COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..367267 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(4777..5364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(5754..7100) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122904.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene glnA CDS complement(7139..7495) product transcriptional repressor GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659548.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene glnR CDS complement(7572..8099) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119916.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(8233..12759) product antigen I/II family LPXTG-anchored adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836421.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(12924..14123) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896645.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 14477..15403 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837134.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 15488..15856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008808817.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(15973..20697) product bacterial Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795191.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 21030..22661 product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026653.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(22758..23054) product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230159.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(23076..24140) product glutamyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209199.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene pepA CDS 24374..25333 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777246.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 25323..26279 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193676.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 26276..27028 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764310.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 27126..28097 product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858246.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(28371..29093) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222228.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(29080..29649) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105299.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene scpB CDS complement(29674..30396) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351881.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(30396..31136) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178439.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene xerD CDS complement(31127..31588) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560712.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(31585..32106) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118952.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(32082..33053) product nucleoside-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182421.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(33050..33844) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370376.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene racE CDS complement(34050..34295) product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364990.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(34441..36066) product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162367.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene treC CDS complement(36130..38097) product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514332.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene treP CDS 38282..38995 product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760673.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene treR CDS 39248..44371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(44441..45421) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470809.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene mraY CDS complement(45423..47678) product penicillin-binding protein 2X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872267.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene pbp2X CDS complement(47682..47999) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818547.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene ftsL CDS complement(48010..48960) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159403.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene rsmH CDS 49123..49317 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082470.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 49333..49875 product DUF3278 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712328.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 50240..50818 product DUF3278 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711223.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 50815..51291 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203066.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 51633..57584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(57749..59359) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156772.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 59512..60996 product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743581.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(61131..62162) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836372.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(62129..62827) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002927078.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(63562..64350) product lantibiotic ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836370.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(64352..65059) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836369.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 65355..65837 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032547.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(65898..68003) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063353.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(68456..72535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(72856..75171) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260646.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene pflB CDS 75404..76465 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904583.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene dinB CDS complement(76500..77345) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280773.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(77405..79300) product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750640.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(79297..79518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 79430..80995 product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227315.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 80992..81732 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189477.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(81825..82040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130036.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(82147..83043) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898882.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(83126..84376) product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952972.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene ilvA CDS complement(84456..85478) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290683.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene ilvC CDS complement(85569..86045) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253803.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene ilvN CDS complement(86038..87738) product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411735.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(88061..90142) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090357.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene fusA CDS complement(90422..90892) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087873.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene rpsG CDS complement(90912..91325) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142332.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene rpsL CDS complement(91644..92243) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772075.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(92245..93342) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893546.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(93347..94081) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009660063.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(94094..94969) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837471.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(94956..95150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708869.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(95147..95338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503437.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(95464..103305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(103485..105152) product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036677.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(105155..105520) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216437.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(105673..105861) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140948.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene rpmB CDS complement(105966..106640) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725742.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(106646..107092) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776591.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(107206..107709) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800927.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(107806..109566) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428271.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(109556..111325) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731786.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(111309..111770) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360516.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 111985..112668 product CD20-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001539.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(112719..113435) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532885.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(113532..114884) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036271.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 115012..115566 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895565.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(115697..115891) product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899876.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(116061..117209) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085455.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene recA CDS complement(117264..118520) product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642685.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(118593..119633) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239268.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(119638..120159) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455529.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(120149..120592) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288232.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene tsaE CDS complement(121434..121853) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438298.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene ndk CDS complement(121965..125663) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228741.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene rpoC CDS complement(125696..129307) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907176.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene rpoB CDS 129750..133466 product pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232748.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(133669..134433) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837550.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(134443..135165) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837551.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(135169..135861) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002907938.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(135894..136772) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837552.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(136784..137782) product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837553.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(138000..139004) product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837554.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 139372..140229 product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844831.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(140459..141511) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229772.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(141622..143430) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334246.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene glmS CDS 143646..144059 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(144098..145477) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943496.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene bglA CDS complement(145576..147429) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814057.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(147446..148702) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900660.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene rseP CDS complement(148718..149521) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189869.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(149530..150288) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466719.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(150493..151077) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014017192.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(151058..152056) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502087.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene ruvB CDS complement(152441..152857) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628397.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(152869..153564) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144910.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(153760..156261) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011806.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene leuS CDS 156580..157620 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660662.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 157633..158724 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289363.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 158714..160372 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140832957.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(160467..161168) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241546.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(161405..162742) product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354889.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(162752..163018) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644126.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(163282..163668) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331493.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene rplQ CDS complement(163680..164615) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568988.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(164658..165041) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118385.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene rpsK CDS complement(165059..165424) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090781.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene rpsM CDS complement(165583..165801) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029883.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene infA CDS complement(165918..166556) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050431.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(166702..168012) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465403.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene secY CDS complement(168025..168465) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766087.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene rplO CDS complement(168610..168792) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057241.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene rpmD CDS complement(168806..169300) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874202.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene rpsE CDS complement(169318..169674) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624044.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene rplR CDS complement(169758..170294) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086626.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene rplF CDS complement(170487..170885) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245504.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene rpsH CDS complement(171170..171355) product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085697.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(171373..171915) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013542.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene rplE CDS complement(171939..172244) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497691.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene rplX CDS complement(172323..172691) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616545.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene rplN CDS complement(172717..172977) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440801.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene rpsQ CDS complement(173002..173208) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772918.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene rpmC CDS complement(173218..173631) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960946.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene rplP CDS complement(173635..174288) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529936.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene rpsC CDS complement(174301..174645) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818137.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene rplV CDS complement(174657..174938) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533766.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene rpsS CDS complement(175042..175875) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512911.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene rplB CDS complement(175893..176189) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055347.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(176189..176812) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024543.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene rplD CDS complement(176837..177463) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160197.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene rplC CDS complement(177546..177854) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284513.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene rpsJ CDS complement(178110..178523) product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837481.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(179091..179717) product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725987.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(179714..180310) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064217.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene nrdG CDS complement(180315..180821) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837627.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(180831..181331) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423404.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(181375..181515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521615.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(181527..183734) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560899.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene nrdD CDS complement(183864..185381) product damage-inducible protein CinA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118112.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(185417..185560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(185636..187168) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877345.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene cls CDS complement(187625..188080) product SP_0198 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694264.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(188171..189421) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464327.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(189728..190033) product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017620.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(190049..190459) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001808830.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene ruvX CDS complement(190472..190738) product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000507059.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(190825..191394) product SP0191 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725123.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(191461..191859) product transcriptional regulator Spx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591165.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene spx CDS complement(191994..194654) product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858856.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene mgtA CDS complement(195057..196118) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042854.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(196111..198942) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152883.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene uvrA CDS 199079..200023 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815623.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 200035..200712 product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078366.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 200728..201075 product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902561.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 201423..202430 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770826.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 202504..202767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(202839..203513) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987422.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(203514..204074) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166578.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(204084..204677) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273417.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene ruvA CDS 204836..205333 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837648.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(205486..207435) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018198.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene mutL CDS 207644..208084 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861965.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 208081..208539 product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745054.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(208582..211116) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963680.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene mutS CDS complement(211167..211613) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231476.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene argR CDS 211768..213459 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092709.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene argS CDS 213794..214039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084861.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 214237..215499 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075798.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(215580..216050) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849614.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene nrdI CDS complement(216127..216660) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140832896.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(216719..218005) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278886.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(218017..219663) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171011731.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(219665..220279) product DUF624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532352.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 220413..220982 product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748388.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(221011..221703) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444643.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(221705..222766) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085672.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(222759..224132) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231807.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(224251..225105) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694521.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(225259..226101) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724947.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(226204..226527) product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253939.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(226517..227212) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208222.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(227350..227907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(228025..229035) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655051.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene tsaD CDS complement(229025..229462) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569814.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene rimI CDS complement(229459..230142) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865694.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene tsaB CDS 230333..230515 product fratricide two-peptide bacteriocin subunit CibA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180803.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene cibA CDS 230517..230660 product fratricide two-peptide bacteriocin subunit CibB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974050.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene cibB CDS complement(230935..231150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282493.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 231441..231674 product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639589.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 231676..233355 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033682444.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(233418..235331) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220952.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene mnmG CDS complement(235340..235795) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442218.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(235936..237057) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282936.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene mnmA CDS complement(237486..238877) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107610.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene argH CDS complement(238905..240101) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031921.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(240117..240923) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033580.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(241201..241836) product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843471.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 242078..242749 product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838912.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene sdaAB CDS 242758..243630 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500045.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene sdaAA CDS 243652..244281 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200879.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(244369..244575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(244637..245059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(245308..247158) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035710.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(247234..248064) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890771.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 248286..249452 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744880.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 249588..249914 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273864.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 249901..250494 product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198679.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 250487..251416 product DUF4097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233696.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 251478..252440 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808449.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(252504..253364) product DUF4299 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140366.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(253486..254472) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030024.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(254604..254906) product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162496604.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(254969..255487) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760537.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(255819..257303) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800385.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(257412..258335) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818352.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(258349..259278) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032152.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(259636..261516) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251368.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(261510..262379) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162927925.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(262466..265111) product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140223810.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(265202..266482) product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640534.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(266611..267897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 268129..270216 product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803428.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(270253..271935) product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721460.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(272457..273962) product zinc ABC transporter substrate-binding lipoprotein AdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724053.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene adcA CDS complement(273972..274778) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950038.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(274771..275475) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269498.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(275475..275915) product zinc-dependent transcriptional regulator AdcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249308.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene adcR CDS complement(276064..278115) product cell surface ecto-5'-nucleotidase Nt5e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837008.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene nt5e CDS complement(278258..279526) product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919866.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene dltD CDS complement(279519..279758) product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351967.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene dltC CDS complement(279771..281015) product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969755.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene dltB CDS complement(281012..282562) product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972622.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene dltA CDS complement(282941..283645) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980821.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(283713..285539) product type 1 glycerol-3-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395901.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene glpO CDS complement(285591..287099) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076678.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene glpK CDS complement(287256..288683) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972623.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 288848..289720 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357854.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene hslO CDS 289707..290687 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183308.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene dusB CDS complement(290744..291430) product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764011.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(291556..292239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730890.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 292505..292735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949600.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(292780..293553) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140989.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(293555..294334) product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736873.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene pnuC CDS complement(294344..295402) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730572.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(295549..297891) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109716.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(297983..298441) product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211277.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(298614..303071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(303273..304001) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136214.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(304001..305008) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754538.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(305047..305745) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001813866.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(305768..306058) product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647665.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(306336..308969) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358440.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene polA CDS complement(309099..311993) product YSIRK-type signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126512433.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(312109..313230) product choline binding-anchored murein hydrolase CbpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866454.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene cbpD CDS complement(313330..313596) product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278167.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(313598..314950) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852497.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene dnaB CDS complement(314994..315446) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864220.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene rplI CDS complement(315443..317416) product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715137.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(317562..318752) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(318822..319370) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599104.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene raiA CDS complement(319450..320112) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649962.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(320109..321338) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867723.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 321464..322099 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395739.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 322114..322557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 322654..323580 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029885.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene cysK CDS complement(323684..324724) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808070.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene tsf CDS complement(324803..325582) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268459.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene rpsB CDS complement(325807..327015) product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727024.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 327366..327620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(327606..328421) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078983.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene mreC CDS complement(328482..329276) product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377893.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(329269..330108) product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510406.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(330093..330920) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835729.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(330917..331462) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712121.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene pgsA CDS complement(331473..332303) product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227988.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene rodZ CDS complement(332330..333613) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170200.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(333610..334860) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424263.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 335021..335389 product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455905.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene yaaA CDS 335392..336483 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266662.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene recF CDS complement(336542..338020) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073412.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene guaB CDS complement(338180..339208) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165472.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene trpS CDS 339404..341026 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958770.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 342114..343640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(343662..346316) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472055.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 346444..346986 product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158276.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 tRNA complement(347022..347095) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA complement(347100..347173) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(347224..347976) product competence system response regulator transcription factor ComE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866062.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene comE CDS complement(347973..349292) product competence system sensor histidine kinase ComD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362880.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene comD CDS complement(349313..349438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 tRNA complement(349603..349676) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(349720..350199) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695939.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene rlmH CDS 350385..351581 product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681606.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 351639..352397 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410378.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 352614..353975 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660615.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene dnaA CDS 354134..355270 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581152.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene dnaN CDS 355335..355529 product DUF951 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285186.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 355614..356729 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218712.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene ychF CDS 356803..357372 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163929.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene pth CDS 357373..360876 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258129.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene mfd CDS 360934..361200 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234978.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 361193..361561 product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041912.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 361566..361688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 361681..362949 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224761.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 362946..364223 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208977.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene tilS CDS 364228..364770 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892177.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene hpt CDS 364786..366744 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744562.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene ftsH CDS 366805..367035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 tRNA 367102..367173 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 sequence02 source 1..5282 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 89..160 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 rRNA 394..1938 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 1990..2064 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 rRNA 2188..5085 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence03 source 1..507 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence04 source 1..42449 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(95..166) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(212..1594) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042750245.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene rlmD CDS 1632..2408 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770524.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene recX CDS 2497..3030 product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775316.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(3101..3868) product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567572.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(3993..5615) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031562.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene groL CDS complement(5631..5915) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917323.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene groES CDS complement(6224..6619) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282467.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(6697..7458) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107784.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(7500..8126) product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578309.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(8142..8459) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615777.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(8456..8755) product DUF4651 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013971.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(9084..10061) product N-acetylmuramoyl-L-alanine amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181146406.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(10180..11787) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105242.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(12104..12694) product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418402.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene rpoE CDS complement(13155..14006) product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989683.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(13999..15816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(15896..18547) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032177.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(18540..19118) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550037.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(19118..19678) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124550.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(19957..20352) product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038635.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 20571..20876 product DUF898 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918611.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(20919..21173) product DUF1912 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119707.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(21183..22517) product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227369.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(22517..22750) product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368739.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(22965..23147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522939.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(23149..23928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045612809.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(24079..24429) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273595.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene rbfA CDS complement(24680..27466) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039230.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene infB CDS complement(27483..27782) product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041387.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(27775..28068) product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857562.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(28090..29214) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032286.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene nusA CDS complement(29269..29748) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972449.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene rimP CDS complement(29875..30510) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266098.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene trmB CDS complement(30507..31301) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000363002.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(31349..32398) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653770.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(32395..33126) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889954.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 33194..33604 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278316.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 33614..33892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777756.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 33962..34615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(34693..35829) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972447.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene dnaJ CDS complement(36291..38114) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034682.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene dnaK CDS complement(38373..38888) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046026.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene grpE CDS complement(38915..39949) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255759.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene hrcA CDS complement(40110..40622) product DUF2812 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608738.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(40657..41232) product DUF2812 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412258.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(41232..41552) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045612791.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 misc_feature complement(41710..>42449) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836658.1:LPXTG-anchored SHIRT domain periscope protein locus_tag LOCUS_03680 sequence05 source 1..773 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(75..148) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA complement(160..245) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA complement(253..324) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA complement(352..424) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA complement(436..519) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA complement(524..596) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA complement(621..693) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA complement(696..768) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 sequence06 source 1..462 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence07 source 1..285 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence08 source 1..6481 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_036095565.1:isopeptide-forming domain-containing fimbrial protein locus_tag LOCUS_03690 CDS 2556..4370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 sequence09 source 1..475 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 111..184 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 sequence10 source 1..235 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence11 source 1..2012 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(34..279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(312..968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(952..1218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 sequence12 source 1..331923 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..695 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011837269.1:SpaA isopeptide-forming pilin-related protein locus_tag LOCUS_03740 CDS 1288..4650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 4857..5597 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837270.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 6130..7086 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867029.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 7070..7627 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045606009.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 7620..7874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361076.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 7886..9940 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421662.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 9970..10830 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233700.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(10870..11898) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090135.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene queA CDS 12045..12752 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864623.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 12827..13342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 13422..13598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 13663..14625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 14762..15697 product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162927913.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene hprK CDS 15690..16478 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886648.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene lgt CDS 16479..16862 product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895039.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 16878..17276 product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517381.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 17350..18480 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170096.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene hemW CDS 18485..19222 product acyl-[acyl-carrier-protein] thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009660378.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 19233..20006 product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875444.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 19996..20613 product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850480.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 20834..21235 product Spx/MgsR family RNA polymerase-binding regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631262.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 21236..21514 product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041974.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 21504..22277 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444050.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 22278..23582 product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160248.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 23793..24671 product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020903179.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 24671..25588 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070903.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene pstC CDS 25578..26462 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543046.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene pstA CDS 26473..27276 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049846.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene pstB CDS 27289..28047 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656571.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene pstB CDS 28059..28712 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946456.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene phoU CDS 28869..29684 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837379.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(29704..30975) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744842.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 31121..31852 product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360301.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene budA CDS 31862..32614 product YhfC family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152243.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 32726..33631 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111588.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene murB CDS 33792..34949 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742913.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 34930..35736 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753801.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 35733..36506 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712742.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 36503..37573 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737955.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 37831..38316 product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847054.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 38338..40956 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811741.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene alaS CDS complement(41043..42491) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181049.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 42764..43927 product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079973.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 43924..44601 product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767783.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene aroD CDS 44591..45445 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762485.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 45464..46531 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702164.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene aroB CDS 46541..47707 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269860.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene aroC CDS 47717..48820 product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140860.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 48831..49169 product YlbF/YmcA family competence regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065990.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 49260..50543 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769891.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene aroA CDS 50536..51012 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151377.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 51009..51857 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686443.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene pheA CDS 51854..53149 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032335.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 53293..54129 product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062005.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 54126..55094 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383750.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 55103..57256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 57260..57976 product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062172213.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 58157..60670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(60716..62194) product type IV teichoic acid flippase TacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835918.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene tacF CDS 62317..63057 product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782679.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene mecA CDS 63204..64490 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216350.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 64492..65361 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692438.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene thrB CDS 65437..65559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 65620..66558 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818187.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene msrB CDS 66618..68342 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681715.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 68344..70092 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828825.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 70192..71451 product TRZ/ATZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049551703.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 71687..72187 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836923.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene rplJ CDS 72262..72630 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196965.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene rplL CDS 72890..76474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 76728..77630 product DUF2268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836465.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 77693..78061 product EXLDI protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836466.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(78222..78707) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836468.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(78739..80085) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199534.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene gdhA CDS 80291..81226 product dihydroorotate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255183.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 81259..82296 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879657.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene holA CDS 82366..82971 product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974746.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene sodA CDS 83127..83657 product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224356.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 83678..84763 product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804758.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene rlmN CDS 85246..86787 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025381.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(86830..87069) product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897142.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(87097..87903) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731912.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 88121..88393 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268760.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene rpsP CDS 88413..88652 product RNA-binding protein KphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379628.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene kphA CDS 88695..89039 product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972493.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 89029..89580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 89654..90172 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105899.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene rimM CDS 90159..90881 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686918.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene trmD CDS 90893..91231 product ATP cone domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196049.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(91259..91579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269557.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 91683..91901 product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807422.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(91935..92492) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896832.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 93070..97479 product Cna B-type domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837563.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(97566..98102) product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709036.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(98246..99592) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209604.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene gor CDS 99859..101043 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181146404.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 101027..101725 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811475.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 101727..102986 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180390.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 103122..105119 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291370.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene metG CDS 105157..106269 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936854.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 106269..106979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(107449..107913) product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057440.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene tnpA CDS complement(108242..108703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 note possible pseudo, frameshifted CDS complement(108690..108881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 note possible pseudo, frameshifted CDS complement(109040..109330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205008888.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(109409..109942) product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684205.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(109995..110231) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274000.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene rpsT CDS complement(110299..111219) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180515.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene coaA CDS 111421..111825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698121.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 112038..112619 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061759014.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 112616..113893 product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202961.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 113913..114575 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773709.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene deoC CDS 114562..114951 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246086.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 115042..116097 product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036137.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 116234..117769 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929819.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 117762..118820 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770055.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 118823..119779 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029122.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(119814..120452) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628796.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene plsY CDS 120591..122534 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037270.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene parE CDS 122547..123023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 123899..124783 product aminoglycoside 6-adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837003.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 125034..127478 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770066.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene parC CDS 127609..128631 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219008.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 128744..128974 product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037095.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 tRNA 129023..129105 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 129113..129184 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 129350..130552 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001631.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene rpsA CDS 130635..131132 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893978.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 131132..132790 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283801.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene dnaX CDS 132818..133012 product DUF3272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041547.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 133164..133934 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114489.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene sufC CDS 133962..135224 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196409.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene sufD CDS 135235..136461 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887749.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 136448..136888 product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218481.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 136946..138358 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797050.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene sufB CDS 138504..138947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505543.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 note possible pseudo, internal stop codon CDS 139158..139454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 note possible pseudo, internal stop codon CDS 139476..140555 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020311.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 note possible pseudo, internal stop codon CDS complement(140578..141426) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592064.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 141568..142404 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161407.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 142512..142787 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284640.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(142917..143903) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204727.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 144097..146565 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154041.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene gyrA CDS 146565..147320 product sortase SrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078841.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene srtA CDS 147520..148317 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254797.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 148468..149748 product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196324.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 149843..151117 product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002635.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 151114..152007 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013236.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene truB CDS 152120..152758 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181374.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene udk CDS 152887..154227 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417503.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene xseA CDS 154205..154417 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043230.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 154414..155289 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743809.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 155282..156097 product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041048.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 156090..156521 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034414.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 156528..158195 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923602.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene recN CDS 158196..158924 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133353.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 159003..160826 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047207.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene lepA CDS 160967..161590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837046.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 161671..162519 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705314.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene dprA CDS 162637..164724 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179617.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene topA CDS 164831..165190 product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237219.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 165284..165916 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638785.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 165960..166616 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461590.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 166931..168493 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261080.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 168505..169542 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162527.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene leuB CDS 169560..169808 product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762428.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 169812..171194 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907585.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene leuC CDS 171204..171797 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410624.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene leuD CDS 171822..172601 product translation factor Sua5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160519.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 172757..174472 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083683.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 174459..175763 product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174705273.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 175937..176923 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931162.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 tRNA 176990..177063 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 177246..177944 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661489.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene rnc CDS 177935..181474 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280953.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene smc CDS 181618..182568 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587430.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 182704..183477 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964806.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 183486..184538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(184690..185505) product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617850.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(185502..186407) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123632.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(186408..186539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 186670..188799 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972513.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 188786..189229 product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778583.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 189289..189561 product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085044.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 189671..191362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 191373..192095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 192099..193190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 193605..194363 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173372.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 194365..196353 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489404.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(196393..197088) product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005264.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 197294..198085 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153023.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 198085..198903 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763459.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 198907..200208 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522324.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene ftsY CDS complement(200253..201740) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096129.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene zwf CDS complement(201890..202630) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096316.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(202630..204795) product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726269.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 204976..206964 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000607031.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene uvrB CDS 206981..207484 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216018.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 209107..209550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837074.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 209574..210041 product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091534.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(210038..210553) product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159176.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(210565..211092) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097388.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(211626..212189) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747412.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(212173..212724) product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284128.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene coaC CDS complement(212736..213425) product phosphopantothenate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699485.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene coaB CDS 213654..215324 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845292.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 215508..217799 product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992872.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene pcrA CDS 217842..218522 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286917.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene radC CDS complement(218519..219208) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743346.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(219224..219865) product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653421.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(219948..220169) product DUF4649 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061759713.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(220170..220517) product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863538.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(220522..221637) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770190.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(221647..222606) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283813.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(222718..223287) product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681283.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 223416..224087 product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171682.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 224071..224889 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799053.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 224886..225782 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209981.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 225826..226800 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451584.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene pta CDS 226883..228061 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886145.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene mutY CDS 228118..228825 product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722073.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene yycF CDS 228818..230167 product cell wall metabolism sensor histidine kinase VicK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593410.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene vicK CDS 230169..230978 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004959.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 231086..232957 product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963214.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 232957..236208 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143843.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(236243..236590) product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434642.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(236702..238420) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121684.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 238829..239983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 240062..241963 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584880.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 241967..242263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 note possible pseudo, internal stop codon CDS 242360..242830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 note possible pseudo, internal stop codon CDS 242911..244089 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083034.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 244179..246137 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042582.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene ligA CDS 246289..248574 product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283052.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene pulA CDS 248771..250195 product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199377.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 250468..252363 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358393.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene glgB CDS 252521..253663 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787248.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 253653..254792 product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687025.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene glgD CDS 254789..256222 product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697284.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene glgA CDS 256281..256925 product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084504.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene serB CDS 256935..258050 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706392.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(258047..258493) product DUF1694 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131073.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 258656..259960 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022818.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene eno CDS 260089..260583 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031472.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 260789..261622 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837044.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 261807..262721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837043.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 262848..263390 product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140224180.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 263675..264178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903442.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 264265..264681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 265022..266311 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836379.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 266321..267415 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009014330.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 267508..268239 product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499433.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 268301..268954 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401337.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 268964..269428 product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135770.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 269441..270709 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924530.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 270751..272091 product sodium-coupled multidrug efflux MATE transporter PdrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284947.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene pdrM CDS 272271..273239 product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105362.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 273256..274248 product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448721.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 274697..275740 product dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752705.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 275785..277491 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162912.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene lpdA CDS 277684..278673 product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873993.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 278778..279419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836964.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(279498..280568) product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817882.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene xerS CDS complement(280708..280998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(280979..281371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(281353..282606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(282606..283028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749954.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(283070..283279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(283233..283406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(283406..283849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749954.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(283850..284074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(284074..284508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749954.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(284550..284915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(284915..285352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749954.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(285453..285875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(286150..286389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(286824..288374) product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392584.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(288387..289166) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201105.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(289153..290004) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201307.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene ylqF CDS 290221..290436 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098944.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 290420..290776 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125656.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(290810..291988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174759.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(292006..295659) product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802630.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene addA CDS complement(295656..298931) product ATP-dependent nuclease subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972512.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene rexB CDS complement(299038..299457) product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836390.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(299450..299911) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836391.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 300058..300867 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593576.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 301010..301918 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859641.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 301929..302681 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581961.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(302720..303598) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221056.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(303598..304296) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101108.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(304403..305140) product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837282.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(305285..306160) product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246756.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene aguB CDS complement(306170..307255) product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969442.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene aguA CDS complement(307252..308379) product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764364.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene nspC CDS complement(308379..309638) product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088780.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(309635..310495) product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366713.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene speE CDS complement(310496..311956) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661024.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(312579..313133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681650.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(313324..314037) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759786.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(314041..314352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420551.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(314472..316214) product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900063.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(316391..316882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002937118.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(316946..317827) product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710090.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(318008..318370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836497.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(318409..318702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(318712..319170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(319333..320001) product DUF443 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006145684.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(320055..320726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836771.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(320961..321350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(321380..322234) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900020.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(322275..322892) product SAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262591.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(323360..323593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(323668..324168) product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403325.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(324193..325167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(325294..325671) product immunity 22 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431156.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(325766..326164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(326161..326430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(326547..326936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(326933..327334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(327369..327566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(327614..328150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(328154..328330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(328405..328899) product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403325.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(329009..330268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(330572..330907) product DUF2185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061130545.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(330894..331436) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837064.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(331450..331923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 sequence13 source 1..277 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence14 source 1..4337 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(209..505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(612..776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(728..1027) product DUF4176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899314.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(1283..1930) product DUF443 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006145684.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(1982..2638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(2733..3389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 sequence15 source 1..349 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence16 source 1..328 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence17 source 1..1308 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(28..252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(269..832) product type VII secretion system immunity protein YqcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967790.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene yqcF CDS complement(853..1308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 sequence18 source 1..742 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence19 source 1..1016 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(36..413) product immunity 22 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451792.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(436..993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 sequence20 source 1..618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence21 source 1..595 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence22 source 1..456 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence23 source 1..61991 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 24..97 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 306..542 product sigma(X)-activator ComW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941921.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene comW CDS 736..2070 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972411.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 2271..2738 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386764.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene tadA CDS 2927..3370 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701987.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 3372..3911 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691249.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 4063..5286 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075213698.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene radA CDS 5359..5853 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001809263.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 6067..7035 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010163.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 7155..7592 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076491.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(7621..8508) product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009146.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 8513..8635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 8783..9952 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366378.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 9949..10719 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616166.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene recO CDS 10716..11708 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717437.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene plsX CDS 11714..11950 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136448.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 12391..12579 product class IIb bacteriocin, lactobin A/cerein 7B family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180818.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 12597..12764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 12774..12962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 13397..15550 product peptide cleavage/export ABC transporter ComA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668317.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene comA CDS 15563..16912 product competence pheromone export protein ComB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801593.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene comB CDS 17080..17787 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043282.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 17844..21569 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361236.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 21582..23024 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220607.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene purF CDS 23068..24090 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284592.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene purM CDS 24087..24632 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717511.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene purN CDS 24633..26195 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166538.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene purH CDS 26316..27581 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772240.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene purD CDS 27782..28273 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165488.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene purE CDS 28260..29351 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002926478.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene purK CDS 29452..29643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 29806..31695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 31712..33010 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972422.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene purB CDS complement(33068..36823) product LPXTG-anchored beta-N-acetylhexosaminidase StrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679939.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene strH CDS complement(37126..37851) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972423.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 38164..39951 product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196523.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 39948..40424 product PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156967.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 40451..41356 product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617011.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 41343..42164 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185298.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 42168..42572 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167449.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 42677..43843 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903539.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 43827..44849 product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229114.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene lacD CDS 44995..46032 product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649427.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 46143..46997 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109290238.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 47311..47883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 47885..48547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 48669..49340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 49343..49999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 50076..50633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 50833..51090 product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185155.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(51312..51608) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904590.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(51958..52263) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365287.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 52438..53001 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836974.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 53274..54509 product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899577.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 54937..55653 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262755.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 55655..56737 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219926.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 56777..57400 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262757.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 57434..57661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 57685..58449 product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614984.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 58483..59862 product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897705.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 59876..60541 product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283896.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 60696..61883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 sequence24 source 1..375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence25 source 1..297 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence26 source 1..330 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence27 source 1..333 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence28 source 1..242 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence29 source 1..295 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence30 source 1..297 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence31 source 1..228 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence32 source 1..310 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence33 source 1..254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence34 source 1..50861 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(86..520) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355907.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(533..1993) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031057.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene gltX CDS complement(2121..3470) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018268.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(3639..4328) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138350.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(4468..6234) product multidrug efflux ABC transporter subunit PatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859877.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene patB CDS complement(6236..7978) product multidrug efflux ABC transporter subunit PatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908161.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene patA CDS 8149..9165 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415108.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 9187..10086 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202229.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene galU CDS complement(10207..10887) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658498.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(10871..11410) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834333.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(11422..12552) product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886120.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(12622..13320) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127466.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene dapD CDS complement(13405..14181) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001812545.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(14394..16895) product penicillin-binding protein PBP1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180963.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene pbp1b CDS 17036..18292 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546887.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene tyrS CDS complement(18370..20430) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008794.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(20432..20710) product DUF6110 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910909.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 20862..21710 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095525.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(21773..24031) product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950133.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene glgP CDS complement(24056..25573) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747274.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene malQ CDS 26048..27319 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095472.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 27446..28738 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414968.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 28740..29582 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065643.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 29763..30563 product DUF1189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938246.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 30573..31559 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145423.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 31782..32825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380253.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 32803..33186 product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866321.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 33188..33709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(33786..34727) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806274.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(34705..36468) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830900.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene aspS CDS complement(36620..36838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832180.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(36857..37498) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771241.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(37508..38209) product DUF3169 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730279.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(38224..38574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(38571..38774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046144.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(38774..38977) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176227.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(39124..40404) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775873.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene hisS CDS 40572..40913 product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001204051.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(40974..42677) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137348.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene ilvD CDS 42908..43090 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290417.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene rpmF CDS 43106..43255 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265622.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene rpmG CDS 43817..44713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(45220..45432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(45499..45690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(45691..45978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(46092..46340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(46392..46607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(46683..46865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(47689..48300) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092756.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene rpsD CDS complement(48503..49537) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836930.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(49534..50232) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836929.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 misc_feature complement(50313..>50861) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836928.1:YSIRK signal domain/LPXTG anchor domain surface protein locus_tag LOCUS_08230 sequence35 source 1..461 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence36 source 1..710238 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(496..1152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(1149..1442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(1444..1845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(1952..6400) product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966969.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene essC CDS complement(6390..7580) product type VII secretion protein EssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966970.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene essB CDS complement(7577..7825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(7825..8310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(8409..11867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(11933..12226) product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966973.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(13056..13547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002937118.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(13568..13729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(13842..14252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(14269..15018) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836451.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(15166..16521) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914611.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene rlmD CDS complement(16594..17568) product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227739.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(17655..18230) product cell wall hydrolase Pmp23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476388.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene pmp23 CDS complement(18257..19231) product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356089.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(19239..20495) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575502.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(20545..20976) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942936.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(20978..21580) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084873038.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(21564..22400) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761857.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene prmC CDS complement(22400..23479) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028801.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene prfA CDS complement(23476..24066) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068144.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 24189..24371 product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117401.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 24506..25879 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632770.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene mnmE CDS complement(25926..26861) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121621.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene dapA CDS complement(26918..27994) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542465.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 tRNA complement(28384..28456) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(28562..29074) product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737071.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 29197..29634 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742997.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 29708..30094 product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910203.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene mscL CDS complement(30136..31230) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709260.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene hemH CDS complement(31308..32180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(32256..33188) product FCT-2 pilus polymerization class B sortase SrtC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921812.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene srtC1 CDS complement(33274..34494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(34539..35090) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460443.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene lepB CDS complement(35090..37681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 38040..39263 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222027.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene pepT CDS complement(39300..42347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(42361..43278) product zinc-binding lipoprotein AdcAII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744526.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene adcAII CDS complement(43474..46011) product pneumococcal-type histidine triad protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061588157.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(46265..47998) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138135.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene ptsP CDS complement(48004..48267) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146947.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 48630..48848 product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259249.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene nrdH CDS 48929..51088 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523239.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene nrdE CDS 51283..52245 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084433.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene nrdF CDS 52383..53150 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917572.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(53191..54597) product 6-phospho-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169251.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene lacG CDS complement(54682..56376) product lactose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037305.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(56376..56693) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078324.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(56729..57565) product transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285698.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(57802..58782) product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229114.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene lacD CDS complement(58784..59713) product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604263.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(59724..60239) product galactose-6-phosphate isomerase subunit LacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216917.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene lacB CDS complement(60270..60695) product galactose-6-phosphate isomerase subunit LacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018897.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene lacA CDS complement(60982..61878) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234196.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(61986..63461) product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382512.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(63516..63821) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590549.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(63859..64335) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521979.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(64526..65215) product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643965.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(65227..66105) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791851.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(66107..66964) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770150.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(66981..68003) product ribitol-5-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609910.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(68008..68715) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638485.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 69155..69454 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981526.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(69496..71259) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020901749.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(71268..71861) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440246.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(71943..72437) product chromosome segregation protein RocS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021242.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene rocS CDS complement(72514..73206) product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689784.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(73222..73533) product cell wall synthase accessory phosphoprotein MacP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517865.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene macP CDS complement(73545..74090) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393827.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(74100..75479) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073746.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene glmU CDS 75635..76435 product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231219.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 76539..77384 product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954113.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 77384..77866 product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085921.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 77866..78489 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780836.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 78628..80118 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102460.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene lysS CDS complement(80193..81032) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182488.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(81048..81677) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891752.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(81688..82329) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120830.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(82718..84517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(84809..86038) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065939.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(86028..87194) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435446.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 87339..88352 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665633.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(88387..88806) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068046.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(88817..90223) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094352.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene atpD CDS complement(90309..91187) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301214.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(91203..92708) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996630.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene atpA CDS complement(92723..93259) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359036.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(93259..93753) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558549.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene atpF CDS complement(93767..94483) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392858.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene atpB CDS complement(94518..94718) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054559.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(94949..95260) product CHY zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899964.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(95275..96561) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169063.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(96699..97397) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936183.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 97538..99100 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065723.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene guaA CDS complement(99173..100744) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863638.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene ffh CDS complement(100756..101088) product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402066.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(101233..102429) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040724.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene tuf CDS complement(102665..103774) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488875.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 103903..105120 product D-alanyl-D-alanine carboxypeptidase PBP3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720654.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene pbp3 CDS complement(105150..105695) product thiol-disulfide oxidoreductase-associated lipoprotein SdbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757379.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene sdbB CDS complement(105708..106415) product thiol-disulfide oxidoreductase-associated membrane protein CcdA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447993.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene ccdA2 CDS complement(106541..107401) product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631543.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(107417..108694) product CBS-HotDog domain-containing transcription factor SpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033830.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene spxR CDS complement(108687..109238) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028733.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(109254..110513) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227097.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(110673..112178) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042795.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene pyk CDS complement(112245..113252) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820885.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene pfkA CDS complement(113333..116434) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561518.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 116848..119130 product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212040.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(119118..119300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 119651..120121 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043026.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(120157..120321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001808548.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(120331..121641) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061648.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene obgE CDS complement(121713..121847) product DUF4044 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863857.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(121877..122065) product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256254.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(122086..123411) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219424.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(123420..124463) product alpha-galactosylglucosyldiacylglycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181146631.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene cpoA CDS complement(124576..124905) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331925.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(124920..126029) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201898.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene rpoD CDS complement(126032..127792) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227864.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene dnaG CDS complement(127989..128747) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125436.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(128744..129610) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004234420.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(129676..130671) product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792147.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene trpX CDS complement(131102..133798) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058155.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene ppc CDS complement(133822..134940) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703358.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(135233..136174) product peptidylprolyl isomerase PrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727935.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene prsA CDS complement(136242..136955) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972506.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(136957..138759) product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244122.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene pepF CDS complement(138778..139734) product competence protein CoiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495911.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene coiA CDS complement(139811..140959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(141137..141997) product SAM-dependent methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413776.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene tehB CDS complement(142012..142479) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051750.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene smpB CDS complement(142442..144796) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654897.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene rnr CDS complement(144890..145123) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282517.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene secG CDS complement(145312..146511) product multidrug efflux MFS transporter PmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136147.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(146498..147103) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516169.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene coaE CDS complement(147103..147927) product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114617.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene mutM CDS complement(147976..148875) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143256.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene era CDS complement(148892..149287) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378153.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(149268..149765) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275156.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene ybeY CDS 149870..151525 product Rqc2 family fibronectin-binding protein PavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006748.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene pavA CDS complement(151725..152456) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357686.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(152612..153322) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972499.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene deoD CDS complement(153796..154506) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862846.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(154511..155320) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143370.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(155317..155877) product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199111.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(155879..157090) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033130.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(157114..157797) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429264.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene rpiA CDS complement(157903..158832) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411174.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(158958..159638) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674912.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(159652..160707) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900595.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 161094..161378 product DUF3270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145228.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(161443..162780) product two-component system sensor histidine kinase CiaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491790.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene ciaH CDS complement(162770..163444) product two-component system response regulator CiaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590640.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene ciaR CDS complement(163554..166100) product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149118.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(166222..166662) product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045611364.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(166659..167507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245814.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(167485..167985) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403613.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(167996..168694) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198457.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(168687..168923) product DUF2829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002874474.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(169015..170058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(170226..172478) product endo-beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757725.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene lytB CDS complement(172589..173527) product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181146586.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(173538..174338) product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070078.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(174585..174965) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157153.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(175063..177834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(177848..179512) product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104950.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(179686..180045) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124830.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene rplT CDS complement(180097..180297) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263327.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene rpmI CDS complement(180330..180887) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466297.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene infC CDS complement(181080..183320) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942437.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(183304..183954) product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387330.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(184021..184590) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443760.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 184767..185879 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905011.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene ald CDS complement(185930..186916) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658206.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(186997..187212) product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232084.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(187209..187814) product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263641.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(187826..188680) product RNA-binding virulence regulatory protein CvfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095453.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene cvfB CDS complement(188740..189297) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262225.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene frr CDS complement(189306..190043) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002996.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene pyrH CDS complement(190127..191461) product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083709.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene trmFO CDS complement(191595..192473) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166880.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene rsmI CDS complement(192476..192793) product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358228.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene yabA CDS complement(192830..193720) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806711.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(193717..194355) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033364.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene tmk CDS complement(194476..195273) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689692.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene proC CDS complement(195277..196539) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254686.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(196549..197658) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120718816.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene proB CDS complement(197760..198659) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403233.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(198643..199110) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745389.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene lspA CDS complement(199107..200015) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025693.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(200248..200541) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916509.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene rpmA CDS complement(200558..200902) product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613699.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(200918..201232) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109141.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene rplU CDS complement(201424..202104) product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509042.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 202260..203237 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915911.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 203234..204316 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850560.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(204341..204718) product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001813593.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 204790..206097 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003489.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 206107..206913 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023518.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene yidA CDS complement(207014..207490) product Imm6 family immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897461.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(207523..208017) product Imm6 family immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897459.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(208081..208407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(208425..209312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(209313..209474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(209563..210444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(211163..211585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(211597..212019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(212089..212643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(212664..212897) product Imm74 family immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989359.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 213305..213484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 213728..213976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10360 tRNA complement(213991..214062) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(214105..214452) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068669.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene rplS CDS complement(214571..214900) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237398.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene crcB CDS complement(214894..215268) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712093.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene crcB CDS complement(215265..215531) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362440.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(215649..216092) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162128.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 216196..217140 product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401775.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 217248..218117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 218281..218523 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710764.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(218641..219975) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100445.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(220520..223696) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126083.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene carB CDS complement(224145..225224) product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166701.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(225259..226197) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293842.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(226216..226737) product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850021.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene pyrR CDS 226784..226918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(226949..227578) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244448.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene nth CDS complement(227579..228121) product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773210.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 228289..228618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389565.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 228958..230517 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140224042.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(230562..231461) product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895747.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene htpX CDS complement(231463..232023) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219822.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 232117..232830 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801941.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene rsmG CDS 233302..234585 product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208912133.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(234630..235535) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071680.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(235544..236479) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872230.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(236476..237201) product CppA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102216.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(237312..238181) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348128.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(238339..239505) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108625.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(239518..240258) product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019252.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(240279..241103) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076720.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(241240..242454) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200061.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene thiI CDS complement(242463..243605) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638923.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 243743..244168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045611899.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(244213..246441) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020902321.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(246606..248558) product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701411.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(248555..249466) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640779.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene pfkB CDS complement(249463..250206) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920629.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 tRNA 250364..250453 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(250622..251581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756234.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 tRNA complement(251660..251749) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tmRNA complement(251823..252167) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(252226..252861) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290661.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(252863..253690) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152854.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(253714..255033) product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140834638.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 255189..255800 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272956.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene def CDS 255845..256573 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855753.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene rlmB CDS complement(256610..257521) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272302.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene trxB CDS complement(257587..257811) product DUF4059 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926599.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(257889..258632) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590982.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(258632..259432) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103449.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(259589..259945) product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889093.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(259958..260473) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170334.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(260470..260964) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405853.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 261099..261545 product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648279.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 261542..262189 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098000.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(262209..262790) product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689963.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene pdxT CDS complement(262791..263666) product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138517.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene pdxS CDS complement(263924..265303) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036771.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 265611..266540 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131397.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 266559..267164 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915944.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 267182..268426 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673679.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(268510..268767) product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371287.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(268809..270845) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164753.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene glyS CDS complement(271105..272022) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038753.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene glyQ CDS complement(272234..272605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(272923..277434) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140224017.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(277724..278566) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099678.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(278648..279988) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361602.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(280141..281868) product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064821.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene ezrA CDS complement(281949..283895) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134035.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene gyrB CDS complement(283909..284481) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001809365.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(284933..289660) product glycoside hydrolase family 70 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836622.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(289747..290610) product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002911924.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(290984..291538) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241407.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(291549..292772) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830659.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(292778..295270) product bifunctional DnaQ family exonuclease/ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848727.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(295467..296318) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863093.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(296375..297148) product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902604.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(297153..298010) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192079.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(298159..298479) product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681704.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(298513..299247) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140955.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(299247..299930) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011637.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 300122..300352 product DUF1797 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443570.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 300592..302850 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882502.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(302893..303507) product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900899.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(303562..304464) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900902.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 304641..305093 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013084.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 305152..305451 product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767189.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(305513..306709) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003914.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene metK CDS complement(307050..308429) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836899.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(308672..310015) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010998.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(310147..310962) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670818.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(311014..313200) product PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974066.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(313419..314345) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625552.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene ftsX CDS complement(314338..315030) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022265.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene ftsE CDS complement(315048..316037) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015511312.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene prfB CDS complement(316254..316910) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268673.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(317323..318033) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062202.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(318033..318797) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185996.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(318797..319753) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662291.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(319757..320626) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941421.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(320746..321906) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726149.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(321995..322264) product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462119.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(322343..322933) product ATP-dependent Clp protease proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613465.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene clpP CDS complement(323107..323757) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515974.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene upp CDS complement(323825..324292) product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136976.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(324311..324868) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004134.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 324993..325838 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219921.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 325896..327077 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680058.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 327091..327612 product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400054.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 327622..328077 product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001861299.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(328106..328846) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274793.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 329205..330545 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120718877.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(330587..331531) product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294309.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene manA CDS complement(331651..333090) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836484.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(333221..333481) product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291476.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(333703..335478) product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191821.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene spxB CDS complement(335805..338027) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136296.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(338037..338408) product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935061.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(338419..338817) product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167201.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 339181..339972 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221739.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene thiD CDS complement(340020..340652) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078223.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene thiE CDS complement(340645..341448) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155185.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(341448..341972) product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225550.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene thiW CDS complement(341976..342668) product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397212.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene tenA CDS complement(342679..343329) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241371.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(343331..344716) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522108.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(344717..345277) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915286.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(345682..346818) product L-lactate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120714.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene lctO CDS 347028..347708 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384107.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 347668..348345 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154147.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 348346..349104 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005008.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 349116..349982 product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765262.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(350045..350677) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170919.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene pyrE CDS complement(350711..351412) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206741.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene pyrF CDS complement(351641..352804) product cell division protein DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031166.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene divIB CDS complement(352814..353872) product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724838.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(353874..355226) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863054.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene murD CDS complement(355344..355598) product DUF3165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262800.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(355618..357459) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164101.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene typA CDS 357618..358343 product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235024.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(358384..358644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(358731..359111) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259256.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(359108..359368) product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051787.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 359444..360352 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222592.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 360398..362197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(362229..362540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734653.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(362767..363666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(364074..370562) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750085.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(370992..371777) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760733.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(371779..372597) product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594188.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(372599..373591) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240801.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(373964..374911) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698052.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(375026..375907) product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019003.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(376047..377375) product sensor histidine kinase VncS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831353.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene vncS CDS complement(377372..378028) product response regulator transcription factor VncR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697960.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene vncR CDS complement(378171..379550) product ABC transporter permease subunit Vex3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902984.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene vex3 CDS complement(379601..380248) product ABC transporter ATP-binding subunit Vex2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173746.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene vex2 CDS complement(380261..381538) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 tRNA complement(381931..382016) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(382097..382672) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158722.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(382672..383460) product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940734.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene codY CDS complement(383745..385319) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671233.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 385668..386984 product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958961.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 387084..388427 product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050251.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 388427..389209 product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263194.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 389337..390419 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040927.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(390462..390923) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814973.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(390901..391674) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794772.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(391664..392413) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199179.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene truA CDS complement(392513..393664) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808693.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(393777..394400) product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033951.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(394403..394741) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900178.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(394953..395471) product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014017309.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(395664..396422) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087897.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene tpiA CDS complement(396519..397196) product DnaD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221586.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(397205..398149) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122725.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene metA CDS complement(398331..398843) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897341.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(398930..399688) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287228.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(400172..400861) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085675.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene rplA CDS complement(400959..401384) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085809.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene rplK CDS complement(401507..402223) product LD-carboxypeptidase LdcB/DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747772.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene ldcB CDS complement(402237..402698) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000335623.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(402772..403737) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077252.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 403874..404425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 404710..405267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(405304..406629) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074656.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene brnQ CDS complement(406814..407101) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659158.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(407098..407688) product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078128.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(407742..409142) product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560281.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene pepV CDS complement(409155..409760) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670172.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(409904..410197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(410178..410570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(410552..411769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(411769..412161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(412282..412431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(412433..412843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(413325..413723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(414011..414865) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015782.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(414855..416702) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972569.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene uvrC CDS complement(416804..417505) product M57 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267194.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(417610..418389) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290025.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(418458..420119) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065637.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(420620..421267) product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188880.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(421435..423711) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045612591.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene recJ CDS 423831..424589 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229573.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 424600..425394 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726170.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 425407..426084 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131158.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 426094..426753 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443889.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 426883..427665 product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836388.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(427952..428974) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262915.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(429042..429479) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166793.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(429409..429585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(429645..430586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836887.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(430750..431601) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045611195.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 431797..432171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044012208.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 432957..434900 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608336.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene thrS CDS complement(435053..436102) product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147505.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(436573..436755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(436847..437821) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887976.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(437814..438491) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548991.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 438819..439382 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899842.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 439468..440244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 440356..441429 product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273825.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 441592..442785 product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843701.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 442887..443516 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690854.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(443555..445447) product endopeptidase PepO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140223944.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene pepO CDS 445627..446349 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619149.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 446346..447194 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559786.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 447221..448150 product metal ABC transporter substrate-binding lipoprotein/adhesin PsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733056.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene psaA CDS 448271..448765 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256028.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene tpx CDS 448849..449499 product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188498.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(450051..450494) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691419.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene dtd CDS complement(450524..452740) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123795.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(452879..454009) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229951.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene ugpC CDS complement(454123..454992) product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987098.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(454996..455382) product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567914.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(455375..456718) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972571.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene cysS CDS complement(456736..457257) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301974.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(457266..458030) product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837515.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(458044..458244) product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893782.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(458294..458911) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899011.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene cysE CDS complement(458927..461140) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972572.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene pnp CDS complement(461793..462659) product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089967.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene metF CDS complement(462753..465002) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108255.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene metE CDS complement(465632..465997) product TIGR02328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625408.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(465981..466385) product YbgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429941.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(466467..467243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(467303..467461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(467421..468635) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082538.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(468613..469659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(469805..470566) product DUF6261 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167729.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(470994..473627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 473761..474378 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076168.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(474425..475312) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164310.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(475471..477357) product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064570.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 477735..479189 product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455282.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 479170..480135 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226009.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(480286..481560) product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704388.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(481560..482732) product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151960.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(482851..483306) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972578.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(483308..484066) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392949.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(484153..486054) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614548.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene pknB CDS complement(486051..486791) product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406247.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(486807..488123) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049552196.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene rsmB CDS complement(488113..489048) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163696.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene fmt CDS complement(489061..491457) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020377.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(491523..491837) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979235.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene rpoZ CDS complement(491862..492488) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775041.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene gmk CDS complement(492623..494236) product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404940.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(494440..494694) product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924721.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(494698..494958) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388572.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(495085..496182) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156355.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(496192..496938) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972581.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(497253..497606) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003001.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene rsfS CDS complement(497607..498200) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331228.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene yqeK CDS complement(498200..498829) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963718.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(498880..499191) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060169.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene yhbY CDS complement(499405..500511) product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391188.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene yqeH CDS complement(500514..501041) product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963733.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(501059..501967) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242268.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(502025..502585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 502735..503946 product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020901597.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene sstT CDS 503996..504949 product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028163.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(504986..505210) product accessory secretory protein Asp5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569973.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(505213..505392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(505385..506731) product accessory Sec system glycosylation chaperone GtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571763.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene gtfB CDS complement(506715..508235) product accessory Sec system glycosyltransferase GtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158445.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene gtfA CDS complement(508248..510620) product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489793.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene secA2 CDS complement(510613..511053) product accessory Sec system protein Asp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587537.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene asp3 CDS complement(511050..512579) product accessory Sec system protein Asp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032114.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene asp2 CDS complement(512563..514143) product accessory Sec system protein Asp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291166.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene asp1 CDS complement(514153..515370) product accessory Sec system protein translocase subunit SecY2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161877.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene secY2 CDS complement(515457..516686) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528551.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(516702..517928) product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409544.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 518311..518664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 note possible pseudo, internal stop codon CDS 518918..519364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(526813..528357) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025411.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(528501..529193) product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836665.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 529359..529661 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705421.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene gatC CDS 529661..531127 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143702.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene gatA CDS 531127..532572 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008652.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene gatB CDS 532716..532880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 532886..533602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 533611..534738 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289234.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 534820..535380 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568640.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene efp CDS 535402..535791 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510591.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 535784..536206 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203654.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene nusB CDS complement(537102..537869) product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017399.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(537866..538732) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173353.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene accD CDS complement(538768..540135) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488679.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene accC CDS complement(540147..540569) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565514.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene fabZ CDS complement(540566..541054) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052235.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene accB CDS complement(541057..542292) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774070.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene fabF CDS complement(542321..543052) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175654.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene fabG CDS complement(543098..544018) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167634.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene fabD CDS complement(544011..544985) product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857443.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene fabK CDS complement(545103..545327) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257838.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(545385..546359) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852942.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(546359..546793) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386352.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(546884..547669) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400069.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 547952..549316 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869662.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 549319..549690 product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079344.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 549904..551178 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884218.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene serS CDS complement(551202..552101) product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735971.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(552212..552760) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206776.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(552891..554213) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891501.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(554560..556896) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035051.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(556997..557545) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624506.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(557542..557844) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002023.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene zapA CDS 557931..558812 product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146887.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene rnhC CDS 558816..559430 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004245100.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene lepB CDS 559560..561929 product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454519.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(561977..563260) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116489.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene tig CDS complement(563351..564007) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140834349.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(564008..564640) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698413.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(564651..565649) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743667.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(565646..566344) product cell wall-active antibiotics response protein LiaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224650.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene liaF CDS complement(566698..569217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 569425..569772 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267509.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(569798..570337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 570567..570926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 570930..572099 product type IV secretion system DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837675.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 572096..572713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 572858..574093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 574158..574499 product DUF771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188031.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 574552..575682 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257255.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(575821..576822) product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210637.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene fni CDS complement(576806..577813) product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226748.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(577800..578753) product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373457.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene mvaD CDS complement(578735..579613) product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163300.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene mvk CDS complement(579731..580750) product choline-binding protein CbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771154.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene cbpC CDS complement(580768..581652) product N-acetylmuramoyl-L-alanine amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691497.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(581752..582441) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000518031.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(582453..583877) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158778.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene gndA CDS complement(583953..585398) product mid-cell-anchored protein MapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039255.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene mapZ CDS complement(585411..586568) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711367.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(587054..587383) product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094897.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene gpsB CDS complement(587453..587980) product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179549.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 588047..588643 product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248753.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene recU CDS 588640..590808 product penicillin-binding protein PBP1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041854.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene pbp1a CDS complement(590976..599225) product beta-N-acetylglucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515824.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(599366..605791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(606091..608073) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842604.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 608311..609165 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600899.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene rfbD CDS complement(609226..610272) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009659423.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene rfbB CDS complement(610265..610813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(610817..611410) product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131446.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(611411..612280) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676152.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene rfbA CDS complement(612352..613404) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475868.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(613432..614535) product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272526.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene glf CDS complement(615266..615442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(615548..616963) product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101282.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(617011..618186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476397.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(618582..618932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(618967..619932) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420465.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(619967..620965) product stealth family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225420236.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(620968..622125) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936352.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(622129..623301) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922115.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(623332..624699) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936357.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(624722..625414) product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775429.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(625424..626116) product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922111.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(626125..626856) product capsular polysaccharide biosynthesis protein Cps4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837624.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene cps4B CDS complement(626858..628303) product capsular polysaccharide biosynthesis protein Cps4A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091050.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene cps4A CDS complement(628495..630456) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836902.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(630603..632570) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837407.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(632856..633368) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708322.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(633420..633584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(633637..634602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(634833..635225) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075973.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene rpsI CDS complement(635244..635690) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044624.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene rplM CDS complement(635901..637031) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245373.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(637097..637990) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895282.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(638243..640648) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961516.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene pheT CDS complement(640778..641824) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007519670.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene pheS CDS complement(642097..642747) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653437.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(642737..643300) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185837.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(643713..644216) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140833033.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 644617..645966 product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691690.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene trkA CDS 645970..647409 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976430.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(647498..648427) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291304.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(648438..649505) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159549.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(649514..650440) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103704.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(650440..651936) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759913.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(652003..653982) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749702.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 tRNA 654280..654352 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(654485..655816) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390035.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(655952..656776) product DNA-entry nuclease EndA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036774.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene endA CDS complement(656817..657011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(656998..658281) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411895.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene murA CDS complement(658591..659628) product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972442.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(659612..660100) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280727.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene coaD CDS complement(660090..660527) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706962.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene rsmD CDS complement(660694..661686) product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747996.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene asnA CDS complement(661796..662479) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109987.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(662534..663274) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152674.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 663308..663586 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174613.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 663655..664593 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835951.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene yidC CDS complement(664665..665459) product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288288.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene pflA CDS complement(665581..666837) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856534.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(666904..667707) product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001809310.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene purR CDS complement(667836..668777) product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703195.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(668767..670023) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020901986.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(670025..670687) product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006147.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(670650..671306) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084984.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene rpe CDS complement(671317..672195) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972439.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene rsgA CDS complement(672197..673069) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216839.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene rsmA CDS complement(673066..673401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(673595..674449) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476327.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(674461..675027) product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476328.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene rnmV CDS complement(675032..675616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(675609..676376) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575607.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 676528..678372 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494369.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(678555..678689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(678834..680048) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666469.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(680192..680491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045612741.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 680659..681111 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079154.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(681233..683212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837024.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(683711..685102) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000452107.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 685168..686130 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124787.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(686183..687193) product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090627.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene ccpA CDS 687398..687715 product DUF960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886035.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(687766..689049) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836379.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(689042..689863) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372490.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene folK CDS complement(690022..690576) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380915.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene folE CDS complement(690557..691879) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000657452.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(691881..692825) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491579.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene folP CDS complement(692929..693636) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181146591.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(693690..695108) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359256.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 695296..696108 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162342.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 696392..697381 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021971.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 697457..698269 product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280328.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 698284..699195 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136858.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(699259..701487) product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(701657..702991) product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991674.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene pepC CDS complement(703101..703823) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234916.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(703897..704127) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901567.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(704137..705378) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243934.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(705394..705546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776632.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(705570..709961) product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071439.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 tRNA complement(710137..710210) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 sequence37 source 1..122944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 340..419 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1924..4716) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768092.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene ileS CDS complement(4969..5763) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123190.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(5780..6034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(6043..6834) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032413.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(6831..7091) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576495.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(7091..7621) product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053356.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(7631..8302) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049394.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(8306..9562) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144280.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene ftsZ CDS complement(9579..10949) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090383.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene ftsA CDS complement(11166..11870) product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055251.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(11961..12572) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857991.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(12559..13932) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778743.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(14016..15059) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814687.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(15232..15828) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966756.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene recR CDS complement(15839..17881) product penicillin-binding protein 2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972469.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene pbp2b CDS 18137..18988 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360347.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(19286..20050) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837344.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(20391..21275) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150277.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(21293..22210) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281520.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(22382..23026) product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057475.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(23047..23499) product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575438.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(23945..24784) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192120.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(24800..25696) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001821805.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(25886..27214) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672105.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(27328..28026) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135651.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(28260..31652) product sialidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002875186.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(31988..32968) product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109290171.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(33438..35453) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048745.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene recG CDS complement(35474..36577) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648090.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene alr CDS complement(36567..36935) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080566626.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene acpS CDS complement(36974..38005) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864040.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(38007..39038) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232189.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(39118..41631) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274071.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene secA CDS complement(41747..42517) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836425.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(43083..43604) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028367.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(43840..44706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(44906..45946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(46073..47383) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207696.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene der CDS complement(47397..48110) product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140846.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(48107..49003) product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446509.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene dnaI CDS complement(49004..50167) product replication initiation and membrane attachment family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802376.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(50168..50641) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203672.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene nrdR CDS 50782..51147 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119149.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 51152..51847 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054202.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 51863..52591 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498756.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(52623..53318) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288948.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(53315..53719) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781329.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 53886..54266 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042750621.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 54364..54585 product DUF4649 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570244.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 54601..54915 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029579.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene trxA CDS 55118..55771 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828762.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene queC CDS 55771..56214 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464576.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene queD CDS 56207..56923 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196451.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene queE CDS 56941..57432 product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082587.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene queF CDS complement(57650..58318) product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714865.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(58429..59220) product DUF2785 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284391.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(59282..60064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(60093..61889) product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435576.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene pepF CDS complement(61900..62643) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188180.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(62645..63595) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164555427.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene prmA CDS complement(63626..64381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(64383..65474) product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606740.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(65456..66940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(66975..67445) product DUF3013 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257105.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 67561..68832 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113205.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 tRNA 69096..69171 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 69524..70039 product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836381.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 70733..71878 product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836378.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(72335..73816) product M protein trans-acting positive regulator PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837580.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 74113..74349 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893931.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 74449..75012 product alkaline shock response membrane anchor protein AmaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030213.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene amaP CDS 75023..75193 product DUF2273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905455.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 75205..75789 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002907890.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 75831..76034 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109957.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(76252..76677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837105.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(76843..77094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(77096..77356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(77460..77915) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770492.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 78126..78647 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565010.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(78636..79091) product effector binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836639.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 79170..80069 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898048.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(80159..80935) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127036.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene trpA CDS complement(80928..82151) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331302.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene trpB CDS complement(82129..82728) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169895.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(82715..83482) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076515.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene trpC CDS complement(83479..84483) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658706.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene trpD CDS complement(84494..85060) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601934.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(85057..86418) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439651.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene trpE CDS complement(87018..88196) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836632.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene trpB CDS complement(88531..89757) product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134519.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(89800..90492) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922186.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(90676..92418) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180039.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(92408..94153) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022594.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(94360..94995) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174446.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(94992..95447) product DUF3290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675334.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 95581..96408 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767454.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 96420..96806 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837298.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 97155..97736 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770415.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 97736..98998 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194464.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(99039..100529) product Sau3AI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068548.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 100645..101910 product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183205.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene dcm CDS complement(101955..102359) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651198.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(102429..103916) product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176978.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(103913..104572) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102032.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(104584..105762) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191948.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 105926..106927 product DNA-binding transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212522.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene galR CDS complement(106995..108032) product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836798.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(108033..108386) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022629.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(108649..109518) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645151.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 109651..110205 product TetR/AcrR family transcriptional regulator SczA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181689.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene sczA CDS 110232..110564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(110547..111074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 note possible pseudo, internal stop codon, frameshifted CDS 111147..111842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 111835..112092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 112105..112332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 112320..112481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(112706..113506) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241772.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(113493..114329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(115096..115698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003648228.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(116036..117556) product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182950.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(117549..118277) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575206.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(118292..119056) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836842.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(119060..119503) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836841.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(119647..120573) product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835622.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 121116..122051 product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844501.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene birA tRNA complement(122128..122215) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA complement(122221..122296) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA complement(122328..122400) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA complement(122415..122489) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA complement(122492..122565) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(122577..122666) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(122677..122752) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(122764..122839) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(122844..122917) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 sequence38 source 1..155767 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..6107 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836870.1:ZmpA/ZmpB/ZmpC family metallo-endopeptidase locus_tag LOCUS_16150 assembly_gap 7580..7731 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7763..12667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 12897..13277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836729.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 13511..19024 product ZmpA/ZmpB/ZmpC family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836924.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 19176..19556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 19754..20446 product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240129.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 20739..21008 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018251.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene rpsO repeat_region 21276..21840 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttatcggtcacaattttggagactacaaaaac CDS 22139..22750 product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531723.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 22913..23959 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949317.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 23961..24716 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364113.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 24736..25746 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722885.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 25727..26419 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176178.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(26462..27211) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500205.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 27332..29680 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360053.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 29782..30459 product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624089.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 30446..31243 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881151.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 31260..32363 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049552700.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 32572..33591 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156535.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene galE CDS 33593..34543 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001812943.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 34884..35393 product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181146618.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 35403..36077 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849378.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene cmk CDS 36196..36702 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162455.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 36702..36872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442260.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 36904..38136 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972566.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene clpX CDS 38145..38732 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422605.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene yihA CDS 38742..39122 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140422.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 39174..40064 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163060.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene rapZ CDS 40061..41038 product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231096.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 41035..41946 product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011281.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene whiA CDS complement(41978..42946) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080996.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 43083..43940 product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011063.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene cdaA CDS 43927..44724 product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230939.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 44743..46107 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521461.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene glmM CDS 46181..46555 product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050086.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 46558..47406 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762066.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 47446..48213 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027870.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene dapB CDS 48225..49409 product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162927915.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 49406..51274 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279110.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 51271..51882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(51936..53129) product CDF family manganese efflux transporter MntE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813926.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene mntE CDS 53436..56132 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032453.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 56237..56647 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412237.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 56659..58254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822855.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 58552..59280 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697767.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene yaaA CDS complement(59312..59860) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039607.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(59952..60398) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900138.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 60517..60993 product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747251.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 61003..62181 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777789.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 62334..63677 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167160.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene asnS CDS 63826..64116 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896497.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene rpsF CDS 64128..64598 product single-stranded DNA-binding protein SsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609607.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene ssbA CDS 64630..64869 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068664.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene rpsR CDS 65179..65688 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365476.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 66127..67275 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002911057.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene wecB CDS 67282..68061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896779.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 68071..68211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263106.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 68204..69514 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896777.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 69523..70626 product glycosyl hydrolase family 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901727.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 70749..72149 product bifunctional Cof-type HAD-IIB family hydrolase/peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339039.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 72151..72510 product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689605.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 72564..73313 product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390783.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 73303..73587 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349604.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 73673..74608 product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036043.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 74662..74988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 75111..75623 product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892258.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 75607..76257 product DUF1803 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614471.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 76359..76559 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051182.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(76592..78037) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590307.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 78143..79765 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064185.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 79968..81926 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748873.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 82072..83166 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031966.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 83174..84340 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521356.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 84433..87528 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096278.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 87576..88187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808215.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 88199..89533 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048094.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene murC CDS 89543..90010 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405290.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 90007..90504 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702238.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 90585..92336 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291437.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene mltG CDS 92398..92880 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818760.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene greA CDS 92957..94321 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070842508.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 94421..94831 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273897.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 95029..95238 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001843884.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 95228..95716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247412.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 95833..97293 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283118.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 97290..98114 product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058036.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene nadE CDS 98272..98823 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835659.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 98987..99697 product thiol-disulfide oxidoreductase-associated membrane protein CcdA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379688.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene ccdA2 CDS 99801..100274 product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759257.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 100284..101396 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998594.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene msrB CDS 101467..102204 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222603.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 102201..103892 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831067.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 104002..104565 product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659517.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 104828..106543 product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554830.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene pabB CDS 106662..107942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 note possible pseudo, frameshifted assembly_gap 107685..107778 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 108149..109069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 109195..110154 product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140224290.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 110253..111092 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158639.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(111291..111461) product DUF3042 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051780.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 111558..112466 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850184.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene miaA CDS 112459..113697 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567353.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene hflX CDS 113690..114313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129677.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 114328..115257 product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354338.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene rnz CDS 115278..116033 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142136.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 116284..123522 product LPXTG-anchored adhesin/beta-galactosidase BgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515226.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene bgaA CDS 123937..124305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 124423..124587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 124589..125620 product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075141044.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 125614..125781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 125786..126052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 126075..126209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 126212..126427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 126719..127021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 127040..127903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 127923..131621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 131685..132188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 132261..132485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 132513..133259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 133301..134413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 134475..134696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 134693..135040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 135000..137354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109621.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 137380..140016 product phage tail tip lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774274.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 140036..140680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002395055.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 140677..140949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 140903..141742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 141755..142273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 142270..144069 product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069653754.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 144090..144353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 144344..148681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 148752..149168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 149386..149778 product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861100.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene mobC CDS 149772..151406 product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774278.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 151456..152748 product ISLre2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453221.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 153176..153358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 sequence39 source 1..36581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(35..508) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588897.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(629..1165) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376736.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene nusG CDS complement(1224..1400) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001210991.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene secE CDS complement(1410..1562) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001809375.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene rpmG CDS complement(1615..3810) product penicillin-binding protein PBP2A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762624.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene pbp2a CDS 3897..4772 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044012468.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(4840..5847) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260685.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene gap CDS complement(6167..8818) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972432.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene adhE CDS complement(9114..9527) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429312.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(9514..9957) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737446.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(10005..10334) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069051.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene yajC CDS complement(10454..12430) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067891.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene tkt CDS complement(12548..13171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932649.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(13227..14213) product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260002.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(14228..15061) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538333.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(15030..15401) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739250.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene rnpA CDS complement(15551..16741) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167757.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(16793..17746) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345135.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(17807..18394) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140224612.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(18427..18840) product competence type IV pilus minor pilin ComGG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265622.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene comGG CDS complement(18818..19279) product competence type IV pilus minor pilin ComGF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250521.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene comGF CDS complement(19242..19544) product competence type IV pilus minor pilin ComGE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601737.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene comGE CDS complement(19507..19941) product competence type IV pilus minor pilin ComGD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044012294.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene comGD CDS complement(19904..20227) product comG operon protein ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738641.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene comGC CDS complement(20229..20696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(21193..22134) product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249543.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene comGA CDS complement(22196..22561) product DUF1033 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286392.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(22719..23870) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134457.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene nagA CDS complement(24011..25828) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220867.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(25962..27104) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285239.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene tgt CDS 27221..28078 product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108864.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(28220..29089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(29230..30441) product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746973.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(30607..31227) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172835.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(31231..32511) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473952.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(32572..34056) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177124.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene thrC CDS complement(34132..35409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091371.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 tRNA complement(35593..35678) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(35686..35759) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(35771..35845) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(35858..35930) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA complement(35940..36022) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA complement(36038..36112) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA complement(36115..36188) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(36200..36289) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(36295..36368) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(36378..36453) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA complement(36487..36559) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 sequence40 source 1..3593 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 574..921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 921..1601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 1603..1896 product DUF4176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926393.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 2122..2550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 2563..2856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 2856..3560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910