOCUS_32840 31925 32338 CDS product DUF2170 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007645549.1 protein_id gnl|my_center|LOCUS_32840 32355 33044 gene locus_tag LOCUS_32850 32355 33044 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073541.1 protein_id gnl|my_center|LOCUS_32850 33177 33827 gene locus_tag LOCUS_32860 33177 33827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073542.1 protein_id gnl|my_center|LOCUS_32860 33820 34146 gene locus_tag LOCUS_32870 33820 34146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073543.1 protein_id gnl|my_center|LOCUS_32870 34228 34827 gene locus_tag LOCUS_32880 34228 34827 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043164119.1 protein_id gnl|my_center|LOCUS_32880 34916 35479 gene locus_tag LOCUS_32890 34916 35479 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925679.1 protein_id gnl|my_center|LOCUS_32890 35476 36153 gene locus_tag LOCUS_32900 35476 36153 CDS product ChrR family anti-sigma-E factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263592.1 protein_id gnl|my_center|LOCUS_32900 36188 36616 gene locus_tag LOCUS_32910 36188 36616 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073250.1 protein_id gnl|my_center|LOCUS_32910 36613 37341 gene locus_tag LOCUS_32920 36613 37341 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263590.1 protein_id gnl|my_center|LOCUS_32920 37341 38648 gene locus_tag LOCUS_32930 37341 38648 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073248.1 protein_id gnl|my_center|LOCUS_32930 38645 39409 gene locus_tag LOCUS_32940 38645 39409 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705032.1 protein_id gnl|my_center|LOCUS_32940 39409 40674 gene locus_tag LOCUS_32950 39409 40674 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073246.1 protein_id gnl|my_center|LOCUS_32950 41408 41851 gene locus_tag LOCUS_32960 41408 41851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 41909 42454 gene locus_tag LOCUS_32970 41909 42454 CDS product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073243.1 protein_id gnl|my_center|LOCUS_32970 42634 43506 gene locus_tag LOCUS_32980 gene htpX 42634 43506 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705391.1 protein_id gnl|my_center|LOCUS_32980 44219 43656 gene locus_tag LOCUS_32990 44219 43656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 44632 45951 gene locus_tag LOCUS_33000 44632 45951 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430161.1 protein_id gnl|my_center|LOCUS_33000 46034 46303 gene locus_tag LOCUS_33010 46034 46303 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212191.1 protein_id gnl|my_center|LOCUS_33010 46781 46338 gene locus_tag LOCUS_33020 46781 46338 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261383.1 protein_id gnl|my_center|LOCUS_33020 48192 46966 gene locus_tag LOCUS_33030 48192 46966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 48611 48240 gene locus_tag LOCUS_33040 48611 48240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 48751 50181 gene locus_tag LOCUS_33050 gene ccoG 48751 50181 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481163.1 protein_id gnl|my_center|LOCUS_33050 >Feature sequence25 61 161 gene locus_tag LOCUS_r00020 61 161 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 267 524 gene locus_tag LOCUS_33060 267 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 1646 483 gene locus_tag LOCUS_33070 gene fadA 1646 483 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070436.1 protein_id gnl|my_center|LOCUS_33070 3804 1660 gene locus_tag LOCUS_33080 gene fadB 3804 1660 CDS product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640242.1 protein_id gnl|my_center|LOCUS_33080 4019 5929 gene locus_tag LOCUS_33090 gene slt 4019 5929 CDS product lytic transglycosylase Slt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_33090 6076 7122 gene locus_tag LOCUS_33100 6076 7122 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308111.1 protein_id gnl|my_center|LOCUS_33100 7172 8014 gene locus_tag LOCUS_33110 gene mreC 7172 8014 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704376.1 protein_id gnl|my_center|LOCUS_33110 8011 8487 gene locus_tag LOCUS_33120 gene mreD 8011 8487 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308115.1 protein_id gnl|my_center|LOCUS_33120 8487 9062 gene locus_tag LOCUS_33130 8487 9062 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261173.1 protein_id gnl|my_center|LOCUS_33130 9071 10546 gene locus_tag LOCUS_33140 gene rng 9071 10546 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704378.1 protein_id gnl|my_center|LOCUS_33140 10546 14493 gene locus_tag LOCUS_33150 10546 14493 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073797.1 protein_id gnl|my_center|LOCUS_33150 14486 15310 gene locus_tag LOCUS_33160 14486 15310 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704381.1 protein_id gnl|my_center|LOCUS_33160 15316 16755 gene locus_tag LOCUS_33170 gene tldD 15316 16755 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210082.1 protein_id gnl|my_center|LOCUS_33170 16787 18016 gene locus_tag LOCUS_33180 16787 18016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 18067 19104 gene locus_tag LOCUS_33190 gene pyrC 18067 19104 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112889.1 protein_id gnl|my_center|LOCUS_33190 19846 19469 gene locus_tag LOCUS_33200 19846 19469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 20752 19883 gene locus_tag LOCUS_33210 20752 19883 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037905.1 protein_id gnl|my_center|LOCUS_33210 21252 20752 gene locus_tag LOCUS_33220 21252 20752 CDS product DUF2271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922386.1 protein_id gnl|my_center|LOCUS_33220 21811 21257 gene locus_tag LOCUS_33230 21811 21257 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810476.1 protein_id gnl|my_center|LOCUS_33230 24066 21952 gene locus_tag LOCUS_33240 24066 21952 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482128.1 protein_id gnl|my_center|LOCUS_33240 24195 25232 gene locus_tag LOCUS_33250 24195 25232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 26855 25815 gene locus_tag LOCUS_33260 26855 25815 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044329667.1 protein_id gnl|my_center|LOCUS_33260 27220 26939 gene locus_tag LOCUS_33270 27220 26939 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070442.1 protein_id gnl|my_center|LOCUS_33270 27462 27217 gene locus_tag LOCUS_33280 27462 27217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402183.1 protein_id gnl|my_center|LOCUS_33280 28297 27848 gene locus_tag LOCUS_33290 28297 27848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 28564 30600 gene locus_tag LOCUS_33300 28564 30600 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815393.1 protein_id gnl|my_center|LOCUS_33300 30647 31765 gene locus_tag LOCUS_33310 30647 31765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 31831 32457 gene locus_tag LOCUS_33320 31831 32457 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088234.1 protein_id gnl|my_center|LOCUS_33320 32444 32749 gene locus_tag LOCUS_33330 32444 32749 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088238.1 protein_id gnl|my_center|LOCUS_33330 32850 37049 gene locus_tag LOCUS_33340 gene cobN 32850 37049 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114926.1 protein_id gnl|my_center|LOCUS_33340 37191 41417 gene locus_tag LOCUS_33350 gene cobN 37191 41417 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114926.1 protein_id gnl|my_center|LOCUS_33350 41604 42059 gene locus_tag LOCUS_33360 41604 42059 CDS product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097873.1 protein_id gnl|my_center|LOCUS_33360 43022 42108 gene locus_tag LOCUS_33370 43022 42108 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113465.1 protein_id gnl|my_center|LOCUS_33370 43046 43627 gene locus_tag LOCUS_33380 43046 43627 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707448.1 protein_id gnl|my_center|LOCUS_33380 43733 44869 gene locus_tag LOCUS_33390 43733 44869 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091593875.1 protein_id gnl|my_center|LOCUS_33390 44953 45177 gene locus_tag LOCUS_33400 44953 45177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 45170 45394 gene locus_tag LOCUS_33410 gene yidD 45170 45394 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141911.1 protein_id gnl|my_center|LOCUS_33410 45420 45812 gene locus_tag LOCUS_33420 45420 45812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 45972 47312 gene locus_tag LOCUS_33430 45972 47312 CDS product DUF4403 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350859.1 protein_id gnl|my_center|LOCUS_33430 48479 47517 gene locus_tag LOCUS_33440 48479 47517 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072111.1 protein_id gnl|my_center|LOCUS_33440 48849 49079 gene locus_tag LOCUS_33450 48849 49079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 49136 49636 gene locus_tag LOCUS_33460 49136 49636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 >Feature sequence26 2027 177 gene locus_tag LOCUS_33470 2027 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 2317 2242 gene locus_tag LOCUS_t00460 2317 2242 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2453 2368 gene locus_tag LOCUS_t00470 2453 2368 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2547 2472 gene locus_tag LOCUS_t00480 2547 2472 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2671 2586 gene locus_tag LOCUS_t00490 2671 2586 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2772 2699 gene locus_tag LOCUS_t00500 2772 2699 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2861 2786 gene locus_tag LOCUS_t00510 2861 2786 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3591 3046 gene locus_tag LOCUS_33480 gene pgsA 3591 3046 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706577.1 protein_id gnl|my_center|LOCUS_33480 5475 3637 gene locus_tag LOCUS_33490 gene uvrC 5475 3637 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706578.1 protein_id gnl|my_center|LOCUS_33490 6244 5600 gene locus_tag LOCUS_33500 gene uvrY 6244 5600 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706579.1 protein_id gnl|my_center|LOCUS_33500 6485 6395 gene locus_tag LOCUS_t00520 6485 6395 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6809 7477 gene locus_tag LOCUS_33510 6809 7477 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072357.1 protein_id gnl|my_center|LOCUS_33510 7602 7985 gene locus_tag LOCUS_33520 7602 7985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 7985 8347 gene locus_tag LOCUS_33530 gene tusC 7985 8347 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044900.1 protein_id gnl|my_center|LOCUS_33530 8350 8613 gene locus_tag LOCUS_33540 8350 8613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 8615 8953 gene locus_tag LOCUS_33550 8615 8953 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072361.1 protein_id gnl|my_center|LOCUS_33550 10490 9195 gene locus_tag LOCUS_33560 gene serS 10490 9195 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072310.1 protein_id gnl|my_center|LOCUS_33560 10973 10587 gene locus_tag LOCUS_33570 gene crcB 10973 10587 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465059.1 protein_id gnl|my_center|LOCUS_33570 12291 10966 gene locus_tag LOCUS_33580 12291 10966 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196299305.1 protein_id gnl|my_center|LOCUS_33580 12928 12293 gene locus_tag LOCUS_33590 gene lolA 12928 12293 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460060.1 protein_id gnl|my_center|LOCUS_33590 15645 12931 gene locus_tag LOCUS_33600 15645 12931 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072306.1 protein_id gnl|my_center|LOCUS_33600 15897 16970 gene locus_tag LOCUS_33610 gene ald 15897 16970 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084547.1 protein_id gnl|my_center|LOCUS_33610 19505 17103 gene locus_tag LOCUS_33620 19505 17103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 20038 19502 gene locus_tag LOCUS_33630 20038 19502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 20675 20142 gene locus_tag LOCUS_33640 20675 20142 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457982.1 protein_id gnl|my_center|LOCUS_33640 22321 20672 gene locus_tag LOCUS_33650 gene pqiB 22321 20672 CDS product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707505.1 protein_id gnl|my_center|LOCUS_33650 22869 22318 gene locus_tag LOCUS_33660 22869 22318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33660 23534 22893 gene locus_tag LOCUS_33670 23534 22893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33670 24417 23539 gene locus_tag LOCUS_33680 gene rssA 24417 23539 CDS product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072756.1 protein_id gnl|my_center|LOCUS_33680 24750 25973 gene locus_tag LOCUS_33690 24750 25973 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262170.1 protein_id gnl|my_center|LOCUS_33690 28405 26297 gene locus_tag LOCUS_33700 28405 26297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 29550 28510 gene locus_tag LOCUS_33710 29550 28510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 30039 29713 gene locus_tag LOCUS_33720 30039 29713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 31476 30094 gene locus_tag LOCUS_33730 31476 30094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 32324 31473 gene locus_tag LOCUS_33740 gene nlpI 32324 31473 CDS product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071440.1 protein_id gnl|my_center|LOCUS_33740 33223 32414 gene locus_tag LOCUS_33750 gene speD 33223 32414 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156788.1 protein_id gnl|my_center|LOCUS_33750 33705 33367 gene locus_tag LOCUS_33760 33705 33367 CDS product DUF3802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419431.1 protein_id gnl|my_center|LOCUS_33760 35003 33861 gene locus_tag LOCUS_33770 35003 33861 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 protein_id gnl|my_center|LOCUS_33770 36972 35023 gene locus_tag LOCUS_33780 36972 35023 CDS product LapD/MoxY N-terminal periplasmic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706510.1 protein_id gnl|my_center|LOCUS_33780 37712 37020 gene locus_tag LOCUS_33790 37712 37020 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073981.1 protein_id gnl|my_center|LOCUS_33790 38831 37815 gene locus_tag LOCUS_33800 38831 37815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 40152 38824 gene locus_tag LOCUS_33810 40152 38824 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706511.1 protein_id gnl|my_center|LOCUS_33810 41541 40177 gene locus_tag LOCUS_33820 41541 40177 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 protein_id gnl|my_center|LOCUS_33820 43714 41561 gene locus_tag LOCUS_33830 43714 41561 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706513.1 protein_id gnl|my_center|LOCUS_33830 <47785 43845 gene locus_tag LOCUS_33840 <47785 43845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063921491.1:DUF5801 repeats-in-toxin domain-containing protein 47176 47195 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence27 1456 452 gene locus_tag LOCUS_33850 gene kdgT 1456 452 CDS product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095118.1 protein_id gnl|my_center|LOCUS_33850 3524 1833 gene locus_tag LOCUS_33860 3524 1833 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489697.1 protein_id gnl|my_center|LOCUS_33860 4290 5420 gene locus_tag LOCUS_33870 4290 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 6669 5761 gene locus_tag LOCUS_33880 6669 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 7538 6774 gene locus_tag LOCUS_33890 7538 6774 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880463.1 protein_id gnl|my_center|LOCUS_33890 7689 9746 gene locus_tag LOCUS_33900 7689 9746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 9795 11774 gene locus_tag LOCUS_33910 9795 11774 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918932.1 protein_id gnl|my_center|LOCUS_33910 12262 11861 gene locus_tag LOCUS_33920 12262 11861 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243208.1 protein_id gnl|my_center|LOCUS_33920 12553 14022 gene locus_tag LOCUS_33930 12553 14022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 14188 15498 gene locus_tag LOCUS_33940 14188 15498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 15504 17681 gene locus_tag LOCUS_33950 15504 17681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 18030 19613 gene locus_tag LOCUS_33960 18030 19613 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841405.1 protein_id gnl|my_center|LOCUS_33960 20009 23227 gene locus_tag LOCUS_33970 20009 23227 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918458.1 protein_id gnl|my_center|LOCUS_33970 24029 23370 gene locus_tag LOCUS_33980 24029 23370 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037565.1 protein_id gnl|my_center|LOCUS_33980 24611 24270 gene locus_tag LOCUS_33990 24611 24270 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705347.1 protein_id gnl|my_center|LOCUS_33990 25241 24756 gene locus_tag LOCUS_34000 25241 24756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 25790 25311 gene locus_tag LOCUS_34010 25790 25311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 25881 27359 gene locus_tag LOCUS_34020 gene tyrR 25881 27359 CDS product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705761.1 protein_id gnl|my_center|LOCUS_34020 27594 27424 gene locus_tag LOCUS_34030 27594 27424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 28018 29340 gene locus_tag LOCUS_34040 gene mpl 28018 29340 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261084.1 protein_id gnl|my_center|LOCUS_34040 29327 29947 gene locus_tag LOCUS_34050 29327 29947 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707290.1 protein_id gnl|my_center|LOCUS_34050 29967 30890 gene locus_tag LOCUS_34060 29967 30890 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462584.1 protein_id gnl|my_center|LOCUS_34060 30883 31656 gene locus_tag LOCUS_34070 30883 31656 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479696.1 protein_id gnl|my_center|LOCUS_34070 31656 32303 gene locus_tag LOCUS_34080 31656 32303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 32682 34301 gene locus_tag LOCUS_34090 32682 34301 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114016.1 protein_id gnl|my_center|LOCUS_34090 34307 34834 gene locus_tag LOCUS_34100 gene msrA 34307 34834 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189960.1 protein_id gnl|my_center|LOCUS_34100 36031 34826 gene locus_tag LOCUS_34110 36031 34826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 36962 36045 gene locus_tag LOCUS_34120 36962 36045 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706755.1 protein_id gnl|my_center|LOCUS_34120 37628 39412 gene locus_tag LOCUS_34130 37628 39412 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071060.1 protein_id gnl|my_center|LOCUS_34130 39955 39491 gene locus_tag LOCUS_34140 gene rnhA 39955 39491 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368126.1 protein_id gnl|my_center|LOCUS_34140 40145 40861 gene locus_tag LOCUS_34150 gene dnaQ 40145 40861 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705465.1 protein_id gnl|my_center|LOCUS_34150 40954 42324 gene locus_tag LOCUS_34160 40954 42324 CDS product TIGR03503 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925880.1 protein_id gnl|my_center|LOCUS_34160 42442 42518 gene locus_tag LOCUS_t00530 42442 42518 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 42565 42641 gene locus_tag LOCUS_t00540 42565 42641 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 42701 42777 gene locus_tag LOCUS_t00550 42701 42777 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 42832 42908 gene locus_tag LOCUS_t00560 42832 42908 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 43575 43733 gene locus_tag LOCUS_34170 43575 43733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 43910 44224 gene locus_tag LOCUS_34180 43910 44224 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388880.1 protein_id gnl|my_center|LOCUS_34180 44217 45431 gene locus_tag LOCUS_34190 44217 45431 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857525.1 protein_id gnl|my_center|LOCUS_34190 46909 46271 gene locus_tag LOCUS_34200 46909 46271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 >Feature sequence28 2996 891 gene locus_tag LOCUS_34210 gene vesC 2996 891 CDS product GlyGly-anchored extracellular serine protease VesC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043985.1 protein_id gnl|my_center|LOCUS_34210 4913 3132 gene locus_tag LOCUS_34220 4913 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 5425 4916 gene locus_tag LOCUS_34230 5425 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 6349 5438 gene locus_tag LOCUS_34240 6349 5438 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263821.1 protein_id gnl|my_center|LOCUS_34240 9021 6352 gene locus_tag LOCUS_34250 9021 6352 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126780017.1 protein_id gnl|my_center|LOCUS_34250 9786 9160 gene locus_tag LOCUS_34260 9786 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 10877 9798 gene locus_tag LOCUS_34270 10877 9798 CDS product ferritin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970770.1 protein_id gnl|my_center|LOCUS_34270 12574 10880 gene locus_tag LOCUS_34280 12574 10880 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902740.1 protein_id gnl|my_center|LOCUS_34280 13058 12564 gene locus_tag LOCUS_34290 13058 12564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 14351 13362 gene locus_tag LOCUS_34300 gene ftsX 14351 13362 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074182.1 protein_id gnl|my_center|LOCUS_34300 15034 14348 gene locus_tag LOCUS_34310 gene ftsE 15034 14348 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_34310 16395 15073 gene locus_tag LOCUS_34320 16395 15073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 16566 17183 gene locus_tag LOCUS_34330 gene rsmD 16566 17183 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693161.1 protein_id gnl|my_center|LOCUS_34330 17199 17579 gene locus_tag LOCUS_34340 17199 17579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 17606 19483 gene locus_tag LOCUS_34350 17606 19483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 19735 19944 gene locus_tag LOCUS_34360 19735 19944 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072720.1 protein_id gnl|my_center|LOCUS_34360 20074 20562 gene locus_tag LOCUS_34370 20074 20562 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439331.1 protein_id gnl|my_center|LOCUS_34370 21241 20684 gene locus_tag LOCUS_34380 21241 20684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 22103 21255 gene locus_tag LOCUS_34390 22103 21255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 22548 23408 gene locus_tag LOCUS_34400 gene tesB 22548 23408 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167662.1 protein_id gnl|my_center|LOCUS_34400 23508 24401 gene locus_tag LOCUS_34410 23508 24401 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704920.1 protein_id gnl|my_center|LOCUS_34410 26307 24484 gene locus_tag LOCUS_34420 26307 24484 CDS product DEAD/DEAH family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815447.1 protein_id gnl|my_center|LOCUS_34420 27433 26957 gene locus_tag LOCUS_34430 gene greB 27433 26957 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316622.1 protein_id gnl|my_center|LOCUS_34430 27836 28999 gene locus_tag LOCUS_34440 27836 28999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 30134 32608 gene locus_tag LOCUS_34450 gene hrpB 30134 32608 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309224.1 protein_id gnl|my_center|LOCUS_34450 32598 34892 gene locus_tag LOCUS_34460 gene mrcB 32598 34892 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707274.1 protein_id gnl|my_center|LOCUS_34460 35546 35079 gene locus_tag LOCUS_34470 gene bfr 35546 35079 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071356.1 protein_id gnl|my_center|LOCUS_34470 36023 35559 gene locus_tag LOCUS_34480 gene bfr 36023 35559 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071355.1 protein_id gnl|my_center|LOCUS_34480 36788 36285 gene locus_tag LOCUS_34490 36788 36285 CDS product cyclin-dependent kinase inhibitor 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149585.1 protein_id gnl|my_center|LOCUS_34490 37022 37786 gene locus_tag LOCUS_34500 37022 37786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 38199 38777 gene locus_tag LOCUS_34510 38199 38777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 39047 40366 gene locus_tag LOCUS_34520 gene pepP 39047 40366 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703431.1 protein_id gnl|my_center|LOCUS_34520 40382 41599 gene locus_tag LOCUS_34530 gene ubiH 40382 41599 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132411.1 protein_id gnl|my_center|LOCUS_34530 41615 42826 gene locus_tag LOCUS_34540 41615 42826 CDS product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262559.1 protein_id gnl|my_center|LOCUS_34540 42944 43714 gene locus_tag LOCUS_34550 42944 43714 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070461.1 protein_id gnl|my_center|LOCUS_34550 43787 46588 gene locus_tag LOCUS_34560 gene ptrA 43787 46588 CDS product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816978.1 protein_id gnl|my_center|LOCUS_34560 >Feature sequence29 1111 2556 gene locus_tag LOCUS_34570 1111 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 2836 4005 gene locus_tag LOCUS_34580 2836 4005 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525264.1 protein_id gnl|my_center|LOCUS_34580 4021 5043 gene locus_tag LOCUS_34590 4021 5043 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383135.1 protein_id gnl|my_center|LOCUS_34590 5054 5818 gene locus_tag LOCUS_34600 gene kduD 5054 5818 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919366.1 protein_id gnl|my_center|LOCUS_34600 5823 7271 gene locus_tag LOCUS_34610 gene aldA 5823 7271 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588856.1 protein_id gnl|my_center|LOCUS_34610 7486 8352 gene locus_tag LOCUS_34620 7486 8352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707493.1 protein_id gnl|my_center|LOCUS_34620 9583 8711 gene locus_tag LOCUS_34630 9583 8711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 11940 9886 gene locus_tag LOCUS_34640 11940 9886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 14931 12532 gene locus_tag LOCUS_34650 14931 12532 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033404426.1 protein_id gnl|my_center|LOCUS_34650 15310 16389 gene locus_tag LOCUS_34660 15310 16389 CDS product glycosyhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029020.1 protein_id gnl|my_center|LOCUS_34660 16541 17464 gene locus_tag LOCUS_34670 16541 17464 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263804.1 protein_id gnl|my_center|LOCUS_34670 19624 17600 gene locus_tag LOCUS_34680 19624 17600 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_34680 22075 21263 gene locus_tag LOCUS_34690 22075 21263 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355660.1 protein_id gnl|my_center|LOCUS_34690 23191 22085 gene locus_tag LOCUS_34700 23191 22085 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729610.1 protein_id gnl|my_center|LOCUS_34700 23323 24189 gene locus_tag LOCUS_34710 23323 24189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 25118 24243 gene locus_tag LOCUS_34720 25118 24243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707493.1 protein_id gnl|my_center|LOCUS_34720 25763 25311 gene locus_tag LOCUS_34730 25763 25311 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920119.1 protein_id gnl|my_center|LOCUS_34730 25879 26718 gene locus_tag LOCUS_34740 25879 26718 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119010.1 protein_id gnl|my_center|LOCUS_34740 27802 26753 gene locus_tag LOCUS_34750 27802 26753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 28018 29013 gene locus_tag LOCUS_34760 gene astE 28018 29013 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097028.1 protein_id gnl|my_center|LOCUS_34760 31400 29019 gene locus_tag LOCUS_34770 31400 29019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 32047 31526 gene locus_tag LOCUS_34780 32047 31526 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881633.1 protein_id gnl|my_center|LOCUS_34780 32306 32127 gene locus_tag LOCUS_34790 32306 32127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 33577 34392 gene locus_tag LOCUS_34800 33577 34392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 34440 36191 gene locus_tag LOCUS_34810 gene msbA 34440 36191 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211320.1 protein_id gnl|my_center|LOCUS_34810 36194 37174 gene locus_tag LOCUS_34820 gene lpxK 36194 37174 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072734.1 protein_id gnl|my_center|LOCUS_34820 37179 37367 gene locus_tag LOCUS_34830 37179 37367 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350068.1 protein_id gnl|my_center|LOCUS_34830 37364 38140 gene locus_tag LOCUS_34840 gene kdsB 37364 38140 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011329.1 protein_id gnl|my_center|LOCUS_34840 38137 38427 gene locus_tag LOCUS_34850 38137 38427 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481865.1 protein_id gnl|my_center|LOCUS_34850 38657 39724 gene locus_tag LOCUS_34860 38657 39724 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477886.1 protein_id gnl|my_center|LOCUS_34860 39733 40707 gene locus_tag LOCUS_34870 39733 40707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 40828 42360 gene locus_tag LOCUS_34880 40828 42360 CDS product DUF3369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362852.1 protein_id gnl|my_center|LOCUS_34880 >Feature sequence30 178 2505 gene locus_tag LOCUS_34890 gene arcB 178 2505 CDS product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488721.1 protein_id gnl|my_center|LOCUS_34890 2674 4761 gene locus_tag LOCUS_34900 gene fusA 2674 4761 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456593.1 protein_id gnl|my_center|LOCUS_34900 8256 4897 gene locus_tag LOCUS_34910 8256 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 9041 8448 gene locus_tag LOCUS_34920 gene cysC 9041 8448 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245829.1 protein_id gnl|my_center|LOCUS_34920 10778 9054 gene locus_tag LOCUS_34930 10778 9054 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261126.1 protein_id gnl|my_center|LOCUS_34930 12210 10795 gene locus_tag LOCUS_34940 12210 10795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 13194 12223 gene locus_tag LOCUS_34950 13194 12223 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261054.1 protein_id gnl|my_center|LOCUS_34950 14126 13218 gene locus_tag LOCUS_34960 gene cysD 14126 13218 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417374.1 protein_id gnl|my_center|LOCUS_34960 17152 14240 gene locus_tag LOCUS_34970 17152 14240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 17183 18181 gene locus_tag LOCUS_34980 gene rsmC 17183 18181 CDS product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262584.1 protein_id gnl|my_center|LOCUS_34980 18302 19534 gene locus_tag LOCUS_34990 gene glgC 18302 19534 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457246.1 protein_id gnl|my_center|LOCUS_34990 19538 20968 gene locus_tag LOCUS_35000 gene glgA 19538 20968 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707514.1 protein_id gnl|my_center|LOCUS_35000 21414 20992 gene locus_tag LOCUS_35010 21414 20992 CDS product DUF3293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706823.1 protein_id gnl|my_center|LOCUS_35010 21642 23288 gene locus_tag LOCUS_35020 21642 23288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 23381 24097 gene locus_tag LOCUS_35030 gene arcA 23381 24097 CDS product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856501.1 protein_id gnl|my_center|LOCUS_35030 24605 24150 gene locus_tag LOCUS_35040 24605 24150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 24618 25553 gene locus_tag LOCUS_35050 24618 25553 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073893.1 protein_id gnl|my_center|LOCUS_35050 25678 28371 gene locus_tag LOCUS_35060 gene secA 25678 28371 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707576.1 protein_id gnl|my_center|LOCUS_35060 28372 28770 gene locus_tag LOCUS_35070 gene mutT 28372 28770 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070770.1 protein_id gnl|my_center|LOCUS_35070 30234 28888 gene locus_tag LOCUS_35080 gene accC 30234 28888 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459551.1 protein_id gnl|my_center|LOCUS_35080 30706 30248 gene locus_tag LOCUS_35090 gene accB 30706 30248 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707112.1 protein_id gnl|my_center|LOCUS_35090 31176 30724 gene locus_tag LOCUS_35100 gene aroQ 31176 30724 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707111.1 protein_id gnl|my_center|LOCUS_35100 31676 31350 gene locus_tag LOCUS_35110 31676 31350 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920728.1 protein_id gnl|my_center|LOCUS_35110 31842 32342 gene locus_tag LOCUS_35120 gene fxsA 31842 32342 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460455.1 protein_id gnl|my_center|LOCUS_35120 32352 34547 gene locus_tag LOCUS_35130 32352 34547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 34991 36373 gene locus_tag LOCUS_35140 34991 36373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 37445 36531 gene locus_tag LOCUS_35150 37445 36531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 37797 37474 gene locus_tag LOCUS_35160 37797 37474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 >Feature sequence31 205 678 gene locus_tag LOCUS_35170 205 678 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704113.1 protein_id gnl|my_center|LOCUS_35170 2716 725 gene locus_tag LOCUS_35180 gene cirA 2716 725 CDS product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489277.1 protein_id gnl|my_center|LOCUS_35180 3144 2983 gene locus_tag LOCUS_35190 gene rsmS 3144 2983 CDS product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051161.1 protein_id gnl|my_center|LOCUS_35190 3427 3146 gene locus_tag LOCUS_35200 3427 3146 CDS product late competence development ComFB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352123.1 protein_id gnl|my_center|LOCUS_35200 4753 3515 gene locus_tag LOCUS_35210 4753 3515 CDS product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812972.1 protein_id gnl|my_center|LOCUS_35210 4800 5225 gene locus_tag LOCUS_35220 4800 5225 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767887.1 protein_id gnl|my_center|LOCUS_35220 5477 5217 gene locus_tag LOCUS_35230 5477 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 6591 5560 gene locus_tag LOCUS_35240 6591 5560 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043922219.1 protein_id gnl|my_center|LOCUS_35240 6696 7175 gene locus_tag LOCUS_35250 6696 7175 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400653.1 protein_id gnl|my_center|LOCUS_35250 7196 7552 gene locus_tag LOCUS_35260 7196 7552 CDS product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071955.1 protein_id gnl|my_center|LOCUS_35260 7596 7814 gene locus_tag LOCUS_35270 7596 7814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 8214 11153 gene locus_tag LOCUS_35280 8214 11153 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919622.1 protein_id gnl|my_center|LOCUS_35280 11184 15479 gene locus_tag LOCUS_35290 gene pulA 11184 15479 CDS product pullulanase-type alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819303.1 protein_id gnl|my_center|LOCUS_35290 15753 17597 gene locus_tag LOCUS_35300 15753 17597 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072207.1 protein_id gnl|my_center|LOCUS_35300 17597 20200 gene locus_tag LOCUS_35310 17597 20200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 21364 20450 gene locus_tag LOCUS_35320 21364 20450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 22821 21490 gene locus_tag LOCUS_35330 22821 21490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 23104 24153 gene locus_tag LOCUS_35340 23104 24153 CDS product DUF1679 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261760.1 protein_id gnl|my_center|LOCUS_35340 24173 25135 gene locus_tag LOCUS_35350 24173 25135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 25473 26177 gene locus_tag LOCUS_35360 25473 26177 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_35360 26417 27391 gene locus_tag LOCUS_35370 26417 27391 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072446.1 protein_id gnl|my_center|LOCUS_35370 27693 27932 gene locus_tag LOCUS_35380 27693 27932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 >Feature sequence32 1361 114 gene locus_tag LOCUS_35390 1361 114 CDS product tagaturonate epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119734.1 protein_id gnl|my_center|LOCUS_35390 2170 1484 gene locus_tag LOCUS_35400 2170 1484 CDS product hydantoin utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125521.1 protein_id gnl|my_center|LOCUS_35400 2843 2163 gene locus_tag LOCUS_35410 gene larB 2843 2163 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125503.1 protein_id gnl|my_center|LOCUS_35410 3642 2830 gene locus_tag LOCUS_35420 gene larE 3642 2830 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142045.1 protein_id gnl|my_center|LOCUS_35420 5476 3707 gene locus_tag LOCUS_35430 5476 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 5868 6827 gene locus_tag LOCUS_35440 5868 6827 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919363.1 protein_id gnl|my_center|LOCUS_35440 7799 6954 gene locus_tag LOCUS_35450 7799 6954 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114256.1 protein_id gnl|my_center|LOCUS_35450 11091 7969 gene locus_tag LOCUS_35460 11091 7969 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035378.1 protein_id gnl|my_center|LOCUS_35460 12941 11469 gene locus_tag LOCUS_35470 12941 11469 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640251.1 protein_id gnl|my_center|LOCUS_35470 14142 13000 gene locus_tag LOCUS_35480 14142 13000 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166869.1 protein_id gnl|my_center|LOCUS_35480 14920 14147 gene locus_tag LOCUS_35490 14920 14147 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028029.1 protein_id gnl|my_center|LOCUS_35490 16284 14920 gene locus_tag LOCUS_35500 16284 14920 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109109.1 protein_id gnl|my_center|LOCUS_35500 17771 16335 gene locus_tag LOCUS_35510 gene pelB 17771 16335 CDS product exopolygalacturonase PelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865120.1 protein_id gnl|my_center|LOCUS_35510 19366 18065 gene locus_tag LOCUS_35520 19366 18065 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 protein_id gnl|my_center|LOCUS_35520 19890 19369 gene locus_tag LOCUS_35530 19890 19369 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577041.1 protein_id gnl|my_center|LOCUS_35530 20876 19887 gene locus_tag LOCUS_35540 20876 19887 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_35540 21766 20924 gene locus_tag LOCUS_35550 gene kduI 21766 20924 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109101.1 protein_id gnl|my_center|LOCUS_35550 22548 21775 gene locus_tag LOCUS_35560 gene kduD 22548 21775 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_35560 22858 25359 gene locus_tag LOCUS_35570 22858 25359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 >Feature sequence33 677 153 gene locus_tag LOCUS_35580 677 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 1837 1610 gene locus_tag LOCUS_35590 1837 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 1983 4295 gene locus_tag LOCUS_35600 1983 4295 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033404426.1 protein_id gnl|my_center|LOCUS_35600 4816 4526 gene locus_tag LOCUS_35610 4816 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 5248 4883 gene locus_tag LOCUS_35620 5248 4883 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392702.1 protein_id gnl|my_center|LOCUS_35620 5692 5910 gene locus_tag LOCUS_35630 5692 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 6109 5921 gene locus_tag LOCUS_35640 6109 5921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 6847 6503 gene locus_tag LOCUS_35650 6847 6503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 8297 7791 gene locus_tag LOCUS_35660 8297 7791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 8994 8518 gene locus_tag LOCUS_35670 8994 8518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 9602 9234 gene locus_tag LOCUS_35680 9602 9234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 11499 10027 gene locus_tag LOCUS_35690 11499 10027 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640251.1 protein_id gnl|my_center|LOCUS_35690 12600 11674 gene locus_tag LOCUS_35700 12600 11674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 13316 12633 gene locus_tag LOCUS_35710 13316 12633 CDS product hydantoin utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125521.1 protein_id gnl|my_center|LOCUS_35710 13996 13316 gene locus_tag LOCUS_35720 gene larB 13996 13316 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100884.1 protein_id gnl|my_center|LOCUS_35720 14795 13983 gene locus_tag LOCUS_35730 14795 13983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 16081 14792 gene locus_tag LOCUS_35740 gene larC 16081 14792 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940817.1 protein_id gnl|my_center|LOCUS_35740 17391 16099 gene locus_tag LOCUS_35750 17391 16099 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334376.1 protein_id gnl|my_center|LOCUS_35750 17873 17394 gene locus_tag LOCUS_35760 17873 17394 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162991909.1 protein_id gnl|my_center|LOCUS_35760 19199 17901 gene locus_tag LOCUS_35770 19199 17901 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 protein_id gnl|my_center|LOCUS_35770 19689 19210 gene locus_tag LOCUS_35780 19689 19210 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577036.1 protein_id gnl|my_center|LOCUS_35780 20598 19693 gene locus_tag LOCUS_35790 20598 19693 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_35790 21583 20741 gene locus_tag LOCUS_35800 gene kduI 21583 20741 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109101.1 protein_id gnl|my_center|LOCUS_35800 22364 21597 gene locus_tag LOCUS_35810 gene kduD 22364 21597 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035409.1 protein_id gnl|my_center|LOCUS_35810 23836 22412 gene locus_tag LOCUS_35820 gene uxaC 23836 22412 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338259.1 protein_id gnl|my_center|LOCUS_35820 >Feature sequence34 2178 88 gene locus_tag LOCUS_35830 gene recD 2178 88 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925866.1 protein_id gnl|my_center|LOCUS_35830 5885 2178 gene locus_tag LOCUS_35840 gene recB 5885 2178 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043027345.1 protein_id gnl|my_center|LOCUS_35840 9373 5882 gene locus_tag LOCUS_35850 gene recC 9373 5882 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022201.1 protein_id gnl|my_center|LOCUS_35850 9677 10576 gene locus_tag LOCUS_35860 9677 10576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 10582 12150 gene locus_tag LOCUS_35870 10582 12150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 12193 13440 gene locus_tag LOCUS_35880 12193 13440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 14545 13427 gene locus_tag LOCUS_35890 14545 13427 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257181.1 protein_id gnl|my_center|LOCUS_35890 15432 14626 gene locus_tag LOCUS_35900 15432 14626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 16282 15452 gene locus_tag LOCUS_35910 16282 15452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 18399 16282 gene locus_tag LOCUS_35920 18399 16282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 19326 18547 gene locus_tag LOCUS_35930 19326 18547 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653653.1 protein_id gnl|my_center|LOCUS_35930 21127 19340 gene locus_tag LOCUS_35940 gene ilvB 21127 19340 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393741.1 protein_id gnl|my_center|LOCUS_35940 23663 21168 gene locus_tag LOCUS_35950 23663 21168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 >Feature sequence35 377 165 gene locus_tag LOCUS_35960 gene nqrM 377 165 CDS product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705066.1 protein_id gnl|my_center|LOCUS_35960 1401 382 gene locus_tag LOCUS_35970 1401 382 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227821.1 protein_id gnl|my_center|LOCUS_35970 2633 1410 gene locus_tag LOCUS_35980 gene nqrF 2633 1410 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071352.1 protein_id gnl|my_center|LOCUS_35980 3315 2692 gene locus_tag LOCUS_35990 gene nqrE 3315 2692 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401432.1 protein_id gnl|my_center|LOCUS_35990 3945 3322 gene locus_tag LOCUS_36000 3945 3322 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071350.1 protein_id gnl|my_center|LOCUS_36000 4715 3945 gene locus_tag LOCUS_36010 4715 3945 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071349.1 protein_id gnl|my_center|LOCUS_36010 5919 4708 gene locus_tag LOCUS_36020 5919 4708 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071348.1 protein_id gnl|my_center|LOCUS_36020 7262 5922 gene locus_tag LOCUS_36030 7262 5922 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494215.1 protein_id gnl|my_center|LOCUS_36030 8856 7672 gene locus_tag LOCUS_36040 gene fabV 8856 7672 CDS product enoyl-ACP reductase FabV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102929.1 protein_id gnl|my_center|LOCUS_36040 9988 8891 gene locus_tag LOCUS_36050 gene dctP 9988 8891 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_36050 11429 10056 gene locus_tag LOCUS_36060 11429 10056 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_36060 11950 11429 gene locus_tag LOCUS_36070 11950 11429 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258193.1 protein_id gnl|my_center|LOCUS_36070 12293 11976 gene locus_tag LOCUS_36080 gene bolA 12293 11976 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261442.1 protein_id gnl|my_center|LOCUS_36080 12917 12309 gene locus_tag LOCUS_36090 12917 12309 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_36090 14174 13275 gene locus_tag LOCUS_36100 14174 13275 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482884.1 protein_id gnl|my_center|LOCUS_36100 14625 14789 gene locus_tag LOCUS_36110 14625 14789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 14964 14770 gene locus_tag LOCUS_36120 14964 14770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 16576 15650 gene locus_tag LOCUS_36130 16576 15650 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704173.1 protein_id gnl|my_center|LOCUS_36130 19046 17400 gene locus_tag LOCUS_36140 gene groL 19046 17400 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729136.1 protein_id gnl|my_center|LOCUS_36140 19409 19119 gene locus_tag LOCUS_36150 19409 19119 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026276.1 protein_id gnl|my_center|LOCUS_36150 20629 19775 gene locus_tag LOCUS_36160 20629 19775 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118789.1 protein_id gnl|my_center|LOCUS_36160 20849 20773 gene locus_tag LOCUS_t00570 20849 20773 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence36 2355 886 gene locus_tag LOCUS_36170 2355 886 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_36170 4082 2520 gene locus_tag LOCUS_36180 4082 2520 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 protein_id gnl|my_center|LOCUS_36180 6987 4201 gene locus_tag LOCUS_36190 6987 4201 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_36190 8126 7413 gene locus_tag LOCUS_36200 gene dsbC 8126 7413 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071231.1 protein_id gnl|my_center|LOCUS_36200 10752 8293 gene locus_tag LOCUS_36210 10752 8293 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_36210 12763 11096 gene locus_tag LOCUS_36220 12763 11096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 14973 13147 gene locus_tag LOCUS_36230 14973 13147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 17001 15397 gene locus_tag LOCUS_36240 17001 15397 CDS product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120965.1 protein_id gnl|my_center|LOCUS_36240 17495 16998 gene locus_tag LOCUS_36250 17495 16998 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105333325.1 protein_id gnl|my_center|LOCUS_36250 >Feature sequence37 <1 2034 gene locus_tag LOCUS_36260 <1 2034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584062.1:endo-1,4-beta-xylanase 2091 3236 gene locus_tag LOCUS_36270 2091 3236 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275490.1 protein_id gnl|my_center|LOCUS_36270 3312 3746 gene locus_tag LOCUS_36280 3312 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 4053 4493 gene locus_tag LOCUS_36290 4053 4493 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942952.1 protein_id gnl|my_center|LOCUS_36290 4650 4997 gene locus_tag LOCUS_36300 4650 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 6263 5097 gene locus_tag LOCUS_36310 6263 5097 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110716881.1 protein_id gnl|my_center|LOCUS_36310 6478 7197 gene locus_tag LOCUS_36320 6478 7197 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967508.1 protein_id gnl|my_center|LOCUS_36320 8724 7204 gene locus_tag LOCUS_36330 8724 7204 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918856.1 protein_id gnl|my_center|LOCUS_36330 11729 8835 gene locus_tag LOCUS_36340 11729 8835 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038268.1 protein_id gnl|my_center|LOCUS_36340 12771 11980 gene locus_tag LOCUS_36350 12771 11980 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080286.1 protein_id gnl|my_center|LOCUS_36350 13774 13022 gene locus_tag LOCUS_36360 13774 13022 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072068.1 protein_id gnl|my_center|LOCUS_36360 14783 13764 gene locus_tag LOCUS_36370 14783 13764 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072067.1 protein_id gnl|my_center|LOCUS_36370 15597 15055 gene locus_tag LOCUS_36380 15597 15055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 16331 15630 gene locus_tag LOCUS_36390 16331 15630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 15649 15668 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence38 2570 474 gene locus_tag LOCUS_36400 gene fusA 2570 474 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261077.1 protein_id gnl|my_center|LOCUS_36400 3065 2595 gene locus_tag LOCUS_36410 gene rpsG 3065 2595 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138050.1 protein_id gnl|my_center|LOCUS_36410 3517 3143 gene locus_tag LOCUS_36420 gene rpsL 3517 3143 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005543325.1 protein_id gnl|my_center|LOCUS_36420 7880 3660 gene locus_tag LOCUS_36430 gene rpoC 7880 3660 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070611.1 protein_id gnl|my_center|LOCUS_36430 11983 7955 gene locus_tag LOCUS_36440 gene rpoB 11983 7955 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005015893.1 protein_id gnl|my_center|LOCUS_36440 12534 12166 gene locus_tag LOCUS_36450 gene rplL 12534 12166 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466152.1 protein_id gnl|my_center|LOCUS_36450 13092 12598 gene locus_tag LOCUS_36460 gene rplJ 13092 12598 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481772.1 protein_id gnl|my_center|LOCUS_36460 14059 13355 gene locus_tag LOCUS_36470 gene rplA 14059 13355 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489780.1 protein_id gnl|my_center|LOCUS_36470 14491 14063 gene locus_tag LOCUS_36480 gene rplK 14491 14063 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085926.1 protein_id gnl|my_center|LOCUS_36480 15136 14594 gene locus_tag LOCUS_36490 gene nusG 15136 14594 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862341.1 protein_id gnl|my_center|LOCUS_36490 15520 15140 gene locus_tag LOCUS_36500 gene secE 15520 15140 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070605.1 protein_id gnl|my_center|LOCUS_36500 15657 15581 gene locus_tag LOCUS_t00580 15657 15581 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence39 154 1875 gene locus_tag LOCUS_36510 154 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 2627 1872 gene locus_tag LOCUS_36520 2627 1872 CDS product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581752.1 protein_id gnl|my_center|LOCUS_36520 2898 3803 gene locus_tag LOCUS_36530 gene rimK 2898 3803 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459235.1 protein_id gnl|my_center|LOCUS_36530 3808 4833 gene locus_tag LOCUS_36540 3808 4833 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 protein_id gnl|my_center|LOCUS_36540 4833 5372 gene locus_tag LOCUS_36550 4833 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 5362 5799 gene locus_tag LOCUS_36560 5362 5799 CDS product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459284.1 protein_id gnl|my_center|LOCUS_36560 5821 6783 gene locus_tag LOCUS_36570 gene corA 5821 6783 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948564.1 protein_id gnl|my_center|LOCUS_36570 6796 7653 gene locus_tag LOCUS_36580 6796 7653 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920837.1 protein_id gnl|my_center|LOCUS_36580 8906 7896 gene locus_tag LOCUS_36590 gene tsaD 8906 7896 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262666.1 protein_id gnl|my_center|LOCUS_36590 9089 9304 gene locus_tag LOCUS_36600 gene rpsU 9089 9304 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309452.1 protein_id gnl|my_center|LOCUS_36600 9313 9759 gene locus_tag LOCUS_36610 9313 9759 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 protein_id gnl|my_center|LOCUS_36610 9834 11606 gene locus_tag LOCUS_36620 gene dnaG 9834 11606 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262668.1 protein_id gnl|my_center|LOCUS_36620 11813 13642 gene locus_tag LOCUS_36630 gene rpoD 11813 13642 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369628.1 protein_id gnl|my_center|LOCUS_36630 >Feature sequence40 46 231 gene locus_tag LOCUS_36640 46 231 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314720.1 protein_id gnl|my_center|LOCUS_36640 1693 305 gene locus_tag LOCUS_36650 1693 305 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704812.1 protein_id gnl|my_center|LOCUS_36650 2037 4940 gene locus_tag LOCUS_36660 gene rapA 2037 4940 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070913.1 protein_id gnl|my_center|LOCUS_36660 >Feature sequence41 2931 47 gene locus_tag LOCUS_r00030 2931 47 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2980 3445 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5018 3494 gene locus_tag LOCUS_r00040 5018 3494 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence42 2188 263 gene locus_tag LOCUS_36670 2188 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 2221 2571 gene locus_tag LOCUS_36680 2221 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 2575 2694 gene locus_tag LOCUS_36690 2575 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 2801 3298 gene locus_tag LOCUS_36700 gene tpx 2801 3298 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402767.1 protein_id gnl|my_center|LOCUS_36700 >Feature sequence43 81 1067 gene locus_tag LOCUS_36710 81 1067 CDS product IS110-like element ISGsu4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941629.1 protein_id gnl|my_center|LOCUS_36710 1044 1063 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1151 1528 gene locus_tag LOCUS_36720 1151 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 >Feature sequence44 385 1035 gene locus_tag LOCUS_36730 385 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 >Feature sequence45 147 530 gene locus_tag LOCUS_36740 147 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 1206 559 gene locus_tag LOCUS_36750 1206 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 <1903 1217 gene locus_tag LOCUS_36760 <1903 1217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_095835446.1:IS110 family transposase 1357 1376 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence46 >Feature sequence47