COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..479182 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 150..260 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 455..531 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 696..1499 product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154870.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene dkgB CDS complement(1520..2434) product DNA-binding transcriptional regulator YafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648539.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene yafC CDS 2539..3714 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127546.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 3846..4646 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230964.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 4724..5494 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207227.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(5550..6770) product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644706.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene mltD CDS complement(6989..7744) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052766.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene gloB CDS 7833..8501 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801233.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(8498..8965) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917872.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene rnhA CDS 9020..9760 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001670675.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene dnaQ tRNA 9894..9970 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(10293..11348) product type VI secretion system ImpA family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402248.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(11359..12102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 12159..12431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 12458..12976 product DUF2778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808301.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 13373..14014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 13936..17253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 17250..17696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(17762..18019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 18354..18587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 18648..18788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 19145..19462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 19459..19926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 20168..20521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(20588..20767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 20955..21164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 note possible pseudo, frameshifted CDS 21377..21655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 note possible pseudo, internal stop codon, frameshifted CDS 22418..22915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 23023..23736 product pili assembly chaperone SafB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691915.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene safB CDS 23760..26270 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669630.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 26292..26762 product AfaD family invasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266939.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene afaD CDS 27170..27991 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119384.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 28806..29753 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970302.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(30092..30811) product adhesin/invasin protein PagN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787614.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene pagN CDS complement(31142..31549) product Spy/CpxP family protein refolding chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000788200.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(31859..32626) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015775.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(32735..35179) product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973055.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene fadE CDS 35419..35997 product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284051.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene lpcA CDS 36210..36977 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333360.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(36948..37688) product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225658.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene dpaA CDS 37938..38993 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226198.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene dinB CDS 39212..40351 product RNA ligase RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528894.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 40348..40962 product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602086.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene prfH CDS complement(41117..42565) product cytosol nonspecific dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292984.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene pepD CDS 42814..43272 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292018.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene gpt CDS 43361..44605 product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189584.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene frsA CDS 44663..45064 product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174696.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene crl CDS complement(45115..46167) product phosphoporin PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043666.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene phoE CDS 46449..47552 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285275.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene proB CDS 47564..48811 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893213.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene proA tRNA 48927..49002 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 49166..49435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 49448..49849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(49774..50073) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169527.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 50140..50508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 50714..51013 product DUF1889 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369626.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 51670..52593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 52725..54146 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene leuC CDS 54148..54774 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972565.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene leuD CDS 54789..55667 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098684.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 55667..56581 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 56615..57580 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367267.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(57525..57797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 58489..58887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(58934..59692) product fimbrial biogenesis chaperone StbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247037.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene stbE CDS complement(59658..60983) product fimbrial usher protein StbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899085.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene stbD CDS complement(60988..63549) product fimbrial outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075318.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(63533..64294) product fimbrial biogenesis chaperone StbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781490.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene stbB CDS complement(64356..64892) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062036.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 65555..66289 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005856.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 66262..66762 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545416.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 67064..68638 product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868284.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 68738..69481 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081360.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 69484..69942 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545416.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 70343..70867 product Ail/Lom family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830239.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 71125..71652 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610820.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 71678..71887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 72035..72304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(72374..73831) product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811956.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene adeC CDS complement(73848..77015) product multidrug efflux RND transporter permease subunit MexQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112892.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene mexQ CDS complement(77012..78238) product multidrug efflux RND transporter periplasmic adaptor subunit MexP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119548.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene mexP CDS 78515..80818 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931165.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 80815..81279 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811033.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene cueR CDS 81357..81551 product gold resistance metallochaperone GolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159469.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene golB CDS 81843..83096 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288510.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 83285..85243 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910350.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 85253..88225 product type III restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689015.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 88720..90123 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393706.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 90120..91130 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151052.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene cydB CDS 91465..92472 product ferrioxamine uptake transcriptional regulator FoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074609.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene foxR CDS 92636..94726 product ferrioxamine B receptor FoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127727.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene foxA CDS complement(94767..95399) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433130.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 95631..95906 product DUF1471 family periplasmic protein YahO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848026.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene yahO CDS complement(96042..97667) product propionate catabolism operon regulatory protein PrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205290.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene prpR CDS 97933..98820 product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052221.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene prpB CDS 98943..100112 product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132750.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene prpC CDS 100150..101601 product bifunctional 2-methylcitrate dehydratase/aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272709.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 101642..103528 product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010226.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene prpE CDS complement(103632..104606) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130724.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene hemB CDS 105119..108133 product autotransporter adhesin EhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181238112.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene ehaB CDS 108219..108842 product hydrogen peroxide resistance inhibitor IprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950094.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene iprA CDS complement(108887..110044) product D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830774.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene ampH CDS 110391..111611 product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477016.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene sbmA CDS 111626..112720 product surface-exposed outer membrane lipoprotein YaiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271423.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene yaiW CDS complement(112758..113066) product YaiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763139.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 113334..113549 product DUF2754 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239240.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(113575..114669) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096588.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene ddlA CDS 114777..115460 product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480796.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 115629..116840 product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446769.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 117131..117397 product anti-adapter protein IraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518423.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene iraP CDS 117746..118066 product phosphate starvation-inducible protein PsiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705165.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene psiF CDS 118293..119270 product diguanylate cyclase AdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484099.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene adrA CDS complement(119285..120094) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412190.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene proC CDS 120234..120689 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158137.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 120874..121419 product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983569.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene aroL CDS 121446..121637 product protein YaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143161.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene yaiA CDS 121888..122565 product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276434.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 122636..122920 product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941953.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene ppnP CDS complement(122958..123881) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964305.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene rdgC CDS 123995..124903 product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219273.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene mak CDS complement(124925..126097) product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326926.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene araJ CDS complement(126270..129410) product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001526312.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene sbcC CDS complement(129407..130609) product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221246.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene sbcD CDS 130824..131513 product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113921.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene phoB CDS 131583..132878 product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893648.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene phoR CDS 133287..134606 product branched-chain amino acid transporter carrier protein BrnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149625.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene brnQ CDS 134621..136051 product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445555.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene proY CDS 136213..138030 product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930730.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene malZ CDS complement(138102..138704) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244731.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(138914..139495) product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009858.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene acpH CDS 139589..140653 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266528.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene queA CDS 140850..141977 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667304.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene tgt CDS 142000..142332 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007628.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene yajC CDS 142393..144207 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934811.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene secD CDS 144218..145189 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046629.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene secF CDS 145334..145699 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793035.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 145725..146417 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198318.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 146587..146934 product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974818.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene yajD CDS 147216..147479 product type I toxin-antitoxin system toxin Ldr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254108.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(147563..148426) product nucleoside-specific channel-forming protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752021.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(148726..149265) product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198480.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 149417..149866 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543535.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene nrdR CDS 149870..150973 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150215.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene ribD CDS 151062..151532 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021372.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene ribE CDS 151553..151972 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801120.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene nusB CDS 152051..153031 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742107.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene thiL CDS 153009..153524 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154063.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene pgpA CDS complement(153628..154602) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199865.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(154659..156521) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006791.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene dxs CDS complement(156545..157444) product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348078.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene ispA CDS complement(157445..157687) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124944.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene xseB CDS 157897..159345 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668658.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene thiI CDS complement(159389..160186) product 2-aminoethylphosphonate ABC transport system, membrane component PhnV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909802.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene phnV CDS complement(160180..161049) product 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052708.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene phnU CDS complement(161052..162161) product 2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928794.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene phnT CDS complement(162167..163180) product 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778002.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene phnS CDS complement(163378..164097) product phosphonate utilization transcriptional regulator PhnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836268.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene phnR CDS 164237..165340 product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203965.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene phnW CDS 165350..166159 product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079741.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(166256..166846) product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275809.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene yajL CDS complement(166809..167720) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705818.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene panE CDS 167846..168337 product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138911.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(168384..169748) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000935.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 170273..171784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 171796..173289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(173371..174261) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971351.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene cyoE CDS complement(174273..174602) product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019878.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(174602..175216) product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179831.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(175206..177197) product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467158.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene cyoB CDS complement(177208..178164) product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239449.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene cyoA CDS complement(178617..180098) product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098484.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene ampG CDS complement(180136..180768) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001539323.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 181018..181335 product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973433.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene bolA CDS 181682..182980 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198406.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene tig CDS 183228..183851 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122257.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene clpP CDS 184103..185374 product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130316.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene clpX CDS 185560..187914 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067728.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene lon CDS 188123..188395 product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043544.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene hupB CDS 188686..190557 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969436.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene ppiD CDS 190707..191081 product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680322.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 191185..191583 product long-chain acyl-CoA thioesterase FadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194543.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene fadM CDS complement(191689..192384) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817201.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene queC CDS complement(192449..194164) product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238179.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 194250..195068 product HMP-PP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113040.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene cof CDS complement(195118..196170) product cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987843.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene cdsH CDS 196286..196744 product DNA-binding transcriptional regulator DecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884593.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene decR CDS 196785..198557 product SmdA family multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235563.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 198550..200331 product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256093.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 200544..200882 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780341.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene glnK CDS 200914..202200 product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684912.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene amtB CDS complement(202300..203160) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084179.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene tesB CDS 203375..203944 product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779802.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(203977..204366) product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961285.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(204597..206147) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213129.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 206372..206632 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801415.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(206834..207304) product YlaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136183.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(207422..207973) product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278793.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene maa CDS complement(208152..208370) product HHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280991.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(208398..208772) product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344807.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene tomB CDS complement(209268..212417) product efflux RND transporter permease AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132507.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene acrB CDS complement(212440..213525) product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039199.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene acrA CDS 213775..214428 product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101755.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene acrR CDS 214553..217909 product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178244.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene mscK CDS complement(217951..218955) product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440515.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(218956..219123) product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051161.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene rsmS CDS complement(219137..219652) product primosomal replication protein N'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844854.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene priC CDS 219733..220110 product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189860.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 220263..220814 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127348.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene apt CDS 220928..222856 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121969.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene dnaX CDS 222902..223231 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 223231..223836 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195023.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene recR CDS 223947..225821 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682145.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene htpG CDS 226179..226823 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220237.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene adk CDS 227052..228014 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250076.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene hemH CDS complement(228011..228982) product acetyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801788.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene aes CDS 229135..230439 product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001766867.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene gsk CDS complement(230488..232164) product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546202.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene ybaL CDS complement(232379..233599) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251598.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 233772..235424 product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095904.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene ushA CDS complement(235541..236020) product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186620.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene ybaK CDS complement(236222..237016) product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421856.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(237102..237929) product DUF1311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488556.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(238083..240584) product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083904.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene copA CDS 240694..241110 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026762.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene cueR CDS complement(241111..241563) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561177.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(241560..242477) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906145.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 242624..243301 product iron ABC transporter ATP-binding protein FetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166987.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene fetA CDS 243288..244067 product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002130.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene fetB CDS complement(244153..245007) product chaperedoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116065.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene cnoX CDS complement(245067..245837) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172802.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(245992..246639) product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010578.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene tesA CDS 246577..247263 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110598.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 247260..249674 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561782.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 249860..250993 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152873.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 251250..252080 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524312.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 252117..253133 product virulence-associated ABC transporter ATP-binding protein SfbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569655.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene sfbB CDS 253126..253785 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342247.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(253824..254918) product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154074.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene mnmH CDS complement(254988..255914) product HTH-type transcriptional activator AllS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460171.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene allS CDS 256141..256623 product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776388.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene allA CDS 256702..257520 product HTH-type transcriptional repressor AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141266.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene allR CDS 257605..259386 product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096863.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene gcl CDS 259399..260175 product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943597.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene hyi CDS 260276..261154 product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765818.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene glxR CDS 261220..262467 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005062.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 262563..264017 product putative allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401139.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 264096..265457 product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006865.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene allB CDS 265516..266814 product uracil/xanthine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484506.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 266837..267985 product glycerate 3-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706333.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene glxK CDS complement(268065..268850) product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540981.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene allE CDS complement(268861..270096) product allantoate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589772.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene allC CDS complement(270118..271167) product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703940.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene allD CDS 271483..273147 product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580919.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 273157..274416 product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495330.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 274428..275237 product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821188.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 275241..276134 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855341.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(276175..277242) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815594.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene purK CDS complement(277239..277748) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098739.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene purE CDS complement(277866..278588) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212291.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene lpxH CDS complement(278591..279085) product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255991.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene ppiB CDS 279258..280643 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912377.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene cysS CDS complement(280687..281511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(281508..281945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(281938..282483) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143573.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(282610..282822) product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190278.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene ybcJ CDS complement(282824..283690) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729163.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene folD CDS 284237..284794 product type 1 fimbrial protein subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681037.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene fimA CDS 284868..285401 product type 1 fimbrial protein subunit FimI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095931.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene fimI CDS 285424..286137 product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764009.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene fimC CDS 286168..288780 product fimbrial biogenesis usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754216.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 288795..289802 product type 1 fimbria D-mannose specific adhesin FimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708646.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene fimH CDS 289812..290330 product fimbria assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603408.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene sfmF CDS complement(290376..291008) product fimbria biosynthesis transcriptional regulator FimZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801270.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene fimZ CDS complement(291612..292334) product fimbria biosynthesis regulator FimY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258098.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene fimY CDS complement(292353..292664) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226497.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(292826..293422) product fimbria biosynthesis transcriptional regulator FimW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948632.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene fimW tRNA 293677..293753 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(293847..294119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 note possible pseudo, internal stop codon, frameshifted CDS complement(294296..294514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 note possible pseudo, internal stop codon, frameshifted CDS 294686..294844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(294901..295608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 295853..296116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 296198..296323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(296534..297460) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703607.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(297457..297819) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915523.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(298242..298448) product copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445906.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(298687..299016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 299125..299304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(299355..300209) product reactive chlorine-specific transcriptional regulator RclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339629.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene rclR CDS 300425..301750 product reactive chlorine resistance oxidoreductase RclA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195937.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene rclA CDS 301907..302143 product reactive chlorine resistance periplasmic protein RclB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922170.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene rclB CDS 302156..302716 product reactive chlorine resistance membrane protein RclC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362177.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene rclC CDS complement(302803..303978) product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816311.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 304304..305698 product phenylalanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786293.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene pheP CDS complement(305740..306987) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156971.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 307298..309268 product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192421.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(309535..310188) product oxygen-insensitive NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355874.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene nfsB CDS complement(310285..310653) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348987.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(310653..311234) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113603.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 311523..311864 product RamA family antibiotic efflux transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155638.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(311870..312118) product DUF1158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682500.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(312185..313303) product YbdK family carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196914.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(313315..314031) product enterobactin synthase subunit EntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681620.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene entD CDS complement(314065..316320) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034967.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 316509..317723 product enterochelin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656592.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene fes CDS 317754..317972 product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000396011.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 317969..321853 product enterobactin non-ribosomal peptide synthetase EntF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194158.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene entF CDS 322103..323239 product LPS O-antigen length regulator Wzz(fepE) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096767.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene wzz(fepE) CDS complement(323292..324086) product iron-enterobactin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140620.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene fepC CDS complement(324083..325075) product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480067.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene fepG CDS complement(325072..326079) product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277880.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene fepD CDS 326190..327434 product enterobactin transporter EntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081657.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene entS CDS complement(327497..328453) product Fe2+-enterobactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239614.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene fepB CDS 328762..329937 product isochorismate synthase EntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367601.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene entC CDS 329947..331557 product (2,3-dihydroxybenzoyl)adenylate synthase EntE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222445.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene entE CDS 331571..332428 product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007162.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 332428..333183 product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase EntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135726.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene entA CDS 333186..333599 product proofreading thioesterase EntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637966.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene entH CDS 333781..335886 product pyruvate/proton symporter CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043112.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene cstA CDS 335950..336147 product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460619.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(336183..337271) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016858.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 337398..338558 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245604.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(338559..339188) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164761.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(339283..340383) product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118148.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 note possible pseudo, frameshifted CDS complement(340549..341451) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002489.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(341768..342514) product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597117.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene dsbG CDS 342955..343518 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052802.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene ahpC CDS 343760..345325 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887645.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene ahpF CDS 345658..346218 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377438.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 346211..348490 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064331.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 348487..349044 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250378.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 349044..349811 product dimethyl sulfoxide reductase anchor subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417104.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(349879..350307) product universal stress protein UspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278499.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene uspG CDS 350530..351768 product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646123.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(351851..352261) product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089748.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene rnk CDS complement(352496..353302) product ribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092588.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene rna CDS complement(353412..354875) product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059033.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(354913..355809) product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982670.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene citG CDS complement(355781..356332) product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236063.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene citX CDS complement(356336..357865) product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192347.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene citF CDS complement(357875..358783) product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622336.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(358780..359076) product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700679.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene citD CDS complement(359073..360149) product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001723760.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene citC CDS 360534..362195 product sensor histidine kinase DpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121811.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene dpiB CDS 362164..362844 product two-component response regulator DpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138786.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene dpiA CDS complement(362898..364283) product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958619.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene dcuC CDS 364716..365234 product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001784638.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene pagP CDS 365422..365631 product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034826.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene cspE CDS complement(365689..366072) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939753.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene crcB CDS 366163..366951 product deaminated glutathione amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959109.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 367080..367283 product twin-arginine translocase subunit TatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503938.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene tatE CDS complement(367369..368334) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042639.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene lipA CDS complement(368540..369493) product YbeF family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282817.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(369795..370436) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284017.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene lipB CDS complement(370536..370799) product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850547.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene ybeD CDS complement(370907..372118) product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858714.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene dacA CDS complement(372259..373392) product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549517.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene rlpA CDS complement(373403..374515) product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131713.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene mrdB CDS complement(374518..376419) product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828701.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene mrdA CDS complement(376450..376917) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776107.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene rlmH CDS complement(376921..377238) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161670.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene rsfS CDS complement(377567..378175) product adenosylcobalamin/alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241920.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 378272..379366 product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173241.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene cobD CDS complement(379341..379982) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989126.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene nadD CDS complement(379984..381015) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620491.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene holA CDS complement(381015..381605) product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269949.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene lptE CDS complement(381620..384202) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157907.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene leuS CDS 384490..384780 product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812779.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 384797..385969 product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460067.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 386019..386972 product 2-keto-3-deoxygluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694473.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 387040..388968 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044179.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 389061..389534 product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044885.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(389573..390568) product Sel1 family TPR-like repeat protein YbeQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578153.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene ybeQ CDS 390693..391400 product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367041.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 391397..392830 product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786582.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 392842..393537 product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030930.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 393534..395006 product co-chaperone DjlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300403.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene djlC CDS complement(395028..396707) product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367875.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene hscC CDS complement(396783..398021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191774878.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(398053..398988) product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207423.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene rihA CDS complement(399105..399830) product glutamate/aspartate ABC transporter ATP-binding protein GltL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631369.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene gltL CDS complement(399830..400504) product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272799.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene gltK CDS complement(400504..401244) product glutamate/aspartate ABC transporter permease GltJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020930.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene gltJ CDS complement(401404..402312) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588823.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(402667..404205) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853074.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene lnt CDS complement(404225..405103) product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278615.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene corC CDS complement(405261..405734) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084477.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene ybeY CDS complement(405731..406777) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493272.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(406982..408406) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519200.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene miaB CDS 408550..409725 product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184625.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene ubiF CDS complement(409792..410184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 tRNA complement(410503..410577) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA complement(410621..410695) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA complement(410742..410818) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA complement(410834..410908) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA complement(410944..411018) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA complement(411042..411126) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA complement(411135..411211) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(411433..413097) product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337026.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene asnB CDS complement(413387..414139) product ribonucleotide monophosphatase NagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153143.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene nagD CDS complement(414186..415406) product DNA-binding transcriptional regulator NagC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187578.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene nagC CDS complement(415411..416565) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271187.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene nagA CDS complement(416625..417425) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237064.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene nagB CDS 417752..419704 product PTS N-acetyl glucosamine transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023150.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene nagE CDS 419915..421582 product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287188.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene glnS CDS 422243..423649 product chitoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258803.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene chiP CDS 423699..424031 product ChiQ/YbfN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722260.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene chiQ CDS complement(424080..425384) product tricarballylate/proton symporter TcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057014.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene tcuC CDS complement(425435..426574) product tricarballylate utilization protein TcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811143.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene tcuB CDS complement(426561..427964) product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228705.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene tcuA CDS complement(428062..428988) product tricarballylate utilization LysR family transcriptional regulator TcuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423368.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene tcuR CDS complement(429103..429555) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131699.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene fur CDS complement(429837..430367) product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018622.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene fldA CDS complement(430518..430811) product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040939.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene ybfE CDS complement(430945..431715) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773252.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene ybfF CDS 431900..432442 product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848395.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene seqA CDS 432467..434107 product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974369.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene pgm CDS complement(434222..434707) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070053.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(434772..436091) product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042659.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene potE CDS complement(436088..438286) product ornithine decarboxylase SpeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046082898.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene speF CDS complement(439048..439725) product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186051.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene kdpE CDS complement(439722..442406) product two-component system sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997481.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene kdpD CDS complement(442403..442987) product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014341418.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene kdpC CDS complement(442996..445044) product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087964.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene kdpB CDS complement(445065..446744) product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730077.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene kdpA CDS 447170..447376 product YbfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401435.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 447488..448909 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142014.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene phrB CDS complement(448948..450429) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041123.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 450758..451501 product radiation resistance protein YbgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798844.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene ybgI CDS 451517..452173 product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188364.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene pxpB CDS 452167..453099 product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932048.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 453089..453823 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017910.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene pxpA CDS 453945..454736 product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113965.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene nei CDS complement(454791..455837) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122050.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(455974..457257) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785816.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 457358..457603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 note possible pseudo, frameshifted CDS 457997..458401 product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001539490.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene sdhC CDS 458395..458742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 458742..460508 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775523.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene sdhA CDS 460522..461241 product succinate dehydrogenase iron-sulfur subunit SdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976880.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene sdhB CDS 461765..464566 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181500.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene sucA CDS 464581..465789 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099858.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene odhB CDS 465931..467097 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048590.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene sucC CDS 467097..467966 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367669.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene sucD CDS 469549..471117 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884372.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene cydA CDS 471133..472272 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568258.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene cydB CDS 472400..472693 product cyd operon protein YbgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875303.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene ybgE CDS 472922..473326 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046241.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene ybgC CDS 473332..474015 product Tol-Pal system protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131318.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene tolQ CDS 474019..474447 product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124676.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene tolR CDS 474512..475690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 475802..477106 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989131.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene tolB CDS 477141..477665 product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176621.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene pal CDS 477675..478463 product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097547.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene cpoB tRNA 478628..478703 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 478840..478915 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 478919..478994 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 sequence02 source 1..45301 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 86..196 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 tRNA 214..289 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 rRNA 331..441 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 CDS complement(1228..1449) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825645.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(1687..4800) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703631.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(4812..5969) product multidrug efflux RND transporter periplasmic adaptor subunit AcrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160334.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene acrE CDS 6383..7045 product multidrug efflux transporter transcriptional repressor AcrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129529.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene acrS CDS complement(7048..9147) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098998.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(9298..9483) product DUF2556 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620015.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(9545..10429) product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642611.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene yhdJ CDS complement(10515..10811) product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462905.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene fis CDS complement(10837..11682) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219664.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene dusB CDS complement(12463..13344) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145849.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene prmA CDS complement(13356..14807) product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175744.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene panF CDS complement(14797..15039) product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340020.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(15148..16497) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884627.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene accC CDS complement(16508..16978) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354626.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene accB CDS complement(17371..17970) product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241496.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene msrQ CDS complement(17971..18975) product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723876.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene msrP CDS complement(19088..20062) product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148246.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 20266..22206 product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241379.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene csrD CDS 22514..23557 product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913396.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene mreB CDS 23622..24674 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802540.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene mreC CDS 24674..25165 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226619.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene mreD CDS 25174..25767 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210300.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 25757..27226 product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123188.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene rng CDS 27337..31137 product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253498.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene yhdP CDS 31282..32727 product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055936.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene tldD CDS complement(32850..33779) product HTH-type transcriptional activator AaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440300.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene aaeR CDS 33961..34164 product p-hydroxybenzoic acid efflux pump operon protein AaeX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051840.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene aaeX CDS 34172..35104 product p-hydroxybenzoic acid efflux pump subunit AaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855134.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene aaeA CDS 35110..37077 product p-hydroxybenzoic acid efflux pump subunit AaeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510909.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene aaeB CDS 37249..37521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103887.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(37581..37847) product DUF1471 family stress response protein YhcN-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853277.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene yhcN-B CDS complement(37951..38214) product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695692.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene yhcN CDS complement(38579..39049) product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257852.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene argR CDS 39464..40402 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861588.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene mdh CDS 40522..41151 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723780.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 41138..41803 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171579.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 42014..43282 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433394.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 43315..44214 product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045349.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene ttdA CDS 44214..44831 product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162405.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene ttdB CDS 44988..45230 product oxaloacetate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180130.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 sequence03 source 1..89224 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 150..260 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 tRNA 318..394 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 403..478 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(581..1417) product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001541181.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene hdfR CDS 1536..1874 product macrodomain Ori organization protein MaoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840996.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene maoP CDS complement(1899..3419) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058995.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 4009..5655 product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012560.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene ilvG CDS 5652..5915 product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001576447.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene ilvM CDS 5933..6862 product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208528.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene ilvE CDS 7022..8872 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127449.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene ilvD CDS 8875..10419 product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989250.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene ilvA CDS complement(10488..10667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 10657..11019 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001779357.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 11016..11357 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560819.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(11360..12247) product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365798.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene ilvY CDS 12412..13887 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024943.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene ilvC CDS complement(13979..14260) product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096806.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene ppiC CDS 14798..16822 product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238841.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene rep CDS complement(16862..18343) product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089447.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene gppA CDS complement(18480..19745) product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047525.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene rhlB CDS 19889..20218 product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305383.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene trxA CDS 20637..21896 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054532.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene rho CDS 22390..23229 product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771938.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene wecA CDS 23241..24287 product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193415.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene wzzE CDS 24343..25473 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866686.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene wecB CDS 25470..26732 product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011236.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene wecC CDS 26732..27799 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822139.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene rffG CDS 27832..28056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 28034..28711 product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012539915.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene rffC CDS 28716..29846 product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612080.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene rffA CDS 29848..31098 product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050302.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene wzxE CDS 31095..32174 product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217177.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 32171..33529 product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055604.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene wzyE CDS 33526..34266 product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183613.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene wecG CDS 34473..35858 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818378.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 tRNA 35961..36037 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 36092..36167 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 36188..36274 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 36317..36393 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(36975..38174) product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979262.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene hemY CDS complement(38174..39343) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138976.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene hemX CDS complement(39365..40105) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025500.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene hemD CDS complement(40102..40962) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001521319.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene hemC CDS 41420..43966 product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281718.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene cyaA CDS complement(44044..44364) product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999925.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene cyaY CDS complement(44434..44814) product DUF3021 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125556.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(44811..45044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 note possible pseudo, internal stop codon CDS 45520..45723 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799903.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 45760..46584 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160671.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene dapF CDS 46581..47288 product DUF484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812770.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 47285..48187 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141123.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene xerC CDS 48187..48903 product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213563.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene yigB CDS 49039..51201 product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383444.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene uvrD CDS 51673..52623 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947139.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene corA CDS 53226..53522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526434.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(53562..54449) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339085.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene rarD CDS complement(54493..54960) product acyl-CoA thioesterase YigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277136.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene yigI CDS 55125..55994 product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201692.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene pldA CDS 56060..57907 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001533487.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene recQ CDS 58088..58591 product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928814.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene rhtC CDS complement(58631..59251) product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142520.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene rhtB CDS 59362..60378 product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487681.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene pldB CDS 60394..61194 product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285338.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene yigL CDS 61275..62174 product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196257.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(62062..63015) product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569786.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene metR CDS 63264..65528 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154198.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene metE CDS 65944..67215 product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017936.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(67295..67984) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213961.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 68366..69127 product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045169.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene udp CDS 69267..70697 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355562.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene rmuC CDS 70793..71548 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229009.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene ubiE CDS 71558..72163 product ubiquinone biosynthesis protein UbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116094.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene ubiJ CDS 72160..73800 product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187559.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene ubiB CDS 74006..74260 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508972.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene tatA CDS 74264..74812 product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459611.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene tatB CDS 74815..75594 product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257554.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene tatC CDS 75624..76418 product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459642.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene tatD CDS complement(76426..76914) product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192407.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene rfaH CDS 77100..78578 product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339760.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene ubiD CDS 78664..79365 product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209828.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene fre CDS 79619..81442 product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669894.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(81639..82802) product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438778.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene fadA CDS complement(82812..85001) product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966004.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene fadB CDS 85191..86522 product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444529.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene pepQ CDS 86522..87136 product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378910.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 87175..88626 product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545686.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene trkH CDS 88638..89183 product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853982.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene hemG sequence04 source 1..5430 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(231..464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 note possible pseudo, internal stop codon, frameshifted CDS complement(568..837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 note possible pseudo, internal stop codon, frameshifted CDS complement(940..1098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(1347..1946) product plasmid SOS inhibition protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087158.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(1940..2104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(2147..3844) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145488.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 4169..4591 product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109071.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene umuD sequence05 source 1..4527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(537..1511) product ParB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431558.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(1511..2716) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200287.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 3131..4072 product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215065.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 sequence06 source 1..32992 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 476..859 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275691.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene secE CDS 861..1406 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287521.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene nusG CDS 1564..1992 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085926.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene rplK CDS 1996..2700 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096676.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene rplA CDS 3116..3613 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207203.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene rplJ CDS 3680..4045 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028882.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene rplL CDS 4363..8391 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263103.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene rpoB CDS 8468..12691 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653965.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene rpoC CDS complement(13062..13382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(13360..13497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 13787..14815 product type III secretion system effector arginine glycosyltransferase NleB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953022.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene nleB CDS 15138..15326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(15477..16610) product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643282.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene thiH CDS complement(16607..17377) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944065.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene thiG CDS complement(17379..17579) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035896383.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene thiS CDS complement(17560..18318) product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999774.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(18311..18946) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284626.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene thiE CDS complement(18946..20841) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108425.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene thiC CDS complement(21205..21693) product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934311.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene rsd CDS 21786..22559 product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373954.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene nudC CDS 22600..23664 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137619.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene hemE CDS 23674..24345 product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362359.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene nfi CDS 24387..24977 product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940092.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 25164..25436 product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044509.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene hupA CDS 25448..26140 product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083923.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(26182..26637) product zinc resistance sensor/chaperone ZraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828133.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene zraP CDS 26891..28288 product two-component system sensor histidine kinase ZraS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001772857.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene zraS CDS 28294..29619 product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617932.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene zraR CDS complement(29616..30905) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866776.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene purD CDS complement(30917..32506) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187502.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene purH sequence07 source 1..3859 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 630..992 product type IV conjugative transfer system pilin TraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994779.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene traA CDS 1007..1318 product type IV conjugative transfer system protein TraL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012100.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene traL CDS 1340..1906 product type IV conjugative transfer system protein TraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399792.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene traE CDS 1893..2633 product type-F conjugative transfer system secretin TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230787.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene traK sequence08 source 1..2481 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence09 source 1..3669 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(405..893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(918..1631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(1640..2422) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013214009.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(2457..2978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(2975..3265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(3267..3572) product type II toxin-antitoxin system toxin CcdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159868.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene ccdB sequence10 source 1..1999 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 154..1691 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 tRNA 1778..1853 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 sequence11 source 1..3027 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 5..1774 product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150450.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene oadA sequence12 source 1..76997 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 145..849 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131144.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 861..1106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 note possible pseudo, frameshifted CDS 1094..2284 product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099391.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene mdtD note possible pseudo, frameshifted CDS complement(2250..3248) product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224487.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene rbsR CDS complement(3252..4181) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844732.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene rbsK CDS complement(4314..5204) product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056260.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene rbsB CDS complement(5229..6194) product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211345.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene rbsC CDS complement(6200..7705) product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339360.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene rbsA CDS complement(7713..8132) product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715950.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene rbsD CDS complement(8349..10217) product low affinity potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102337.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene kup CDS 10565..12061 product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940993.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene ravA CDS 12055..13506 product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956591.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene viaA CDS complement(13511..14503) product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845119.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene asnA CDS 14654..15112 product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433016.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene asnC CDS 15202..15645 product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763722.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene mioC CDS 16024..17913 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499882.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene mnmG CDS 18010..18639 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519938.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene rsmG CDS 19255..19635 product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145371.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene atpI CDS 19644..20459 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135632.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene atpB CDS 20506..20745 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene atpE CDS 20805..21275 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052212.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene atpF CDS 21290..21823 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288957.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene atpH CDS 21836..23377 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176751.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene atpA CDS 23428..24291 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896504.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene atpG CDS 24318..25700 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190499.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene atpD CDS 25721..26140 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251971.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 26370..27068 product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009901.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 27388..28758 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934853.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene glmU CDS 28947..30776 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334049.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene glmS CDS complement(30927..32717) product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235491.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 32779..33597 product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166706.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 33646..35019 product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162538.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 35185..36225 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867129.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene pstS CDS 36361..37320 product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741630.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene pstC CDS 37320..38210 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212190.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene pstA CDS 38303..39070 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063118.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene pstB CDS 39085..39810 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377800.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene phoU CDS complement(39905..40570) product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078084.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene yieH CDS 40739..42076 product adenine permease AdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214973.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene adeP CDS complement(42121..42687) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013212.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(42705..43460) product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190678.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(43618..44577) product HTH-type transcriptional regulator YidZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749373.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene yidZ CDS complement(44546..45733) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819608.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(45916..47280) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019075.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene mnmE CDS 47332..47538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(47422..49068) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378272.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene yidC CDS complement(49292..49618) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239725.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene rnpA CDS 50538..51869 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059095.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene dnaA CDS 51874..52974 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673474.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene dnaN CDS 53122..54195 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059373.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene recF CDS 54224..56638 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072047.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene gyrB CDS complement(56657..57553) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054598.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(57668..58861) product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975831.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(58875..60137) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061243.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 60442..61287 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985571.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene yidA CDS 61548..62237 product D-galactonate utilization transcriptional regulator DgoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369039.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene dgoR CDS 62234..63112 product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703896.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 63096..63713 product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703895.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 63710..64858 product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703894.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene dgoD CDS 64988..66280 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032706561.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(66306..69041) product TMAO reductase system sensor histidine kinase/response regulator TorS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106933.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene torS CDS 69121..70161 product TMAO reductase system periplasmic protein TorT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259560.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene torT CDS complement(70134..70826) product two-component system response regulator TorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120125.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene torR CDS 70956..72140 product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230242.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene torC CDS 72130..74682 product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790669.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene torA CDS 74675..75307 product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595416.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene torD CDS 75497..76897 product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724476.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 sequence13 source 1..6157 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(62..1006) product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238304.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(1003..1560) product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828299.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene dsbE CDS complement(1557..3488) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982516.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(3485..3964) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053607.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene ccmE CDS complement(3961..4173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(4170..4916) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266010.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(4959..5618) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990042.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene ccmB misc_feature complement(5615..>6157) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000888541.1:cytochrome c biogenesis heme-transporting ATPase CcmA locus_tag LOCUS_06900 sequence14 source 1..26410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(338..496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 431..625 product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289082.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene bfd CDS 698..1174 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675528.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene bfr CDS complement(1171..1638) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495849.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 2018..2329 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181005.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene rpsJ CDS 2362..2991 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579838.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene rplC CDS 3002..3607 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424395.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene rplD CDS 3604..3906 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617546.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene rplW CDS 3924..4745 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301869.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene rplB CDS 4762..5040 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138115.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene rpsS CDS 5055..5387 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447529.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene rplV CDS 5405..6106 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529945.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene rpsC CDS 6119..6529 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941208.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene rplP CDS 6529..6720 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644742.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene rpmC CDS 6720..6974 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130101.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene rpsQ CDS 7138..7509 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613954.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene rplN CDS 7520..7834 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729185.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene rplX CDS 7849..8388 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096206.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene rplE CDS 8403..8708 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118932.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene rpsN CDS 8742..9134 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062611.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene rpsH CDS 9147..9680 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091939.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene rplF CDS 9690..10043 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358956.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene rplR CDS 10058..10561 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940121.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene rpsE CDS 10565..10744 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140434.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene rpmD CDS 10748..11182 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238917.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene rplO CDS 11190..12521 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118861.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene secY CDS 12816..13172 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090779.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene rpsM CDS 13189..13578 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029684.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene rpsK CDS 13612..14232 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135224.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene rpsD CDS 14258..15247 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162094.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene rpoA CDS 15288..15671 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216370.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene rplQ CDS 15779..16147 product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266513.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 16158..16583 product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285589.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene zntR CDS 16641..16910 product alternative ribosome-rescue factor ArfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092695.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene arfA CDS complement(16846..17259) product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008119.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene mscL CDS complement(17401..18777) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691374.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene trkA CDS complement(18799..20088) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744595.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene rsmB CDS complement(20140..21087) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285161.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene fmt CDS complement(21103..21612) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114992.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene def CDS 21744..22868 product DNA-protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124521.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene dprA CDS 22840..23313 product DUF494 family protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460663.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene smg CDS 23340..23882 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129710.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 23887..24459 product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063622.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene tsaC CDS 24461..25282 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388662.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene aroE CDS 25279..25536 product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070570.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(25512..26066) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285635.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 26180..26332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 sequence15 source 1..227922 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(265..504) product oxaloacetate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001151.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(663..2003) product citrate/sodium symporter CitS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183602.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene citS CDS 2302..3291 product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181444.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene citC CDS 3321..3614 product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691461.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene citD CDS 3611..4480 product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247810.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene citE CDS 4491..6011 product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665586.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene citF CDS 6011..6562 product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679050.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene citX CDS 6540..7448 product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103241.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene citG CDS 7628..8449 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544030.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene dapB CDS 9311..10459 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597281.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene carA CDS 10478..13705 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126321.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene carB CDS 13979..14374 product carnitine metabolism transcriptional regulator CaiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333324.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene caiF CDS complement(14452..15048) product carnitine operon protein CaiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122865.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene caiE CDS complement(15158..15943) product crotonobetainyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004377.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene caiD CDS complement(15997..17550) product crotonobetaine/carnitine-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355790.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene caiC CDS complement(17613..18830) product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016209.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene caiB CDS complement(18942..20084) product crotonobetainyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347135.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene caiA CDS complement(20119..21636) product L-carnitine/gamma-butyrobetaine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787084.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene caiT CDS 22117..22887 product electron transfer flavoprotein FixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692187.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 22903..23844 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032189.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 23894..25180 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287774.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 25177..25464 product ferredoxin-like protein FixX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203737.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene fixX CDS 25611..26951 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136163.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 27040..27270 product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172089.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 27556..27978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802644.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(28202..28492) product DUF1471 family virulence protein SrfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745961.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene srfN CDS 29390..31279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 31686..32216 product glutathione-regulated potassium-efflux system oxidoreductase KefF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600696.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene kefF CDS 32209..34071 product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377172.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene kefC CDS 34269..34748 product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624378.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene folA CDS complement(34854..35702) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257211.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene apaH CDS complement(35713..36090) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610896.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene apaG CDS complement(36093..36914) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065397.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene rsmA CDS complement(36911..37900) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093001.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene pdxA CDS complement(37900..39186) product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800482.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene surA CDS complement(39240..41600) product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746124.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene lptD CDS 41854..42666 product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200595.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene djlA CDS complement(42761..43420) product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525195.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene rluA CDS complement(43432..46338) product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116972.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene rapA CDS complement(46512..48863) product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035599.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene polB CDS complement(48907..49527) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035634.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 50045..50464 product DUF4751 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103153.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(50470..51165) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888641.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene araD CDS complement(51306..52808) product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151698.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene araA CDS complement(52819..54528) product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951805.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene araB CDS 54868..55713 product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852388.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene araC CDS 55832..56599 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148375.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(56638..57345) product thiamine ABC transporter ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915973.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene thiQ CDS complement(57329..58939) product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235645.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene thiP CDS complement(58915..59898) product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915326.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene thiB CDS complement(60076..61734) product HTH-type transcriptional regulator SgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139028.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene sgrR CDS 61803..61949 product glucose uptake inhibitor SgrT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095557.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene sgrT CDS 62269..62550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(62604..63209) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818262.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene leuD CDS complement(63220..64620) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140632.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene leuC CDS complement(64623..65714) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042333.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene leuB CDS complement(65714..67285) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082813.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene leuA CDS 68116..69060 product transcriptional regulator LeuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115424.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene leuO CDS 69469..71106 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425609.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene ilvI CDS 71106..71600 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001563086.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene ilvN CDS 71884..72888 product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762406.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene cra CDS 73494..73952 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488291.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene mraZ CDS 73954..74895 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970440.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene rsmH CDS 74892..75257 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625651.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene ftsL CDS 75273..77039 product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642235.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene ftsI CDS 77026..78513 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775075.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene murE CDS 78510..79868 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626645.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene murF CDS 79862..80944 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964138.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene mraY CDS 80947..82263 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796441.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene murD CDS 82263..83507 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239803.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene ftsW CDS 83504..84571 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016622.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene murG CDS 84690..86165 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096072.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene murC CDS 86158..87078 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763895.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 87080..87910 product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075728.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene ftsQ CDS 87907..89169 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588463.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene ftsA CDS 89230..90381 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462798.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene ftsZ CDS 90482..91399 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595474.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene lpxC CDS 91678..92175 product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014320.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene secM CDS 92237..94942 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905763.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene secA CDS 95094..95489 product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736063.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene mutT CDS complement(95523..96512) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200039.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 96616..97539 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001802116.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(97536..97727) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286419.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene yacG CDS complement(97737..98480) product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557441.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene zapD CDS complement(98480..99100) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270913.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene coaE CDS 99326..100369 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217357.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(100400..101602) product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114107.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene hofC CDS complement(101592..102977) product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650611.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene gspE CDS complement(102987..103424) product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414989.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene ppdD CDS complement(103646..104539) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135134.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene nadC CDS 104627..105190 product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936326.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene ampD CDS 105187..106041 product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172040.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene ampE CDS complement(106133..107083) product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024772.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(107083..108489) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357550.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(108653..110023) product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969487.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene aroP CDS 110589..111353 product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331771.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene pdhR CDS 111513..114176 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003851.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene aceE CDS 114191..116074 product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963602.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene aceF CDS 116276..117700 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519338.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene lpdA CDS 117989..118273 product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765363.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(118311..119102) product DUF2950 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757452.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(119115..120737) product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174529.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 121126..123723 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888954.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene acnB CDS complement(124645..124803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 125239..125601 product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384314.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene yacL CDS 125836..126789 product 2-keto-3-deoxygluconate permease 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022089.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 126786..128057 product D-threonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783298.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 128047..129030 product D-threonate 4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448742.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 129040..129807 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678254.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(129837..130631) product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734279.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene speD CDS complement(130652..131512) product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829972.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene speE CDS complement(131619..132005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 132168..133778 product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946058.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene cueO CDS complement(133856..136210) product pyrroloquinoline quinone-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829735.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 136452..136988 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683333.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene hpt CDS complement(137046..137660) product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651585.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene can CDS 137817..138743 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150644.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 138740..139510 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983419.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(139630..140709) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301944.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(140718..143264) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097475.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(143291..143974) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097474.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(144022..144561) product type 1 fimbrial major subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369870.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene fimA CDS 144931..145371 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901966.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 145433..146662 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245304.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(146669..147049) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621526.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene panD CDS complement(147144..147998) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905353.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene panC CDS complement(148124..148915) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043003.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene panB CDS complement(149036..149515) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150775.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene folK CDS complement(149512..150876) product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204100700.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene pcnB CDS complement(151071..152012) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763945.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene gluQRS CDS complement(152036..152491) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155232.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene dksA CDS complement(152668..153372) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899414.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene sfsA CDS complement(153389..153919) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294175.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene thpR CDS 153947..156421 product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938517.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene hrpB CDS 156562..159084 product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918132.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene mrcB CDS 159377..161620 product ferrichrome porin FhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124438.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene fhuA CDS 161669..162466 product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157197.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene fhuC CDS 162466..163356 product Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208784.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene fhuD CDS 163353..165410 product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088086.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene fhuB CDS 166347..166907 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032645.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 166993..169650 product outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181237660.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 169668..170420 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281615.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 170439..170951 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178263.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 170948..171424 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822649.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 171424..171954 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050120.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 172023..172793 product StfH/YfcO family fimbrial adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602831.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(172901..174181) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045264.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene hemL CDS 174351..175772 product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845433.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene clcA CDS 175854..176198 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278668.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene erpA CDS complement(176299..176922) product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964234.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(176959..177759) product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118833.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene btuF CDS complement(177752..178450) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689821.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene mtnN CDS 178535..180052 product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146450.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene dgt CDS 180182..181609 product serine endoprotease DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753959.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene degP CDS 181762..182919 product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929458.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene cdaR CDS complement(182976..186008) product putative mucin/carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704442.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(186194..186580) product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272193.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 186827..188128 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484585.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(188165..188989) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186669.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene dapD CDS complement(189019..191691) product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094518.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene glnD CDS complement(191929..192723) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018214.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene map CDS 193174..193899 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246886.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene rpsB CDS 194085..195008 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808106.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene tsf CDS 195153..195878 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224567.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene pyrH CDS 196025..196582 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622423.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene frr CDS 196723..197919 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811892.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene ispC CDS 198301..198990 product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947409.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene ispU CDS 199003..199860 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922422.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene cdsA CDS 199872..201224 product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949016.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene rseP CDS 201256..203670 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240921.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene bamA CDS 203793..204278 product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758966.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene skp CDS 204282..205307 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139265.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene lpxD CDS 205413..205868 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210741.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene fabZ CDS 205872..206660 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566033.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene lpxA CDS 206660..207808 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741216.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene lpxB CDS 207805..208401 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569412.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene rnhB CDS 208425..211907 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294828.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene dnaE CDS 211920..212879 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055753.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene accA CDS 213059..214822 product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524168.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 214898..217039 product lysine decarboxylase LdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021059.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene ldcC CDS 217095..217484 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901086.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 217547..218839 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210062.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene tilS CDS complement(218923..219183) product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062330.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene rof CDS complement(219170..219370) product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518678.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 219568..220113 product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185319.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 220110..220532 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560526.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene arfB CDS 220564..221265 product envelope stress response activation lipoprotein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252574.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene nlpE CDS complement(221339..223057) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260683.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene proS CDS complement(223168..223875) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093978.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene tsaA CDS complement(223872..224276) product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202315.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene rcsF CDS complement(224395..225210) product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874217.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene metQ CDS complement(225249..225902) product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287483.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(225895..226926) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594016.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene metN CDS 227116..227682 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140158.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene gmhB sequence16 source 1..5165 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 194..1222 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149790.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene murB CDS 1219..2181 product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655746.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene birA CDS complement(2216..3142) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023068.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene coaA tRNA 3568..3643 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 3652..3736 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA 3853..3927 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA 3934..4009 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 sequence17 source 1..8735 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..526 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000002787.1:conjugal transfer pilus-stabilizing protein TraP locus_tag LOCUS_09350 CDS 513..728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 725..1057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 note possible pseudo, frameshifted CDS 1319..1741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 1858..2310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 2432..2716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 note possible pseudo, frameshifted CDS 2733..2912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 note possible pseudo, frameshifted CDS 3112..3357 product replication regulatory protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229817.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene repA CDS 3677..4546 product incFII family plasmid replication initiator RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213292.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene repA CDS 5444..5623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(5720..6196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(6732..7289) product virulence membrane protein PagC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789474.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene pagC CDS complement(7379..8224) product YjiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490324.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(8275..8460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 sequence18 source 1..10945 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 64..139 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA 274..349 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 954..1997 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115355.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene nadA CDS 2022..2741 product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345378.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene pnuC CDS complement(2738..3676) product CDF family zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951257.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene zitB CDS complement(3787..4173) product YbgS-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784380.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 4493..5545 product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109233.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene aroG CDS complement(5639..6184) product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881093.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(6199..7044) product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816933.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 7174..8064 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263794.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(8065..8991) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767508.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 9271..10539 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703620.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 10589..10837 product oxaloacetate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703617.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 sequence19 source 1..1108 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 143..511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(596..757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 sequence20 source 1..1076 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(34..>1076) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025381298.1:IS630 family transposase locus_tag LOCUS_09620 sequence21 source 1..2894 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(104..1093) product RepB family plasmid replication initiator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361615.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 2649..2771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 sequence22 source 1..2572 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 234..1349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 1435..1851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 1957..2370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 sequence23 source 1..305612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 311..421 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 CDS complement(590..1027) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973251.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 1184..2113 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122765.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene metA CDS 2379..3983 product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069369.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene aceB CDS 4015..5319 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857886.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene aceA CDS 5421..7172 product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137261.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene aceK CDS complement(7136..7570) product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001412115.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(7554..8378) product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226433.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene iclR CDS 8682..12365 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095965.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene metH CDS 12632..14263 product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956807.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(14323..14925) product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421788.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene pepE note possible pseudo, internal stop codon, frameshifted CDS 15235..15774 product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096724.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 15821..16690 product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954615.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene rluF CDS complement(16687..16959) product DUF3811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207628.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(17022..17780) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068169.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(17767..18630) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924650.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(18647..19486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472332.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(19510..21099) product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099738.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(21528..22256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(22835..23251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 note possible pseudo, frameshifted CDS 23701..24048 product Mor transcription activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619864.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(24179..25528) product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136394.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene lysC CDS 25916..27565 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790033.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene pgi CDS 28006..28251 product exopolysaccharide production protein YjbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976742.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene yjbE CDS 28315..28953 product YjbF family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824800.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 28950..29687 product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977977.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 29687..31783 product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750797.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 31926..32336 product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982749.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene psiE CDS complement(32502..33392) product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252081.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene malG CDS complement(33407..34951) product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382568.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene malF CDS complement(35083..36273) product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695415.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene malE CDS 36635..37744 product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179177.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene malK CDS 37833..39191 product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973678.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 39355..40272 product maltose operon protein MalM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782497.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene malM CDS 40453..40950 product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019220.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene ubiC CDS 40964..41836 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455249.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene ubiA CDS complement(41935..44355) product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017366.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene plsB CDS 44526..44894 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002902.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 45003..45611 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646079.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene lexA CDS complement(45682..45903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 45790..47115 product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128110.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene dinF CDS 47016..47225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 47244..47456 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981150.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(47555..48070) product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416271.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene zur CDS 48317..49627 product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039344.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 49715..50713 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182236.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene dusA CDS 50881..51123 product envelope stress response protein PspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891414.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene pspG CDS complement(51298..52281) product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235562.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 52346..53761 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918353.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene dnaB CDS 53793..54872 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147297.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene alr CDS 55058..56251 product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486904.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene tyrB CDS 56438..57151 product acid phosphatase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724436.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene aphA CDS 57280..57696 product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270393.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 57699..58055 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155664.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(58056..58394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146604.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(58381..58824) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432193.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(58968..61793) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357724.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene uvrA CDS 62041..62571 product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209100.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene ssb1 CDS 63612..64244 product SPI-4 type I secretion system auxiliary protein SiiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389235.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene siiA CDS 64352..65629 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875187.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 65619..66938 product SPI-4 type I secretion system protein SiiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989277.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene siiC CDS 66935..68212 product SPI-4 type I secretion system protein SiiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081932.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene siiD CDS 68229..84908 product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052484.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 84948..87014 product SPI-4 type I secretion system protein SiiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358570.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene siiF CDS complement(87292..87573) product YjcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719058.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 88136..89737 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083646.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(89725..90048) product superoxide response transcriptional regulator SoxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019484.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene soxS CDS 90135..90593 product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412686.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene soxR CDS 90886..91554 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958574.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 91902..93251 product guanine/hypoxanthine transporter GhxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106903.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene ghxP CDS 93401..95047 product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001536604.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(95142..96029) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354962.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 96133..96543 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257347.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 96536..97225 product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067098.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(97264..98913) product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832531.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene actP CDS complement(98910..99224) product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999620.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(99470..101428) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083869.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene acs CDS 101860..103296 product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101783.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene nrfA CDS 103408..103974 product cytochrome c nitrite reductase pentaheme subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115063.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene nrfB CDS 103971..104642 product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278023.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene nrfC CDS 104639..105595 product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199631.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene nrfD CDS 105588..107324 product heme lyase NrfEFG subunit NrfEF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551709.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene nrfEF note possible pseudo, internal stop codon, frameshifted CDS 107317..107826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 note possible pseudo, internal stop codon, frameshifted CDS 107823..108443 product heme lyase NrfEFG subunit NrfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083247.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene nrfG CDS 108676..108879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 108788..110098 product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793283.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene gltP CDS complement(110256..110945) product Sel1 family TPR-like repeat protein YjcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803225.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene yjcO CDS complement(111122..113269) product formate dehydrogenase N subunit alpha, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989279.1 transl_table 11 codon_start 1 transl_except (pos:112850..112852,aa:Sec) note codon on position 140 is selenocysteine opal codon. locus_tag LOCUS_10540 CDS complement(113624..114532) product lipid A hydroxylase LpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457029.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene lpxO CDS complement(114790..115224) product aminoalkylphosphonate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602318.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene phnO CDS complement(115376..115819) product VOC family metalloprotein YjdN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131301.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene yjdN CDS complement(115939..116274) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056482.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 116742..118244 product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919708.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene proP CDS complement(118411..119490) product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212189.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene pmrB CDS complement(119491..120159) product two-component system response regulator PmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697895.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene pmrA CDS complement(120156..121799) product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919286.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene eptA CDS complement(121933..123270) product arginine/agmatine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093130.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene adiC CDS complement(123410..124171) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217076.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(124469..126739) product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978690.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene adiA CDS complement(126969..127901) product transcriptional regulator MelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106992.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene melR CDS 128173..129525 product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520868.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene melA CDS 129609..131039 product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028072.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene melB CDS complement(131137..132783) product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037190.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene fumA CDS complement(132879..134219) product anaerobic C4-dicarboxylate transporter DcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899146.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene dcuB CDS complement(134366..134632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(134949..135668) product two-component system response regulator DcuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611308.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene dcuR CDS complement(135665..137254) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682899.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(137755..137964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 137896..140100 product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211602.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 140114..140740 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211603.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene dmsB CDS 140733..141506 product dimethyl sulfoxide reductase anchor subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544919.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 141581..142174 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112218.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(142258..143658) product DUF1996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773796.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 144007..144867 product YjiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268195.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(145380..145652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 145585..145959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(145952..146224) product transcriptional regulator RtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269916.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene rtsB CDS complement(146236..146919) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921674.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 147915..148208 product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110456.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 148205..148696 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626103.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(148944..149696) product non-specific acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001785756.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 tRNA complement(150407..150482) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(150598..151173) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188506.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(151210..152913) product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068881.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(152889..153236) product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887832.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene cutA CDS complement(153357..154658) product anaerobic C4-dicarboxylate transporter DcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637594.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene dcuA CDS complement(154773..156209) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069440.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene aspA CDS 156550..157026 product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267291.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene fxsA CDS complement(157085..158347) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989305.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 158602..158895 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027827.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 158939..160585 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729126.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene groL CDS 160829..161182 product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605289.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(161230..162087) product YjeJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229237.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(162369..163397) product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940490.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene epmB CDS 163438..164004 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257282.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene efp CDS 164023..164199 product entericidin A/B family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977686.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 164307..164453 product lipoprotein toxin entericidin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239598.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene ecnB CDS complement(164484..165023) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763937.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 165328..165645 product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118469.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene sugE CDS complement(165662..166195) product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238395.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(166307..166666) product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609650.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene frdD CDS complement(166677..167072) product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208749.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene frdC CDS complement(167083..167817) product fumarate reductase iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829507.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene frdB CDS complement(167810..169600) product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192954.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene frdA CDS 169923..170900 product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004789.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene epmA CDS 171126..172628 product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149876.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene yjeM CDS 172680..172994 product YjeO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276180.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(173061..176387) product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236760.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene mscM CDS complement(176406..177374) product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934955.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene asd CDS complement(177466..178518) product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041948.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene rsgA CDS 178625..179170 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271546.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene orn CDS complement(179232..179951) product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922806.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 tRNA 180247..180322 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 180479..180554 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 180711..180786 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(181056..182195) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964745.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene queG CDS 182194..183741 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968671.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene nnr CDS 183713..184174 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981984.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene tsaE CDS 184191..185510 product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640365.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene amiB CDS 185520..187376 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122547.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene mutL CDS 187414..188319 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000739.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene miaA CDS 188402..188710 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051875.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene hfq CDS 188782..190062 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460344.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene hflX CDS 190277..191536 product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312504.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene hflK CDS 191539..192543 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232417.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene hflC CDS 192622..192819 product DUF2065 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089290.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 192922..194220 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527972.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene purA CDS 194428..194853 product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177630.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene nsrR CDS 194891..197329 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076357.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene rnr CDS 197420..198151 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293265.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene rlmB CDS 198284..198688 product DUF2170 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312608.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 198703..199401 product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511955.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 199401..200471 product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037962.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 200468..201127 product YjfK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090298.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 201145..201543 product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547734.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 201553..202191 product DUF1190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085609.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 202194..203357 product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943948.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 203442..205064 product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118984.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(205109..205384) product DUF1471 family protease activator YjfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000441025.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene yjfN CDS complement(205515..205817) product biofilm peroxide resistance protein BsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586831.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene bsmA CDS 206028..206777 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560304.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene yjfP CDS complement(206774..207529) product HTH-type transcriptional regulator UlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133618.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene ulaR CDS complement(207634..208698) product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049161.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene ulaG CDS 209061..210458 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404875.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene ulaA CDS 210474..210779 product PTS ascorbate transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218362.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene ulaB CDS 210789..211253 product PTS ascorbate transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776536.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene ulaC CDS 211267..211917 product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056755.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene ulaD CDS 211927..212781 product L-ribulose-5-phosphate 3-epimerase UlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949528.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene ulaE CDS 212781..213467 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170772.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(213596..213871) product DUF1471 family protein YjfY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001756165.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene yjfY CDS 214341..214736 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216673.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene rpsF CDS 214743..215057 product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001768658.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene priB CDS 215062..215289 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene rpsR CDS 215331..215780 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196065.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene rplI CDS 215928..216854 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381071.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(216904..217539) product OapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119449.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 217759..218379 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001663320.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene fklB CDS 218675..220078 product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228328.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene cycA CDS 220416..221555 product DKNYY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155542.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 221570..222958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944334.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(223025..223687) product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331469.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene ytfE CDS complement(223790..224755) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623287.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(224836..225684) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560623.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 225772..226158 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201297.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(226216..228159) product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589381.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 228427..229167 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893400.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene cysQ CDS complement(229157..229714) product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175301.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 230041..230247 product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689229.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(230332..231675) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934974.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(231858..232496) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051467.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene msrA CDS 232709..234442 product autotransporter assembly complex protein TamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120231.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene tamA CDS 234439..238218 product autotransporter assembly complex protein TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060812.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene tamB CDS 238221..238565 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219167.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(238619..239827) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203124.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(239824..240984) product metallo-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977198.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(241397..241927) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055079.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene ppa CDS complement(242154..243152) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853761.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene fbp CDS 243327..244700 product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219848.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene mpl CDS complement(244807..245358) product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166287.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene yjgA CDS 245466..246806 product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852994.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene pmbA CDS 246905..247291 product cytochrome b562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232231.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene cybC CDS 247578..247907 product glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255103.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 247918..248280 product SFCGS family glycine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435389.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 248280..248582 product DUF4312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975186.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 248605..249381 product DUF4311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478578.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 249393..250037 product DUF4310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392129.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 250096..251229 product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459938.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 251213..252331 product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139189.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 252328..253068 product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779260.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 253085..254998 product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989308.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 255076..255318 product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212724.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 255308..255592 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220578.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(255596..256060) product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268860.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene nrdG CDS complement(256182..258320) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187820.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene nrdD CDS complement(258729..260381) product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155051.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene treC CDS complement(260431..261849) product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048822.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene treB CDS complement(261987..262934) product trehalose operon repressor TreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181306.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene treR CDS 263318..266026 product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001775586.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene mgtA CDS complement(266142..266588) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251083.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(266663..267049) product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047544.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene ridA CDS complement(267126..267587) product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148566.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene pyrI CDS complement(267600..268535) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013055.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene pyrB CDS complement(268763..269251) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666047.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(269438..270841) product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514432.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(270897..271901) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237033.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene argF CDS complement(272013..272945) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428744.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene arcC CDS complement(272956..274179) product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410840.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene arcA CDS 274852..275304 product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635207.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(275378..276382) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103040.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene argF CDS 276548..276964 product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002940.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene rraB CDS 277024..277788 product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218459.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene miaE CDS complement(278022..278363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 note possible pseudo, frameshifted CDS complement(278317..278511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 note possible pseudo, frameshifted CDS complement(278618..279121) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519079.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 279316..280503 product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066967.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(280645..283500) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416348.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(283500..283943) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190722.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene holC CDS complement(284080..285591) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397157.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene pepA CDS 286007..287086 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584132.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene lptF CDS 287086..288168 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182241.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene lptG CDS complement(288374..289372) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244064.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(289436..290755) product gnt-II system L-idonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128336.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene idnT CDS complement(290817..291581) product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998695.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene idnO CDS complement(291606..292637) product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197416.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene idnD CDS 292854..293384 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896738.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene idnK CDS complement(293412..294431) product NADPH-dependent aldehyde reductase Ahr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301967.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene ahr tRNA 294654..294738 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 295233..295733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 note possible pseudo, internal stop codon CDS 295810..296058 product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141823.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 296167..296406 product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817080.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 296409..296717 product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817079.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 297123..297281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(297295..297510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 note possible pseudo, frameshifted CDS complement(297803..298336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 note possible pseudo, frameshifted CDS 298784..299281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 299403..300143 product SEF14/SEF18 fimbria chaperone SefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001772663.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene sefB CDS 300160..302604 product SEF14/SEF18 fimbria usher protein SefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753917.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene sefC CDS 302601..303047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(303081..303896) product AraC family invasion system transcriptional regulator VirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005116773.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene virF CDS 304473..304682 product transcriptional regulator PefI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504713.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene pefI CDS 304667..305017 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135400.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 sequence24 source 1..7798 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(384..734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 note possible pseudo, frameshifted CDS 857..1216 product IS200/IS605-like element ISEc46 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064873.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene tnpA CDS complement(1343..1993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(2255..2980) product type III secretion system effector phosphothreonine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121867.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(3261..5036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(5088..5255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(5218..5985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(6159..6323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 note possible pseudo, frameshifted CDS complement(6497..6892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 sequence25 source 1..2072 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 106..663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 sequence26 source 1..3209 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(25..801) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253471.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(801..1784) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128344.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(2260..2958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703615.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 sequence27 source 1..116252 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2907..10214) product DUF823/DUF824 repeat adhesin RatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837143.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene ratB CDS complement(10380..15959) product DUF823 domain-containing adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375801.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(16097..17056) product SinI family autotransporter-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149068.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(17114..18994) product intimin-like inverse autotransporter SinH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002432009.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene sinH CDS complement(19504..19725) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402503.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(19814..21286) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249413.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene der CDS complement(21405..22583) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177072.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene bamB CDS complement(22594..23214) product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409190.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(23228..24502) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107147.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene hisS CDS complement(24613..25731) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551816.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene ispG CDS complement(25758..26762) product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090905.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene rodZ CDS complement(27054..28220) product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003206.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(28427..28858) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963846.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene ndk CDS complement(28979..29842) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247794.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(29842..30651) product dimethyl sulfoxide reductase anchor subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544883.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(30644..31273) product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077439.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene dmsB CDS complement(31270..33369) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098283.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(33804..36119) product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014751.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene pbpC CDS complement(36120..41054) product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681887.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 41263..42105 product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205251.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene sseA CDS 42351..43019 product DUF5066 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355346.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(43588..44373) product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612718.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene sseB CDS complement(44474..45757) product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133543.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene pepB CDS complement(45935..46135) product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523621.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene iscX CDS complement(46147..46482) product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124466.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene fdx CDS complement(46484..48334) product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196658.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene hscA CDS complement(48347..48862) product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384391.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene hscB CDS complement(49058..49381) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028952.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene iscA CDS complement(49410..49796) product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331704.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene iscU CDS complement(49824..51038) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775265.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene iscS CDS complement(51219..51713) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241346.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene iscR CDS complement(51873..52604) product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940032.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene trmJ CDS 52723..53526 product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553464.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene suhB CDS 53671..54549 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174949.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 54731..55555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 note possible pseudo, frameshifted CDS 55539..55775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 note possible pseudo, frameshifted CDS 55779..56597 product anaerobic sulfite reductase subunit AsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017585.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene asrB CDS 56608..57621 product sulfite reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020685.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene asrC CDS complement(57622..58608) product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098297.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(58599..59267) product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805721.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 59363..60640 product stationary phase inducible protein CsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982954.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene csiE CDS complement(60635..61774) product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173729.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(61970..63223) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919178.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 63548..64738 product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883143.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene hmpA CDS 64920..66464 product lysine decarboxylation/transport transcriptional activator CadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187128.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene cadC CDS 66825..68156 product cadaverine/lysine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100004.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene cadB CDS 68239..70383 product lysine decarboxylase CadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100652.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene cadA CDS 70439..71899 product dipeptide permease DtpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856790.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene dtpD CDS complement(71948..72286) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914032.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene glnB CDS complement(72363..73700) product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625590.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene glrR CDS complement(73697..74383) product two-component system QseEF-associated lipoprotein QseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054242.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene qseG CDS complement(74463..75848) product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001538042.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene qseE CDS 75926..76105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(76543..80430) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970035.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene purL CDS 80686..82230 product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734212.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene mltF CDS complement(82281..82799) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134566.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene tadA CDS complement(82857..83492) product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253562.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene yfhb CDS complement(83496..84857) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361665.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(84868..85761) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048539.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene murQ CDS 85877..86725 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995694.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(86764..87681) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684023.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(87703..88899) product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276374.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 89015..89941 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001581956.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 89979..90239 product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196291.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(90351..90731) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986043.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene acpS CDS complement(90731..91462) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818969.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene pdxJ CDS complement(91474..92202) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399380.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene recO CDS complement(92214..93119) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102231.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene era CDS complement(93116..93730) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989216.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene rnc CDS complement(94070..95044) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002559.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene lepB CDS complement(95061..96860) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790154.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene lepA CDS complement(97111..97590) product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589049.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene rseC CDS complement(97587..98543) product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812023.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene rseB CDS complement(98543..99193) product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168379.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene rseA CDS complement(99225..99800) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003307.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene rpoE CDS 100226..101848 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989173.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene nadB CDS complement(101833..102570) product tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083348.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene trmN CDS 102700..104034 product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219176.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene srmB CDS complement(104052..104951) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309673.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 105054..105641 product cysteine/O-acetylserine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188410.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene eamB CDS complement(105703..106086) product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627811.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene grcA CDS 106405..107094 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179978.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene ung CDS complement(107210..108247) product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997368.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 108451..108870 product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098738.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene trxC CDS 108943..109623 product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183640.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene tapT CDS 109677..112337 product protein lysine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082656.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene pat CDS 112449..113807 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949286.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene pssA CDS 113852..114175 product YfiM family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264473.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(114172..115473) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807800.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(115577..116032) product DUF4385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985648.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 sequence28 source 1..4330 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(31..999) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122320241.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(989..2653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(2637..3059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(3404..4144) product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817006.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 sequence29 source 1..2160 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(326..796) product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243713.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 1212..1592 product conjugal transfer relaxosome DNA-binding protein TraM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151524.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene traM CDS 1786..2097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 note possible pseudo, frameshifted sequence30 source 1..1156 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(450..737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 sequence31 source 1..1505581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(73..825) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301554.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene gpmA CDS complement(1049..2089) product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931431.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene galM CDS complement(2083..3231) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049364.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene galK CDS complement(3234..4280) product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187468.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene galT CDS complement(4291..5307) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265456.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene galE CDS complement(5530..6438) product DUF2167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885529.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(6609..8084) product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096923.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene modF CDS complement(8152..8940) product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147416.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene modE CDS 8967..9218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 9385..10158 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951413.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene modA CDS 10158..10847 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604026.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene modB CDS 10850..11908 product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891721.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene modC CDS complement(11909..12769) product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989132.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 12891..13886 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815470.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene pgl CDS complement(14030..15313) product putative acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094768.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 15605..16774 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249497.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene hutI CDS 16771..17712 product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195673.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene hutG CDS 17757..18482 product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287410.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 18679..20364 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115205.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene hutU CDS 20366..21886 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095232.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene hutH CDS complement(21971..22447) product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767403.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(22505..23794) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205503.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene bioA CDS 23881..24921 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090724.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene bioB CDS 24918..26075 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118943.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene bioF CDS 26059..26814 product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079913.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene bioC CDS 26807..27493 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167219.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene bioD CDS 28144..30165 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042501.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene uvrB CDS 30655..31491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 note possible pseudo, internal stop codon, frameshifted CDS 31579..32235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 note possible pseudo, internal stop codon, frameshifted CDS 32325..32909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 note possible pseudo, frameshifted CDS complement(33001..33909) product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246034.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene yvcK CDS 34273..35295 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168180.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene moaA CDS 35317..35829 product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084604.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene moaB CDS 35832..36317 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080893.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene moaC CDS 36310..36555 product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001575835.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene moaD CDS 36557..37009 product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545202.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene moaE CDS 37057..37761 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367602.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 38092..38613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 38655..39245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 39253..39813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(39816..40778) product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129824.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(40778..42019) product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649638.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene clsB CDS complement(42016..42774) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192041.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 42907..43317 product YbhQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871970.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(43279..44385) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469048.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(44501..45631) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045765.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(45624..47360) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287626.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(47353..48348) product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743445.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene hlyD CDS complement(48348..49022) product transcriptional regulator CecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025256.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene cecR CDS 49252..50613 product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007058.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene rhlE CDS 50821..52965 product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704815.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene dinG CDS 52995..53969 product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386513.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene ybiB CDS complement(54125..54385) product DUF1471 family protein YbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849089.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene ybiJ CDS complement(54670..54936) product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146332.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 55141..56067 product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305954.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene rlmF CDS complement(56064..58280) product mechanosensitive channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267712.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene ybiO CDS complement(58399..59121) product glutamine ABC transporter ATP-binding protein GlnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569093.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene glnQ CDS complement(59118..59777) product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159076.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene glnP CDS complement(59921..60667) product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838671.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene glnH CDS complement(61144..61647) product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100805.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene dps CDS complement(61950..62837) product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119558.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene rhtA CDS 63190..63705 product outer membrane protein OmpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716763.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene ompX CDS complement(63767..65347) product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089326.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(65612..65740) product manganase accumulation protein MntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001761.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene mntS CDS 65926..66399 product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533542.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene mntR CDS 66396..67508 product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046516.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(67552..68472) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056404.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene ldtB CDS 68691..70283 product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961480.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 70530..71426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(71548..71997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 note possible pseudo, internal stop codon CDS complement(72379..73644) product DUF1479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210972.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 73906..74715 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217910.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(74793..77225) product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192654.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(77231..78130) product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576948.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(78408..79157) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829275.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene moeB CDS complement(79157..80392) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343820.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene moeA CDS 80595..81536 product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030503.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene iaaA CDS 81547..83418 product glutathione ABC transporter ATP-binding protein GsiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120605.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene gsiA CDS 83451..84989 product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191432.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene gsiB CDS 85047..85970 product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936066.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene gsiC CDS 85973..86884 product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236024.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene gsiD CDS complement(86975..88300) product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073304.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene rimO CDS 88531..88914 product biofilm formation regulator BssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259651.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene bssR CDS 89627..90142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 90165..90914 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447049.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 90925..91878 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189890.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 91911..92174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 92171..93334 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085913.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 93783..95468 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449775.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(95474..96364) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811152.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(96626..97051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 97395..97895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 note possible pseudo, internal stop codon, frameshifted CDS 97913..98077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 note possible pseudo, internal stop codon, frameshifted CDS complement(98074..98700) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631908.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 99076..100146 product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195712.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene dacC CDS complement(100191..100949) product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450106.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene deoR CDS complement(101021..101695) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520197.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene ybjG CDS 101942..103174 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181284.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(103228..104043) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023559.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(104040..105251) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217437.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 105407..106039 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661882.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(106156..107643) product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024851.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(107683..107841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 note possible pseudo, internal stop codon CDS 108112..108489 product inner membrane protein YbjM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680848.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(108521..108784) product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495513.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 108954..109244 product YbjC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259133.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 109228..109950 product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075306.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene nfsA CDS 110008..110910 product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684361.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene rimK CDS 111007..111483 product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624817.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 111829..112944 product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125773.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene potF CDS 113032..114165 product putrescine ABC transporter ATP-binding subunit PotG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996054.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene potG CDS 114175..115128 product putrescine ABC transporter permease PotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105449.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene potH CDS 115125..115970 product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061634.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene potI CDS 116116..116517 product DUF2593 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763976.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 116560..117687 product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149787.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene rlmC CDS 117982..119325 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399316.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 119355..119675 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655400.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 119685..121172 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644028.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(121391..122122) product ABC transporter substrate-binding protein ArtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737538.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene artJ CDS complement(122359..123027) product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895396.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene artM CDS complement(123027..123743) product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001677.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene artQ CDS complement(123750..124481) product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756586.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene artJ CDS complement(124499..125227) product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027186.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene artP CDS complement(125457..125972) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270727.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 126100..126423 product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160725.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 126420..127250 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645850.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(127247..128260) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866904.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(128356..129789) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079004.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(129800..130801) product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566341.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene ltaE CDS complement(130840..132558) product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815309.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene poxB CDS complement(132716..133684) product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988821.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene hcr CDS complement(133696..135348) product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458773.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene hcp CDS complement(135492..136391) product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491116.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 136593..138251 product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599771.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(138248..139198) product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682088.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 139344..140462 product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201759.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene macA CDS 140459..142405 product macrolide ABC transporter ATP-binding protein/permease MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125880.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene macB CDS complement(142535..142756) product cold shock-like protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447499.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene cspD CDS 143080..143400 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520789.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene clpS CDS 143431..145707 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934058.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene clpA CDS complement(145920..146117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(146279..146656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14950 tRNA complement(147087..147174) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(147323..148000) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097901.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(148020..148880) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809962.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 148989..149900 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597928.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(149991..150209) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene infA CDS complement(150521..151225) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241650.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene aat CDS complement(151270..152991) product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202266.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene cydC CDS complement(152992..154758) product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044527.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene cydD CDS complement(154872..155840) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537407.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene trxB CDS 156386..156880 product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228469.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene lrp CDS 157015..161136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 161276..161890 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001765126.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene lolA CDS 161900..163243 product replication-associated recombination protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067785.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene rarA CDS 163502..164794 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886697.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene serS CDS 165031..167475 product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850260.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene dmsA CDS 167486..168103 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213069.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene dmsB CDS 168105..168968 product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534681.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 169318..170466 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029921.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 170684..172105 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134259.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(172398..173195) product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067928.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene pflA CDS 173771..174730 product SPI-1 type III secretion system effector SopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145541.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene sopD CDS complement(174806..177088) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292799.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene pflB CDS complement(177148..178005) product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642539.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene focA CDS complement(178410..180170) product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194823.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 180307..180999 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642873.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 181185..182273 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079590.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene serC CDS 182344..183627 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445205.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene aroA CDS 183770..184531 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792300.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 184704..185387 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125007.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene cmk CDS 185501..187174 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140324.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene rpsA CDS 187330..187614 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167332.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene ihfB CDS complement(187997..188188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 188234..190108 product ComEC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705794.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 190145..191893 product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551246.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene msbA CDS 191890..192867 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561698.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene lpxK CDS 192911..194143 product crosslink repair DNA glycosylase YcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056498.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene ycaQ CDS 194195..194377 product protein YcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350061.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene ycaR CDS 194374..195120 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011583.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene kdsB CDS 195331..196224 product YcbJ family phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436890.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(196204..196980) product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899546.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene elyC CDS 197116..197919 product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154025.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene cmoM CDS 197912..199234 product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288827.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene mukF CDS 199215..199919 product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295931.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene mukE CDS 199919..204385 product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572729.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene mukB CDS 204730..206580 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925899.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene ldtD CDS 206840..207388 product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357053.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 207416..208063 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109472.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(208125..209315) product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462648.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene aspC CDS complement(209500..210591) product porin OmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977709.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene ompF CDS complement(211185..212585) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117867.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene asnS CDS complement(212786..213247) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762345.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(213311..213478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 213565..214779 product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047950.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene dpaL CDS 215025..216461 product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893189.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(216539..217741) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191411.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene pncB CDS complement(217826..218035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(217936..218346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 218367..218996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 218980..219606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 219603..221312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 221312..221893 product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885576.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 222767..223339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 223607..223855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 note possible pseudo, frameshifted CDS complement(223987..224613) product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419689.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(224973..225659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(225930..226121) product DinI-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497441.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 226548..229160 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193884.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene pepN CDS 229368..230378 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291724.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene pyrD CDS 230544..231086 product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220671.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene zapC CDS complement(231083..232192) product YcbX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224084.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 232291..234399 product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086472.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene rlmKL CDS 234412..236319 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053045.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 236334..237587 product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333152.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene pqiA CDS 237592..239232 product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433416.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene pqiB CDS 239229..239792 product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759136.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene pqiC CDS complement(240315..240833) product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227928.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene fabA CDS complement(240902..242662) product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156455.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 242848..243300 product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877174.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene matP CDS complement(243372..244424) product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989142.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene ompA CDS complement(244781..245161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 245507..246112 product TfoX/Sxy family DNA transformation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202371.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(246099..248252) product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950867.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene yccS CDS complement(248271..248717) product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261222.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 248841..250895 product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420526.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene helD CDS complement(250931..251389) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424187.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene mgsA CDS complement(251484..252146) product DUF2057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847719.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 252320..252733 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975203.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(252778..253095) product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561983.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene hspQ CDS complement(253153..254364) product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140485.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene rlmI CDS 254579..255127 product Raf kinase inhibitor-like protein YbcL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313946.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene ybcL CDS 255144..255932 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330817.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 255981..256262 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072884.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene yccX CDS complement(256259..256588) product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904446.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene tusE CDS complement(256675..257334) product FtsH protease modulator YccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374046.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene yccA tRNA 257729..257816 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(257953..258633) product type III secretion system effector protease PipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938184.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene pipA CDS complement(258853..259728) product SPI-2 type III secretion system effector PipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123042.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene pipB CDS complement(260276..260617) product type III secretion system chaperone SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444726.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene sigE CDS complement(260634..262319) product SPI-1 type III secretion system effector inositol phosphate phosphatase SopB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166955.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene sopB CDS complement(263041..264603) product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760238.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(264683..266047) product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240036.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(266040..266708) product response regulator transcription factor HprR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343829.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene hprR CDS 266856..267266 product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833187.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene hiuH CDS complement(267599..268111) product 4-hydroxyphenylacetate 3-monooxygenase reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195559.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(268129..269691) product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801496.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene hpaB CDS complement(269909..270349) product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543921.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene hpaR CDS 270624..271913 product 4-hydroxyphenylacetate degradation bifunctional isomerase/decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679210.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene hpaG CDS 271910..273376 product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723530.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene hpaE CDS 273378..274229 product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516973.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene hpaD CDS 274239..274619 product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119858.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 274762..275565 product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884795.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene hpaH CDS 275576..276367 product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785061.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene hpaI CDS 276440..277816 product 4-hydroxyphenylacetate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285789.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene hpaX CDS 277826..278722 product 4-hydroxyphenylacetate catabolism regulatory protein HpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000336599.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene hpaA CDS 278736..279674 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976557.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(281098..281403) product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284251.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene cbpM CDS complement(281403..282323) product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420603.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene cbpA CDS 282559..282921 product copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118904.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 282970..284856 product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972986.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 284853..285476 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876697.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 285466..285972 product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907521.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 286105..286521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 note possible pseudo, internal stop codon CDS 286528..287346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 note possible pseudo, internal stop codon CDS complement(287380..287607) product YccJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143126.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(287628..288224) product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062894.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene wrbA CDS 288609..288776 product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273665.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 288913..289551 product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083125.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene rutR CDS complement(289548..289943) product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821059.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(290002..293982) product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537509.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene putA CDS 294404..295912 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018468.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene putP CDS 296530..296826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 296805..297593 product phosphate starvation-inducible protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001617488.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene phoH CDS complement(297699..298580) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433673.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(298866..300362) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261398.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(300699..301379) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054243.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 301897..303039 product N-acetylneuraminate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525766.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 303085..303777 product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700857.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 304060..305340 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560763.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 305351..306457 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988585.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(306624..306917) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096224.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 306948..307166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(307768..308226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(308350..308721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(308730..309170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(309190..310062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(310095..310574) product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284958.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(310562..311953) product type VI secretion system ImpA and VasL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087741.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(311964..314510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 tRNA 312709..312795 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS 314633..315031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 315250..315501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 315826..316122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 316190..316642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 note possible pseudo, frameshifted CDS 316705..317154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16460 note possible pseudo, frameshifted CDS 317348..317647 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169527.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 317644..318135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 note possible pseudo, frameshifted CDS 318132..318497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 note possible pseudo, frameshifted CDS complement(318636..319415) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086142.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 319683..319961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 note possible pseudo, frameshifted CDS 320018..320335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 note possible pseudo, internal stop codon, frameshifted CDS 320875..321087 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208507.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(321112..321291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(321545..322741) product porin OmpS1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080666.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene ompS1 CDS 323391..323702 product cell division protein DrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107435.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene drpB CDS 323782..324477 product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377043.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 324551..325981 product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157299.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 325962..326432 product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785981.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(326421..327341) product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212262.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene yedA CDS 327517..328428 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922683.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 328505..328690 product YodC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178602.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 328855..330567 product cellulose biosynthesis regulator diguanylate cyclase DgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119838.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene dgcQ CDS complement(330546..331361) product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948794.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(331671..331898) product YodD family peroxide/acid resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844798.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene yodD CDS 332027..332221 product protein DsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867218.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene dsrB CDS complement(332260..332883) product transcriptional regulator RcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103972.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene rcsA CDS complement(333165..333959) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616875.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene fliR CDS complement(333968..334237) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187355.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene fliQ CDS complement(334247..334984) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253411.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene fliP CDS complement(334984..335361) product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978276.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene fliO CDS complement(335361..335774) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282109.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene fliN CDS complement(335771..336775) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502815.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene fliM CDS complement(336780..337247) product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132172.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene fliL CDS complement(337352..338569) product flagellar hook length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631663.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene fliK CDS complement(338566..339009) product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046981.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene fliJ CDS complement(339031..340401) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213259.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene fliI CDS complement(340401..341108) product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064158.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene fliH CDS complement(341101..342096) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067735.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene fliG CDS complement(342089..343771) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276841.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene fliF CDS 343988..344302 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719033.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene fliE CDS complement(344422..344808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639596.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(345073..345306) product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790504.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene yedF CDS complement(345303..346508) product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580669.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene yedE CDS 346694..347107 product lipoprotein YedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754694.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene yedD CDS complement(347147..348631) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795470.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene amyA CDS complement(348703..349071) product flagella biosynthesis regulatory protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204899.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene fliT CDS complement(349071..349478) product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287765.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 gene fliS CDS complement(349493..350899) product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146805.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene fliD CDS 350799..351137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 351155..352672 product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079784.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 352751..353956 product flagellin lysine-N-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816588.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene fliB CDS 354183..354872 product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087453.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 354931..355482 product flagella biosynthesis regulatory protein FliZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218080.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene fliZ CDS 355581..356429 product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761628.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene tcyJ CDS 356583..357569 product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128192.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene dcyD CDS 357590..358258 product cystine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158238.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene tcyL CDS 358255..359007 product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273033.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene yecC CDS 359240..359962 product transcriptional regulator SdiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157173.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene sdiA CDS complement(360029..360253) product DUF2594 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106483.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 360717..361373 product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611323.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene uvrY CDS 361370..363202 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289473.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene uvrC CDS 363259..363807 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160192.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene pgsA tRNA 363959..364034 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA 364086..364159 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA 364171..364257 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS 364613..364837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 365057..366490 product SH3 domain-containing C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989033.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 366703..367029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 367268..367933 product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781529.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(368008..369276) product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001562965.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene tyrP CDS 369446..369685 product YecH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377238.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(369731..370228) product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920615.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene ftnA CDS complement(370468..370803) product YecR-like lipofamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803230.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 371059..371697 product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705970.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(371876..372379) product non-heme ferritin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741707.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 372929..373486 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754799.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 373715..373897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 note possible pseudo, internal stop codon CDS 374120..374923 product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840119.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene otsB CDS 374898..376319 product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089042.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene otsA CDS complement(376337..376765) product universal stress protein UspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122416.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene uspC CDS 377561..377902 product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518146.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene flhD CDS 377905..378483 product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605989.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene flhC CDS 378608..379495 product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906317.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene motA CDS 379492..380421 product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795656.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene motB CDS 380432..382441 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061308.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene cheA CDS 382462..382965 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147296.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene cheW CDS 383202..384863 product methyl-accepting chemotaxis protein II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483273.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene tar CDS 385017..385883 product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204368.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene cheR CDS 385880..386929 product protein-glutamate methylesterase/protein glutamine deamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036391.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene cheB CDS 386947..387336 product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763861.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene cheY CDS 387347..387991 product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983587.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene cheZ CDS 388185..389336 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797087.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene flhB CDS 389329..391407 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002392.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene flhA CDS 391407..391799 product flagellar protein FlhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233619.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene flhe CDS 392036..393175 product glycoside hydrolase family 105 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989908.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(393229..395100) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446482.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene mrdA CDS complement(395289..397022) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025371.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene argS CDS 397259..397828 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024793.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 397848..398594 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185770.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene cutC CDS complement(398830..399801) product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569029.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene cmoB CDS complement(399798..400541) product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019609.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene cmoA CDS complement(400582..400977) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252975.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(401030..401848) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639226.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(401845..402411) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916144.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 402736..404508 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258634.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene aspS CDS 404611..405063 product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653696.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene nudB CDS 405093..405833 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907242.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 405870..406391 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022509.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene ruvC CDS complement(406393..406992) product YebB family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716741.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 407510..407893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 408253..408864 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580335.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene ruvA CDS 408873..409883 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568508.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene ruvB CDS complement(409962..410747) product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571518.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene znuB CDS complement(410744..411499) product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203015.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene znuC CDS 411578..412522 product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625584.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene znuA CDS 412538..413857 product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001184019.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene mepM CDS 413974..414945 product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448401.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene lpxM CDS complement(415018..416460) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091158.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene pyk CDS complement(416584..417453) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056719.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 417795..419270 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301712.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene zwf CDS 419505..421316 product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069125.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene edd CDS 421354..421995 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800493.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene kdgA CDS complement(422095..423273) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173426.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene purT CDS 423404..423694 product DNA damage-inducible protein YebG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257728.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene yebG CDS 423762..424115 product protein YebF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042123.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene yebF CDS 424209..424868 product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024713.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 425081..427132 product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936997.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene ptrB CDS complement(427169..427867) product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944282.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene exoX CDS complement(427891..428547) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100250.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(428655..428885) product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856224.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 429023..429397 product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168393.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene yobA CDS 429398..430273 product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979693.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene copD CDS 430290..430643 product YebY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722366.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(431026..432105) product phage integrase Arm DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189090.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(432080..432358) product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311878.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 432772..434751 product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237518.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 435440..435688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517636.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 435752..436351 product DUF1367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940329.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 436348..436575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 436705..437394 product bacteriophage antitermination protein Q inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705893.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 437491..438015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(438389..438838) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798706.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(439199..439885) product type III secretion system effector protease PipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938184.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene pipA CDS 440155..440490 product phage holin, lambda family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120501.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 440477..440926 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095605.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 440923..441423 product prophage endopeptidase RzpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082739.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene rzpD CDS 441631..441945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 442022..442201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(442318..442851) product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161597822.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 442941..443636 product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152615.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 443921..444871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 note possible pseudo, internal stop codon CDS 444914..446281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 note possible pseudo, internal stop codon CDS 446424..447140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 note possible pseudo, frameshifted CDS 447196..447489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(447691..448413) product SPI-1 type III secretion system guanine nucleotide exchange factor SopE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161708.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene sopE CDS 448626..448778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 note possible pseudo, internal stop codon, frameshifted CDS complement(448893..449693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(450638..450907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 note possible pseudo, frameshifted CDS complement(450922..451533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 note possible pseudo, frameshifted CDS complement(451551..452204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 452235..452465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 note possible pseudo, internal stop codon CDS 452555..453052 product DUF2514 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050879.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(453309..453476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 453784..454275 product DUF1441 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348565.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 454262..454441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 454828..455424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 455514..455690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 note possible pseudo, internal stop codon CDS 455745..456431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 note possible pseudo, internal stop codon CDS 456380..456880 product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885577.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(456977..457177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(459007..459405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(459631..459789) product DUF5993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480735.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 460616..460852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 461436..461654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 462622..463782 product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209743.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(464036..464215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 464597..464791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS 464923..465342 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354403.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(465715..466191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030950.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(466521..466916) product DUF1398 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422884.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 467600..468322 product SPI-1 type III secretion system guanine nucleotide exchange factor SopE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161708.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene sopE CDS 468607..468771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 468744..468977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 468998..469645 product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986169.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene pphA CDS complement(469664..469855) product DUF1482 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457838.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(469966..470205) product YebV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978523.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(470320..471861) product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989184.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene rsmF CDS complement(471837..474470) product PqiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551143.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(474439..475722) product membrane integrity lipid transport subunit YebS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207300.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene yebS CDS 475851..476348 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145727.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 476446..477132 product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431401.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene proQ CDS 477152..479200 product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091235.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene prc CDS 479394..480275 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984498.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene htpX CDS complement(480323..481618) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296135.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 481506..481709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 481872..482663 product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262197.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene kdgR CDS complement(482875..483114) product invasion protein YobH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236782.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene yobH CDS 483486..483773 product YebO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000660.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 484578..484787 product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062678.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene cspE CDS 485007..486752 product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730322.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene ftsI CDS 486818..487627 product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010934.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene rlmA CDS complement(487624..488190) product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518359.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene mntP CDS complement(488600..489058) product DUF986 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156273.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(489117..489968) product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518647.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(489981..490781) product PTS mannose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406918.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 gene manY CDS complement(490834..491802) product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150523.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene manX CDS 492275..493834 product CNNM family cation transport protein YoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421821.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene yoaE CDS complement(493856..495202) product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192512.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 495176..495337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(495595..496959) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624274.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene sdaA CDS complement(497223..497801) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381544.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(497805..499169) product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978456.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene pabB CDS 499250..499429 product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457328.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(499435..499779) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029549.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 499910..501820 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128807.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 501878..502573 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221014.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene tsaB CDS 502645..503226 product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290594.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 503431..505116 product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758418.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene fadD CDS 505189..506316 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109129.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene rnd CDS complement(506438..506704) product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185666.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene minE CDS complement(506708..507520) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101048.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene minD CDS complement(507544..508251) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072527.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene minC CDS 508377..508670 product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250286.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 508720..509379 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519895.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 509472..509918 product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785857.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 510270..510407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 510599..510772 product addiction module toxin, GnsA/GnsB family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083582.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(510844..511185) product DUF1971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018971.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(511294..511824) product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943475.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene dsbB CDS complement(511966..513510) product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406446.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene nhaB CDS 513730..514449 product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234821.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene fadR CDS complement(514496..516028) product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240763.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 516351..517649 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266934.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 517663..518733 product catabolic alanine racemase DadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197904.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene dadX CDS complement(518796..520529) product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000338376.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(520626..521540) product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051613.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene ldcA CDS 521819..522322 product membrane-bound lytic murein transglycosylase EmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776974.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene emtA CDS complement(522336..523070) product flagellar brake protein YcgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017410.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene ycgR CDS 523239..523493 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511323.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(523556..525268) product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841738.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene treA CDS complement(525482..526756) product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366353.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(527253..528389) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888121.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene appB CDS complement(528401..529945) product cytochrome bd-II oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263597.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene appC CDS complement(530020..530868) product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063377.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(530865..531269) product hydrogenase-1 operon protein HyaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262577.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene hyaE CDS complement(531259..531855) product hydrogenase 1 maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993803.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(531852..532583) product Ni/Fe-hydrogenase b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147028.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene hyaC CDS complement(532602..534395) product Ni/Fe-hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070982.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene hyaB CDS complement(534392..535510) product hydrogenase 1 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058323.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene hyaA CDS complement(535691..535900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(536425..536877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(536916..537263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(538295..539386) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505850.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene ychF CDS complement(539503..540087) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985595.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene pth CDS 540363..540641 product stress-induced protein YchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823885.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene ychH CDS complement(540686..542371) product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037188.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene dauA CDS complement(542496..543443) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518537.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene prs CDS complement(543709..544560) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988253.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene ispE CDS complement(544557..545180) product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174482.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene lolB CDS 545494..546750 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173208.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene hemA CDS 546791..547873 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804703.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene prfA CDS 547873..548706 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347320.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene prmC CDS 548703..549092 product invasion regulator SirB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150667.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene sirB2 CDS 549096..549905 product invasion regulator SirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257065.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene sirB1 CDS 549943..550797 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811046.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene kdsA CDS complement(550851..551951) product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148419.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene chaA CDS 552218..552448 product putative cation transport regulator ChaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146392.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene chaB CDS complement(552528..552881) product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179794.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 553058..554482 product YchO/YchP family invasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008985.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(554483..555133) product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064595.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene narL CDS complement(555126..556922) product nitrate/nitrite two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476239.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene narX CDS 557263..558660 product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019848.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene narK CDS 559048..562791 product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032878.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 562788..564326 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702629.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene narH CDS 564323..565033 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571671.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene narJ CDS 565033..565710 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545591.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene narI CDS 565952..567481 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212716.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 tRNA complement(568108..568192) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(568403..568487) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(568828..569670) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191159.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene purU CDS complement(569721..570053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 570299..571195 product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230581.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene rssA CDS 571286..572299 product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193432.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene rssB CDS 572502..573410 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729450.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene galU CDS complement(573542..573955) product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287383.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene hns CDS 574618..575235 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068097.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene tdk CDS complement(575432..578110) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301680.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene adhE CDS 578587..579234 product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615840.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 579998..581629 product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560668.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene oppA CDS 581751..582671 product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911094.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene oppB CDS 582686..583582 product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096272.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene oppC CDS 583594..584601 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058853.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 584598..585602 product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994698.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene oppF CDS 585650..586486 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045367413.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(586534..586884) product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069343.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 note possible pseudo, internal stop codon, frameshifted CDS complement(586897..588357) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206886.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene cls CDS complement(588717..589013) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967605.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 589237..589965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(590024..590425) product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210317.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene yciA CDS complement(590586..591125) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808682.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(591182..591925) product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028506.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 592693..593331 product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714798.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene ompW CDS complement(593413..594291) product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488351.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(594311..594817) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109977.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(594891..595394) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022822.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(595484..595666) product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807657.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(596146..596952) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443029.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene trpA CDS complement(596952..598145) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209485.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene trpB CDS complement(598155..599513) product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195287.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene trpCF CDS complement(599517..601112) product bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763483.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene trpD CDS complement(601112..602674) product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194375.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 602935..603816 product RNase AM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500433.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene rnm CDS 603824..604444 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077250.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 604545..605420 product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291232.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene rluB CDS complement(605507..606097) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278854.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene cobO CDS complement(606094..606855) product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559310.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 607093..608139 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422082.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene sohB CDS complement(608181..608432) product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548616.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 608835..611432 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513593.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene topA CDS 611843..612817 product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776231.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene cysB CDS 613794..616469 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099459.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene acnA CDS complement(616525..617115) product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176284.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene ribA CDS 617311..618075 product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948651.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene pgpB CDS 618225..618533 product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876301.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 618540..619709 product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891378.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene lapB CDS 619900..620637 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763993.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene pyrF CDS 620637..620963 product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285199.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene yciH CDS complement(621083..621301) product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480930.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene osmB CDS complement(621560..622312) product DNA-binding transcriptional regulator YciT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088593.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(622399..622578) product protein YciZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069350.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene yciZ CDS complement(622700..624691) product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989147.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene pdeR CDS complement(624944..626878) product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000485046.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(626967..628100) product CMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298115.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(628300..629088) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506501.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene fabI CDS 630089..631066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 631533..632240 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268399.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(632256..633062) product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230463.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene sapF CDS complement(633064..634056) product peptide ABC transporter ATP-binding protein SapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128869.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene sapD CDS complement(634056..634946) product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146150.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene sapC CDS complement(634933..635898) product peptide ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583298.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene sapB CDS complement(635895..637544) product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241626.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene sapA CDS complement(637656..638636) product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764157.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene pspF CDS 638807..639475 product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511000.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene pspA CDS 639535..639759 product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274953.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene pspB CDS 639759..640118 product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014347.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene pspC CDS 640141..640359 product phage shock protein PspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097607.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene pspD CDS 640435..640749 product thiosulfate sulfurtransferase PspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913432.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene pspE CDS 640898..642295 product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825858.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 642292..643353 product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294457.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 643501..645042 product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235493.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene tyrR CDS complement(645132..645638) product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084375.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene tpx CDS 645754..646719 product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258077.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene ycjG CDS complement(646694..647422) product murein tripeptide amidase MpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219125.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene mpaA CDS 647612..649225 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216556.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(649322..650251) product aromatic alcohol reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814344.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 650370..651275 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359197.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 651584..652420 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456775.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(652511..653224) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979081.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene bdcA CDS 653302..653892 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208481.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 654021..654257 product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168017.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(654471..655088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(655972..656823) product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989022.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 657210..657968 product two-partner-like secretion system exoprotein ZirU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273672.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene zirU CDS 658043..660025 product two-partner secretion translocator ZirT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232040.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene zirT CDS 660151..660876 product two-partner-like secretion system exoprotein ZirS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242932.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene zirS CDS 661014..661532 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062616.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(661639..661977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051816.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(662005..662691) product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097260.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 662735..663337 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163369.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(663419..664450) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493669.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 664689..664943 product DUF2534 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605645.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(664998..665945) product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262143.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene uspE CDS complement(666096..666848) product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611917.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene fnr CDS complement(667044..667559) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945036.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene ogt CDS 667817..668380 product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046807.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene smrA CDS 668854..669945 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945629.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 670091..671074 product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387372.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene zntB CDS 671561..672934 product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096453.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene dbpA CDS complement(672978..673913) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156215.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene ttcA CDS complement(673965..674237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(674230..674847) product exodeoxyribonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105118.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(674875..675192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(675277..675498) product killing protein KilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560226.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene kilR CDS 675936..676457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(676447..676572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(676565..676729) product YdaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169151.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(677105..677572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 677884..678174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(678336..678890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(678887..679819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 680246..680401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 680692..680862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 680925..681524 product DUF1367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940304.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 681524..681814 product DUF1364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228038.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 681811..682347 product DUF1133 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640158.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 684518..684913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 684835..685023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 685013..685294 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705707.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 685291..685836 product putative peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166765.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 685833..686042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 686682..687020 product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159242.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(687070..687504) product universal stress protein UspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082296.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene uspF CDS 687718..687927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(687986..691510) product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193255.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene nifJ CDS complement(692096..692506) product heat shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725242.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene hslJ CDS complement(692617..693606) product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762205.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene ldhA CDS 693846..696482 product YdbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677026.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 696482..696673 product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784063.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 696681..697004 product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760346.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 697258..697596 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518898.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(697593..698198) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048924.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene azoR CDS 698381..702301 product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001785213.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene hrpA CDS 702365..703165 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098505.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 703282..703812 product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005022464.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene cybB CDS complement(704083..704745) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239881.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS complement(705209..705799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 note possible pseudo, frameshifted CDS complement(705829..706332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 note possible pseudo, internal stop codon, frameshifted CDS complement(706895..707575) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560165.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(707572..708303) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185897.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(708328..708960) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094452.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(708982..709593) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949382.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 710651..710995 product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281194.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(711116..712342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 714537..714812 product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096678.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 714844..715962 product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366371.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 716131..717756 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419375.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(717817..718740) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366376.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 719033..720376 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013762.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 720425..721933 product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933982.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 722183..723808 product glucan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081955.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 724013..724579 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024312.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(724757..725476) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027219.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(725567..726610) product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197408.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene idnD CDS complement(726627..727988) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769658.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(728072..728839) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971598.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 729177..730430 product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602314.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene rspA CDS complement(730571..731008) product cryptic aminoglycoside N-acetyltransferase AAC(6')-Iy/Iaa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354865.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene aac(6') CDS complement(731008..731805) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001670738.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(731815..732447) product ribulose-phosphate 3 epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600614.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(732459..732896) product SgcA family PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606458.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene sgcA CDS complement(733028..733834) product BtpA family protein SgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118614.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene sgcQ CDS complement(733848..735161) product PTS sugar transporter subunit IIC SgcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460840.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene sgcC CDS complement(735172..735453) product PTS sugar transporter subunit IIB SgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976132.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene sgcB CDS complement(735450..736568) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144622.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 736785..737324 product 50S ribosomal protein L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229308.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 gene rimL CDS complement(737321..738301) product YdcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599089.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene ydcK CDS 738408..739421 product dicarboxylate transporter/tellurite-resistance protein TehA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000336113.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene tehA CDS 739408..740004 product tellurite resistance methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218282.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene tehB CDS 740160..740828 product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259016.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(740882..742060) product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238501.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 742153..742689 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369547.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 742768..744732 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249757.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(744733..744966) product DUF2554 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956438.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 744997..745185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(745237..745632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 746724..747122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747901.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 747644..748414 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237711.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 748550..749974 product GntR family transcriptional regulator YdcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760699.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene ycdR CDS 750089..751534 product aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158107.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene patD CDS complement(752151..754295) product virulence-associated effector SrfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165637.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene srfC CDS complement(754292..757285) product virulence factor SrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960825.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(757278..758603) product virulence-associated effector SrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129948.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene srfA CDS 758827..759060 product YdcY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018716.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(759065..759514) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076571.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(759514..760029) product L-methionine sulfoximine/L-methionine sulfone acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155377.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene mddA CDS 760241..761278 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682108.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 761612..762277 product colanic acid/biofilm transcriptional regulator McbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119592.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene mcbR CDS complement(762333..764351) product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692046.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene pqqU CDS 764717..765778 product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550638.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 765923..766144 product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732362.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(766221..767714) product L-asparagine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857112.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene ansP CDS 768227..768859 product type III secretion system effector SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147139.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene steA CDS 769142..769987 product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200336.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene nhoA CDS complement(770023..770916) product PhzF family isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804298.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(771022..771702) product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617102.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene narI CDS complement(771699..772394) product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166289.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene narW CDS complement(772394..773938) product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702603.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene narH CDS complement(773935..777675) product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040363.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(777767..779005) product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198245.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(779370..779948) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121044.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 780066..781553 product methyl viologen efflux MFS transporter SmvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489748.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene smvA CDS complement(781578..782018) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338748.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(782102..783190) product porin OmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096520.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 783273..783455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(783713..784594) product aromatic amino acid efflux DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198225.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene yddG CDS 784872..787919 product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602782.1 transl_table 11 codon_start 1 transl_except (pos:785457..785459,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_21220 gene fdnG CDS 787933..788817 product formate dehydrogenase N subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240581.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene fdnH CDS 788810..789466 product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045648.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene fdnI CDS complement(789557..790567) product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642447.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene adhP CDS complement(790849..792546) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450511.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(792723..792866) product stationary-phase-induced ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841559.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene sra CDS complement(792961..793176) product biofilm-dependent modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495700.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene bdm CDS 793689..794120 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152297.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 794470..794799 product acid-activated periplasmic chaperone HdeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032161.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene hdeB CDS 794942..795727 product OBAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698597.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 795856..797640 product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095550.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene treZ CDS 797637..800165 product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613170.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene treY CDS 800222..802297 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096571.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene glgX CDS complement(802410..803612) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000336171.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(803625..805076) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261868.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene nhaC CDS complement(805220..806200) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211038.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 806458..806739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 806894..807097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(807028..807360) product DUF1493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704508.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 807687..807854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(807912..808985) product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954693.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(809178..809666) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293639.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 809711..811219 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223342.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 811209..812450 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095727.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 812694..814076 product PhoPQ-activated pathogenicity-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476914.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 814253..815539 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824230.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 815514..816539 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864933.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(816598..817269) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518759.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(817435..818523) product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976508.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 819065..820057 product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194451.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS 820060..821862 product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089679.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 821882..822556 product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924456.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene cybH CDS 822562..823170 product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852667.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene hybD CDS 823170..823469 product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334908.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene hypC CDS 823466..823876 product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155978.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 823894..824955 product hydrogenase expression/formation C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016742.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 824927..825115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 825129..825830 product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189412.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 825843..826184 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544945.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene hypA CDS complement(826325..827443) product porin OmpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837937.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene ompN CDS 828075..828272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 828226..828702 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513115.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(828758..829672) product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001670736.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(829927..830286) product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992456.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(830286..831212) product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257409.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene glsB CDS complement(831285..832673) product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178397.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene sad CDS 832776..833648 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366540.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 833764..834954 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154617.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(835001..835666) product MarC family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968968.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS 835925..836359 product multiple antibiotic resistance transcriptional regulator MarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843434.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene marR CDS 836379..836762 product MDR efflux pump AcrAB transcriptional activator MarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091194.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene marA CDS 836791..837006 product multiple antibiotic resistance protein MarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783049.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene marB CDS complement(837125..838027) product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987753.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene eamA CDS 838255..839442 product efflux MFS transporter YdeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068053.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene ydeE CDS complement(840133..840525) product YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776348.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 840953..841480 product 2-oxo-tetronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235351.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(841616..841798) product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807642.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(842142..844184) product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106277.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 gene dcp CDS 844323..845069 product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636564.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene ydfG CDS 845199..845885 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215563.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS 846067..846270 product putative selenium delivery protein YdfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989267.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene ydfZ CDS complement(846337..847803) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181244.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(847947..849326) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192118.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(849380..850399) product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096790.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(850410..851624) product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706283.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene rspA CDS complement(851746..852072) product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921383.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 852224..852565 product DUF1283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066440.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 852601..853161 product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199998.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene speG CDS complement(853202..853879) product YnfC family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743128.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS 854019..854324 product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059218804.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 854481..856919 product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117601.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 857018..859453 product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705268.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 859464..860081 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213069.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene dmsB CDS 860083..860940 product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534718.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS 860983..861597 product Tat proofreading chaperone DmsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206559.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 gene dmsD CDS 861902..862612 product osmoprotectant ABC transporter permease OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547814.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene osmY CDS 862641..863543 product osmoprotectant ABC transporter substrate-binding protein OsmX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211196.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 gene osmX CDS 863553..864200 product osmoprotectant ABC transporter permease OsmW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379676.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 gene osmW CDS 864200..865348 product osmoprotectant ABC transporter ATP-binding protein OsmV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593089.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene osmV CDS 865484..866773 product voltage-gated ClC-type chloride channel ClcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554911.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene clcB CDS complement(866729..867424) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919236.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 gene bioD CDS complement(867550..868770) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225096.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(868898..869797) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019571.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(870081..870275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 870274..871170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 871565..871813 product acid resistance repetitive basic protein Asr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001766314.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene asr CDS 872082..872903 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549642.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(872943..873272) product multidrug/spermidine efflux SMR transporter subunit MdtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183821.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 gene mdtI CDS complement(873259..873621) product multidrug/spermidine efflux SMR transporter subunit MdtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500278.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene mdtJ CDS 874039..875073 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118268.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(875248..876636) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014056.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene pntB CDS complement(876647..878176) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219360.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene pntA CDS 878703..879647 product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769298.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene ydgH CDS 879946..881328 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412353.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(881390..881725) product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524877.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 881852..882583 product two-component system response regulator RstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080045.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene rstA CDS complement(882761..883006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 883063..884214 product porin OmpS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824321.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene ompS2 CDS 884373..886073 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928668.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 886184..887485 product two-component system sensor histidine kinase RstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732951.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene rstB CDS 887561..888490 product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092483.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene tus CDS complement(888487..889890) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259129.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene fumC CDS complement(890058..891704) product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066606.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene fumB CDS 891904..893079 product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170615.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene manA CDS 893182..894690 product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753325.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 894880..895029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22270 note possible pseudo, frameshifted CDS 895385..896386 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565566.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene add CDS complement(896461..897501) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343837.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 898132..898347 product transcription modulator YdgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217946.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene ydgT CDS 898403..898876 product DUF2569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214061.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 898953..899534 product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133179.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene rsxA CDS 899534..900112 product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092600.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene rsxB CDS 900105..902219 product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915582.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene rsxC CDS 902220..903278 product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231887.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene rsxD CDS 903282..903902 product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920820.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene rsxG CDS 903905..904597 product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289628.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 904597..905232 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030324.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene nth CDS 905833..907338 product dipeptide/tripeptide permease DtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100913.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene dtpA CDS 907443..908048 product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765713.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene gstA CDS complement(908107..908967) product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789751.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene pdxY CDS complement(909027..910301) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168626.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene tyrS CDS complement(910428..911084) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282834.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene pdxH CDS complement(911143..911448) product C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061974.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene mliC CDS complement(911560..912681) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835021.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene anmK CDS 912953..913420 product outer membrane lipoprotein SlyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597179.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene slyB CDS complement(913468..913902) product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445639.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene slyA CDS 914342..915202 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016506.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 915202..917241 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777620.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(917217..917738) product superoxide dismutase [Cu-Zn] SodC2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826818.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene sodC2 CDS complement(917818..918714) product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250718.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 919107..919706 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041823.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 919765..920862 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092935.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 920931..921338 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237787.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene gloA CDS 921439..922086 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282267.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene rnt CDS complement(922164..922511) product monothiol glutaredoxin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108176.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene grxD CDS complement(922756..922941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 923225..923668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 923795..924376 product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007299.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene sodB CDS 924844..925869 product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190992.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene purR CDS complement(925866..926798) product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269528.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene punR CDS 926911..928116 product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182326.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene punC CDS 928406..929554 product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098879.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene cfa CDS complement(929596..930237) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493973.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 930454..931827 product multidrug efflux MATE transporter MdtK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175077.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 tRNA 931979..932055 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA 932066..932142 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(932300..933358) product SPI-2 type III secretion system apparatus protein SsaU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291715.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene ssaU CDS complement(933355..934134) product SPI-2 type III secretion system apparatus protein SsaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194051.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene ssaT CDS complement(934135..934401) product SPI-2 type III secretion system apparatus protein SsaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999977.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene ssas CDS complement(934398..935045) product SPI-2 type III secretion system export apparatus protein SsaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056360.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 gene ssaR CDS complement(935113..936081) product SPI-2 type III secretion system cytoplasmic ring protein SsaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944194.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene ssaQ CDS complement(936062..936436) product SPI-2 type III secretion system apparatus protein SsaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223304.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 gene ssaP CDS complement(936417..936794) product SPI-2 type III secretion system apparatus protein SsaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449096.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 gene ssaO CDS complement(936797..937822) product SctN family type III secretion system ATPase SsaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787208.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene ssaN CDS complement(938088..940133) product SPI-2 type III secretion system apparatus protein SsaV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258227.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene ssaV CDS complement(940118..940486) product SPI-2 type III secretion system apparatus protein SsaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383695.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 gene ssaM CDS complement(940544..941536) product SPI-2 type III secretion system apparatus protein SsaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238877.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene ssaL CDS complement(941526..942200) product SPI-2 type III secretion system apparatus protein SsaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011199.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene ssaK CDS complement(942763..943410) product SPI-2 type III secretion system apparatus lipoprotein SsaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862869.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 gene ssaJ CDS complement(943509..943772) product SctI family type III secretion system inner rod subunit SsaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989174.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 gene ssaI CDS complement(943769..944059) product EscG/YscG/SsaH family type III secretion system needle protein co-chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457355.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(944037..944252) product type III secretion system needle filament protein SsaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350226.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 gene ssaG CDS complement(944346..944888) product pathogenicity island 2 effector protein SseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805847.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene sseG CDS complement(945830..946261) product SycD/LcrH family type III secretion system chaperone SscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979964.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene sscB CDS complement(946316..946732) product LcrR family type III secretion system chaperone SseE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249605.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene sseE CDS complement(946735..947322) product SPI-2 type III secretion system translocon protein SseD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388328.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 gene sseD CDS complement(947338..948792) product SPI-2 type III secretion system translocon protein SseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079758.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene sseC CDS complement(948795..949268) product SycD/LcrH family type III secretion system chaperone SscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711030.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene sscA CDS complement(949265..949855) product SPI-2 type III secretion system translocon protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094422.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene sseB CDS complement(949862..950185) product SPI-2 type III secretion system chaperone SseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972855.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene sseA CDS complement(950391..950633) product YscE family type III secretion system co-chaperone SsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210204.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 gene ssaE CDS complement(950641..951852) product SctD family type III secretion system inner membrane ring subunit SsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323784.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene ssaD CDS complement(951833..953326) product SPI-2 type III secretion system protein SpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261287.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene spiA CDS complement(953328..953711) product SPI-2 type III secretion system protein SpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001738217.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene spiC CDS 954069..954335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 954304..956892 product two component system sensor kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050754.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 956923..957561 product two component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666335.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 957740..958468 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122320.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 958640..959599 product transcriptional regulator MlrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060717.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene mlrB CDS complement(959721..959933) product fumarate hydratase FumD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165779.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene fumD CDS complement(960031..960651) product tetrathionate respiration response regulator TtrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190927.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene ttrR CDS complement(960626..962374) product tetrathionate respiration histidine kinase TtrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816070.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene ttrS CDS 962586..963320 product tetrathionate reductase subunit TtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269830.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 gene ttrB CDS 963321..964343 product tetrathionate reductase subunit TtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149765.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 gene ttrC CDS 964336..967398 product tetrathionate reductase subunit TtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002364.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene ttrA CDS 967721..968947 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703938.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 968959..969696 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697190.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 969755..970648 product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037942.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 970670..972013 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756081.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 972415..973827 product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751448.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 gene pykF CDS 974138..974374 product murein lipoprotein Lpp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082307.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene lpp CDS 974457..974699 product major outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082326.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(974765..975766) product L,D-transpeptidase LdtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817111.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene ldtE CDS complement(975921..976337) product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729470.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene sufE CDS complement(976350..977570) product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143859.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene sufS CDS complement(977567..978838) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907921.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene sufD CDS complement(978813..979559) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948895.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene sufC CDS complement(979576..981063) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089373.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene sufB CDS complement(981072..981440) product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418973.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene sufA CDS 981867..983213 product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261850.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(983501..983689) product YdiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638607.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(983788..984198) product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637930.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 gene menI CDS complement(984195..987251) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612899.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 987516..988634 product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248612.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 gene ydiK CDS 989092..989451 product YdiL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602304.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 989592..990803 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795534.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS 991167..992402 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296106.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 992469..993335 product quinate/shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383485.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene ydiB CDS 993407..994138 product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860197.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 gene aroD CDS 994292..995887 product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805700.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 995901..997052 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347850.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(997128..998018) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284799.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 998481..999245 product electron transfer flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692160.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 999267..999824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 note possible pseudo, internal stop codon, frameshifted CDS 999900..1000202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 note possible pseudo, internal stop codon, frameshifted CDS 1000259..1001545 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278481.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS 1001542..1001835 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081072.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 1002073..1003713 product medium-chain fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302824.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene fadK CDS complement(1003755..1006133) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069332.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene ppsA CDS 1006470..1007303 product posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370992.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene ppsR CDS 1007459..1008505 product 3-deoxy-7-phosphoheptulonate synthase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082192.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene aroH CDS 1008662..1008853 product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089115.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene hemP CDS complement(1008888..1010330) product protein adenylyltransferase SelO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175658.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 gene selO CDS complement(1010392..1011105) product anti-FlhDC factor YdiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561998.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene ydiV CDS complement(1011419..1011883) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213259.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS complement(1011960..1012709) product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080607.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene btuD CDS complement(1012709..1013260) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181565.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(1013352..1014332) product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954986.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene btuC CDS complement(1014535..1014834) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229266.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene ihfA CDS complement(1014839..1017226) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672399.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 gene pheT CDS complement(1017242..1018225) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018570.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene pheS CDS 1018317..1018481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(1018527..1018883) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124850.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene rplT CDS complement(1018934..1019131) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124225.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 gene rpmI CDS complement(1019227..1019661) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058403.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene infC CDS complement(1019773..1021701) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144226.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene thrS CDS complement(1023033..1023191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 1023232..1023822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(1024507..1025361) product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816806.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(1025423..1025671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 1025814..1026773 product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046434.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(1026822..1027580) product YdiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770984.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS 1027869..1028801 product 6-phosphofructokinase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251706.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene pfkB CDS 1028897..1029187 product type V toxin-antitoxin system endoribonuclease antitoxin GhoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146133.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene ghoS CDS 1029294..1030154 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267686.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(1030197..1030733) product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222158.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 1030882..1031550 product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106859.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene hxpB CDS 1031688..1032287 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505801.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 1032424..1033815 product cystine/sulfocysteine:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010658.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene tcyP CDS complement(1033918..1034160) product cell division activator CedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977510.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene cedA CDS 1034525..1036777 product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019093.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene katE CDS complement(1036821..1037579) product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442732.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene chbG CDS complement(1037592..1038947) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078788.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(1039072..1039911) product transcriptional regulator ChbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983393.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene chbR CDS complement(1039925..1040272) product PTS N,N'-diacetylchitobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459882.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene chbA CDS complement(1040323..1041681) product PTS N,N'-diacetylchitobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073015.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 gene chbC CDS complement(1041764..1042084) product PTS N,N'-diacetylchitobiose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412161.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene chbB CDS complement(1042385..1042726) product osmotically-inducible lipoprotein OsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039301.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene osmE CDS 1042945..1043772 product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174989.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 gene nadE CDS 1043893..1044774 product excinuclease Cho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518228.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene cho CDS complement(1044849..1045334) product ATP-independent periplasmic protein-refolding chaperone Spy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228995.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene spy CDS complement(1045670..1046638) product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368452.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene astE CDS complement(1046631..1047974) product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123947.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 gene astB CDS complement(1047971..1049449) product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177206.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene astD CDS complement(1049446..1050480) product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263882.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 gene astA CDS complement(1050471..1051697) product bifunctional succinylornithine transaminase/acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059512.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 1052143..1052949 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673954.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene xthA CDS 1053022..1053438 product pyrimidine (deoxy)nucleoside triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592145.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(1053398..1053673) product YnjH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254672.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 1053912..1055255 product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372866.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene gdhA CDS complement(1055285..1057234) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235869.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 gene topB CDS complement(1057239..1058282) product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043069.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 gene selD CDS complement(1058400..1058951) product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339313.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 1059125..1060981 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259874.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 gene sppA CDS 1061077..1062093 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170143.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 gene ansA CDS 1062120..1062776 product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184700.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene pncA CDS complement(1062879..1064237) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438819.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(1064373..1065131) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719088.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(1065261..1066244) product NADH-dependent methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723717.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 gene ydjG CDS complement(1066254..1067201) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309545.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(1067206..1068042) product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878893.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(1068064..1069107) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798110.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS complement(1069118..1070497) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435315.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(1070524..1071600) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645203.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS 1071908..1072321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(1072494..1072772) product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046864.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(1072814..1073227) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519539.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene msrB CDS 1073569..1074564 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153505.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene gapA CDS 1074893..1075777 product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366147.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(1075876..1076724) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843742.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(1076830..1077924) product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029244.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(1078316..1079062) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163762.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 1079490..1081424 product protein kinase YeaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764228.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene yeaG CDS 1081547..1082833 product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219724.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(1082978..1083178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 1083473..1084966 product diguanylate cyclase DgcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766137.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene dgcJ CDS 1085007..1085534 product YbaK/prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989016.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 1085844..1086290 product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460698.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(1086270..1087064) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579795.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS 1087165..1088349 product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205360.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 1088468..1088815 product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222524.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(1088801..1089112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487129.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(1089181..1089432) product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673491.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(1089865..1090113) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512149.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(1090427..1091068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762776.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(1091298..1091480) product DUF1869 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513734.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(1091483..1091845) product DUF1971 domain-containing protein YeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248993.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 gene yeaR CDS complement(1092019..1092657) product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457190.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 gene leuE CDS complement(1092854..1093399) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617989.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 1093715..1093963 product biofilm/acid-resistance regulator YmgB/AriR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208085.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(1094217..1095065) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190268.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(1095134..1095781) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001787632.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(1095872..1096660) product cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175788.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 gene aadA CDS complement(1096769..1097419) product metal-binding protein ZinT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234684.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 gene zinT tRNA complement(1097528..1097604) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 1098133..1099266 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456065.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(1099348..1099938) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947464.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(1099932..1100729) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950217.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(1100723..1101535) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966645.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(1101525..1102502) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520270.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(1102499..1104133) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946075.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS 1104815..1105129 product TRL-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182479.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 1105278..1105808 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929974.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(1105891..1106934) product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761737.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(1107273..1107740) product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518864.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS 1108060..1108233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS 1108868..1109212 product c-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977725.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 tRNA complement(1109967..1110043) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS complement(1110434..1110991) product virulence membrane protein PagC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789474.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene pagC CDS 1112198..1112410 product cold shock-like protein CspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001537306.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 gene cspF CDS 1112925..1113347 product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001537478.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS 1113538..1113777 product virulence protein MsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497451.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 gene msgA CDS 1114267..1114947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 1115377..1115583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(1116038..1117162) product type III secretion system effector SopF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917281.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene sopF CDS complement(1117623..1118873) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444506.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 gene icd CDS 1119165..1119710 product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249410.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene rluE CDS 1119707..1120036 product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825956.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS 1120048..1120509 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476064.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS 1120518..1121669 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004540.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene mnmA CDS 1121750..1122397 product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024131182.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene hflD CDS 1122401..1123771 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423756.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene purB CDS 1123895..1124569 product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986522.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene phoP CDS 1124569..1126032 product two-component system sensor histidine kinase PhoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031689.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene phoQ CDS 1126113..1127234 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456524.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(1127274..1128479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902462.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(1128612..1129841) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359416.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene pepT CDS 1130092..1131228 product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531581.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene potA CDS 1131212..1132075 product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799391.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene potB CDS 1132404..1133414 product SPI-2 type III secretion system effector SifA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682002.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 gene sifA CDS 1133730..1134509 product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580299.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene potC CDS 1134534..1135580 product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759329.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 gene potD CDS complement(1135662..1136483) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191856.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene cobB CDS complement(1136502..1137413) product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291327.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene nagK CDS complement(1137442..1138686) product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168092.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 gene lolE CDS complement(1138686..1139387) product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033714.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene lolD CDS complement(1139380..1140579) product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272105.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 gene lolC CDS 1140917..1144363 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114340.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene mfd CDS 1144511..1145476 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482967.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(1145573..1145830) product multiple stress resistance protein BhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800134.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene bhsA CDS 1146072..1146707 product TetR family copper-responsive transcriptional repressor ComR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205980.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 gene comR CDS complement(1146781..1147320) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043449.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(1147499..1148803) product NADH-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211053.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene ndh CDS complement(1149058..1149600) product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587943.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 gene ycfP CDS complement(1149625..1150650) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529339.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 gene nagZ CDS complement(1150661..1151485) product thiamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257320.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 gene thiK CDS complement(1151466..1152104) product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164360.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 gene lpoB CDS complement(1152118..1152492) product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589560.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(1152495..1152854) product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532068.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene hinT CDS 1153196..1155370 product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953420.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene fhuE CDS complement(1155455..1156888) product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475735.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 gene ptsG CDS complement(1157183..1157980) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480274.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(1157991..1158995) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872450.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene holB CDS complement(1158992..1159633) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535399.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene tmk CDS complement(1159623..1160645) product cell division protein YceG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736473.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 gene yceG CDS complement(1160648..1161457) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478660.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 gene pabC CDS complement(1161581..1162822) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044667.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene fabF CDS complement(1162908..1163144) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103754.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene acpP CDS complement(1163300..1164034) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007236.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 gene fabG CDS complement(1164047..1164976) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191346.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene fabD CDS complement(1164992..1165945) product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288151.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene fabH CDS complement(1166025..1167104) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518286.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene plsX CDS complement(1167238..1167411) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290727.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene rpmF CDS complement(1167463..1167984) product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174492.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene yceD CDS 1168182..1168766 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137608.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(1168837..1169061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(1169264..1170025) product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094974.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS complement(1170163..1171164) product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846324.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene rluC CDS 1171696..1174902 product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827472.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 gene rne CDS complement(1175149..1176102) product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223025.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 gene flgL CDS complement(1176117..1177778) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096425.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 gene flgK CDS complement(1177843..1178793) product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578683.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene flgJ CDS complement(1178793..1179896) product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518955.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(1179902..1180600) product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174897.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 gene flgH CDS complement(1180655..1181437) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625851.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene flgG CDS complement(1181451..1182206) product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349284.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(1182227..1183438) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010567.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 gene flgE CDS complement(1183465..1184163) product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020450.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene flgD CDS complement(1184175..1184579) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196448.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene flgC CDS complement(1184583..1184999) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887042.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene flgB CDS 1185156..1185815 product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194076.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 gene flgA CDS 1185907..1186200 product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020892.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 gene flgM CDS 1186205..1186627 product flagella biosynthesis chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197547.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene flgN CDS complement(1186709..1188283) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155214.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 gene murJ CDS complement(1188548..1189471) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259737.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(1189473..1190120) product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873047.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(1190156..1190740) product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468201.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 gene rimJ CDS 1190977..1192185 product multidrug efflux MFS transporter MdtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092170.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 gene mdtH CDS 1192249..1192896 product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780893.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene grxB CDS 1193021..1193581 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713057.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS 1193685..1194731 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126592.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene pyrC CDS 1194805..1195050 product DNA damage-inducible protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217768.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene dinI CDS 1195340..1195594 product biofilm formation regulator BssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414441.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene bssS CDS 1195707..1196825 product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872781.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 gene solA CDS 1197242..1197814 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011132.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS 1197811..1198386 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739886.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(1198438..1199490) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144640.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 1199710..1200630 product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163974.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS 1200785..1201999 product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075040.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene mdtG CDS 1202081..1202455 product MysB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180050.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(1202456..1202683) product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217832.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS complement(1202757..1205300) product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044602.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 gene mdoH CDS complement(1205293..1206825) product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001562609.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 gene mdoG CDS 1207100..1208254 product glucans biosynthesis protein MdoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100054.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene mdoC CDS complement(1208271..1209758) product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976323.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(1209694..1210233) product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203944.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 gene ymdB CDS complement(1210320..1210640) product type 1 fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111254.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(1210771..1211097) product curli assembly chaperone CsgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557254.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 gene csgC CDS complement(1211159..1211614) product curli major subunit CsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771416.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 gene csgA CDS complement(1211656..1212138) product curli minor subunit CsgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791653.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 gene csgB CDS 1212866..1213516 product biofilm master transcriptional regulator CsgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481516.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene csgD CDS 1213521..1213916 product curli production assembly/transport protein CsgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833307.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene csgE CDS 1213943..1214359 product curli production assembly/transport protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264073.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 gene csgF CDS 1214386..1215219 product curli production assembly/transport protein CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137620.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene csgG CDS complement(1215258..1215740) product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337814.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS complement(1215841..1216395) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001883.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(1216419..1217156) product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283643.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(1217241..1218179) product glyoxylate/hydroxypyruvate reductase GhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402555.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 gene ghrA tRNA 1218415..1218502 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS 1219375..1219524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(1219697..1220719) product IS110-like element IS1111A family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041952483.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(1221181..1221999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25580 tRNA complement(1223014..1223103) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS 1223192..1223989 product DgsA anti-repressor MtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598924.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene mtfA tRNA 1224090..1224165 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA 1225060..1225135 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS 1225315..1226589 product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032666220.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(1226661..1226912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212204.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(1227391..1227888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(1228250..1228858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS 1229224..1230105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(1230333..1230611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(1230679..1232517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(1232533..1233090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(1233498..1233803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS 1234440..1235960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS complement(1235984..1236829) product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470596.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(1237060..1237335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(1237346..1237876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS 1238311..1238712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 1238816..1239193 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001417601.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene bamE CDS complement(1239271..1240881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(1240933..1241895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS complement(1241951..1242373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(1242422..1242691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 1244051..1244785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 1244816..1245607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 1245693..1246172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 1246333..1246737 product H-NS family nucleoid-associated regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287388.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(1247153..1247701) product SLATT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039060.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS complement(1247766..1249037) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039059.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(1249283..1249579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS complement(1249624..1249914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS complement(1249996..1250214) product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071599.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(1250365..1251240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS 1251783..1252307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS 1252782..1253480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 1253823..1255991 product SEL1-like repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211266.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 1256048..1257778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645013.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 1257988..1258161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(1258118..1258303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(1258683..1260137) product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428186.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(1260333..1260659) product DUF1493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886449.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS complement(1260653..1261039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133086100.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 note possible pseudo, frameshifted tRNA complement(1261536..1261611) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS complement(1261752..1263278) product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989199.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 tRNA 1263369..1263444 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS complement(1263670..1264599) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252822.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 gene ldtA CDS complement(1264677..1265747) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193966.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 gene cobT CDS complement(1265774..1266517) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039987.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 gene cobS CDS complement(1266514..1267059) product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973185.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 gene cobU CDS complement(1267056..1268576) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189676.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS complement(1268573..1269388) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881535.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(1269397..1270077) product energy-coupling factor ABC transporter transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147138.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(1270061..1270342) product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753216.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS complement(1270344..1271081) product cobalt ECF transporter S component CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816682.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene cbiM CDS complement(1271078..1271791) product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013551.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(1271788..1272582) product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168485.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(1272585..1273361) product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816684.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(1273373..1274098) product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953643.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS complement(1274098..1275072) product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098913.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 gene cbiG CDS complement(1275134..1275907) product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004870.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(1275891..1276469) product decarboxylating cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650991.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(1276459..1277064) product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958833.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS complement(1277058..1278197) product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292925.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 gene cbiD CDS complement(1278197..1278829) product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816687.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(1278840..1279799) product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153666.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 gene cbiB CDS complement(1279796..1281175) product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741259.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(1281773..1282684) product regulatory protein PocR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622328.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene pocR CDS complement(1282900..1283694) product propanediol diffusion facilitator PduF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000027.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene pduF CDS 1284219..1284503 product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183618.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 gene pduA CDS 1284500..1285312 product propanediol utilization microcompartment protein PduB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097484.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 gene pduB CDS 1285331..1286995 product propanediol dehydratase large subunit PduC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256897.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 gene pduC CDS 1287006..1287680 product propanediol dehydratase medium subunit PduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405054.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 gene pduD CDS 1287695..1288216 product propanediol dehydratase small subunit PduE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090601.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 gene pduE CDS 1288226..1290058 product propanediol dehydratase reactivase alpha subunit PduG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268875.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene pduG CDS 1290048..1290398 product propanediol dehydratase reactivase beta subunit PduH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377971.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 gene pduH CDS 1290417..1290692 product propanediol utilization microcompartment protein PduJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057755.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene pduJ CDS 1290717..1291178 product propanediol utilization microcompartment protein PduK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284376.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 gene pduK CDS 1291178..1291810 product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356724.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS 1291807..1292298 product propanediol utilization microcompartment protein PduM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012961.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene pduM CDS 1292302..1292577 product propanediol utilization microcompartment protein PduN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549827.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 gene pduN CDS 1292587..1293597 product two-domain cob(I)yrinic acid a,c-diamide adenosyltransferase PduO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029486.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene pduO CDS 1293594..1294988 product CoA-acylating propionaldehyde dehydrogenase PduP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097666.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 gene pduP CDS 1295000..1296112 product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091449.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 gene pduQ CDS 1296109..1297464 product cobalamin reductase PduS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058762.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene pduS CDS 1297467..1298021 product propanediol utilization microcompartment protein PduT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075775.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 gene pduT CDS 1298021..1298371 product propanediol utilization microcompartment protein PduU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000441103.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 gene pduU CDS 1298376..1298828 product propanediol utilization protein PduV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826280.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 gene pduV CDS 1298813..1300027 product propanediol utilization propionate kinase PduW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120652.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene pduW CDS 1300265..1300987 product L-threonine kinase PduX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201312.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS complement(1301021..1301356) product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450405.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS complement(1301601..1302659) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200856.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS complement(1302778..1303245) product DNA gyrase inhibitor SbmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384326.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 gene sbmC CDS complement(1303396..1304568) product serine-type D-Ala-D-Ala carboxypeptidase DacD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296209.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene dacD CDS complement(1304692..1305456) product thiosulfate reductase cytochrome B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092553.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS complement(1305453..1306031) product thiosulfate reductase electron transport protein PhsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016236.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene phsB CDS complement(1306046..1308322) product thiosulfate reductase PhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028230.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene phsA CDS 1309965..1311290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS 1311657..1313087 product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216700.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 gene sbcB CDS complement(1313223..1314581) product putrescine/proton symporter PlaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178807.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene plaP CDS complement(1314867..1315781) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803316.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS complement(1315827..1316651) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754712.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS 1317010..1317909 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886604.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 gene hisG CDS 1318012..1319316 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009629.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 gene hisD CDS 1319313..1320392 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102709.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 gene hisC CDS 1320389..1321456 product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080040.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 gene hisB CDS 1321456..1322046 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103591.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 gene hisH CDS 1322046..1322783 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586403.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 gene hisA CDS 1322765..1323541 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880125.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene hisF CDS 1323535..1324146 product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954855.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 gene hisIE CDS complement(1324225..1325208) product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215243.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 gene wzzB CDS complement(1325351..1326517) product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704814.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene ugd CDS complement(1326754..1328160) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043528.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene gndA CDS complement(1328324..1329754) product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368710.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS complement(1329825..1331258) product O-antigen biosynthesis phosphomannomutase RfbK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103638.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene rfbK CDS complement(1331245..1332684) product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009019.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(1332685..1333629) product O antigen biosynthesis rhamnosyltransferase RfbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene rfbN CDS complement(1333630..1334691) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763397.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS complement(1335266..1336267) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989202.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS complement(1336269..1337552) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228890.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(1337638..1338654) product CDP-paratose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770936.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(1338651..1339475) product CDP-paratose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697757.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(1339527..1340840) product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene rfbH CDS complement(1340867..1341946) product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene rfbG CDS complement(1341951..1342724) product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648783.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene rfbF CDS complement(1342740..1343714) product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018226.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS complement(1343720..1344271) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973711.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene rfbC CDS complement(1344272..1345156) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857536.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene rfbA CDS complement(1345198..1346097) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023656.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 gene rfbD CDS complement(1346097..1347182) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697846.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene rfbB CDS complement(1347559..1348452) product GalU regulator GalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981469.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene galF CDS complement(1348630..1350033) product colanic acid biosynthesis protein WcaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111852.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene wcaM CDS complement(1350044..1351264) product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868505.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene wcaL CDS complement(1351261..1352541) product colanic acid biosynthesis pyruvyl transferase WcaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097868.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene wcaK CDS complement(1352563..1354041) product colanic acid undecaprenyl disphosphate flippase WzxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058696.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene wzxC CDS complement(1354143..1355537) product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183160.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene wcaJ CDS complement(1355591..1356961) product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164216.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 gene cpsG CDS complement(1357072..1358508) product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605946.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 gene cpsB CDS complement(1358511..1359734) product colanic acid biosynthesis fucosyltransferase WcaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699650.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 gene wcaI CDS complement(1359731..1360204) product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001688181.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS complement(1360207..1361172) product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041701.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS complement(1361175..1362296) product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048162.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 gene gmd CDS complement(1362320..1362874) product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153597.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene wcaF CDS complement(1362890..1363636) product colanic acid biosynthesis glycosyltransferase WcaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480132.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene wcaE CDS complement(1363649..1364863) product colanic acid polymerase WcaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107842.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 gene wcaD CDS complement(1364838..1366055) product colanic acid biosynthesis glycosyltransferase WcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023824.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 gene wcaC CDS complement(1366052..1366540) product colanic acid biosynthesis acetyltransferase WcaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888724.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 gene wcaB CDS complement(1366543..1367385) product colanic acid biosynthesis glycosyltransferase WcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097880.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 gene wcaA CDS complement(1367472..1369631) product tyrosine-protein kinase Wzc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137223.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene wzc CDS complement(1369628..1370077) product low molecular weight protein-tyrosine-phosphatase Wzb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482225.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene wzb CDS complement(1370083..1371129) product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978074.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 1371897..1373477 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454718.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(1373563..1375419) product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252274.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene asmA CDS complement(1375458..1376039) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234783.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene dcd CDS complement(1376130..1376771) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132082.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene udk CDS 1377102..1380092 product MASE1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042960.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(1380060..1380929) product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494720.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 gene alkA CDS 1381063..1382415 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469615.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 gene yegD CDS 1382856..1384097 product multidrug efflux RND transporter subunit MdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678826.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 gene mdtA CDS 1384097..1387219 product multidrug efflux RND transporter permease subunit MdtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197813.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene mdtB CDS 1387220..1390300 product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001210089.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene mdtC CDS 1390297..1391709 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134351.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 1391709..1393112 product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870082.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 gene baeS CDS 1393109..1393831 product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137847.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene baeR CDS complement(1394220..1394387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 1394418..1395302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989040.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS 1395302..1396018 product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498586.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS 1396029..1398140 product DUF4034 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434232.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS 1398256..1399617 product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001517981.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene yegQ CDS complement(1400256..1400672) product CesT family type III secretion system chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287291.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 1401691..1402590 product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273393.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene yegS CDS complement(1402643..1403695) product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129590.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene fbaB CDS 1403949..1405220 product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858692.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 1405217..1406221 product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642789.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS 1406218..1407183 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012656.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS complement(1407157..1407903) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434062.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS complement(1407939..1408739) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188955.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 gene thiD CDS complement(1408726..1409523) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182157.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 gene thiM CDS complement(1409622..1409807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 1409933..1410247 product Ni(II)/Co(II) efflux transporter accessory subunit RcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837534.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene rcnB CDS complement(1410291..1411313) product putative fimbrial-like adhesin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702202.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS complement(1411329..1413815) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945390.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS complement(1413844..1414524) product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677183.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(1414586..1415119) product fimbrial protein YehD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830686.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene yehD CDS complement(1415398..1415679) product YehE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760404.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS complement(1415957..1417066) product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005426.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene apbC CDS 1417231..1419264 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195338.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene metG CDS 1419505..1419963 product YehR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703137.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS 1420135..1420665 product YehR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197951.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(1420722..1421246) product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950413.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS complement(1421236..1421955) product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598632.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 gene btsR CDS complement(1421952..1423637) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272839.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS 1423860..1424591 product HTH-type transcriptional regulator MlrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240415.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene mlrA CDS complement(1424739..1425470) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824854.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS complement(1425454..1426401) product glycine betaine ABC transporter ATP binding protein YehX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569315.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene yehX CDS complement(1426394..1427563) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278105.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(1427567..1428484) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155871.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS complement(1428665..1430962) product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871556.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 gene bglX CDS 1431229..1432959 product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095234.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 gene dld CDS complement(1433018..1433965) product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001319943.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 gene pbpG CDS complement(1434131..1434718) product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017057.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS 1434877..1435446 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930540.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(1435495..1436256) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169612.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS complement(1436322..1437686) product multidrug resistance outer membrane protein MdtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081453.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene mdtQ CDS 1437949..1438146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(1438217..1439155) product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001802202.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene dusC CDS complement(1439264..1440457) product 3-hydroxybenzoate 6-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150113.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS complement(1440472..1441116) product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781184.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene maiA CDS complement(1441125..1441826) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170621.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS complement(1441842..1442879) product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289858.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 gene gtdA CDS complement(1442891..1444249) product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194222.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS 1444375..1445283 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024658.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS 1445415..1445813 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045719.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS 1445810..1446505 product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989296.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 1446659..1447543 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553529.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 gene cdd CDS 1447720..1448439 product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920079.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 gene sanA CDS 1448436..1448681 product DUF2542 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605187.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS 1448886..1450127 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136400.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS 1450121..1451356 product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956072.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene preA CDS complement(1451431..1452441) product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275103.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 gene mglC CDS complement(1452457..1453977) product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255032.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 gene mglA CDS complement(1454111..1455109) product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036947.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene mglB CDS complement(1455608..1456630) product HTH-type transcriptional regulator GalS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628627.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene galS CDS complement(1456780..1457922) product DUF418 domain-containing protein YeiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001765111.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene yeiB CDS complement(1457937..1458605) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139611.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene folE CDS 1458935..1459792 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425481.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 gene fghA CDS complement(1459781..1460170) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876815.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS complement(1460175..1461476) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443204.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 1461759..1462646 product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022911.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 gene serB CDS 1462679..1464001 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174929.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS complement(1464045..1466036) product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488257.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 gene cirA CDS complement(1466382..1467851) product lysine-specific permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534995.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 gene lysP CDS complement(1468041..1468904) product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548316.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 gene yieE CDS 1469025..1470074 product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137966.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS 1470153..1471010 product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873905.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 gene nfo CDS complement(1471075..1472763) product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854408.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 gene fruA CDS complement(1472780..1473718) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091249.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 gene fruK CDS complement(1473718..1474848) product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487294.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 gene fruB CDS 1475217..1476398 product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551934.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene setB CDS complement(1476462..1477127) product GNVR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213885.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS 1478218..1478790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS 1479003..1479989 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169350.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS 1479992..1480738 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178088.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS 1481152..1481724 product bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241015.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 gene mepS CDS 1482050..1483606 product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957756.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS 1483713..1485518 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561746.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 1485528..1486622 product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501623.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS 1486622..1487647 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137761.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 1487649..1489238 product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203612.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 gene yejF CDS complement(1489242..1489586) product YejG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094639.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(1489977..1491167) product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213351.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(1491195..1491890) product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234836.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 gene rsuA CDS 1492042..1493802 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578121.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 1493927..1494211 product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494192.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 gene rplY CDS complement(1494319..1494939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033434.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(1494967..1495974) product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050806.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 gene yejK CDS 1496154..1496381 product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135904.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 1496413..1498173 product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256152.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 gene yejM tRNA 1498247..1498323 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS complement(1498634..1498783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28110 note possible pseudo, frameshifted CDS complement(1498944..1500728) product SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115839.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 gene sspH2 CDS complement(1501979..1502263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28130 note possible pseudo, internal stop codon CDS complement(1502306..1502821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28140 note possible pseudo, internal stop codon CDS 1502899..1503087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 1503074..1503277 product virulence protein MsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001653202.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS complement(1503469..1504026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 1504762..1505409 product nitrate/nitrite response regulator protein NarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115500.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 gene narP sequence32 source 1..183908 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 121..1140 product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938843.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 gene dppB CDS 1150..2052 product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084689.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 gene dppC CDS 2063..3046 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196507.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 gene dppD CDS 3043..4056 product dipeptide ABC transporter ATP-binding subunit DppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103568.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 gene dppF CDS complement(4157..5455) product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150177.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 6074..6205 product type I toxin-antitoxin system toxin Ldr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001541083.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS complement(6287..7966) product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192026.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 gene bcsG CDS complement(7963..8154) product cellulose biosynthesis protein BcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988321.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene bcsF CDS complement(8151..9710) product cellulose biosynthesis c-di-GMP-binding protein BcsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205773.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 gene bcsE CDS 9967..10170 product cellulose biosynthesis protein BcsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282616.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene bcsR CDS 10171..10923 product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996130.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 gene bcsQ CDS 10920..13544 product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275344.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene bcsA CDS 13705..15855 product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823808.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 gene bcsB CDS 15859..16968 product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988805.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 gene bcsZ CDS 17040..20492 product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225124.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 gene bcsC CDS 20666..22672 product biofilm formation regulator HmsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014344205.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene hmsP CDS 22830..24116 product C4-dicarboxylate transporter DctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858232.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 gene dctA CDS 24336..25823 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163190.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(25877..26806) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037582.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS 27035..27802 product cyclic-guanylate-specific phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595629.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 gene pdeH CDS 27912..29972 product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158664.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS complement(30012..31334) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148985.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS complement(31685..32713) product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191231.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 gene yhjD CDS complement(32786..33685) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358042.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 34316..34918 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196086.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(34924..35280) product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120250.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 35561..37150 product STY4199 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099200.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS complement(37163..38812) product alpha,alpha-trehalase TreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934251.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 gene treF CDS 39138..39857 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572570.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 40036..41010 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966767.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS 41074..41919 product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966764.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 41973..43292 product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498698.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS 43369..44394 product asparaginase AnsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246337.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene ansZ CDS complement(44441..45793) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160779.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 gene gorA CDS complement(45898..46740) product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954235.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 46951..48222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS 48404..50446 product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184173.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 gene prlC CDS 50453..51211 product 16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165126.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 gene rsmJ CDS complement(51303..52775) product dipeptide/tripeptide permease DtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098284.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 gene dtpB CDS complement(53100..53534) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323571.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 gene uspA CDS 53922..54257 product universal stress protein UspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626193.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 gene uspB CDS complement(54398..55894) product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902764.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 gene pitA CDS 56125..57321 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439232.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS 57627..58694 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359835.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS 58691..61432 product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202935.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 gene rbbA CDS 61432..62556 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314210.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(62645..63106) product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190057.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 gene nikR CDS complement(63138..63716) product 4'-phosphopantetheinyl transferase AcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284366.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 gene acpT CDS complement(63768..64817) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179588.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS 64949..66166 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001576500.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS complement(66170..66727) product DcrB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245277.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(66800..67465) product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187489.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS 67635..67880 product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001541054.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 gene tusA CDS complement(67904..69547) product methyl-accepting chemotaxis citrate transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789682.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS complement(69747..71945) product Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106671.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 gene zntA CDS complement(72026..72652) product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964735.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS 72794..73165 product DUF2500 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042855.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS complement(73187..73456) product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001575094.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS complement(73446..74042) product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743275.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 gene rsmD CDS 74168..75643 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118701.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 gene ftsY CDS 75646..76314 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617729.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 gene ftsE CDS 76307..77362 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081708.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 gene ftsX CDS 77608..78462 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159621.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 gene rpoH CDS 78790..79887 product branched chain amino acid ABC transporter substrate-binding protein LivJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021996.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 gene livJ CDS complement(80083..80466) product aspartate 1-decarboxylase autocleavage activator PanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778873.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 gene panM CDS 80887..81996 product high-affinity branched-chain amino acid ABC transporter substrate-binding protein LivK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822976.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 gene livK CDS 82056..82982 product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003007.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 gene livH CDS 82979..84256 product branched chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803764.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 gene livM CDS 84253..85020 product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082083.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene livG CDS 85022..85735 product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416114.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 gene livF CDS 85866..86087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS 86084..86452 product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816307.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS 86711..88027 product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624747.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 gene ugpB CDS 88132..89019 product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099302.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 gene ugpA CDS 89016..89861 product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572199.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 gene ugpE CDS 89863..90933 product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907851.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS 90930..91670 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073552.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene ugpQ CDS complement(91683..92099) product DUF2756 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826039.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS 92225..93967 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805086.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 gene ggt CDS complement(94012..95046) product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675710.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(95043..96014) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038946.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS complement(96068..96829) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066512.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(96845..98059) product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667442.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(98324..98812) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290280.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 gene yhhY CDS 99281..100318 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172399.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS 100442..101137 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639789.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS 101550..102503 product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730239.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 gene gntR CDS 102681..103175 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108342.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 gene gntK CDS 103172..104512 product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105950.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 gene gntU CDS complement(104742..104906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS 104936..106042 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799940.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 gene asd CDS 106389..108575 product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098552.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 gene glgB CDS 108572..110548 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192475.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 gene glgX CDS 110563..111858 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253993.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 gene glgC CDS 111858..113291 product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197660.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 gene glgA CDS 113311..115758 product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993423.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 gene glgP CDS 115936..116691 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894191.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS complement(116735..117640) product 2-keto-3-deoxygluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136613.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 gene yagE CDS complement(117684..119399) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966867.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(119396..120730) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094951.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS 121068..122177 product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083283.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 122335..123831 product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982774.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 123841..124386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS complement(124433..125950) product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448178.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene glpD CDS 126149..126475 product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434523.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 gene glpE CDS 126551..127381 product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928705.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 gene glpG CDS 127475..127663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29250 note possible pseudo, frameshifted CDS 127645..128232 product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815087.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 note possible pseudo, frameshifted CDS complement(128229..129812) product DNA-binding transcriptional regulator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232919.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 gene rtcR CDS 130002..131555 product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123257.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS 131900..133117 product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105467.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 gene rtcB CDS 133121..134140 product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827117.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 gene rtcA CDS 134249..134509 product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816235.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS 134512..134787 product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170383.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS complement(134875..137580) product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907046.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 gene malT CDS 138174..140567 product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082255.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 gene malP CDS 140577..142655 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428711.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 gene malQ CDS complement(142774..144090) product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131741.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 gene gntT CDS complement(144467..145042) product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619394.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 gene nfuA CDS complement(145101..145592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(145579..145764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS 145822..146592 product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998145.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 gene bioH CDS complement(146628..147554) product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235943.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(147789..148025) product [Fe-S]-dependent transcriptional repressor FeoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157589.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 gene feoC CDS complement(148038..150356) product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736984.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 gene feoB CDS complement(150375..150602) product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160955.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 gene feoA CDS complement(151039..153369) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980674.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS complement(153468..153941) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856695.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 gene greB CDS 154167..154886 product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157751.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 gene ompR CDS 154892..156235 product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253815.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 gene envZ CDS complement(156310..157917) product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265689.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 gene pckA CDS 158297..160006 product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446446.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(160115..160993) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001775502.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 gene hslO CDS complement(161018..161419) product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660720.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 gene hslR CDS complement(161430..162098) product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520508.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 gene yrfG CDS complement(162163..164295) product intracellular growth attenuator protein IgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104086.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 gene igaA CDS 164618..165181 product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519362.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 gene nudE CDS complement(165277..167808) product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013215.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 gene mrcA CDS 167950..168729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874746.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS 168729..169268 product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951390.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS 169252..169725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992480.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 169715..170116 product HofP DNA utilization family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868832.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 170067..171269 product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832818.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 gene hofQ CDS 171734..172255 product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818621.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 gene aroK CDS 172423..173400 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439825.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 gene aroB CDS 173498..174775 product cell division protein DamX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343137.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 gene damX CDS 174956..175792 product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742132.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene dam CDS 175810..176487 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816285.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 gene rpe CDS 176480..177238 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038040.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 gene gph CDS 177231..178235 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165562.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 gene trpS CDS complement(178380..178550) product YhfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472323.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 misc_feature complement(178743..>183908) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001189075.1:autotransporter outer membrane beta-barrel domain-containing protein locus_tag LOCUS_29700 sequence33 source 1..284464 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3495 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704642.1:autotransporter outer membrane beta-barrel domain-containing protein locus_tag LOCUS_29710 CDS complement(3657..5006) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953156.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 gene xseA CDS 5167..6633 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944174.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 gene guaB CDS 6703..8280 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138293.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 gene guaA CDS 8503..8790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(8810..9124) product DUF1493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365765.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS complement(9111..9377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS 9448..9681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29780 note possible pseudo, frameshifted CDS complement(9833..10024) product YfgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076001.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS 10593..12650 product sensor domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773655.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(12686..14227) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123330.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 gene ppx CDS complement(14232..16298) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529558.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 gene ppk1 CDS complement(16487..17125) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028592.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 gene purN CDS complement(17125..18177) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001767330.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 gene purM CDS 18575..19201 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706208.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 gene upp CDS 19289..20578 product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198341.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 gene uraA CDS 20649..21374 product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100388.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(21401..21760) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132650.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 gene arsC CDS complement(21800..23263) product beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489630.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 gene bepA CDS 23471..24538 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892056.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS 24815..26002 product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209535.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS 26070..27338 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200863.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS 27344..28483 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706383.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(28530..29000) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068686.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 gene bcp CDS complement(29000..29572) product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001576288.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 29718..30596 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494019.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 gene dapA CDS 30613..31647 product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331881.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 gene bamC CDS 31822..32535 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171630.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS 32666..33529 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267527.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS 33545..35563 product tRNA cytosine(34) acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279850.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 gene tmcA CDS complement(35590..35790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS complement(35818..36945) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277830.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 gene dapE CDS complement(36949..37305) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631925.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS complement(37879..40992) product multidrug efflux RND transporter permease AcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263083.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 gene acrD CDS complement(41177..42877) product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216820.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 gene narQ CDS 43063..45024 product formate-dependent uric acid utilization protein AegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078843.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 gene aegA CDS complement(45473..46771) product penicillin binding protein PBP4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673295.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 gene pbp4b CDS 46975..47550 product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084037.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 gene nudK CDS 47675..48718 product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270663.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS 48846..49076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS complement(49139..51139) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087345.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 gene tkt CDS complement(51159..52109) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072436.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 gene tal CDS 52381..54660 product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344299.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 gene maeB CDS 55077..55412 product ethanolamine utilization microcompartment protein EutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031444.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 gene eutS CDS 55425..55904 product ethanolamine utilization acetate kinase EutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820751.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 gene eutP CDS 55882..56571 product ethanolamine utilization acetate kinase EutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733871.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 gene eutQ CDS 56568..57371 product ethanolamine utilization cob(I)yrinic acid a,c-diamide adenosyltransferase EutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997668.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 gene eutT CDS 57368..58384 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582913.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 gene pta CDS 58425..58715 product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387713.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 gene eutM CDS 58828..59115 product ethanolamine utilization microcompartment protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001522340.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 gene eutN CDS 59127..60530 product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075647.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS 60541..61380 product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929675.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 gene eutJ CDS 61370..62557 product ethanolamine utilization ethanol dehydrogenase EutG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147519.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 gene eutG CDS 62677..63903 product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512341.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 gene eutH CDS 63900..65303 product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097523.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 gene eutA CDS 65315..66676 product ethanolamine ammonia-lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769994.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 gene eutB CDS 66695..67591 product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372351.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 gene eutC CDS 67601..68260 product ethanolamine utilization microcompartment protein EutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111056.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 gene eutL CDS 68273..68767 product ethanolamine utilization microcompartment protein EutK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606260.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 gene eutK CDS 68815..69867 product HTH-type transcriptional regulator EutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753659.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 gene eutR CDS 70188..70334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(70316..70645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(70666..71565) product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801336.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 gene hemF CDS complement(71568..72437) product N-acetylmuramoyl-L-alanine amidase AmiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102880.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 gene amiA CDS 72650..73075 product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406008.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS 73062..73511 product DUF2919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842927.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS 73573..74148 product RpoE-regulated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838971.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS 74243..75142 product porphyrinogen peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084583.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene yfeX CDS 75380..76171 product SDR family oxidoreductase UcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517460.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 gene ucpA CDS 76329..77345 product thiosulfate/sulfate ABC transporter substrate-binding protein CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290267.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 gene cysP CDS 77345..78178 product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881746.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 gene cysT CDS 78178..79053 product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852703.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 gene cysW CDS 79043..80140 product sulfate/thiosulfate ABC transporter ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021072.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 gene cysA CDS 80208..81119 product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093881.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 gene cysM CDS 81371..81979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS complement(82079..82444) product YfeK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710735.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(82521..83240) product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263738.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS complement(83255..84547) product transcriptional regulator PtsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565130.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 gene ptsJ CDS 84630..85496 product pyridoxine/pyridoxal/pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529606.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 gene pdxK CDS 85493..85732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844540.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS complement(85896..86405) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522253.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 gene crr CDS complement(86446..88173) product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098199.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 gene ptsI CDS complement(88222..88479) product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 gene ptsH CDS complement(88863..89834) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036904.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 gene cysK CDS complement(89998..90759) product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255008.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 gene cysZ CDS 90991..91977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS 92049..94064 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433258.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 gene ligA CDS 94057..94284 product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114688.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS complement(94281..95279) product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765569.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS 95369..96295 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109834.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS complement(96357..97118) product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722932.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 97374..98207 product xanthosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119752.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 gene xapA CDS 98262..99518 product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513243.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS 99577..99735 product DUF1427 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658727.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS 99784..100671 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438886.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 tRNA complement(100835..100910) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA complement(100915..100990) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA complement(101032..101107) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA complement(101153..101228) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 CDS 101487..102902 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695623.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 gene gltX CDS complement(102956..103327) product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826515.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(103350..103712) product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472034.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 tRNA 103934..104009 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA 104052..104127 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 CDS 104318..106507 product sensor domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112949.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS complement(106560..107762) product nucleoside permease NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376341.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 gene nupC CDS 108105..109346 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131734.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(109407..109733) product DUF2502 domain-containing protein YpeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490091.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 gene ypeC CDS complement(109847..110845) product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640297.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene mgrA CDS 111025..112677 product alpha-keto acid decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180878.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS complement(112697..113932) product ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468932.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS 114136..115101 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170371.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 gene glk CDS 115824..117062 product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785618.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 gene alaC CDS complement(117586..118506) product kdo(2)-lipid IV(A) palmitoleoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484431.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 gene lpxP CDS 119028..119270 product YfdY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639889.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(119545..120762) product phosphoglycerate transporter PgtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955756.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 gene pgtP CDS 121068..121328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 121342..122565 product phosphoglycerate transport regulator PgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467983.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 gene pgtC CDS 122577..124568 product two-component system sensor histidine kinase PgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678500.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 gene pgtB CDS 124558..125805 product two-component system response regulator PgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930841.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 gene pgtA CDS 126073..127011 product omptin family outer membrane protease PgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716015.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 gene pgtE CDS 127903..128403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS complement(128520..129830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS complement(130460..130714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30880 tRNA complement(132165..132239) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 CDS complement(132315..133256) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377769.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS 133545..134300 product phospholipid-binding lipoprotein MlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776787.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 gene mlaA CDS complement(134361..135674) product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001766332.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 gene fadL CDS 136099..136323 product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030904.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS 136501..137811 product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248124.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 gene fadI CDS 137811..139958 product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214156.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 gene fadJ CDS 140167..140652 product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195808.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 gene sixA CDS complement(140752..141303) product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730794.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 gene smrB CDS 141469..142401 product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001542329.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene prmB CDS 142437..143522 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918475.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 gene aroC CDS 143526..144350 product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750429.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 gene mepA CDS 144350..145159 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368599.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS 145159..145707 product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089233.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene epmC CDS 145740..146015 product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559749.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS complement(146067..148067) product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816082.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene mnmC CDS 148227..149441 product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817161.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene fabB CDS complement(150262..150780) product YbjP/YqhG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847532.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(150780..151148) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118257.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS complement(151317..151565) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433427.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS 151738..152112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051260.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS 152292..153467 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127714.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(153464..154465) product flagella biosynthesis regulator Flk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553395.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene flk CDS 154569..155705 product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699178.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 gene pdxB CDS 155773..156786 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289141.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS 156786..157598 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016631.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 gene truA CDS 157647..158306 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364318.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS 158456..159370 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118383.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 gene accD CDS 159438..160706 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792271.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 gene folC CDS 160696..161370 product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157040.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene dedD CDS 161681..162169 product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262102.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 gene cvpA CDS 162207..163724 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334231.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 gene purF CDS complement(163760..165187) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168932.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS 165398..166795 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132306.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS 166886..168307 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072509.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS 168309..169412 product alanine/ornithine racemase family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281913.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS 169476..170882 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380357.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS 170909..171478 product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825682.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS 171767..172549 product lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754418.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 gene argT CDS 172787..173569 product histidine ABC transporter substrate-binding protein HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731871.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 gene hisJ CDS 173752..174438 product histidine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965498.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS 174435..175142 product histidine ABC transporter permease HisM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569771.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 gene hisM CDS 175153..175929 product histidine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986775.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 gene hisP CDS complement(175981..176874) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166265.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS complement(177000..177647) product GSH-dependent disulfide bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566559.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 gene yfcG CDS 177790..178434 product glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043013.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 gene yfcF CDS 178490..179041 product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772458.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 gene yfcE CDS 179098..179652 product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230215.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 gene yfcD CDS complement(179658..180677) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026954.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS 180930..181373 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901818.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS 181454..181726 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699818.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS 181747..183138 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681684.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS 183135..183965 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103260.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS 183958..184911 product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098117.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS complement(184960..186438) product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117932.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene yfcC CDS complement(186698..188842) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086690.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 gene pta CDS complement(188919..190121) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095689.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 gene ackA CDS 190539..190916 product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106616.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene yfbV CDS 190999..191493 product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426135.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS 191504..192163 product sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013205.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS 192240..194066 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012871.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS complement(194172..194771) product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813878.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 gene yfbR CDS complement(194865..196079) product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074540.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 gene alaA CDS 197011..197949 product transcriptional regulator LrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606282.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 gene lrhA CDS 198576..199019 product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062993.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 gene nuoA CDS 199035..199697 product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386728.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 gene nuoB CDS 199784..201586 product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247855.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 gene nuoC CDS 201589..202089 product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545038.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 gene nuoE CDS 202086..203423 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800046.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 gene nuoF CDS 203454..206180 product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518099.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 gene nuoG CDS 206177..207154 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118517.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 gene nuoH CDS 207169..207711 product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172747.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 gene nuoI CDS 207722..208276 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393522.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene nuoJ CDS 208273..208575 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612687.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 gene nuoK CDS 208572..210413 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056574.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 gene nuoL CDS 210727..212256 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926422.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene nuoM CDS 212263..213720 product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156669.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 gene nuoN CDS 214609..216399 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244800.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS complement(216440..217441) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368546.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS complement(217507..218433) product ribonuclease BN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000419093.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 gene rbn CDS 218485..218946 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568155.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS 219001..219306 product stress response protein ElaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242981.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 gene elaB CDS 219407..220702 product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555672.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 gene menF CDS 220788..222458 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116387.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 gene menD CDS 222455..223213 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979148.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 gene menH CDS 223228..224085 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640013.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 gene menB CDS 224085..225047 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255562.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 gene menC CDS 225044..226411 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144672.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 gene menE CDS 226509..226766 product signal transduction protein PmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455131.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 gene pmrD CDS complement(226761..227138) product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538693.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 gene arnF CDS complement(227138..227473) product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579483.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 gene arnE CDS complement(227470..229116) product lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024131156.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 gene arnT CDS complement(229113..230012) product 4-deoxy-4-formamido-L-arabinose-phosphoundecaprenol deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169759.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 gene arnD CDS complement(230009..231991) product bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648774.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 gene arnA CDS complement(231988..232971) product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458894.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 gene arnC CDS complement(232974..234113) product UDP-4-amino-4-deoxy-L-arabinose aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279286.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 gene arnB CDS 234412..235017 product lipopolysaccharide core heptose(II)-phosphate phosphatase PmrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879245.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 gene pmrG CDS complement(235062..235487) product nucleoside triphosphatase NudI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249902.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 gene nudI CDS 235634..236308 product YfaZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001574701.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS 236423..237619 product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935685.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS 237869..238651 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894172.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS 238665..239870 product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427822.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 gene rhmD CDS 239926..241215 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028931.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS 241241..242044 product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992948.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 gene yfaU CDS 242050..242226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS complement(242313..243335) product SPI-2 type III secretion system effector deubiquitinase SseL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017745.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 gene sseL CDS complement(243761..244951) product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285727.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 gene glpC CDS complement(244948..246207) product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667159.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 gene glpB CDS complement(246284..247825) product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857213.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 gene glpA CDS 248098..249456 product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948703.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 gene glpT CDS 249461..250531 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858949.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 gene glpQ CDS complement(250647..251525) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176728.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS 251687..252877 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660244.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS complement(252879..253133) product ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533921.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 gene yfaE CDS complement(253133..254263) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332020.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 gene nrdB CDS complement(254376..256661) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076502.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 gene nrdA CDS complement(257017..257745) product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091011.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS complement(257828..258523) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944714.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS 258762..260087 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098092.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 260102..261304 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705579.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS 261714..264350 product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281282.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 gene gyrA CDS 264468..267314 product two-component system sensor histidine kinase RcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876074.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 gene rcsC CDS complement(267417..268067) product response regulator transcription factor RcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061910.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 gene rcsB CDS complement(268084..270753) product phosphotransferase RcsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083209.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 gene rcsD CDS 271481..272617 product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865526.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS 272732..273784 product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784304.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 gene apbE CDS 273868..274926 product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975974.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 gene ada CDS 274929..275579 product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884984.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 gene alkB CDS 275653..277296 product multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421580.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS complement(277479..277985) product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764187.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 gene eco CDS 278868..279131 product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260058.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 gene napD CDS 279128..281614 product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778090.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 gene napA CDS 281621..282316 product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091679.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 gene napG CDS 282303..283172 product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013528.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 gene napH CDS 283267..283737 product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835182.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 gene napB CDS 283747..284349 product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431773.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 gene napC sequence34 source 1..546986 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 206..1507 product oxalacetate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444843.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS 1560..2258 product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600161.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS complement(2292..3362) product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497705.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 gene degS CDS complement(3455..4822) product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716695.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 gene degQ CDS complement(4979..5377) product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481183.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 gene zapG CDS 5570..6694 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191224.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 gene zapE CDS 6996..7424 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847559.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 gene rplM CDS 7440..7832 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829815.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 gene rpsI CDS 7990..8784 product DUF695 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505558.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS 9047..9685 product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257300.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 gene sspA CDS 9691..10191 product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366112.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 gene sspB CDS 10309..11091 product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382926.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 gene nanR CDS 11226..12119 product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029662.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 gene nanA CDS 12235..13725 product sialic acid transporter NanT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108071.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 gene nanT CDS 13772..14461 product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054239.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 14458..15333 product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208982.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 gene nanK CDS 15330..15797 product N-acetylneuraminate anomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979902.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 gene nanQ CDS complement(15879..17159) product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180693.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS complement(17146..18399) product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076275.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 gene codB CDS complement(18515..19618) product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184299.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS complement(19825..21243) product glutamate synthase subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081705.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 gene gltD CDS complement(21253..25710) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965014.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 gene gltB CDS 25591..25851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS 26385..27314 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176887.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS 27408..29744 product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809818.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 gene arcB CDS 29971..30624 product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719819.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 gene elbB CDS 30621..31349 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044653.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 gene mtgA CDS complement(31424..32056) product PhoP regulatory network protein YrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602196.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 gene yrbL CDS complement(32306..32578) product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216797.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 gene npr CDS complement(32575..33429) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243746.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 gene rapZ CDS complement(33475..33966) product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609332.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 gene ptsN CDS complement(34084..34371) product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176588.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 gene hpf CDS complement(34394..35827) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809012.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 gene rpoN CDS complement(35875..36600) product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224104.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 gene lptB CDS complement(36607..37161) product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669770.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 gene lptA CDS complement(37130..37705) product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047845.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 gene lptC CDS complement(37702..38268) product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030029.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 gene kdsC CDS complement(38289..39275) product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018616.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 gene kdsD CDS complement(39289..40266) product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922739.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS 40479..41291 product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531560.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 gene mlaF CDS 41299..42081 product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925786.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 gene mlaE CDS 42086..42637 product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193591.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 gene mlaD CDS 42656..43291 product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476475.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 gene mlaC CDS 43291..43587 product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188843.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 gene mlaB CDS 43775..44029 product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900133.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 gene ibaG CDS 44083..45342 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357288.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 gene murA CDS complement(45401..45688) product DNA-binding transcriptional regulator SfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444167.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 gene sfsB CDS complement(45920..46891) product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047354.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 gene ispB CDS 47149..47460 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271396.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 gene rplU CDS 47480..47737 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940593.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 gene rpmA CDS 47867..48832 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813052.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS 48848..50020 product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673554.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 gene cgtA CDS complement(50151..51584) product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212675.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 gene dacB CDS 51832..52308 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148008.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 gene greA CDS complement(52464..52796) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196654.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 gene yhbY CDS 52884..53510 product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145975.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 gene rlmE CDS 53605..55548 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107481.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 gene ftsH CDS 55653..56501 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764715.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 gene folP CDS 56494..57831 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071169.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 gene glmM CDS 58054..58386 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272680.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 gene secG tRNA 58400..58486 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 CDS complement(58571..59530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS complement(59688..61031) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207645.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 gene argG tRNA 61375..61451 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 CDS 61659..62111 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024135124.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 gene rimP CDS 62139..63641 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031036.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 gene nusA CDS 63666..66344 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131175.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 gene infB CDS 66565..66966 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040205.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 gene rbfA CDS 66966..67910 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089682.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 gene truB CDS 68061..68330 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059465.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 gene rpsO CDS 68542..70707 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989243.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 gene pnp CDS 70940..71701 product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802069.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 gene nlpI CDS 71880..73769 product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301504.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene deaD CDS 73923..75167 product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224390.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 gene mtr CDS complement(75228..75758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294022.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS 75917..76636 product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532752.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS complement(76614..77621) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130426.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS complement(77799..78677) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877709.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS complement(78686..79681) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421309.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS 79898..80422 product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884720.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS 80416..80919 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908562.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS complement(80906..81223) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928379.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS 81261..81704 product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380404.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS complement(81684..82202) product protein/nucleic acid deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037599.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 gene yhbO CDS 82333..82968 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001638995.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(83035..83610) product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643280.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 gene dolP CDS complement(83620..84210) product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893483.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 gene diaA CDS complement(84232..84627) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057282.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS complement(84585..86627) product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249248.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS 86691..87554 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812294.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 gene rsmI CDS complement(87712..88485) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083899.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS complement(88596..89639) product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844177.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 gene gatD CDS complement(89683..91056) product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490608.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS complement(91060..91344) product PTS galactitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824293.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 gene gatB CDS complement(91375..91839) product PTS galactitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080443.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 gene gatA CDS complement(91854..93125) product tagatose-bisphosphate aldolase subunit GatZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853833.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 gene gatZ CDS complement(93245..94099) product tagatose bisphosphate family class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469985.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS complement(94357..95928) product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273719.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 gene garD CDS 96458..97228 product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057715.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 gene garL CDS 97254..98144 product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178106.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 gene garR CDS 98242..99387 product glycerate 2-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706461.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 gene garK CDS 100614..101552 product transcriptional regulator TdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094904.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 gene tdcA CDS 101650..102639 product bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548373.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 gene tdcB CDS 102660..103991 product threonine/serine transporter TdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020078491.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 gene tdcC CDS 104058..105266 product propionate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001859.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 gene tdcD CDS 105300..107594 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867312.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 gene pflB CDS 107664..109028 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622070.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 gene tdcG CDS 109343..110674 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401598.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS 110700..112010 product serine dehydratase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000463069.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS complement(112123..112287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS complement(112311..113012) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633552.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 113117..114013 product DNA-binding transcriptional regulator YhaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041028.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 gene yhaJ CDS complement(114052..114417) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384139.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS complement(114541..115527) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531164.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS complement(115595..115987) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603920.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS complement(116235..116534) product YqjK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095496.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS complement(116531..116929) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785626.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(116932..117237) product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031219.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS complement(117279..117647) product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877297.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS complement(117792..118175) product EnvZ/OmpR regulon moderator MzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917516.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 gene mzrA CDS complement(118179..118841) product DedA family general envelope maintenance protein YqjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422141.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 gene yqjA CDS complement(119291..120535) product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235369.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 gene sstT CDS complement(120790..121758) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098834.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS complement(122029..123027) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617687.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS complement(123116..123748) product vancomycin high temperature exclusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951045.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS complement(123960..124457) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202966.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS 124543..125679 product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019992.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 gene rlmG CDS complement(125760..127778) product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121488.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 gene fadH CDS complement(127949..129238) product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001536702.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 gene ygjG CDS 129758..131278 product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094656.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS 131645..133234 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478457.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS complement(133231..133875) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983441.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS 134110..134877 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213683.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 tRNA complement(134957..135032) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 CDS 135158..135664 product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237776.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 gene mug CDS complement(135788..137770) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519776.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 gene rpoD CDS complement(137785..139530) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918867.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 gene dnaG CDS complement(139765..139980) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 gene rpsU CDS 140208..141221 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264383.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 gene tsaD CDS 141245..141424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS complement(141471..142082) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272784.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 gene plsY CDS 142186..142548 product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001540933.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 gene folB CDS 142646..143467 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281933.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 gene bacA CDS complement(143571..144812) product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708457.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS complement(144875..145489) product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125344.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS 145731..147032 product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046233.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS 147150..149993 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188297.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 gene glnE CDS 150041..151474 product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867682.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 gene hldE CDS complement(151933..153612) product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342894.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS complement(153631..154251) product DUF1449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171735.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS 154509..154718 product cell surface composition regulator GlgS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928927.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 gene glgS CDS complement(154793..155089) product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001537605.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS 155526..156179 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076978.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 gene ribB CDS complement(156458..157027) product protein-disulfide oxidoreductase DsbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345576.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 gene dsbI note possible pseudo, internal stop codon CDS complement(157042..157713) product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096232.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS complement(157733..159529) product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460261.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS complement(160172..160945) product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115874.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 gene zupT CDS 161086..161874 product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245226.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 gene ygiD CDS complement(161936..163099) product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442833.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS complement(163105..163680) product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831528.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS complement(163989..165458) product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001663008.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 gene tolC CDS 165665..166297 product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231952.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 gene nudF CDS 166294..166716 product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833403.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS 166741..167568 product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444734.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 gene cpdA CDS 167568..168149 product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105725.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 gene yqiA CDS 168177..170069 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195318.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 gene parE CDS complement(170194..170508) product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958587.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS complement(170540..171121) product NADPH:quinone oxidoreductase MdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065430.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 gene mdaB CDS complement(171228..172577) product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779337.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 gene qseC CDS complement(172574..173233) product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221574.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 gene qseB CDS 173385..173777 product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731552.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS 173849..174715 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998802.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS 174826..177084 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281905.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 gene parC CDS 177341..178078 product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965730.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 gene plsC CDS 178152..179564 product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010658.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 gene ftsP CDS complement(179609..180916) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345269.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS complement(180927..181409) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259757.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS complement(181451..182434) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645961.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS 182922..185093 product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274469.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS 185296..185490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS complement(185648..186103) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128238.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS complement(186148..187602) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818491.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS complement(187799..188626) product 2,5-didehydrogluconate reductase DkgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013149.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 gene dkgA CDS complement(188732..189895) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787713.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 gene yqhD CDS 190070..190987 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759292.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS complement(191051..191710) product DedA family general envelope maintenance protein YghB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268441.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 gene yghB CDS complement(191850..193037) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130268.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 gene metC CDS 193289..194023 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527859.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 gene exbB CDS 194030..194455 product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251476.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 gene exbD CDS complement(194568..195452) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019040.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS complement(195576..195980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098710.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS complement(195967..196377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936453.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS 196481..196984 product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433046.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS 197264..197758 product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439337.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS 198065..199708 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098705.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS 199793..200080 product DUF2623 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059119.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS 200270..201388 product hydrogenase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145429.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 gene hybO CDS 201391..202377 product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081721.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 gene hybA CDS 202367..203545 product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017676.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 gene hybB CDS 203542..205245 product hydrogenase 2 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083046.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 gene hybC CDS 205245..205739 product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221964.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS 205732..206220 product hydrogenase-2 assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004951.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 gene hybE CDS 206213..206554 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544945.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 gene hypA CDS 206582..206830 product hydrogenase maturation factor HybG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334887.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 gene hybG CDS 206906..207958 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032012.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS 207955..208668 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220944.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS complement(208736..209602) product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774864.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 gene yghU CDS 209829..211685 product bifunctional glutathionylspermidine amidase/synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033690.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 gene gss CDS 212355..213410 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475254.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS complement(213710..215122) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190176.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 gene uxaC CDS complement(215134..216606) product fructuronate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437132.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS complement(216717..217901) product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815487.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 gene uxuA CDS 218306..219610 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784371.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS 220006..220884 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137806.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS 220923..221846 product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540892.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS 222572..223057 product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000338756.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS 223057..223437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS complement(223573..225057) product NAD-dependent phenylacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286412.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS 225219..226520 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092814.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS 226535..226909 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704675.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS 227118..228617 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475953.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS 228595..229152 product DUF3156 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100106.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS complement(229256..229939) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275352.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS 230451..231635 product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704668.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS 231704..233443 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704667.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS complement(233491..234369) product itaconate degradation transcriptional regulator RipR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212067.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 gene ripR CDS 234461..235303 product itaconate degradation C-C-lyase RipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212068.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 gene ripC CDS 235327..235854 product (R)-specific enoyl-CoA hydratase RipB/Ich inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212069.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 gene ripB CDS 235879..237204 product itaconate CoA-transferase RipA/Ict inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212070.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 gene ripA CDS 237215..237649 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208236.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 tRNA complement(237808..237883) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 CDS complement(237989..238696) product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234466.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS 239130..241256 product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839779.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 gene speC CDS complement(241318..242322) product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049802.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 note possible pseudo, frameshifted CDS complement(242280..242573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34540 note possible pseudo, frameshifted CDS complement(242790..243875) product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976289.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 gene mltC CDS complement(243988..244263) product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091706.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(244291..245343) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148958.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 gene mutY CDS 245498..246217 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786887.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 gene trmB CDS 246217..246543 product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107559.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS 246593..247312 product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984827.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS 247501..248547 product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394189.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 gene ansB CDS 248680..249687 product DUF1202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252198.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS complement(249778..250914) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096530.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 gene hemW CDS complement(250907..251500) product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174773.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS complement(251508..251798) product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277205.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 gene yggU CDS complement(251795..252361) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094848.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS complement(252380..253084) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997790.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS 253102..254082 product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055657.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS 254214..254900 product global regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098333.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS complement(254947..255363) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285491.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 gene ruvX CDS complement(255363..255926) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053167.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS complement(256142..257089) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593242.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 gene gshB CDS complement(257109..257840) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001800534.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 gene rsmE CDS complement(257917..258624) product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286121.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 gene endA CDS complement(258720..259175) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856775.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS complement(259296..260690) product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113171.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 gene galP CDS complement(261183..262337) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062140.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 gene metK CDS 262411..262692 product protein YqgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305310.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 gene yqgD CDS 263205..265103 product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278580.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 gene speA CDS 265248..265979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758897.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS 266184..266933 product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438650.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS 268156..269628 product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640209.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS 269631..270647 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853929.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS 270661..271668 product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214544.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS 271707..272201 product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209301.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS 272535..273350 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531321.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS 273555..274475 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105550.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 gene speB CDS complement(274576..275334) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701830.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS 275610..277601 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098658.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 gene tkt CDS complement(277645..278301) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956919.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS complement(278295..278972) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520421.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS complement(278960..279667) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553271.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS complement(279668..280246) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124001.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS complement(280272..280697) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218564.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS 281071..282117 product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218338.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 gene epd CDS 282139..283302 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111274.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 gene pgk CDS 283404..284483 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034386.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 gene fbaA CDS 284716..285576 product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389833.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS 285777..286412 product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626880.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 gene argO CDS 286506..287252 product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669854.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS complement(287518..288411) product DNA-binding transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828344.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 gene argP CDS 288565..289224 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189741.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 gene rpiA CDS 289440..290723 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151621.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 gene serA CDS complement(291104..291700) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621084.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS complement(291946..292275) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276011.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 gene zapA CDS 292442..293020 product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027229.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS 293046..294362 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193684.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 gene pepP CDS 294359..295537 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111142.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 gene ubiH CDS 295663..296865 product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192154.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 gene ubiI CDS 297320..298414 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068738.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 gene gcvT CDS 298440..298829 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295377.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 gene gcvH CDS 298992..301865 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194962.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 gene gcvP CDS 302321..303214 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819369.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS complement(303262..304695) product 6-phospho-beta-glucosidase BglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230148.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 gene bglA CDS 304853..305164 product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182971.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 gene yqfB CDS 305328..305987 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250289.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS 305995..306186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS complement(306103..307083) product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874170.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 gene ygfZ CDS complement(307098..307334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS 307333..307599 product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351186.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 gene sdhE CDS 307580..307993 product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244781.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS complement(308046..308567) product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055885.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 gene fldB CDS 308680..309576 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434302.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 gene xerD CDS 309600..310313 product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745614.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 gene dsbC CDS 310319..312052 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813396.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 gene recJ CDS 312374..313255 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989230.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 gene prfB note possible pseudo, frameshifted CDS 313265..314782 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003338.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 gene lysS CDS complement(314858..315403) product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133998.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 gene idi CDS 315668..316426 product amidase activator ActS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518939.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 gene actS tRNA 316506..316579 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 CDS complement(316711..317511) product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989071.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS complement(317797..318057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS 318232..318483 product toxin-antitoxin system antitoxin VapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557549.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 gene vapB CDS 318483..318881 product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911334.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 gene vapC CDS 319698..320225 product STM3031 family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038500.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS 320272..320904 product YfdX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835265.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS 321623..322204 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244646.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS 322324..324807 product fimbrial outer membrane usher protein StdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705516.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 gene stdB CDS 324848..325591 product fimbrial biogenesis chaperone StdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798497.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 gene stdC CDS 325588..326664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141334.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS 326808..327320 product CaiF/GrlA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000336256.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS 327307..328065 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134788.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS complement(328275..329111) product nickel/cobalt efflux protein RcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134629.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 gene rcnA CDS 329233..329505 product Ni(II)/Co(II)-binding transcriptional repressor RcnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019953.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 gene rcnR CDS complement(329536..330765) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036836.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS complement(330907..331362) product multidrug/biocide efflux PACE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597495.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS 331466..332329 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270764.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS 332452..333630 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665983.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS 333989..334897 product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383270.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 gene kduI CDS 334954..335715 product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602495.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 gene kduD CDS 336069..337487 product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253635.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 gene araE CDS 337600..338307 product aspartate/glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848628.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS complement(338279..339214) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741798.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS 339332..340594 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056585.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 gene lysA CDS complement(340604..341626) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968342.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS complement(341637..342665) product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201028.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 gene galR CDS 343258..345417 product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896085.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 gene aas CDS 345410..346612 product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004684.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 gene lplT CDS complement(346699..347739) product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558970.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS complement(347930..348148) product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758664.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS complement(348318..349031) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895635.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS complement(349213..349908) product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274935.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 gene mutH CDS 350591..351121 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564481.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 gene rppH CDS 351134..353380 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957883.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 gene ptsP CDS 353596..354471 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204645.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 gene lgt CDS 354478..355272 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816222.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 gene thyA CDS 355457..355927 product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857051.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS 355918..356481 product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029148.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS 356478..356885 product DUF2509 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078536.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS 356870..357190 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019280.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS 357206..360577 product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946820.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 gene recC CDS 360755..363643 product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138262.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 gene ptrA CDS 363636..367181 product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000533.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 gene recB CDS 367178..369013 product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155175.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 gene recD CDS complement(369116..370447) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588970.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 gene argA CDS 370737..371933 product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011916.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 gene amiC tRNA complement(372043..372119) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 tRNA complement(372149..372225) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 CDS 372433..373530 product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678621.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 gene mltA CDS 373640..374446 product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117742.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 gene tcdA CDS complement(374498..375169) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343890.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 gene rarD CDS complement(375685..376128) product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184198.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 gene csdE CDS complement(376128..377333) product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991058.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 gene csdA CDS 377526..377753 product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750393.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS 378100..379017 product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044409.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 gene gcvA CDS 379030..379431 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203913.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS 379424..380524 product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045494.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 gene rlmM CDS complement(380583..381293) product L-fucose operon activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642330.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 gene fucR CDS complement(381351..381773) product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920848.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 gene fucU CDS complement(381775..383193) product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763972.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 gene fucK CDS complement(383294..385069) product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724126.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 gene fucI CDS complement(385101..386417) product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528619.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 gene fucP CDS 386973..387620 product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440828.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 gene fucA CDS 387637..388785 product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013573.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 gene fucO CDS complement(388877..389632) product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532501.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 gene xni CDS complement(389802..391169) product L-serine ammonia-lyase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626388.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 gene sdaB CDS complement(391228..392517) product HAAAP family serine/threonine permease SdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859030.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 gene sdaC CDS complement(393082..394446) product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627966.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 gene ppnN CDS complement(394559..395407) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100463.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 gene queF CDS 395476..396021 product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343990.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 gene syd CDS 396633..396962 product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207010.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS 396962..397744 product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890022.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 gene truC CDS 397763..398212 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807735.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS complement(398362..398613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS 398693..400051 product galactarate/glucarate/glycerate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097011.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 gene gudP CDS 400048..401388 product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211809.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS 401409..402749 product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107119.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 gene gudD CDS 402827..403969 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706477.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS complement(404013..406769) product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186405.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 gene barA CDS 406827..408122 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046844.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 gene rlmD CDS 408174..410408 product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226841.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 gene relA CDS complement(410758..411789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS complement(411844..412380) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079652.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS complement(412377..412847) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832400.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS complement(412862..413362) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178263.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS complement(413388..414161) product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044464.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS complement(414174..416819) product outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181237660.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS complement(416953..417540) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032646.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS 418148..418948 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210450.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 gene mazG CDS 419176..420813 product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210863.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 gene pyrG CDS 420896..422194 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036734.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 gene eno CDS 422330..423001 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199961.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 gene queE repeat_region 423298..423996 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccgcgccagcggggataaac CDS 424097..424894 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208015.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS complement(424982..425344) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108313.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 gene queD CDS 425768..427567 product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210901.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 gene cysJ CDS 427567..429279 product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291998.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 gene cysI CDS 429381..430115 product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080392.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 gene cysH CDS complement(430203..431156) product SPI-1 type III secretion system effector SopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145541.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 gene sopD CDS 431711..434263 product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233965.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS 434275..435831 product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084093.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 gene casA CDS 435828..436382 product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029331.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 gene casB CDS 436396..437454 product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206445.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 gene cas7e CDS 437465..438211 product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085058.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 gene cas5e CDS 438193..438843 product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281434.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 gene cas6e CDS 438840..439760 product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144875.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 gene cas1e CDS 439760..440053 product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063176.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 gene cas2e repeat_region 440150..440727 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccgcgccagcggggataaaccg CDS complement(440742..441788) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490486.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS 442039..442947 product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372384.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 gene cysD CDS 442957..444396 product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092273.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 gene cysN CDS 444383..444988 product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173663.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 gene cysC CDS 445084..445362 product DUF3561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118109.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS 445553..445864 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517480.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 gene ftsB CDS 445883..446593 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741649.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 gene ispD CDS 446593..447072 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219244.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 gene ispF CDS 447069..448118 product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134253.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 gene truD CDS 448099..448860 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221538.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 gene surE CDS 448854..449480 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253542.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS complement(449619..449816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS 449935..450789 product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272624.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 gene nlpD CDS 450852..451844 product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081498.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 gene rpoS CDS complement(451889..452125) product non-oxidative hydroxyarylic acid decarboxylases subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562964.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS complement(452136..453563) product non-oxidative hydroxyarylic acid decarboxylases subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863165.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS complement(453563..454156) product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764801.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS 454327..454731 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423338.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS complement(454750..455514) product DNA-binding transcriptional repressor YgbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613182.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 gene ygbI CDS 455711..456634 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847985.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS 456628..457890 product 3-oxo-tetronate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590392.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS 457887..458525 product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153636.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS 458530..459306 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136884.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS 459346..460296 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165737.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS 460293..461789 product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202725.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS complement(461831..462742) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216318.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS 462851..464059 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222405.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS 464056..464436 product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703291.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS complement(464492..467059) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005807.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 gene mutS CDS 467217..467627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS 467819..467971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS 468201..468869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS 468896..469390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS complement(469635..470291) product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420463.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 gene pphB CDS 470679..470855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS complement(470928..471452) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971655.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS complement(471452..471733) product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855694.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS complement(472605..473048) product SPI-1 type III secretion system invasion lipoprotein InvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715096.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 gene invH CDS 473393..474154 product type III secretion system transcriptional activator InvF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001674874.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 gene invF CDS 474295..475839 product type III secretion system outer membrane ring protein InvG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848103.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 gene invG CDS 475836..476954 product type III secretion system gatekeeper InvE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612166.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 gene invE CDS 476979..479036 product type III secretion system export apparatus protein InvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927219.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 gene invA CDS 479060..479467 product SPI-1 type III secretion system chaperone SpaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164066.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 gene spaK CDS 479464..480759 product SctN family type III secretion system ATPase InvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856766.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 gene invC CDS 480737..481180 product SPI-1 type III secretion system protein SpaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555884.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 gene spaM CDS 481180..482190 product SPI-1 type III secretion system protein SpaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503113.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 gene spaN CDS 482190..483101 product SPI-1 type III secretion system protein SpaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058738.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 gene spaO CDS 483091..483765 product SPI-1 type III secretion system export apparatus protein SpaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526019.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 gene spaP CDS 483791..484051 product SPI-1 type III secretion system export apparatus protein SpaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342503.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 gene spaQ CDS 484055..484846 product SPI-1 type III secretion system export apparatus protein SpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964941.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 gene spaR CDS 484833..485903 product SPI-1 type III secretion system export apparatus protein SpaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097721.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 gene spaS CDS 486041..486538 product SycD/LcrH family type III secretion system chaperone SicA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386309.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 gene sicA CDS 486541..488322 product SPI-1 type III secretion system needle tip complex protein SipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245782.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 gene sipB CDS 488350..489579 product SPI-1 type III secretion system needle tip complex protein SipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909023.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 gene sipC CDS 489650..490681 product SPI-1 type III secretion system needle tip complex protein SipD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932243.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 gene sipD CDS 490745..492757 product SPI-1 type III secretion system effector SipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258814.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 gene sipA CDS 492776..493024 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055579.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 CDS 493068..493328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692253.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS 493355..493747 product chaperone SicP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147852.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 gene sicP CDS 493758..495365 product SPI-1 type III secretion system effector GTPase-activating protein SptP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946989.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 gene sptP CDS complement(495419..495820) product SPI-1 type III secretion system invasion protein IagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558926.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 gene iagB CDS complement(495919..497514) product transcriptional regulator HilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120092.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 gene hilA CDS complement(498672..499601) product transcriptional regulator HilD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432696.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 gene hilD CDS 500031..501095 product type III secretion system inner membrane ring protein PrgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450189.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 gene prgH CDS 501120..501362 product type III secretion system needle filament protein PrgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143299.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 gene prgI CDS 501381..501686 product type III secretion system inner rod protein PrgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020428.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 gene prgJ CDS 501683..502441 product type III secretion system inner membrane ring lipoprotein PrgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621241.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 gene prgK CDS 502434..503012 product oxygen-regulated invasion protein OrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001574876.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 gene orgA CDS 502969..503649 product type III secretion system linker protein OrgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916657.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 gene orgB CDS 503646..504098 product type III secretion system effector protein OrgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612184.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS 504443..505330 product invasion transcriptional regulator HilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243995.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 gene hilC CDS 505715..506470 product transcriptional regulator SprB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246664.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 gene sprB CDS 506673..507539 product type III secretion system YopJ family effector YopP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117648.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 gene yopP CDS complement(507638..508486) product iron/manganese ABC transporter permease subunit SitD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477918.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 gene sitD CDS complement(508477..509337) product iron/manganese ABC transporter permease subunit SitC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104338.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 gene sitC CDS complement(509334..510155) product iron/manganese ABC transporter ATP-binding protein SitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083163.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 gene sitB CDS complement(510152..511069) product iron/manganese ABC transporter substrate-binding protein SitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182930.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 gene sitA CDS 511251..511595 product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117938.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS complement(511657..513735) product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122695.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 gene flhA CDS complement(513954..514964) product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343887.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 gene hypE CDS complement(514961..516082) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212958.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 gene hypD CDS complement(516082..516354) product hydrogenase 3 maturation protein HypC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334871.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 gene hypC CDS complement(516345..517217) product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337646.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 gene hypB CDS complement(517286..517642) product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544461.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 gene hypA CDS 517852..518313 product formate hydrogenlyase regulator HycA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158074.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 gene hycA CDS 518459..519067 product formate hydrogenlyase subunit HycB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079164.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 gene hycB CDS 519067..520893 product formate hydrogenlyase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097032.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 gene hycC CDS 520896..521819 product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110563.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS 521837..523546 product formate hydrogenlyase subunit HycE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461354.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 gene hycE CDS 523556..524098 product formate hydrogenlyase subunit HycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493767.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 gene hycF CDS 524098..524865 product formate hydrogenlyase subunit HycG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067418.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 gene hycG CDS 524862..525272 product formate hydrogenlyase maturation HycH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003725.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS 525265..525735 product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132980.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 gene hycI CDS 525762..526244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37270 note possible pseudo, frameshifted CDS 526288..526572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37280 note possible pseudo, frameshifted CDS 526773..527318 product electron transport protein HydN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078791.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 gene hydN CDS 527464..529704 product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963417.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 gene hypF CDS complement(529801..530934) product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086352.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 gene norW CDS complement(530931..532370) product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025997.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 gene norV CDS 532556..534076 product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010816.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 gene norR CDS complement(534073..535038) product arabinose-5-phosphate isomerase GutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278206.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 gene gutQ CDS complement(535031..535804) product glucitol operon DNA-binding transcriptional repressor SrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804536.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 gene srlR CDS complement(536002..536361) product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255198.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 gene gutM CDS complement(536438..537217) product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077371.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 gene srlD CDS complement(537229..537591) product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111554.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 gene srlB CDS complement(537603..538574) product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199043.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS complement(538571..539134) product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573335.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 gene srlA CDS 539388..540467 product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476820.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 gene mltB CDS complement(540505..540750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS 540946..541443 product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132240.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 gene pncC CDS 541528..542589 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963150.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 gene recA CDS 542706..543206 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294863.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 gene recX CDS 543442..546072 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047238.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 gene alaS CDS 546307..546492 product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 gene csrA tRNA 546796..546888 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 tRNA 546892..546968 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 sequence35 source 1..134873 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 239..805 product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271296.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 gene yqaB CDS 802..1227 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279499.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS 1304..2860 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611827.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 gene gshA CDS 3010..3525 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130191.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 gene luxS CDS 3871..5241 product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645128.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS complement(5290..6828) product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187289.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 gene emrB CDS complement(6845..8017) product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275597.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 gene emrA CDS complement(8144..8674) product transcriptional repressor MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378431.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 gene mprA CDS complement(9171..10355) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165770.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS complement(10520..11515) product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216613.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 gene proX CDS complement(11585..12649) product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775015.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 gene proW CDS complement(12642..13844) product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985490.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 gene proV CDS complement(14199..15158) product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777898.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 gene nrdF CDS complement(15169..17286) product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201426.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 gene nrdE CDS complement(17286..17696) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275403.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 gene nrdI CDS complement(17693..17938) product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028873.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 gene nrdH CDS complement(18210..18641) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209805.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS 18730..20064 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138449.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS complement(20148..20474) product DUF883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519557.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS 20636..20986 product DUF2002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281304.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS complement(21021..21470) product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492647.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 gene alaE CDS complement(21496..21675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS 22168..22569 product DNA-binding protein StpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051100.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 gene stpA CDS complement(22659..22838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370085.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 CDS complement(22917..23444) product rhodanese family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022010.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 CDS complement(23454..23753) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137417.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS 23936..24094 product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508175.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 CDS 24194..24643 product potassium binding protein Kbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522413.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 gene kbp CDS complement(24665..25342) product DNA-binding transcriptional regulator CsiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126152.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 gene csiR CDS complement(25384..26784) product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531291.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 gene gabP CDS complement(26914..28197) product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095643.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 gene gabT CDS complement(28212..29660) product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176534.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 gene gabD CDS complement(29682..30950) product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271916.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 gene lhgO CDS complement(30976..31953) product glutarate dioxygenase GlaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993092.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 gene glaH CDS complement(32257..33771) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382024.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS complement(33782..34213) product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283754.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS complement(34228..35205) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098088.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS 35360..36034 product transcriptional regulator TctD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237936.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 gene tctD CDS 36021..37436 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872343.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 CDS 37569..38582 product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212234.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS complement(40494..41423) product VirK family antimicrobial peptide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178741.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS 42029..43081 product SPI-2 type III secretion system effector PipB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001801692.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 gene pipB2 CDS 43277..43588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS 44219..46294 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682025.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS complement(46336..47265) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274373.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS complement(47297..48541) product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239947.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS complement(48651..52307) product salmochelin/enterobactin export ABC transporter IroC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111827.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 gene iroC CDS complement(52388..53503) product salmochelin biosynthesis C-glycosyltransferase IroB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221113.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 gene iroB CDS complement(54129..54326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS 54588..54854 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139109819.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS 55076..55699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37980 note possible pseudo, frameshifted CDS complement(55755..55946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167337863.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS complement(56495..57298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38000 CDS complement(57697..58290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS complement(58552..59757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38020 CDS complement(59767..60783) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027757.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS complement(60786..61418) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052560.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS 61540..61782 product Rha family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102106.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS 61816..62325 product phage regulatory CII family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460893.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS 62497..62838 product DUF5347 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996717.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS 62906..63139 product DUF2732 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244218.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS 63139..63366 product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752613.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 CDS 63363..64220 product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104152.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS 64217..66631 product replication endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017503.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS 66784..66972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001580533.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 CDS 66983..67216 product DinI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217561.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 CDS 67276..68007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS 68321..69985 product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994298.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS complement(70089..71129) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040233361.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS complement(71129..72895) product terminase ATPase subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098452.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS 73038..73871 product GPO family capsid scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098796.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS 73888..74949 product phage major capsid protein, P2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098795.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 CDS 74953..75603 product terminase endonuclease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059175.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS 75697..76161 product head completion/stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010835209.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS 76161..76364 product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868184.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS 76368..76583 product HP1 family phage holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171565.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS 76564..77079 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069919.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS 77076..77504 product Rz-like lysis system protein LysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162926034.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 gene lysB CDS 77600..78031 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039939.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS 78024..78470 product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343944.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS complement(78472..79323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS 79401..79979 product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993749.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS 79976..80335 product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177408.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 CDS 80322..81230 product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268327.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS 81223..81828 product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098785.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS 81825..83678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS 83678..84253 product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885577.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS 85123..85347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS 85450..86622 product phage tail sheath protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046101.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS 86632..87147 product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207653.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS 87202..87504 product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280965.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS 87631..90438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS 90435..90920 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098780.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS 90917..92017 product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098779.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 tmRNA complement(92422..92784) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(92856..94046) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989217.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS complement(94027..96207) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196137.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 CDS complement(96204..97532) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533850.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 CDS complement(97678..109152) product Ig-like domain repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237656.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS complement(109767..110294) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518569.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 gene smpB CDS 110426..110875 product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242603.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS 110865..111155 product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112990.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS complement(111321..111659) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203445.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 gene bamE CDS complement(111808..113469) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880973.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 gene recN CDS complement(113555..114433) product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059155.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 gene nadK CDS 114395..115147 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518875.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 gene grpE CDS complement(115182..115787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS complement(115908..117149) product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519447.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS complement(117214..118005) product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001537507.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 CDS 118171..119532 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460052.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 gene ffh CDS 119785..120033 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256453.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 gene rpsP CDS 120052..120600 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043266.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 gene rimM CDS 120645..121412 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469802.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 gene trmD CDS 121453..121800 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065257.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 gene rplS CDS complement(121957..123108) product diguanylate cyclase DgcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030993.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 gene dgcN CDS complement(123170..123694) product YfiR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212373.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 CDS 124128..125198 product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168062.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 gene aroF CDS 125208..126329 product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225191.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 gene tyrA CDS 126387..127295 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210976.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 CDS complement(127256..128416) product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200079.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 gene pheA CDS complement(128667..129005) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178449.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 gene raiA CDS complement(129277..130014) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197667.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 gene bamD CDS 130146..131126 product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079130.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 gene rluD CDS 131123..131854 product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992642.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 gene yfiH CDS 131984..134557 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235094.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 gene clpB sequence36 source 1..191602 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 251..1477 product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809957.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 CDS complement(1479..1739) product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012543411.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS 2115..2534 product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532742.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 gene ibpA CDS 2644..3072 product heat shock chaperone IbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001766501.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 gene ibpB CDS 3261..4922 product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279784.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS 5366..5713 product YidH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640235.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 CDS 5703..6065 product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113457.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS 6062..6592 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147843.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 CDS complement(6674..7996) product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427787.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 gene dsdA CDS complement(8014..9351) product D-serine transporter DsdX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543313.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 gene dsdX CDS 9562..10500 product DNA-binding transcriptional regulator DsdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989264.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 gene dsdC CDS 10588..11649 product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238915.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS complement(11576..12760) product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828742.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 gene emrD CDS complement(12963..13796) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094802.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS 14844..16532 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168445.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 gene ilvB CDS 16536..16826 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171826.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 gene ilvN CDS complement(16828..17613) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448638.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS 17938..18858 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350272.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 gene rbsK CDS 18889..20205 product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998359.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 gene fucP CDS 20217..21230 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213216.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS 21384..21974 product transcriptional regulator UhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633674.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 gene uhpA CDS 21974..23476 product signal transduction histidine-protein kinase/phosphatase UhpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091255.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 gene uhpB CDS 23486..24778 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948180.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS 24956..26347 product hexose-6-phosphate:phosphate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879212.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 gene uhpT CDS 26540..26992 product DUF1198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519640.1 transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS complement(27425..27748) product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274842.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS complement(27732..28136) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263506.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS 28307..29500 product purine ribonucleoside efflux pump NepI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004798.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 gene nepI CDS complement(29560..30942) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270464.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 CDS complement(31048..31341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824217.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS 31538..34336 product transcriptional regulator DagR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446280.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 gene dagR CDS 34555..34980 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214106.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS 34991..35476 product PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284295.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS 35622..36371 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380259.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 CDS 36371..37228 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093404.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 CDS 37232..38341 product D-glucosaminate-6-phosphate ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188469.1 transl_table 11 codon_start 1 locus_tag LOCUS_39070 gene dgaE CDS 38328..39071 product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186142.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS 39307..40248 product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749532.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 CDS complement(40291..41193) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535970.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS 41717..42400 product MgtC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392697.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 CDS 42620..45346 product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131278.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 gene mgtA CDS 45661..46140 product anti-virulence regulator CigR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705491.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 CDS complement(46308..46988) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106461.1 transl_table 11 codon_start 1 locus_tag LOCUS_39140 CDS 47772..48629 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098484.1 transl_table 11 codon_start 1 locus_tag LOCUS_39150 CDS 48622..49104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001521985.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 CDS complement(49199..52066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39170 CDS complement(52141..52758) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984810.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS 53772..53945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39190 CDS complement(54057..55094) product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703846.1 transl_table 11 codon_start 1 locus_tag LOCUS_39200 CDS complement(55281..55631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39210 note possible pseudo, internal stop codon CDS complement(55628..56128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39220 note possible pseudo, internal stop codon, frameshifted CDS complement(56125..56622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39230 CDS complement(56637..56813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS 57491..57835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39250 tRNA complement(58152..58246) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 CDS 58534..59916 product glycoside-pentoside-hexuronide family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834259.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS 59928..62246 product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703001.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 gene yicI CDS complement(62349..64058) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766661.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS complement(64179..65570) product xanthine/proton symporter XanP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115428.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 gene xanP CDS 65798..67003 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462252.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 gene gltS CDS complement(67039..69120) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016758.1 transl_table 11 codon_start 1 locus_tag LOCUS_39310 gene recG CDS complement(69126..69815) product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068431.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 gene trmH CDS complement(69820..71931) product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280498.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 gene spoT CDS complement(71950..72225) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 transl_table 11 codon_start 1 locus_tag LOCUS_39340 gene rpoZ CDS complement(72280..72903) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046966.1 transl_table 11 codon_start 1 locus_tag LOCUS_39350 gene gmk CDS 73160..74845 product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309848.1 transl_table 11 codon_start 1 locus_tag LOCUS_39360 gene ligB CDS complement(74842..75459) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924333.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 CDS complement(75710..76591) product HARLDQ motif MBL-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083230.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS 76665..77567 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050861.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS complement(77617..78480) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621352.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS 78606..79322 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247078.1 transl_table 11 codon_start 1 locus_tag LOCUS_39410 gene rph CDS 79401..80042 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806169.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 gene pyrE CDS complement(80120..80716) product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818596.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 gene slmA CDS complement(80824..81282) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717792.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 gene dut CDS complement(81260..82483) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001541625.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 gene coaBC CDS 82656..83321 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380129.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 gene radC CDS 83539..83775 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519051.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 gene rpmB CDS 83796..83963 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051798.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 gene rpmG CDS 84061..84870 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114515.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 gene mutM CDS complement(84898..85377) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171888.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 gene coaD CDS complement(85386..86663) product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891584.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 gene waaA CDS 87126..88142 product lipopolysaccharide core heptosyltransferase RfaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001210932.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 gene rfaQ CDS 88139..89263 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261571.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 CDS 89256..90053 product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229818.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 gene rfaP CDS 90109..90318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS 90388..91467 product lipopolysaccharide 1,6-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704702.1 transl_table 11 codon_start 1 locus_tag LOCUS_39560 gene waaB CDS 91473..92486 product lipopolysaccharide 3-alpha-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088491.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 gene waaO CDS 92504..93517 product lipopolysaccharide 1,2-glucosyltransferase RfaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376863.1 transl_table 11 codon_start 1 locus_tag LOCUS_39580 gene rfaJ CDS 93540..94238 product lipopolysaccharide core heptose(II) kinase RfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582822.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 gene rfaY CDS 94388..95197 product 3-deoxy-D-manno-oct-2-ulosonate III transferase WaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536021.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 gene waaZ CDS 95297..96442 product lipopolysaccharide N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591814.1 transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS complement(96500..97714) product O-antigen ligase RfaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958453.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 gene rfaL CDS complement(97754..98707) product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264610.1 transl_table 11 codon_start 1 locus_tag LOCUS_39630 gene rfaC CDS complement(98707..99753) product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699210.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 gene rfaF CDS complement(99756..100688) product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587771.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 gene rfaD CDS 100891..102087 product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213794.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 gene kbl CDS 102097..103122 product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645995.1 transl_table 11 codon_start 1 locus_tag LOCUS_39670 gene tdh CDS 103416..104450 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798185.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS complement(104437..105399) product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135520.1 transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS complement(105403..106686) product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214137.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 gene envC CDS complement(106696..108240) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116577.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 gene gpmM CDS 108488..108919 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156179.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 CDS 109006..109257 product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273795.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 gene grxC CDS 109301..109768 product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003370.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 gene secB CDS 109768..110787 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076596.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 gene gpsA CDS 110865..111686 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112114.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 gene cysE CDS complement(111769..112965) product glucarate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234818.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 gene gudP CDS complement(113153..114349) product L-talarate/galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218254.1 transl_table 11 codon_start 1 locus_tag LOCUS_39780 CDS 114619..115671 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981551.1 transl_table 11 codon_start 1 locus_tag LOCUS_39790 CDS complement(115739..116212) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932331.1 transl_table 11 codon_start 1 locus_tag LOCUS_39800 gene trmL CDS complement(116278..117468) product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587027.1 transl_table 11 codon_start 1 locus_tag LOCUS_39810 gene lldD CDS complement(117465..118241) product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636695.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 gene lldR CDS complement(118238..119893) product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055299.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 gene lldP CDS complement(120192..124304) product trimeric autotransporter adhesin SadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079584.1 transl_table 11 codon_start 1 locus_tag LOCUS_39840 gene sadA CDS complement(124348..125031) product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277586.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 CDS complement(125519..125881) product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665687.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS 126172..126381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062561.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS complement(126391..126915) product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193201.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 gene mtlR CDS complement(126978..128126) product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645390.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 gene mtlD CDS complement(128347..130263) product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093287.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 gene mtlA CDS 130739..131347 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766681.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 CDS 131446..132837 product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200188.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 gene selA CDS 132834..134684 product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582376.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 gene selB CDS complement(134932..135813) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188270.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 CDS 135982..137520 product aldehyde dehydrogenase AldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183998.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 gene aldB CDS complement(137638..139593) product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101526.1 transl_table 11 codon_start 1 locus_tag LOCUS_39960 CDS 139857..140672 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891802.1 transl_table 11 codon_start 1 locus_tag LOCUS_39970 CDS complement(140833..141528) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893174.1 transl_table 11 codon_start 1 locus_tag LOCUS_39980 gene araD CDS complement(141522..142382) product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244034.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS complement(142375..143037) product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089538.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 gene ulaD CDS complement(143034..144530) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074072.1 transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS complement(144534..145520) product 2,3-diketo-L-gulonate transporter substrate-binding protein YiaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776928.1 transl_table 11 codon_start 1 locus_tag LOCUS_40020 gene yiaO CDS complement(145532..146809) product 2,3-diketo-L-gulonate transporter large permease YiaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301825.1 transl_table 11 codon_start 1 locus_tag LOCUS_40030 gene yiaN CDS complement(146812..147285) product 2,3-diketo-L-gulonate TRAP transporter small permease YiaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832313.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 gene yiaM CDS complement(147424..148356) product DUF4862 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794971.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 CDS complement(148380..148844) product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576062.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 CDS complement(148856..149854) product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869006.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 gene yiaK CDS 150084..150884 product IclR family transcriptional regulator YiaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081338.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 gene yiaJ CDS 151001..151474 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078818.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 CDS complement(151511..152761) product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144384.1 transl_table 11 codon_start 1 locus_tag LOCUS_40100 gene avtA CDS complement(152935..154962) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761327.1 transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS 155530..156102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40120 CDS complement(156163..157341) product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459824.1 transl_table 11 codon_start 1 locus_tag LOCUS_40130 CDS 157704..159026 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149568.1 transl_table 11 codon_start 1 locus_tag LOCUS_40140 gene xylA CDS 159126..160580 product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275331.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 gene xylB CDS 160755..161108 product YiaA/YiaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340932.1 transl_table 11 codon_start 1 locus_tag LOCUS_40160 CDS complement(161131..162126) product O-acetyltransferase WecH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182662.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 gene wecH CDS 162292..162594 product YsaB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605592.1 transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS 162733..163644 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168544.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 gene glyQ CDS 163654..165723 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291805.1 transl_table 11 codon_start 1 locus_tag LOCUS_40200 gene glyS CDS 166038..166277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40210 note possible pseudo, internal stop codon CDS 166320..166511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40220 note possible pseudo, internal stop codon CDS 166683..167150 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702452.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 CDS 167349..167615 product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965889.1 transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS 167603..168088 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533908.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 CDS complement(168459..168998) product copper-binding periplasmic metallochaperone CueP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047148.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 gene cueP CDS complement(169172..169384) product RNA chaperone/antiterminator CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014594.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 gene cspA CDS complement(169672..170004) product HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455790.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS 170401..171111 product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190524.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 CDS complement(171161..172135) product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804690.1 transl_table 11 codon_start 1 locus_tag LOCUS_40300 gene ghrB CDS complement(172354..173016) product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747548.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS 173169..175502 product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148449.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 CDS complement(175471..175911) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619903.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 CDS complement(175889..176470) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188408.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 gene tag CDS 176681..177331 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637074.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 CDS complement(177333..177521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40360 CDS 177849..178373 product long polar fimbria major subunit LpfA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758167.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 gene lpfA1 CDS 178458..179156 product long polar fimbrial biogenesis chaperone LpfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836900.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 gene lpfB CDS 179179..181707 product outer membrane usher protein LpfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558664.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 gene lpfC CDS 181725..182804 product long polar fimbrial protein LpfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694929.1 transl_table 11 codon_start 1 locus_tag LOCUS_40400 gene lpfD CDS 182810..183337 product long polar fimbrial protein LpfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831422.1 transl_table 11 codon_start 1 locus_tag LOCUS_40410 gene lpfE CDS 183573..185246 product kdo(2)-lipid A phosphoethanolamine 7''-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269253.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 gene eptB tRNA 185337..185413 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00700 CDS 185448..185633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40430 CDS complement(185728..186735) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290717.1 transl_table 11 codon_start 1 locus_tag LOCUS_40440 CDS 186885..188009 product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940824.1 transl_table 11 codon_start 1 locus_tag LOCUS_40450 CDS 188067..189392 product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975177.1 transl_table 11 codon_start 1 locus_tag LOCUS_40460 CDS 189975..191555 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028045.1 transl_table 11 codon_start 1 locus_tag LOCUS_40470 sequence37 source 1..172196 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 177..1835 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989106.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 CDS 1837..2523 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377415.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 CDS complement(2545..3465) product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127280.1 transl_table 11 codon_start 1 locus_tag LOCUS_40500 gene rihC CDS complement(3481..3723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40510 note possible pseudo, frameshifted CDS complement(3689..4684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516332.1 transl_table 11 codon_start 1 locus_tag LOCUS_40520 note possible pseudo, frameshifted CDS complement(4884..5834) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166426.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 gene ispH CDS complement(5837..6286) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047269.1 transl_table 11 codon_start 1 locus_tag LOCUS_40540 gene fkpB CDS complement(6441..6941) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042743.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 gene lspA CDS complement(6941..9811) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989105.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 gene ileS CDS complement(9820..10758) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767311.1 transl_table 11 codon_start 1 locus_tag LOCUS_40570 gene ribF CDS 11087..11350 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518655.1 transl_table 11 codon_start 1 locus_tag LOCUS_40580 gene rpsT CDS 11806..13179 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989104.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS 13219..15258 product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116444.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 CDS complement(15313..16212) product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062872.1 transl_table 11 codon_start 1 locus_tag LOCUS_40610 gene nhaR CDS complement(16274..17440) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681337.1 transl_table 11 codon_start 1 locus_tag LOCUS_40620 gene nhaA CDS complement(17603..19318) product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094796.1 transl_table 11 codon_start 1 locus_tag LOCUS_40630 CDS complement(19445..20692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494928.1 transl_table 11 codon_start 1 locus_tag LOCUS_40640 CDS complement(20717..21907) product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971151.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 CDS complement(22006..23499) product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831876.1 transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS 24093..24854 product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791535.1 transl_table 11 codon_start 1 locus_tag LOCUS_40670 CDS 24962..26524 product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262866.1 transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS complement(26570..28288) product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035853.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 CDS 28811..29251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40700 CDS complement(29259..30263) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247397.1 transl_table 11 codon_start 1 locus_tag LOCUS_40710 CDS 30625..31074 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250363.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 CDS complement(31174..31461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839835.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 CDS complement(31500..32345) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291399.1 transl_table 11 codon_start 1 locus_tag LOCUS_40740 CDS complement(32409..33044) product fimbrial chaperone BcfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135039.1 transl_table 11 codon_start 1 locus_tag LOCUS_40750 gene bcfG CDS complement(33106..33624) product fimbrial protein BcfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243237.1 transl_table 11 codon_start 1 locus_tag LOCUS_40760 CDS complement(33640..34185) product fimbrial protein BcfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082042.1 transl_table 11 codon_start 1 locus_tag LOCUS_40770 CDS complement(34186..35193) product fimbrial protein BcfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701249.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 CDS complement(35194..37815) product fimbrial biogenesis usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123830139.1 transl_table 11 codon_start 1 locus_tag LOCUS_40790 CDS complement(37820..38506) product fimbrial biogenesis chaperone BcfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742560.1 transl_table 11 codon_start 1 locus_tag LOCUS_40800 gene bcfB CDS complement(38607..39149) product fimbrial protein BcfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743355.1 transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS complement(39579..40271) product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738610.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS complement(40564..43560) product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704341.1 transl_table 11 codon_start 1 locus_tag LOCUS_40830 CDS complement(43652..45751) product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235792.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS 46132..46575 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860681.1 transl_table 11 codon_start 1 locus_tag LOCUS_40850 CDS 46592..47125 product glycoside hydrolase family 108 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068133.1 transl_table 11 codon_start 1 locus_tag LOCUS_40860 CDS complement(47186..47530) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026890.1 transl_table 11 codon_start 1 locus_tag LOCUS_40870 CDS complement(47657..48604) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534904.1 transl_table 11 codon_start 1 locus_tag LOCUS_40880 CDS complement(48885..50024) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119009.1 transl_table 11 codon_start 1 locus_tag LOCUS_40890 gene dnaJ CDS complement(50110..52026) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516126.1 transl_table 11 codon_start 1 locus_tag LOCUS_40900 gene dnaK CDS 52375..52779 product DUF2541 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258093.1 transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS 52815..53528 product acidic protein MsyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103477.1 transl_table 11 codon_start 1 locus_tag LOCUS_40920 gene msyB CDS 53678..54244 product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528527.1 transl_table 11 codon_start 1 locus_tag LOCUS_40930 gene satP CDS complement(54301..54891) product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094677.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 gene mog CDS complement(55002..55955) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130175.1 transl_table 11 codon_start 1 locus_tag LOCUS_40950 gene tal CDS 56224..57654 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113816.1 transl_table 11 codon_start 1 locus_tag LOCUS_40960 CDS 57733..58506 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906171.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 gene yaaA CDS complement(58600..59886) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781103.1 transl_table 11 codon_start 1 locus_tag LOCUS_40980 gene thrC CDS complement(59890..60819) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241685.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 gene thrB CDS complement(60821..63283) product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264731.1 transl_table 11 codon_start 1 locus_tag LOCUS_41000 gene thrA CDS complement(63644..64330) product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266768.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 CDS 64966..65682 product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194359.1 transl_table 11 codon_start 1 locus_tag LOCUS_41020 gene arcA CDS 66648..67319 product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811633.1 transl_table 11 codon_start 1 locus_tag LOCUS_41030 CDS 67658..68203 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482234.1 transl_table 11 codon_start 1 locus_tag LOCUS_41040 CDS 68274..68957 product fimbrial biogenesis chaperone SthA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680527.1 transl_table 11 codon_start 1 locus_tag LOCUS_41050 gene sthA CDS 69132..71540 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097475.1 transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS 71558..72115 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056988.1 transl_table 11 codon_start 1 locus_tag LOCUS_41070 CDS 72156..73241 product type 1 fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703282.1 transl_table 11 codon_start 1 locus_tag LOCUS_41080 CDS complement(73299..74648) product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920380.1 transl_table 11 codon_start 1 locus_tag LOCUS_41090 gene creD CDS complement(74706..76130) product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219536.1 transl_table 11 codon_start 1 locus_tag LOCUS_41100 gene creC CDS complement(76130..76819) product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187043.1 transl_table 11 codon_start 1 locus_tag LOCUS_41110 gene creB CDS complement(76832..77320) product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875811.1 transl_table 11 codon_start 1 locus_tag LOCUS_41120 gene creA CDS 77517..78386 product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371679.1 transl_table 11 codon_start 1 locus_tag LOCUS_41130 gene robA tRNA complement(78626..78719) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00710 CDS 78881..79027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41140 CDS 79079..79594 product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001341279.1 transl_table 11 codon_start 1 locus_tag LOCUS_41150 gene yjjX CDS complement(79696..80022) product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192005.1 transl_table 11 codon_start 1 locus_tag LOCUS_41160 gene trpR CDS complement(80080..82017) product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343943.1 transl_table 11 codon_start 1 locus_tag LOCUS_41170 gene sltY CDS 82226..83893 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046772.1 transl_table 11 codon_start 1 locus_tag LOCUS_41180 gene ettA CDS complement(84011..85243) product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532645.1 transl_table 11 codon_start 1 locus_tag LOCUS_41190 gene nadR CDS complement(85394..86776) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029720.1 transl_table 11 codon_start 1 locus_tag LOCUS_41200 gene radA CDS complement(86860..87828) product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132983.1 transl_table 11 codon_start 1 locus_tag LOCUS_41210 gene serB CDS 87945..88589 product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090067.1 transl_table 11 codon_start 1 locus_tag LOCUS_41220 CDS 88623..89639 product lipoate--protein ligase LplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209755.1 transl_table 11 codon_start 1 locus_tag LOCUS_41230 gene lplA CDS complement(89644..90972) product type II toxin-antitoxin system HipA family toxin YjjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293112.1 transl_table 11 codon_start 1 locus_tag LOCUS_41240 gene yjjJ CDS complement(91151..91870) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224864.1 transl_table 11 codon_start 1 locus_tag LOCUS_41250 gene deoD CDS complement(92080..93303) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816454.1 transl_table 11 codon_start 1 locus_tag LOCUS_41260 gene deoB CDS complement(93355..94677) product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477838.1 transl_table 11 codon_start 1 locus_tag LOCUS_41270 gene deoA CDS complement(94801..95580) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031624265.1 transl_table 11 codon_start 1 locus_tag LOCUS_41280 gene deoC CDS 95840..97390 product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111683.1 transl_table 11 codon_start 1 locus_tag LOCUS_41290 CDS 97638..98225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41300 CDS complement(98258..99031) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119010.1 transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS complement(99028..100101) product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531551.1 transl_table 11 codon_start 1 locus_tag LOCUS_41320 CDS complement(100225..100386) product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490276.1 transl_table 11 codon_start 1 locus_tag LOCUS_41330 CDS complement(100515..101132) product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178963.1 transl_table 11 codon_start 1 locus_tag LOCUS_41340 gene osmY CDS complement(101534..103123) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175968.1 transl_table 11 codon_start 1 locus_tag LOCUS_41350 gene prfC CDS complement(103215..103895) product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978805.1 transl_table 11 codon_start 1 locus_tag LOCUS_41360 gene yjjG CDS complement(103914..104417) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092432.1 transl_table 11 codon_start 1 locus_tag LOCUS_41370 gene rimI CDS complement(104305..104742) product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203999.1 transl_table 11 codon_start 1 locus_tag LOCUS_41380 CDS 104845..105873 product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272292.1 transl_table 11 codon_start 1 locus_tag LOCUS_41390 gene rsmC tRNA 106064..106150 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00720 tRNA 106178..106264 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00730 tRNA 106296..106382 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00740 CDS complement(106414..106650) product DUF1435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941878.1 transl_table 11 codon_start 1 locus_tag LOCUS_41400 CDS 107051..107965 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211217.1 transl_table 11 codon_start 1 locus_tag LOCUS_41410 CDS 108086..108874 product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331545.1 transl_table 11 codon_start 1 locus_tag LOCUS_41420 gene fhuF CDS 109033..109491 product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058267.1 transl_table 11 codon_start 1 locus_tag LOCUS_41430 CDS complement(109542..110165) product DNA-binding transcriptional activator BglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431550.1 transl_table 11 codon_start 1 locus_tag LOCUS_41440 gene bglJ CDS complement(110177..110902) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936654.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 CDS 111615..112391 product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989102.1 transl_table 11 codon_start 1 locus_tag LOCUS_41460 CDS 112382..112855 product threonine/serine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511327.1 transl_table 11 codon_start 1 locus_tag LOCUS_41470 CDS 112948..113487 product primosomal protein DnaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098578.1 transl_table 11 codon_start 1 locus_tag LOCUS_41480 gene dnaT CDS 113490..114227 product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799923.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 gene dnaC CDS 114285..114746 product DUF2501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090314.1 transl_table 11 codon_start 1 locus_tag LOCUS_41500 CDS 115029..117320 product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292715.1 transl_table 11 codon_start 1 locus_tag LOCUS_41510 gene opgB CDS complement(117454..118464) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236585662.1 transl_table 11 codon_start 1 locus_tag LOCUS_41520 CDS complement(118482..119540) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016539.1 transl_table 11 codon_start 1 locus_tag LOCUS_41530 CDS complement(119553..120401) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002401797.1 transl_table 11 codon_start 1 locus_tag LOCUS_41540 CDS complement(120379..121158) product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357107.1 transl_table 11 codon_start 1 locus_tag LOCUS_41550 CDS complement(121184..121645) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287114.1 transl_table 11 codon_start 1 locus_tag LOCUS_41560 CDS complement(121660..122082) product PTS mannose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287112.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 CDS complement(122184..124949) product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287111.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 CDS complement(125272..126933) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919571.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 gene tsr CDS 127300..129450 product pyruvate/proton symporter BtsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379928.1 transl_table 11 codon_start 1 locus_tag LOCUS_41600 gene btsT CDS 129545..129748 product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460616.1 transl_table 11 codon_start 1 locus_tag LOCUS_41610 CDS 129759..130715 product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187846.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 gene yjiA CDS complement(130790..131092) product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063142.1 transl_table 11 codon_start 1 locus_tag LOCUS_41630 CDS complement(131079..131366) product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131963.1 transl_table 11 codon_start 1 locus_tag LOCUS_41640 CDS 131804..133645 product nuclease-related domain-containing DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263035.1 transl_table 11 codon_start 1 locus_tag LOCUS_41650 CDS 134088..134258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41660 CDS 134258..134833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41670 CDS 134826..136091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41680 CDS complement(136123..136272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41690 CDS 136376..136822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41700 CDS 136794..137261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41710 CDS 137210..137548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41720 note possible pseudo, frameshifted CDS 137612..139231 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 transl_table 11 codon_start 1 locus_tag LOCUS_41730 CDS 139221..140525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41740 CDS 140620..143886 product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858356.1 transl_table 11 codon_start 1 locus_tag LOCUS_41750 CDS 144050..144970 product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554540.1 transl_table 11 codon_start 1 locus_tag LOCUS_41760 CDS complement(145047..145211) product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704272.1 transl_table 11 codon_start 1 locus_tag LOCUS_41770 CDS complement(145416..146786) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095438.1 transl_table 11 codon_start 1 locus_tag LOCUS_41780 CDS complement(146967..147920) product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749985.1 transl_table 11 codon_start 1 locus_tag LOCUS_41790 CDS 148399..149640 product multidrug efflux MFS transporter MdtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188918.1 transl_table 11 codon_start 1 locus_tag LOCUS_41800 gene mdtM CDS 149727..150998 product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033044.1 transl_table 11 codon_start 1 locus_tag LOCUS_41810 CDS 151218..152402 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233270.1 transl_table 11 codon_start 1 locus_tag LOCUS_41820 CDS 152735..152917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41830 CDS 153275..153946 product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068750.1 transl_table 11 codon_start 1 locus_tag LOCUS_41840 CDS 153943..154404 product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211979.1 transl_table 11 codon_start 1 locus_tag LOCUS_41850 CDS 154417..155589 product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113054.1 transl_table 11 codon_start 1 locus_tag LOCUS_41860 gene iadA CDS 155708..156616 product hypochlorite stress DNA-binding transcriptional regulator HypT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383509.1 transl_table 11 codon_start 1 locus_tag LOCUS_41870 gene hypT CDS complement(156622..157356) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683258.1 transl_table 11 codon_start 1 locus_tag LOCUS_41880 CDS complement(157595..158041) product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907666.1 transl_table 11 codon_start 1 locus_tag LOCUS_41890 CDS 158843..159856 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094618.1 transl_table 11 codon_start 1 locus_tag LOCUS_41900 gene trpS CDS complement(159857..160582) product Uxu operon transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841652.1 transl_table 11 codon_start 1 locus_tag LOCUS_41910 gene uxuR CDS 161127..161645 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588705.1 transl_table 11 codon_start 1 locus_tag LOCUS_41920 CDS complement(161662..162030) product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001796324.1 transl_table 11 codon_start 1 locus_tag LOCUS_41930 CDS complement(162328..163239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556762.1 transl_table 11 codon_start 1 locus_tag LOCUS_41940 CDS 164253..164444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41950 CDS 164687..164944 product YjhX family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054380.1 transl_table 11 codon_start 1 locus_tag LOCUS_41960 CDS 164955..166580 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979786.1 transl_table 11 codon_start 1 locus_tag LOCUS_41970 CDS 167140..167856 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532938.1 transl_table 11 codon_start 1 locus_tag LOCUS_41980 CDS complement(168336..169046) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199879.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 note possible pseudo, internal stop codon CDS complement(169047..169211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42000 note possible pseudo, internal stop codon CDS complement(169680..170015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42010 note possible pseudo, internal stop codon CDS 170067..170315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42020 CDS complement(170299..170577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42030 note possible pseudo, frameshifted CDS complement(170840..171685) product YjiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490324.1 transl_table 11 codon_start 1 locus_tag LOCUS_42040 CDS complement(171736..171921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42050 CDS complement(171872..172177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42060 sequence38 source 1..5700 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(625..3033) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103899.1 transl_table 11 codon_start 1 locus_tag LOCUS_42070 CDS complement(3260..3784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42080 CDS complement(4059..4361) product adhesin biosynthesis transcription regulatory family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930062.1 transl_table 11 codon_start 1 locus_tag LOCUS_42090 CDS 5068..5454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42100 sequence39 source 1..79530 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(113..964) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201804.1 transl_table 11 codon_start 1 locus_tag LOCUS_42110 gene murI CDS complement(909..2753) product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591414.1 transl_table 11 codon_start 1 locus_tag LOCUS_42120 gene btuB CDS 3127..4227 product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186987.1 transl_table 11 codon_start 1 locus_tag LOCUS_42130 gene trmA CDS complement(4274..4633) product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813838.1 transl_table 11 codon_start 1 locus_tag LOCUS_42140 CDS complement(4649..5284) product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001537960.1 transl_table 11 codon_start 1 locus_tag LOCUS_42150 gene fabR CDS 5549..6883 product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120789.1 transl_table 11 codon_start 1 locus_tag LOCUS_42160 gene sthA CDS complement(6866..7783) product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025919.1 transl_table 11 codon_start 1 locus_tag LOCUS_42170 gene oxyR CDS complement(8067..9443) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230038.1 transl_table 11 codon_start 1 locus_tag LOCUS_42180 gene argH CDS complement(9561..10334) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001575262.1 transl_table 11 codon_start 1 locus_tag LOCUS_42190 gene argB CDS complement(10345..11349) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935332.1 transl_table 11 codon_start 1 locus_tag LOCUS_42200 gene argC CDS complement(11540..11740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42210 CDS 11660..12589 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800207.1 transl_table 11 codon_start 1 locus_tag LOCUS_42220 gene argE CDS 12958..15609 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005544.1 transl_table 11 codon_start 1 locus_tag LOCUS_42230 gene ppc CDS 15820..17553 product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192092.1 transl_table 11 codon_start 1 locus_tag LOCUS_42240 CDS 17714..18565 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274601.1 transl_table 11 codon_start 1 locus_tag LOCUS_42250 CDS complement(18552..18905) product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323848.1 transl_table 11 codon_start 1 locus_tag LOCUS_42260 CDS complement(18907..19785) product [formate-C-acetyltransferase]-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204105.1 transl_table 11 codon_start 1 locus_tag LOCUS_42270 CDS complement(19751..22048) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184831.1 transl_table 11 codon_start 1 locus_tag LOCUS_42280 CDS complement(22147..22467) product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161259.1 transl_table 11 codon_start 1 locus_tag LOCUS_42290 CDS complement(22482..23561) product PTS fructose transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004469.1 transl_table 11 codon_start 1 locus_tag LOCUS_42300 CDS 23870..26371 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174077.1 transl_table 11 codon_start 1 locus_tag LOCUS_42310 gene ptsP CDS 26382..27044 product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424865.1 transl_table 11 codon_start 1 locus_tag LOCUS_42320 gene fsa CDS 27056..28159 product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374033.1 transl_table 11 codon_start 1 locus_tag LOCUS_42330 CDS 28418..29041 product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647891.1 transl_table 11 codon_start 1 locus_tag LOCUS_42340 CDS complement(29099..31279) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108110.1 transl_table 11 codon_start 1 locus_tag LOCUS_42350 gene katG CDS complement(31444..32334) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007509.1 transl_table 11 codon_start 1 locus_tag LOCUS_42360 gene metF CDS 32613..34094 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090459.1 transl_table 11 codon_start 1 locus_tag LOCUS_42370 CDS complement(34039..35145) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976816.1 transl_table 11 codon_start 1 locus_tag LOCUS_42380 gene alr CDS complement(35142..36380) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087881318.1 transl_table 11 codon_start 1 locus_tag LOCUS_42390 CDS complement(36645..38201) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865256.1 transl_table 11 codon_start 1 locus_tag LOCUS_42400 CDS 38337..39461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134817.1 transl_table 11 codon_start 1 locus_tag LOCUS_42410 CDS 40488..40694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42420 CDS 40697..41554 product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369769.1 transl_table 11 codon_start 1 locus_tag LOCUS_42430 CDS complement(41670..44102) product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110811.1 transl_table 11 codon_start 1 locus_tag LOCUS_42440 gene metL CDS complement(44105..45265) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197208.1 transl_table 11 codon_start 1 locus_tag LOCUS_42450 gene metB CDS 45530..45847 product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852811.1 transl_table 11 codon_start 1 locus_tag LOCUS_42460 gene metJ CDS 46445..48094 product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669894.1 transl_table 11 codon_start 1 locus_tag LOCUS_42470 CDS 48295..48957 product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792797.1 transl_table 11 codon_start 1 locus_tag LOCUS_42480 CDS complement(49002..49214) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715284.1 transl_table 11 codon_start 1 locus_tag LOCUS_42490 gene rpmE CDS 49418..51616 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109394.1 transl_table 11 codon_start 1 locus_tag LOCUS_42500 gene priA CDS 51771..52796 product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841337.1 transl_table 11 codon_start 1 locus_tag LOCUS_42510 gene cytR CDS 52983..53864 product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068798.1 transl_table 11 codon_start 1 locus_tag LOCUS_42520 gene ftsN CDS 53956..54486 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208240.1 transl_table 11 codon_start 1 locus_tag LOCUS_42530 gene hslV CDS 54496..55827 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293355.1 transl_table 11 codon_start 1 locus_tag LOCUS_42540 gene hslU CDS 55894..56823 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139635.1 transl_table 11 codon_start 1 locus_tag LOCUS_42550 gene menA CDS 56916..57401 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872918.1 transl_table 11 codon_start 1 locus_tag LOCUS_42560 gene rraA CDS complement(57623..57862) product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051368.1 transl_table 11 codon_start 1 locus_tag LOCUS_42570 gene zapB CDS 58261..59106 product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084284.1 transl_table 11 codon_start 1 locus_tag LOCUS_42580 CDS 59127..60635 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137244.1 transl_table 11 codon_start 1 locus_tag LOCUS_42590 gene glpK CDS 60747..61757 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250625.1 transl_table 11 codon_start 1 locus_tag LOCUS_42600 gene glpX CDS 61854..62600 product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796307.1 transl_table 11 codon_start 1 locus_tag LOCUS_42610 gene fpr CDS complement(62706..63134) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155237.1 transl_table 11 codon_start 1 locus_tag LOCUS_42620 CDS 63235..63831 product YiiQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802241.1 transl_table 11 codon_start 1 locus_tag LOCUS_42630 CDS 63944..64711 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216342.1 transl_table 11 codon_start 1 locus_tag LOCUS_42640 gene tpiA CDS complement(64803..65567) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088043.1 transl_table 11 codon_start 1 locus_tag LOCUS_42650 CDS complement(65577..65870) product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001543603.1 transl_table 11 codon_start 1 locus_tag LOCUS_42660 gene lsrG CDS complement(65949..66824) product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774152.1 transl_table 11 codon_start 1 locus_tag LOCUS_42670 gene lsrF CDS complement(66853..67875) product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090739.1 transl_table 11 codon_start 1 locus_tag LOCUS_42680 gene lsrB CDS complement(67904..68905) product autoinducer 2 ABC transporter permease LsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981826.1 transl_table 11 codon_start 1 locus_tag LOCUS_42690 gene lsrD CDS complement(68902..69945) product autoinducer 2 ABC transporter permease LsrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911130.1 transl_table 11 codon_start 1 locus_tag LOCUS_42700 gene lsrC CDS complement(69939..71474) product autoinducer 2 ABC transporter ATP-binding protein LsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167253.1 transl_table 11 codon_start 1 locus_tag LOCUS_42710 gene lsrA CDS 71731..72690 product transcriptional regulator LsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283049.1 transl_table 11 codon_start 1 locus_tag LOCUS_42720 gene lsrR CDS 72819..74369 product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113082.1 transl_table 11 codon_start 1 locus_tag LOCUS_42730 gene lsrK CDS 74383..74733 product dimethylsulfonioproprionate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909989.1 transl_table 11 codon_start 1 locus_tag LOCUS_42740 CDS complement(74970..75140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42750 CDS complement(75238..75969) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764005.1 transl_table 11 codon_start 1 locus_tag LOCUS_42760 CDS complement(76023..77063) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557877.1 transl_table 11 codon_start 1 locus_tag LOCUS_42770 CDS complement(77073..78032) product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646490.1 transl_table 11 codon_start 1 locus_tag LOCUS_42780 CDS complement(78043..79377) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095593.1 transl_table 11 codon_start 1 locus_tag LOCUS_42790 sequence40 source 1..73468 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(315..845) product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989262.1 transl_table 11 codon_start 1 locus_tag LOCUS_42800 gene mobB CDS complement(827..1411) product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046874.1 transl_table 11 codon_start 1 locus_tag LOCUS_42810 gene mobA CDS 1481..1750 product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649858.1 transl_table 11 codon_start 1 locus_tag LOCUS_42820 CDS 1827..2813 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999265.1 transl_table 11 codon_start 1 locus_tag LOCUS_42830 CDS 2830..3453 product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725369.1 transl_table 11 codon_start 1 locus_tag LOCUS_42840 gene dsbA CDS complement(3466..4215) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196902.1 transl_table 11 codon_start 1 locus_tag LOCUS_42850 CDS 4762..7548 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249956.1 transl_table 11 codon_start 1 locus_tag LOCUS_42860 gene polA CDS complement(7883..8515) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183327.1 transl_table 11 codon_start 1 locus_tag LOCUS_42870 gene yihA CDS 8782..8979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42880 CDS 9098..9613 product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743292.1 transl_table 11 codon_start 1 locus_tag LOCUS_42890 gene yihI CDS 9802..11175 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003520.1 transl_table 11 codon_start 1 locus_tag LOCUS_42900 gene hemN CDS complement(11488..12897) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188774.1 transl_table 11 codon_start 1 locus_tag LOCUS_42910 gene glnG CDS complement(12906..13955) product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146194.1 transl_table 11 codon_start 1 locus_tag LOCUS_42920 gene glnL CDS complement(14230..15639) product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271699.1 transl_table 11 codon_start 1 locus_tag LOCUS_42930 gene glnA CDS 16015..17838 product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572064.1 transl_table 11 codon_start 1 locus_tag LOCUS_42940 gene typA CDS complement(17893..18627) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270591.1 transl_table 11 codon_start 1 locus_tag LOCUS_42950 CDS complement(18612..19490) product STM4011 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681897.1 transl_table 11 codon_start 1 locus_tag LOCUS_42960 CDS complement(19487..20728) product STM4012 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058547.1 transl_table 11 codon_start 1 locus_tag LOCUS_42970 CDS complement(20730..21605) product STM4013/SEN3800 family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282797.1 transl_table 11 codon_start 1 locus_tag LOCUS_42980 CDS complement(21598..22584) product STM4014 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631310.1 transl_table 11 codon_start 1 locus_tag LOCUS_42990 CDS complement(22636..23484) product STM4015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042080.1 transl_table 11 codon_start 1 locus_tag LOCUS_43000 CDS complement(23641..24333) product porin OmpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838825.1 transl_table 11 codon_start 1 locus_tag LOCUS_43010 gene ompL CDS complement(24401..24979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43020 note possible pseudo, frameshifted CDS complement(24964..25821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43030 note possible pseudo, frameshifted CDS complement(25867..27249) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084241.1 transl_table 11 codon_start 1 locus_tag LOCUS_43040 CDS complement(27295..29331) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087028.1 transl_table 11 codon_start 1 locus_tag LOCUS_43050 CDS complement(29375..30217) product aldose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005052848.1 transl_table 11 codon_start 1 locus_tag LOCUS_43060 CDS complement(30236..31477) product sulfoquinovose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870897.1 transl_table 11 codon_start 1 locus_tag LOCUS_43070 gene yihS CDS complement(31493..32371) product sulfofructosephosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067413.1 transl_table 11 codon_start 1 locus_tag LOCUS_43080 gene yihT CDS complement(32394..33290) product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268240.1 transl_table 11 codon_start 1 locus_tag LOCUS_43090 gene yihU CDS 33455..34351 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520529.1 transl_table 11 codon_start 1 locus_tag LOCUS_43100 CDS 34379..35188 product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059689.1 transl_table 11 codon_start 1 locus_tag LOCUS_43110 CDS 35379..35978 product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965695.1 transl_table 11 codon_start 1 locus_tag LOCUS_43120 gene yihX CDS 36065..36844 product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921423.1 transl_table 11 codon_start 1 locus_tag LOCUS_43130 CDS 36841..37278 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560975.1 transl_table 11 codon_start 1 locus_tag LOCUS_43140 gene dtd CDS 37323..38264 product fatty acid biosynthesis protein FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080770.1 transl_table 11 codon_start 1 locus_tag LOCUS_43150 gene fabY CDS complement(38279..38707) product type II toxin-antitoxin system HigA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259009.1 transl_table 11 codon_start 1 locus_tag LOCUS_43160 CDS complement(38722..39033) product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558160.1 transl_table 11 codon_start 1 locus_tag LOCUS_43170 CDS complement(39119..40048) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162859.1 transl_table 11 codon_start 1 locus_tag LOCUS_43180 CDS 40266..40577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099360.1 transl_table 11 codon_start 1 locus_tag LOCUS_43190 CDS 40578..40868 product NadS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356397.1 transl_table 11 codon_start 1 locus_tag LOCUS_43200 gene nadS CDS complement(40915..41844) product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027727.1 transl_table 11 codon_start 1 locus_tag LOCUS_43210 gene fdhE CDS complement(41841..42476) product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829025.1 transl_table 11 codon_start 1 locus_tag LOCUS_43220 gene fdoI CDS complement(42473..43375) product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331359.1 transl_table 11 codon_start 1 locus_tag LOCUS_43230 gene fdxH CDS complement(43388..46438) product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989259.1 transl_table 11 codon_start 1 transl_except (pos:45851..45853,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_43240 gene fdnG CDS 46666..47469 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059746.1 transl_table 11 codon_start 1 locus_tag LOCUS_43250 gene fdhD CDS complement(47737..48201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43260 note possible pseudo, frameshifted CDS complement(48158..48757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43270 note possible pseudo, frameshifted CDS 48940..50040 product YiiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828045.1 transl_table 11 codon_start 1 locus_tag LOCUS_43280 CDS complement(50396..50719) product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368956.1 transl_table 11 codon_start 1 locus_tag LOCUS_43290 CDS complement(50719..51378) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683586.1 transl_table 11 codon_start 1 locus_tag LOCUS_43300 CDS 51479..52027 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989088.1 transl_table 11 codon_start 1 locus_tag LOCUS_43310 CDS complement(52116..52430) product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619478.1 transl_table 11 codon_start 1 locus_tag LOCUS_43320 gene rhaM CDS complement(52427..53575) product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009255.1 transl_table 11 codon_start 1 locus_tag LOCUS_43330 gene fucO CDS complement(53702..54529) product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179732.1 transl_table 11 codon_start 1 locus_tag LOCUS_43340 gene rhaD CDS complement(54672..55931) product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211475.1 transl_table 11 codon_start 1 locus_tag LOCUS_43350 CDS complement(55928..57397) product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143961.1 transl_table 11 codon_start 1 locus_tag LOCUS_43360 gene rhaB CDS 57685..58521 product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217112.1 transl_table 11 codon_start 1 locus_tag LOCUS_43370 gene rhaS CDS 58674..59522 product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013291.1 transl_table 11 codon_start 1 locus_tag LOCUS_43380 gene rhaR CDS complement(59519..60553) product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063537.1 transl_table 11 codon_start 1 locus_tag LOCUS_43390 gene rhaT CDS 61184..61855 product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378721.1 transl_table 11 codon_start 1 locus_tag LOCUS_43400 CDS complement(62013..63182) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566798.1 transl_table 11 codon_start 1 locus_tag LOCUS_43410 CDS complement(63088..63903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43420 CDS 64233..64853 product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122632.1 transl_table 11 codon_start 1 locus_tag LOCUS_43430 gene sodA CDS 64923..65612 product 6-hydroxyaminopurine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343930.1 transl_table 11 codon_start 1 locus_tag LOCUS_43440 gene yiiM CDS 65624..66019 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133445.1 transl_table 11 codon_start 1 locus_tag LOCUS_43450 CDS 66140..66343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43460 CDS complement(66391..67764) product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580402.1 transl_table 11 codon_start 1 locus_tag LOCUS_43470 gene cpxA CDS complement(67761..68459) product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033727.1 transl_table 11 codon_start 1 locus_tag LOCUS_43480 gene cpxR CDS 68610..69110 product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233466.1 transl_table 11 codon_start 1 locus_tag LOCUS_43490 gene cpxP CDS 69258..70160 product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077323.1 transl_table 11 codon_start 1 locus_tag LOCUS_43500 gene fieF CDS 70345..71307 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591793.1 transl_table 11 codon_start 1 locus_tag LOCUS_43510 gene pfkA CDS 71511..72500 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758715.1 transl_table 11 codon_start 1 locus_tag LOCUS_43520 CDS 72601..73356 product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750765.1 transl_table 11 codon_start 1 locus_tag LOCUS_43530 sequence41 source 1..30558 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(784..2157) product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349908.1 transl_table 11 codon_start 1 locus_tag LOCUS_43540 gene cysG CDS complement(2169..2978) product nitrite transporter NirC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493575.1 transl_table 11 codon_start 1 locus_tag LOCUS_43550 gene nirC CDS complement(3174..3500) product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084814.1 transl_table 11 codon_start 1 locus_tag LOCUS_43560 gene nirD CDS complement(3497..6004) product NADPH-nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049259.1 transl_table 11 codon_start 1 locus_tag LOCUS_43570 gene nirB CDS 5897..6169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43580 CDS complement(6303..7484) product MFS transporter TsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185273.1 transl_table 11 codon_start 1 locus_tag LOCUS_43590 gene tsgA CDS 7761..8333 product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920482.1 transl_table 11 codon_start 1 locus_tag LOCUS_43600 gene ppiA CDS 8337..8609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43610 CDS 8599..9201 product putative adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280679.1 transl_table 11 codon_start 1 locus_tag LOCUS_43620 CDS 9233..9796 product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601879.1 transl_table 11 codon_start 1 locus_tag LOCUS_43630 gene pabA CDS 9882..11099 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190017.1 transl_table 11 codon_start 1 locus_tag LOCUS_43640 CDS complement(11142..13172) product YccS/YhfK family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012135464.1 transl_table 11 codon_start 1 locus_tag LOCUS_43650 CDS complement(13278..13910) product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242758.1 transl_table 11 codon_start 1 locus_tag LOCUS_43660 gene crp CDS 14218..14622 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148917.1 transl_table 11 codon_start 1 locus_tag LOCUS_43670 CDS complement(14718..15587) product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274690.1 transl_table 11 codon_start 1 locus_tag LOCUS_43680 CDS complement(15638..15856) product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586568.1 transl_table 11 codon_start 1 locus_tag LOCUS_43690 CDS complement(15853..16875) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057395.1 transl_table 11 codon_start 1 locus_tag LOCUS_43700 CDS 17118..17429 product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047690.1 transl_table 11 codon_start 1 locus_tag LOCUS_43710 CDS complement(17431..17652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43720 CDS complement(17815..19722) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634756.1 transl_table 11 codon_start 1 locus_tag LOCUS_43730 CDS 19988..20539 product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081820.1 transl_table 11 codon_start 1 locus_tag LOCUS_43740 gene kefG CDS 20539..22344 product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398137.1 transl_table 11 codon_start 1 locus_tag LOCUS_43750 gene kefB CDS 22354..22554 product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007735.1 transl_table 11 codon_start 1 locus_tag LOCUS_43760 CDS 22649..23239 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861345.1 transl_table 11 codon_start 1 locus_tag LOCUS_43770 gene slyD CDS complement(23428..23646) product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152702.1 transl_table 11 codon_start 1 locus_tag LOCUS_43780 CDS 23866..24684 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838232.1 transl_table 11 codon_start 1 locus_tag LOCUS_43790 gene fkpA CDS 24960..25682 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091471.1 transl_table 11 codon_start 1 locus_tag LOCUS_43800 CDS 25682..26068 product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268013.1 transl_table 11 codon_start 1 locus_tag LOCUS_43810 gene tusD CDS 26068..26424 product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820707.1 transl_table 11 codon_start 1 locus_tag LOCUS_43820 gene tusC CDS 26432..26719 product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903398.1 transl_table 11 codon_start 1 locus_tag LOCUS_43830 gene tusB CDS 26845..27219 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246815.1 transl_table 11 codon_start 1 locus_tag LOCUS_43840 gene rpsL CDS 27315..27785 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138043.1 transl_table 11 codon_start 1 locus_tag LOCUS_43850 gene rpsG CDS 27882..29996 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124693.1 transl_table 11 codon_start 1 locus_tag LOCUS_43860 gene fusA